CN115247106A

CN115247106A - Endoscope multienzyme cleaning composition and application thereof

Info

Publication number: CN115247106A
Application number: CN202210045248.4A
Authority: CN
Inventors: 梁平
Original assignee: First Affiliated Hospital of Zhengzhou University
Current assignee: First Affiliated Hospital of Zhengzhou University
Priority date: 2022-01-15
Filing date: 2022-01-15
Publication date: 2022-10-28

Abstract

The invention provides a multi-enzyme composition for cleaning an endoscope and a method for cleaning the endoscope by adopting the multi-enzyme composition. The invention provides the multienzyme composition comprising lysozyme and muramidase, the step-by-step cleaning and the step-by-step cleaning operation under the alkaline and weakly acidic conditions respectively, so that the protein residue on the surface of the endoscope and the pollution of various viruses can be effectively removed, and the cleaning agent has a good cleaning effect on the biofilm pollution easily formed on the surface of the endoscope. Can obviously improve the cleaning quality of the digestive endoscopy, ensures the disinfection and sterilization effect and avoids the infection of hospitals.

Description

Endoscope multienzyme cleaning composition and application thereof

Technical Field

The invention belongs to the technical field of medical cleaning agents, and particularly relates to an endoscope multienzyme cleaning composition and application thereof.

Background

In recent years, with the gradual increase of precise and complex medical instruments, medical biomaterials such as various catheters, pacemakers, artificial valves, implants, dialysis techniques, endoscopes and the like are also widely used.

The cleaning and disinfection work of the endoscope is an important measure for preventing hospital infection, and the cleaning effect of the endoscope directly influences the disinfection effect. The technical operating specification of endoscope cleaning and disinfection issued by the ministry of health in 2004 defines that one person needs to carry out one lens one enzyme when a multienzyme lotion is used in endoscope cleaning, the enzyme lotion can effectively remove proteoglycan, fat and carbohydrate adhered to the surface of the endoscope, so that the quantity of organic matters and microorganisms remained on the surface of the endoscope is minimized, and whether the endoscope is thoroughly and reliably cleaned and disinfected directly relates to the safety of patients.

As the endoscope has a complex and fine structure and is fast in clinical turnover, the disinfection and cleaning of the endoscope are always a big problem in hospitals for many years. In the past, the endoscope is cleaned only by using clean water, so that the dirt such as body fluid, mucus, blood and the like adhered to the surface of the endoscope is difficult to be dissolved completely, and the dirt is solidified into crystals and is gathered on the surface of the gastroscope and in each lumen due to the contact with acetaldehyde compound glutaraldehyde, so that the disinfection effect is not ideal. The investigation shows that the main microorganisms polluted by the endoscope are staphylococcus aureus, pseudomonas aeruginosa, escherichia coli, hepatitis b virus, mycobacterium and the like. A large number of researches prove that the enzyme cleaning agent can decompose organic matters and proteins of a human body, reduce the microbial load on the surface of an object by 3-5 logarithmic levels, effectively digest protein components in bacterial endotoxin, make the bacterial endotoxin lose active components, and has the effect of removing pyrogen. Therefore, the enzyme cleaning agent is selected as the precondition for ensuring thorough cleaning.

The enzyme lotion can effectively remove proteoglycan, fat and carbohydrate adhered to the surface of the endoscope, so that the quantity of organic matters and microorganisms remained on the surface of the endoscope is reduced to the minimum, and whether the endoscope is thoroughly and reliably cleaned and disinfected directly relates to the safety of patients.

Infections centered on biomaterials due to the adhesion of bacteria to the surface of biomaterials forming biofilms) are becoming increasingly serious. The existence of the biological membrane enables bacteria to resist the cleaning and disinfection effects, causes the failure of cleaning and disinfection of biological materials and becomes a potential factor of nosocomial infection

The biofilm is a protective growth mode of bacteria, and due to the existence of the biofilm, the drug resistance of bacteria in the biofilm is more than 1000 times higher than that of bacteria in a planktonic state, so that clinically serious nosocomial infection can be caused by the formation of the bacterial biofilm, and data show that clinical bacterial infection caused by the biofilm accounts for more than 60% of the infection rate. In clinical reuse cavity type instruments (such as endoscopes), due to the characteristics of the instruments, deposits and minerals which are difficult to clean can be generated and adhered to and accumulated on the surfaces of the instruments during use, and in actual use, the instruments are often contacted with organic pollutants such as mucus, saliva, blood and the like, and the pollutants can easily cause the formation of bacterial biofilms on the surfaces of the instruments and in the cavities of the instruments. Once the biofilm is formed, the bacteria in the inner layer are protected by outer secretion polysaccharide and protein components, and cannot be sufficiently exposed to a disinfectant or a sterilizing agent, so that the disinfection or sterilization fails, and hospital infection is caused.

Bacterial biofilms are aggregates of microbial cells bound to surfaces, typically encased in an extracellular polymeric polysaccharide matrix and forming a membranous-like structure. Biofilms can form on a variety of surfaces, including living tissue, indwelling medical devices, water body lines for various uses, or natural water systems, and bacterial biofilms continue to grow until mature. The biofilm formation process comprises 5 stages, namely reversible adsorption of bacteria, irreversible attachment of EPS matrix, proliferation and division of bacteria, generation of extracellular polymers and initial formation of a biofilm, and attachment of other microorganisms on the biofilm. With the maturation of the biological membrane, the resistance of the biological membrane to antibacterial drugs and bactericides is enhanced, and if the biological membrane in the multiplexing medical instrument is not removed, the sterilization quality of the biological membrane cannot be guaranteed. According to the journal of the science of the united states, mucus on walls, plaque on teeth and films formed on various surfaces of medical instruments or hospital articles in the shower are bacterial biofilms which persist after scrubbing and even antibacterial treatment.

Digestive endoscopy is an important tool for diagnosing and treating digestive tract diseases, and is applied more and more widely in clinic. As an invasive instrument, a digestive endoscope is easily polluted by tissues, body fluids, blood and the like of a patient, and is one of potential risk factors of iatrogenic infection due to the complex structure, special material and difficult cleaning and disinfection. At present, the biological film is generally considered to be an important factor causing endoscope infection, and the removal effect of the biological film directly influences the disinfection quality of the endoscope. Biofilm (BF) protects bacteria from the environment and increases bacterial resistance to disinfectants, the formation of which can significantly reduce the effectiveness of disinfectants. Bacterial biofilms have been found to be ubiquitous in disinfected endoscopes, which play an important role in endoscope-related infections. The cleaning effect of the biological film can guide the correct selection and use of the cleaning agent in the clinical endoscope reprocessing.

The existing cleaning agent has the defects of low cleaning efficiency, incomplete cleaning of internal dirt and the like generally existing in medical instruments such as endoscopes and lumen medical instruments which are difficult to clean, and particularly has limited cleaning effect on virus pollution and biomembrane pollution in the using process of the endoscopes. The endoscope cleaning composition or the cleaning liquid provided by the invention can be used for efficiently cleaning the endoscope, effectively removing the virus pollution in the using process of the endoscope, has a good cleaning effect on the formation of an endoscope biomembrane, and is worthy of popularization and application in clinical application.

Disclosure of Invention

The invention aims to provide an improved endoscope cleaning composition or cleaning solution, aiming at the problems that the cleaning solution in the prior art has low cleaning efficiency, can not completely remove the dirt in the endoscope, lumen medical instruments and the like, and particularly has limited effect on removing virus pollution and biomembrane pollution in the using process of the endoscope.

In order to solve the technical problems, the invention adopts the following technical scheme.

The invention discloses a multi-enzyme composition for cleaning an endoscope, which comprises a composition A and a composition B, wherein the composition A comprises the following components in parts by weight: alkaline protease, lipase, amylase, cellulase, ribonuclease, polyvinyl methyl ether, diethanolamine; the composition B comprises: lysozyme, muramidase, sodium borate, diethanolamine and sodium sulfate.

Preferably, the composition a comprises, by mass: 1-20 parts of alkaline protease, 0.5-10 parts of lipase, 0.5-10 parts of amylase, 0.5-10 parts of cellulase, 0.01-0.5 part of ribonuclease, 0.1-2 parts of polyvinyl methyl ether and 0.1-2 parts of diethanolamine; the composition B comprises the following components in parts by mass: 1-5 parts of lysozyme, 1-5 parts of lywallzyme, 0.1-2 parts of sodium borate, 0.1-2 parts of diethanolamine and 0.1-2 parts of sodium sulfate.

Preferably, the composition a comprises, by mass: 5 parts of alkaline protease, 3 parts of lipase, 2 parts of amylase, 2 parts of cellulase, 0.05 part of ribonuclease, 0.5 part of polyvinyl methyl ether, 0.5 part of diethanolamine and the composition B, which are calculated according to the parts by mass, comprise the following components: 3 parts of lysozyme, 3 parts of lywallzyme, 0.5 part of sodium borate, 0.5 part of diethanolamine and 0.5 part of sodium sulfate.

The invention discloses a multienzyme cleaning solution for cleaning an endoscope, which comprises a multienzyme cleaning solution A and a multienzyme cleaning solution B, wherein the multienzyme cleaning solution A is prepared by dissolving alkaline protease, lipase, amylase, cellulase, ribonuclease, polyvinyl methyl ether and diethanol amine in normal saline, and the pH value is adjusted to be 7-9; the multienzyme cleaning solution B is prepared by dissolving lysozyme, lywallzyme, sodium borate, diethanolamine and sodium sulfate in normal saline, and the pH value is adjusted to 5-7.

Preferably, the pH is adjusted with sodium hydroxide or hydrochloric acid, respectively.

Preferably, the endoscope is cleaned by the multienzyme cleaning solution A under the alkaline condition so as to remove pollutants such as protein, nucleic acid and the like attached to the surface of the endoscope.

Preferably, the endoscope is cleaned by the multienzyme cleaning solution B under an acidic condition so as to remove pollutants such as bacterial biofilms and the like attached to the surface of the endoscope.

Preferably, the multienzyme cleaning solution A is prepared from the following components in parts by mass: 1-20% of alkaline protease, 0.5-10% of lipase, 0.5-10% of amylase, 0.5-10% of cellulase, 0.01-0.5% of ribonuclease, 0.1-2% of polyvinyl methyl ether, 0.1-2% of diethanolamine, and the balance of normal saline; the multienzyme cleaning solution B is prepared from the following components in parts by mass: 1-5% of lysozyme, 1-5% of lywallzyme, 0.1-2% of sodium borate, 0.1-2% of diethanolamine, 0.1-2% of sodium sulfate and the balance of physiological saline.

Preferably, the multienzyme cleaning solution A is prepared from the following components in parts by mass: 5% of alkaline protease, 3% of lipase, 2% of amylase, 2% of cellulase, 0.05% of ribonuclease, 0.5% of polyvinyl methyl ether, 0.5% of diethanolamine and the balance of normal saline, and the pH value is adjusted to 7.5; the multienzyme cleaning solution B is prepared from the following components in parts by mass: 3% lysozyme, 3% lywallzyme, 0.5% sodium borate, 0.5% diethanolamine, 0.5% sodium sulfate, and the balance normal saline, and the pH value is adjusted to 6.5.

The invention discloses a preparation method of a multienzyme cleaning solution for cleaning an endoscope, which comprises the following steps: respectively weighing alkaline protease, lipase, amylase, cellulase, ribonuclease, polyvinyl methyl ether and diethanolamine, dissolving in normal saline, adjusting pH value to 7-9, and using as multienzyme cleaning solution A; weighing lysozyme, lywallzyme, sodium borate, diethanolamine and sodium sulfate respectively, dissolving in normal saline, adjusting pH to 5-7, and using as multienzyme cleaning solution B.

Preferably, 1-20g of alkaline protease, 0.5-10g of lipase, 0.5-10g of amylase, 0.5-10g of cellulase, 0.01-0.5g of ribonuclease, 0.1-2g of polyvinyl methyl ether and 0.1-2g of diethanolamine are respectively weighed, the volume is fixed to 100mL by using normal saline, the pH value is adjusted to 7-9, and the solution is used as a multienzyme cleaning solution A; respectively weighing 1-5g of lysozyme, 1-5g of muramidase, 0.1-2g of sodium borate, 0.1-2g of diethanolamine and 0.1-2g of sodium sulfate, diluting to 100mL by using normal saline, and adjusting the pH value to 5-7 to obtain a multienzyme cleaning solution B. Preferably, 5g of alkaline protease, 3g of lipase, 2g of amylase, 2g of cellulase, 0.05g of ribonuclease, 0.5g of polyvinyl methyl ether and 0.5g of diethanolamine are weighed, the volume is adjusted to 100mL by using normal saline, and the pH value is adjusted to 7-9 to be used as a multienzyme cleaning solution A; 3g of lysozyme, 3g of lywallzyme, 0.5g of sodium borate, 0.5g of diethanolamine and 0.5g of sodium sulfate are respectively weighed, the volume is determined to be 100mL by using normal saline, and the pH value is adjusted to be 5-7 to be used as multienzyme cleaning solution B.

The invention discloses a kit, which comprises the multi-enzyme composition or the multi-enzyme cleaning solution.

The invention discloses application of the multienzyme composition or the multienzyme cleaning solution or the kit in cleaning a medical endoscope.

The invention discloses a multienzyme cleaning method of an endoscope, which comprises the following steps: (1) Taking the endoscope used in case examination, repeatedly wiping off dirt on the surface by using wet gauze, placing the endoscope in a 1 st groove, cleaning the endoscope by using flowing water, and repeatedly scrubbing the endoscope by using the gauze; (2) Placing the composition A or the multi-enzyme lotion A in a No. 2 groove, diluting with normal saline, wherein the water temperature is 30-38 ℃, placing the endoscope treated in the step (1) in the No. 2 groove, soaking for 10-25 minutes, sucking the enzyme liquid by using an injector during the soaking, repeatedly cleaning the lumen of the endoscope, wiping the surface of the endoscope with the enzyme liquid, and then washing with flowing water; (3) Placing the composition B or the multi-enzyme washing liquid B in a3 rd groove, diluting with normal saline, wherein the water temperature is 30-38 ℃, placing the endoscope washed in the step (2) in the 3 rd groove, soaking for 10-25 minutes, sucking the enzyme liquid by using an injector to repeatedly wash the lumen of the endoscope, wiping the surface of the endoscope with the enzyme liquid, and then washing with flowing water; (4) Preparing 2% glutaraldehyde as a disinfectant in the 4 th tank, placing the endoscope subjected to washing treatment in the step (3) in the 4 th tank, soaking for 15-25 minutes, sucking the disinfectant by using an injector to repeatedly clean the lumen of the endoscope, wiping the surface of the endoscope with the disinfectant, and washing with flowing water; (5) And (5) placing the endoscope washed in the step (4) in a 5 th groove, continuously washing the surface and the lumen of the endoscope by flowing water, wiping by a disinfection towel, and then blowing for later use.

Preferably, the water temperature in the step (2) is 37 ℃, and the soaking time is 15 minutes.

Preferably, the water temperature in the step (3) is 37 ℃ and the soaking time is 15 minutes.

Preferably, the soaking time in step (4) is 20 minutes.

The invention provides the multienzyme composition comprising lysozyme and muramidase and the step-by-step cleaning, can effectively remove protein residues on the surface of the endoscope and the pollution of various viruses, and particularly has good effect of removing the biofilm pollution easily formed on the surface of the endoscope.

Drawings

FIG. 1 is a statistical graph showing the detection of protein residues after endoscope washing.

FIG. 2 shows the electrophoresis chart of the residual detection RT-PCR of hepatitis B virus after endoscope cleaning. Wherein, lane 1 is marker, lane 2 is positive control, lane 3-6 is amplification result of control group, and lane 7-11 is amplification result of the method of the invention.

FIG. 3 shows the electrophoresis chart of the hepatitis C virus residual detection RT-PCR after endoscope cleaning. Wherein, lane 1 is marker, lane 2 is positive control, lane 3-6 is amplification result of control group, and lane 7-11 is amplification result of the method of the invention.

FIG. 4 shows the RT-PCR electrophoretogram for detecting syphilis virus residues after endoscope cleaning. Wherein, lane 1 is marker, lane 2 is positive control, lane 3-6 is amplification result of control group, and lane 7-11 is amplification result of the method of the invention.

Detailed Description

The following detailed description of embodiments of the invention refers to the accompanying drawings. It should be understood that the detailed description and specific examples, while indicating the present invention, are given by way of illustration and explanation only, not limitation.

EXAMPLE 1 preparation of Multi-enzyme Wash

1) Preparation of the multiple enzyme composition A. Respectively weighing 5g of alkaline protease, 3g of lipase, 2g of amylase, 2g of cellulase, 0.05g of ribonuclease, 0.5g of polyvinyl methyl ether and 0.5g of diethanolamine, and uniformly mixing.

Preparation of multiple enzyme Wash A. The prepared multienzyme composition A is dissolved in normal saline, the volume is adjusted to 100mL, and the pH value is adjusted to 7.6 by sodium hydroxide.

2) Preparation of the multienzyme composition B. 3g of lysozyme, 3g of lywallzyme, 0.5g of sodium borate, 0.5g of diethanolamine and 0.5g of sodium sulfate are respectively weighed and mixed uniformly.

And (3) preparing a multi-enzyme lotion B. Dissolving the prepared multienzyme composition B in normal saline, fixing the volume to 100mL, and adjusting the pH value to 6.3 by using hydrochloric acid.

EXAMPLE 2 cleaning operation of endoscope

1) Cleaning endoscope operation using the cleaning composition of the present invention

(1) Taking an endoscope used in case examination, repeatedly wiping off dirt on the surface by using wet gauze, cleaning the endoscope by using flowing water in a 1 st groove, and repeatedly scrubbing the endoscope by using the gauze;

(2) Placing 20mL of the multi-enzyme washing solution A in the example 1 in A2 nd tank, diluting with normal saline to a constant volume of 1000mL, wherein the water temperature is 38 ℃, placing the endoscope treated in the step (1) in the 2 nd tank, soaking for about 20 minutes, sucking the enzyme solution by using a syringe to repeatedly clean the lumen of the endoscope, wiping the surface of the endoscope with the enzyme solution, and then washing with flowing water;

(3) Placing 20mL of the multi-enzyme washing solution B in the embodiment 1 in a3 rd groove, diluting with normal saline to a constant volume of 1000mL, wherein the water temperature is 38 ℃, placing the endoscope washed in the step (2) in the 3 rd groove, soaking for about 22 minutes, sucking the enzyme solution by using an injector to repeatedly wash the lumen of the endoscope, wiping the surface of the endoscope with the enzyme solution, and then washing with flowing water;

(4) Preparing 2% glutaraldehyde as a disinfectant in the 4 th tank, placing the endoscope subjected to washing treatment in the step (3) in the 4 th tank, soaking for about 18 minutes, sucking the disinfectant by using an injector to repeatedly clean the lumen of the endoscope, wiping the surface of the endoscope with the disinfectant, and washing with flowing water;

(5) And (5) placing the endoscope washed in the step (4) in a 5 th groove, continuously washing the surface and the lumen of the endoscope by flowing water, wiping by a disinfection towel, and then blowing for later use.

2) Control group cleaning endoscope operation (with quadruple ferment cleanser)

Referring to the endoscope cleaning operation flow of the cleaning composition of the present invention in 1), the multi-enzyme lotion a in step (2) and the multi-enzyme lotion B in step (3) were respectively replaced with a quadruple enzyme (Rapidmult i-enzymeklener) cleaner and diluted by the corresponding times according to the manufacturer's recommended ratio.

Example 3 detection of protein residues after endoscope cleaning

50 sets of postoperative endoscopes are selected respectively and cleaned by the method of the embodiment 1 and the contrast method. For the cleaned endoscope, a residual protein detection bar Pro-tect test is adopted, and according to the evaluation of the change of the detection bar, green is negative (-), light grey (light purple) is weak positive (+), grey (purple) is positive (+ +), dark grey (brown purple) is strong positive (+ +), and the endoscope is judged to be qualified if being negative. The yield results obtained with the method of the invention and the control method are referenced to fig. 1 (P < 0.05). The two methods for cleaning the endoscope have high protein clearance rate, and the cleaning method has a high protein removal effect.

Example 4 ATP fluorescence detection after endoscope cleaning

50 sets of postoperative endoscopes are selected respectively and cleaned by the method of the embodiment 1 and the contrast method. For the cleaned endoscope, a swab head brush is cut off according to the instructions and put into an Ultrasnap ATP fluorescence sampling rod, and an ATP detection instrument is used for reading. According to the product description, the product is judged to be unqualified (positive) when the Relative Light Unit (RLU) value is more than or equal to 150. The results of the measurements are shown in Table 1 below.

Table 1: ATP fluorescence detection for endoscope cleaning

	Number of endoscopes to be cleaned	Number of endoscopes qualified in ATP detection	Percent of pass
				The method of the invention	50	50	100%
Control	50	48	96%

EXAMPLE 5 detection of hepatitis B Virus residue after endoscopic cleaning

10 sets of endoscopes used after operation of patients with positive hepatitis B are selected respectively and cleaned by the method of the embodiment 1 and the contrast method. For the cleaned endoscope, the liquid in the 5 th tank is taken as the object of reverse transcription amplification.

And taking 10 muL of the cleaning solution in the step, and adding 2 muL OLigo d (T), 4 muL of 5 xM-MLV Buffer and dNTP (10 mmol/muL) into the solution. 4 muL, 0.5 muL of an RNA inhibitor, and 0.5 muL of M-MLV. Then putting the cDNA into a water bath at 42 ℃ for incubation for 1h 20min, putting the cDNA into a water bath kettle at 72 ℃ again for 10min, and then taking the cDNA out, namely carrying out reverse transcription to obtain the cDNA.

Wherein, 5 sets of cleaning solution are randomly selected from 10 sets to be respectively reverse-transcribed, and 4 sets of cleaning solution are randomly selected from 10 sets to be respectively reverse-transcribed.

Designing a primer according to the sequence of the hepatitis B core region:

wherein the sequence of the upstream primer is as follows: 5 'ggagctcactg tggagtttactict 3';

the sequence of the downstream primer is as follows: 5 'gattccga gattgagatc t3';

and (3) performing amplification by using an RT-PCR method. The reaction conditions are as follows:

pre-denaturation at 95 ℃ for 5 min, annealing at 94 ℃ for 30 sec, annealing at 56 ℃ for 35 sec, extension at 72 ℃ for 40 sec, 40 cycles, and final extension at 72 ℃ for 10 min. The amplification results are shown in FIG. 2. Wherein: lane 1 is marker, lane 2 is positive control (concentration is 50 ng/L), lane 3-6 is control amplification result, and lane 7-11 is amplification result by the method of the present invention.

Example 6 hepatitis C Virus residual detection after endoscope cleaning

10 sets of endoscopes used after operation of patients with positive hepatitis C are selected respectively and cleaned by the method of the embodiment 1 and the control method. For the cleaned endoscope, the liquid in the 5 th tank is taken as the object of reverse transcription amplification.

Taking 10 muL of the cleaning solution in the step, and adding 2 muL OLigo d (T), 4 muL of 5 XM-MLV Buffer and dNTP (10 mmol/muL) into the solution. 4 muL, 0.5 muL of an RNA inhibitor, and 0.5 muL of M-MLV. Then putting the cDNA into a water bath at 42 ℃ for incubation for 1h 20min, putting the cDNA into a water bath kettle at 72 ℃ again for 10min, and then taking the cDNA out, namely carrying out reverse transcription to obtain the cDNA.

Designing a primer according to the sequence of hepatitis C:

wherein the sequence of the upstream primer is as follows: 5 'tcccctgtgtgtga ggaacta3';

the sequence of the downstream primer is as follows: 5 'gtttagggattcgtgctcca 3';

pre-denaturation at 95 ℃ for 5 min, annealing at 94 ℃ for 30 sec, annealing at 58 ℃ for 30 sec, extension at 72 ℃ for 35 sec, 40 cycles, and final extension at 72 ℃ for 10 min. The amplification results are shown in FIG. 3. Wherein: lane 1 is marker, lane 2 is positive control (concentration is 50 ng/L), lane 3-6 is control amplification result, and lane 7-11 is amplification result by the method of the present invention.

Example 7 detection of residual syphilis Virus after endoscopic cleaning

10 sets of endoscopes used by patients with syphilis as positive after operation are selected respectively, and the endoscopes are cleaned by the method of the embodiment 1 and the control method. For the cleaned endoscopes, the liquid in the 5 th tank is taken as the object of reverse transcription amplification.

Designing a primer according to the bmp gene of the treponema pallidum:

wherein the sequence of the upstream primer is as follows: 5 'cagat acatagttcc cg';

the sequence of the downstream primer is as follows: 5 'gtcgagcaccttgccgagc';

pre-denaturation at 95 ℃ for 5 min, annealing at 94 ℃ for 30 sec, annealing at 55 ℃ for 55 sec, extension at 72 ℃ for 55 sec, 40 cycles, and final extension at 72 ℃ for 10 min. The amplification results are shown in FIG. 4. Wherein: lane 1 is marker, lane 2 is positive control (concentration is 50 ng/L), lane 3-6 is control amplification result, and lane 7-11 is amplification result by the method of the present invention.

EXAMPLE 8 establishment of model of Artificial biofilm

1) Inoculating Escherichia coli strain in sterile Muller-Hinton broth culture medium to obtain pure strain liquid, and adjusting bacteria concentration to 10 ^６ CFU/mL is ready for use.

2) Adding the prepared bacterial suspension into a container200ml TSB Erlenmeyer flask, make its bacterial liquid concentration 10 ^２ CFU/mL is ready for use. The flask was stoppered with a stopple with vent holes (filter layer 0.22 mm), extended through the vent holes to the bottom of the flask, and a fresh endoscopic biopsy tube 40 cm, 2mm in diameter, a reservoir bag and tubing, an infusion pump were connected to the bacterial suspension to form a closed loop culture system (maintain at 37 ℃,4 h/d was circulated at 12 ml/min with a peristaltic pump, tryptone soy broth medium (TSB) was changed daily, 5 d was continuously cultured, 6 d was used to flush the lumen with 500 ml sterile saline at a flow rate of 10 ml/min, and a 1.8cm sample was taken per 10cm length for use.

Example 9 cleaning of endoscopic Artificial biofilm model and viable count of biofilm

Each 5 sections of the prepared endoscope model tube were cleaned by the method of example 1 and the control method. And sampling the cleaned sample tube to be detected according to GB 15982. "take 50ml sterile sample solution (phosphate buffer solution containing corresponding neutralizer) with sterile syringe, inject from the inlet of the test tube" wash, then collect with 100ml sterile blue cap reagent bottle full volume at the outlet of biopsy tube. The eluate was mixed well, 1.0ml was inoculated into a dish, and the number of colonies (CFU/piece) was counted. The counting results are shown in tables 2 and 3 below.

Table 2: the cleaning method of the invention counts the number of viable bacteria in the biological membrane

	Experimental group 1	Experimental group 2	Experimental group 3	Experimental group 4	Experimental group 5
						Count of bacterial colony	12 CFU/piece	8 CFU/piece	15 CFU/piece	14 CFU/piece	7 CFU/piece

From the counting results in table 2, the colony count of the endoscope after cleaning is lower than 20 CFU/piece by the cleaning method of the present invention.

Table 3: comparison group cleaning method biological membrane viable count counting result

	Control group 1	Control group 2	Control group 3	Control group 4	Control group 5
						Count of bacterial colony	117 CFU/piece	84 CFU/piece	53 CFU/piece	71 CFU/piece	62 CFU/piece

The colony count of the cleaned endoscope is higher by adopting the method of the control group, which indicates that the method of the control group has poor effect on removing the endoscope biomembrane.

The present invention is illustrated by the above examples, but the present invention is not limited to the above process steps, i.e., it is not meant to imply that the present invention must rely on the above process steps to be practiced. It will be apparent to those skilled in the art that any modification of the present invention, equivalent substitutions of selected materials and additions of auxiliary components, selection of specific modes and the like, which are within the scope and disclosure of the present invention, are contemplated by the present invention.

Claims

1. A multi-enzyme composition for endoscope cleaning, comprising a composition a and a composition B, wherein the composition a comprises: alkaline protease, lipase, amylase, cellulase, ribonuclease, polyvinyl methyl ether, diethanolamine; the composition B comprises: lysozyme, muramidase, sodium borate, diethanolamine and sodium sulfate.

2. The multi-enzyme composition according to claim 1, wherein the composition a comprises, in parts by mass: 1-20 parts of alkaline protease, 0.5-10 parts of lipase, 0.5-10 parts of amylase, 0.5-10 parts of cellulase, 0.01-0.5 part of ribonuclease, 0.1-2 parts of polyvinyl methyl ether and 0.1-2 parts of diethanolamine; the composition B comprises the following components in parts by mass: 1-5 parts of lysozyme, 1-5 parts of lywallzyme, 0.1-2 parts of sodium borate, 0.1-2 parts of diethanolamine and 0.1-2 parts of sodium sulfate.

3. The multi-enzyme composition according to claim 2, wherein the composition A comprises the following components in parts by mass: 5 parts of alkaline protease, 3 parts of lipase, 2 parts of amylase, 2 parts of cellulase, 0.05 part of ribonuclease, 0.5 part of polyvinyl methyl ether, 0.5 part of diethanolamine, and the composition B comprises the following components in parts by mass: 3 parts of lysozyme, 3 parts of lywallzyme, 0.5 part of sodium borate, 0.5 part of diethanolamine and 0.5 part of sodium sulfate.

4. The multienzyme cleaning solution for cleaning the endoscope is characterized by comprising a multienzyme cleaning solution A and a multienzyme cleaning solution B, wherein the multienzyme cleaning solution A is prepared by dissolving alkaline protease, lipase, amylase, cellulase, ribonuclease, polyvinyl methyl ether and diethanolamine in normal saline, and the pH value is adjusted to be 7-9; the multienzyme cleaning solution B is prepared by dissolving lysozyme, lywallzyme, sodium borate, diethanolamine and sodium sulfate in normal saline, and adjusting the pH value to 5-7.

5. The multienzyme cleaning solution according to claim 4, wherein the multienzyme cleaning solution A is prepared from the following components in parts by mass: 1-20% of alkaline protease, 0.5-10% of lipase, 0.5-10% of amylase, 0.5-10% of cellulase, 0.01-0.5% of ribonuclease, 0.1-2% of polyvinyl methyl ether, 0.1-2% of diethanolamine and the balance of normal saline; the multienzyme cleaning solution B is prepared from the following components in parts by mass: 1-5% of lysozyme, 1-5% of lywallzyme, 0.1-2% of sodium borate, 0.1-2% of diethanolamine, 0.1-2% of sodium sulfate and the balance of normal saline.

6. The multi-enzyme cleaning solution according to claim 5, wherein the multi-enzyme cleaning solution A is prepared from the following components in parts by mass: 5% of alkaline protease, 3% of lipase, 2% of amylase, 2% of cellulase, 0.05% of ribonuclease, 0.5% of polyvinyl methyl ether, 0.5% of diethanolamine and the balance of normal saline, and the pH value is adjusted to 7.5; the multienzyme cleaning solution B is prepared from the following components in parts by mass: 3% lysozyme, 3% lywallzyme, 0.5% sodium borate, 0.5% diethanolamine, 0.5% sodium sulfate, and the balance normal saline, and the pH value is adjusted to 6.5.

7. A preparation method of a multienzyme cleaning solution for an endoscope is characterized by comprising the following steps: respectively weighing alkaline protease, lipase, amylase, cellulase, ribonuclease, polyvinyl methyl ether and diethanolamine, dissolving in normal saline, adjusting pH to 7-9, and using as multienzyme cleaning solution A; lysozyme, lywallzyme, sodium borate, diethanolamine and sodium sulfate are respectively weighed and dissolved in normal saline, and the pH value is adjusted to 5-7 to be used as multienzyme cleaning liquid B.

8. A kit comprising a multi-enzyme composition according to any one of claims 1 to 3 or a multi-enzyme wash according to any one of claims 4 to 6.

9. Use of the multi-enzyme composition according to any one of claims 1-3 or the multi-enzyme washing solution according to any one of claims 4-6 or the kit according to claim 8 for washing a medical endoscope.

10. A multi-enzyme cleaning solution for endoscopes, characterized by being prepared by the method of claim 7.