CN115232756A - Recombinant yeast engineering bacterium for producing levo-borneol - Google Patents

Abstract

The invention discloses a recombinant bacterium and application thereof, the recombinant bacterium is a yeast containing or expressing blumea balsamifera monoterpene synthase BbTPS3 or blumea balsamifera monoterpene synthase BbTPS3 fusion protein in vivo, and is used for producing levo-borneol; experiments prove that the recombinant bacterium obtained by modification (such as codon optimization, protein truncation, kozak increase or protein fusion) can improve the yield of the L-borneol, and is suitable for industrial production of the L-borneol.

Description

Recombinant yeast engineering bacterium for producing levo-borneol

Technical Field

The invention relates to the field of genetic engineering and fermentation engineering, in particular to a genetic engineering bacterium for producing natural borneol and a construction method and application thereof.

Background

Borneol, also known as borneol, bicyclic monoterpene compounds, which is classified into d-borneol and l-borneol according to optical activity, the d-borneol is also known as natural borneol, the plant source is mainly camphor (Cinnamomum camphora (l.) presl) and plum-leaf tree (Cinnamomum burmann (Nees et t. Nees) Blume) of lauraceae; l-borneol is also called Blumea balsamifera (L.) DC., which is a main plant source of Blumea balsamifera (L.) DC., belonging to Compositae. The lavender, olibanum, pine tree, fir, citronella oil, and Olibanum may also contain Borneolum.

Borneol is a precious traditional Chinese medicinal material and a high-grade spice, and is widely applied to the fields of medicines, foods, daily chemicals, pesticides and the like, most of patent medicine raw materials and formulas of pharmaceutical enterprises and pharmaceutical factories tend to use cheap and easily-obtained synthetic borneol at present, but the synthetic borneol also contains toxic isoborneol besides borneol, and researchers adopt a plant extraction method on borneol plant sources, but the acquisition of natural borneol is limited by the low content of natural compounds in plants, the extraction rate, the long plant growth period, the limited planting area and the like. The method is a feasible idea for producing borneol and other monoterpene compounds and derivatives thereof by utilizing a synthetic biology strategy. It was found that the biosynthesis of monoterpene compounds is derived from the common precursor geranyl Diphosphate (GPP), and in plants, acetyl-CoA via Mevalonate (MVA) pathway and 4-phospho-2-methylerythrose (2-C-methyl-D-erythrol-4-phosphate, MEP) pathway produces isopentenyl Diphosphate (IPP) and its isomer dimethylallyl Diphosphate (DMAPP), IPP and DMAPP condense to produce Cascade under the catalysis of geranyl-pyrophosphate Synthase, and finally form a great variety of monoterpene compounds (O' BRIN T, BERTHOLANI S J, ZHANG Y, et al]ACS cat, 2018, 8. Zhang Chaoet al (CN 110669713A) discloses a yeast engineering bacterium with high-yield monoterpene component, and makes it be reconstituted in Saccharomyces cerevisiaeThe biosynthetic pathway of limonene synthase can realize the heterologous synthesis of D-limonene, and the yield of the D-limonene is 27.3mg/L; duckweed et al (CN 111411101A) use cis-linalool synthetase t67OMcLIS to construct linalool biosynthesis pathway by over-expressing whole MVA pathway and introducing ERG20 with FPP formation reducing ability ^F96W/N127W Variant, such that the supply of precursor GPP was enhanced, the final strain produced 53.14mg/L linalool culture in shake flasks. Therefore, the construction of the monoterpene engineering bacteria improves the yield of the monoterpene, but borneol related engineering bacteria are not reported.

Disclosure of Invention

One aspect of the invention is to provide a yeast engineering bacterium (recombinant bacterium) for producing L-borneol, wherein the recombinant bacterium is a yeast containing or expressing blumea balsamifera monoterpene synthase BbTPS3 in vivo. Blumea balsamifera synthase BbTPS3 described in the present invention has been disclosed in applicant's prior patent (CN 201910775971.6), which is a monoterpene synthase derived from Blumea balsamifera (L.) DC., that can be used to synthesize or prepare L-borneol, and the entire contents of which are incorporated herein and made a part thereof.

In another aspect, the yeast contains a codon-optimized blumea balsamifera monoterpene synthase BbTPS3 gene. The present invention is improved according to the codon preference of Saccharomyces cerevisiae, and the improved method is a conventional technical means in the art, for example, artificially synthesized according to the sequence of related genes known in the art and referring to the codon preference of Saccharomyces cerevisiae (the codon preference design of Saccharomyces cerevisiae can be carried out with reference to the information disclosed in http:// www.kazusa.or.jp/codon/cgi-bin/showcodin.cgispecies = 493), and any of the above genes designed according to the codon preference of Saccharomyces cerevisiae can be used in the present invention.

Preferably, the coding nucleic acid of the codon-optimized BbTPS3 is shown as SEQ ID NO. 1.

In another aspect, the invention also includes protein modifications to the key enzyme BbTPS3. The N-terminal amino acid of the BbTPS3 is truncated to form 3 truncated proteins (hereinafter referred to as t14-BbTPS3, t18-BbTPS3 and t38-BbTPS 3), and the levo-borneol yield of the truncated proteins of the t14-BbTPS3 and the t18-BbTPS3 is obviously improved. The coding nucleic acids of t14-BbTPS3, t18-BbTPS3 and t38-BbTPS3 are shown in SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4.

On the other hand, a universal Kozak sequence (SEQ ID NO: 5) was added in front of the ATG start codon of the truncated protein to obtain 3 new truncated forms (hereinafter referred to as t14-BbTPS3K, t18-BbTPS3K, t38-BbTPS 3K), and it was found that the yield of L-borneol was not increased, and then a yeast-specific Kozak sequence (SEQ ID NO: 6) was tried to obtain 1 new truncated form (hereinafter referred to as t14-BbTPS3K 2), and further the yield of D-borneol was increased.

On the other hand, on the basis of the experiments, the invention inspects the influence of the flexible connecting peptide on the yield, selects 5 flexible connecting peptides for inspection, and respectively constructs ERG20 from ' GGGS ', ' GSG ', ' YRSKI ', ' VIPFIS ', ' WRFSPKLQ ^F96W-N127W (also known as ERG20WW with sequence SEQ ID NO: 7) preceding fusion protein with BbTPS3-14 following fusion protein (hereinafter referred to as ERG20WW-GGGS-t14-BbTPS3K2 (SEQ ID NO: 8), ERG20WW-GSG-t14-BbTPS3K2 (SEQ ID NO: 9), ERG20WW-YRSQI-t14-BbTPS3K2 (SEQ ID NO: 10), ERG20WW-VIPFIS-t14-BbTPS3K2 (SEQ ID NO: 11), ERG20WW-WRFSPKLQ-t14-BbTPS3K2 (SEQ ID NO: 12), and ERG20WW ^F96W ， ^N127W -GGGS-t14-BbTPS3K2-2 (SEQ ID NO: 13); or a fusion protein with BbTPS3-14 at the front after construction of ERG20WW (hereinafter referred to as t14-BbTPS3K2-GGGS-ERG 20) ^F96W，N127W The fusion protein of-2 (SEQ ID NO: 14) further improves the production of L-borneol.

In certain embodiments, the in vivo containing or expressing a blumea balsamifera monoterpene synthase or a blumea balsamifera synthase BbTPS3 fusion protein according to the invention is introducing a nucleic acid encoding said blumea balsamifera monoterpene synthase or a nucleic acid encoding said blumea balsamifera monoterpene synthase BbTPS3 fusion protein into said yeast; and/or, the step of introducing the coding nucleic acid of blumea balsamifera monoterpene synthase into the microzyme is to introduce a coding nucleic acid expression cassette containing the blumea balsamifera monoterpene synthase into the microzyme; the step of introducing the coding nucleic acid of the blumea balsamifera monoterpene synthase fusion protein into the microzyme is to introduce a coding nucleic acid expression cassette containing the blumea balsamifera monoterpene synthase fusion protein into the microzyme; and/or, the coding nucleic acid expression cassette containing blumea balsamifera monoterpene synthase is introduced into the yeast through a vector expressing the coding nucleic acid expression cassette of blumea balsamifera monoterpene synthase; the yeast is preferably introduced in plasmid form.

In certain embodiments, the present invention improves the supply of precursor material GPP (hereinafter referred to as M/D) by optimization of the stock solution. For example, the yeast of the present invention comprises endogenous genes related to mevalonate pathway derived from yeast, such as acetoacetyl-CoA transferase gene ERG10, HMG-CoA synthase gene ERG13, HMG-CoA reductase gene tHMG1, phosphomevalonate kinase gene ERG8, mevalonate pyrophosphate decarboxylase gene ERG19, farnesyl pyrophosphate synthase gene ERG20, mevalonate kinase gene ERG12, isopentenyl pyrophosphate isomerase gene IDI1. In certain preferred embodiments, ERG20 used in the present invention is a mutant ERG20 ^F96W/N127W 。

In certain embodiments, the yeast of the invention is Saccharomyces cerevisiae (Saccharomyces cerevisiae); and/or the saccharomyces cerevisiae is CEN. PK2-1D, and the genotypes are MAT alpha, URA3-52, TRP1-289, LEU2-3112, HIS3 delta 1, MAL2-8C and SUC2.

In a fifth aspect of the present invention, there is provided a method for producing levoborneol, comprising:

inoculating the recombinant yeast for producing the L-borneol into a culture medium, fermenting, extracting, separating and fermenting a bacterial liquid to obtain a target product, namely the L-borneol, wherein the recombinant yeast can be used for producing GPP by fermentation.

Drawings

FIG. 1 is a schematic diagram of the biosynthetic pathway of GPP and L-borneol in Saccharomyces cerevisiae;

FIG. 2 is a graph of geraniol yield in engineered Chassis strains, where A is the growth curve of strain M/D; b is the yield of the M/D geraniol of the strain;

FIG. 3 is a GC-MS qualitative detection diagram of L-borneol, wherein A is a weather chromatogram detection result of L-borneol; b is the mass spectrum identification result of the levo-borneol;

FIG. 4A shows the effect of different N-terminal truncations of blumea balsamifera monoterpene synthase BbTPS3 on L-borneol production (MD-B3, MD-B5 and MD-B7) and the effect of different Kozak sequences on L-borneol production (MD-B4, MD-B6, MD-B8 and MD-B9);

FIG. 4B shows the effect of fusion proteins of different linker peptides on L-borneol production.

Detailed Description

Experimental materials

TABLE 1 vector and Strain information

TABLE 2 primer information

Construction of eukaryotic plasmid (pESC-LEU)

BbTPS3-F’AGGAGAAAAAACCCCGATGGTTGGTTTCCAGAAGCACTC

BbTPS3-R’GTGAGTCGTATTACGGGGTCTTTGGCTTCAACAACAAGGAG

TABLE 3 protein engineering primer information

The main reagents are as follows:

gene JET Gel Extraction Kit (Thermo Scientific Co., U.S.A.); atm plasma mini kit I (Omega Bio-Tek company, usa); pEASY-Uni Seamless Cloning and Assembly Kit (Kyoto King Kogyo Biotech, inc.); 2 × EasyTaq PCR Supermix (+ dye) (Beijing Quanjin Biotechnology is limitedCompany); easypure Genomic DNA Kit (Beijing Quanjin Biotechnology Co., ltd.); phusion high-fidelity Master Mix (NEB, USA); bsaI (NEB corporation, USA); bamHI-HF (NEB corporation, USA); t4 DNA Ligase, NEB, USA; SD-Ura Yeast Medium (Beijing Pankeno science and technology, ltd.); SD-LEU-Ura yeast medium (Beijing Pankeno science and technology Co., ltd.); frozen-EZ Yeast Transformation II Kit ^TM (Zymo Research Biotech Co., ltd;

YPD solid plate: 1% yeast extract +2% peptone +2% glucose +1.5% agar; preparing corresponding liquid culture medium (YPD liquid culture medium) without adding agar;

YPL induction medium: 1% yeast extract +2% peptone +2% galactose;

SD-Ura solid plate: SD-Ura +2% glucose +2% agar; the corresponding liquid culture medium (SD-Ura liquid culture medium) is obtained without adding agar;

SD-Ura-LEU solid plate: SD-Ura-LEU +2% glucose +2% agar; the corresponding liquid medium (SD-Ura-LEU liquid medium) was prepared without adding agar.

Example 1 construction of recombinant Yeast Chassis bacteria

The Saccharomyces cerevisiae CEN. PK2-1D is modified by taking precursor substance GPP increasing L-borneol as an index, and the modification method is referred to in the literature (Jianga G Z, yaoa M D, wanga Y, et al management of GES and ERG20 for biochemical Engineering in Saccharomyces cerevisiae [ J ] metabolism Engineering,2017, 41. (the recombinant yeast base plate bacteria information of the invention is shown in the table 1).

1. Construction of Yeast strains

The initial strain used in this study was CEN. PK2-1D from Saccharomyces cerevisiae (Table 1). All endogenous genes ERG10, ERG13, tHMG1, ERG12, ERG8, ERG19, IDI1, ERG20 of the MVA pathway are derived from CEN. PK2-1D genomic DNA. ERG20 mutant ERG20 used in this study ^F96W/N127W Is reported to have higher monoterpene production efficiency. By usingM2S integration method the Gene expression cassette is integrated into the yeast chromosome (Li S, ding W, zhang X, et al. Development of a modulated two-step (M2S) chromosome integration technique for integration of multiple transcription units in Saccharomyces cerevisiae [ J]Biotechnology for Biofuels,2016,30 (1): 232-243.). Briefly described, ERG10 and ERG13 were amplified by adding BsaI cleavage sites and the head-to-head promoter (pGAL 1-pGAL 10) was ligated into the termination vector T1- (TPI 1-PGI 1) to generate plasmid T1- (ERG 10-ERG 13). Two terminators were inserted into the plasmid, and homology arms L1 and L2 were designed at the terminators, respectively. Similarly, T2- (tHMG 1-tHMG 1), T3- (tHMG 1-ERG 12), T4- (ERG 8-ERG 19) and T5- (IDI 1-ERG 20) ^F96W-N127W ) Have specific homology arms L2 and L3, L3 and L4, L4 and L5, and L5 and L6, respectively.

Each expression module with a homology arm was amplified separately. This time, a foreign gene was constructed at the 15-locus (YPRC. DELTA.15) of the s.cerevisiae genome and used as a Ura selection marker. Amplifying from CEN. PK2-1D genome DNA to obtain upstream homology arm YPRC delta 15-UP; amplifying a URA3 module comprising a promoter from a pESC-URA vector; l1 was amplified from the T1 vector. The selection marker module YPRC delta 15up-ura3-L1 was formed by overlapping PCR (overlap PCR) assembly of 3 modules. The downstream homology arm YPRC delta 15DOWN is amplified from CEN. PK2-1D genomic DNA, L6 is amplified from a T5 vector, and then the downstream homology arm modules L6-YPRC delta 15 are generated by combination.

All modules were electroporated into cen. Pk2-1D for assembly and integration. The transformation product is dripped in the center of a defective SD-Ura solid plate, uniformly coated by a coater until all the coated bacterial liquid is completely absorbed, and placed in a 30 ℃ incubator for inverted culture for 2-3d. Single colony is picked for sequencing verification to obtain a positive strain MD (attached figure 1).

2. Fermentation of

To determine the capacity of MD strains to produce GPP, the strains were subjected to fermentation assays. The detailed process comprises the following steps:

(1) Picking single MD colony growing on the SD-Ura solid plate, placing the single MD colony in 10mL SD-Ura liquid culture medium, and keeping the temperature at 200rpm for 48h at 30 ℃;

(2) The cells were collected by centrifugation at 5000g 5min at room temperature, transferred to 10mL YPL induction medium, and induced-cultured at 30 ℃ and 200rpm for 48 hours to obtain a fermentation product.

3. Fermentation product extraction

The target component is terpenoid, fat-soluble and easily soluble in ethyl acetate, so that ethyl acetate is selected as a solvent to extract a fermentation product to obtain the target compound. Wherein the extraction steps are as follows:

(1) After fermentation, 5ml of fermentation liquor is sucked, and is added with equal volume of ethyl acetate for ultrasonic extraction for 1h, the fermentation liquor is evenly mixed by turning upside down every 10 minutes, and ice is added to keep the ultrasonic temperature at 10 ℃ so as to avoid volatilization of products;

(2) 13,000g, centrifuging for 10 minutes, sucking the upper organic phase, adding a proper amount of anhydrous sodium sulfate (drying for 30min at 120 ℃), shaking while adding, and removing the water in the extract;

(3) Transfer to liquid phase vial, seal, for GC-MS detection.

4. GC-MS detection of fermentation product

The GC-MS analysis conditions are as follows: the chromatographic column is TR-5ms (30 m × 0.25 mm), 1 μ L of sample is injected, and the sample is maintained at 50 deg.C for 2min and at 5 deg.C for min under no-flow-splitting mode ^-1 Raising the temperature to 230 ℃, keeping the temperature for 5min, and keeping the temperature for 10 ℃ min ^-1 Heating to 300 deg.C, and maintaining for 2min; the sample inlet temperature is 280 ℃, the transmission line temperature is 280 ℃, and the electron energy is 70ev, and the sample is scanned in the range of 50-300 m/z. And (4) taking a geraniol standard as a control, making a standard curve, and determining the content of geraniol in the sample.

In the MD strain, the yield of geraniol detected was 12.52 mg.L ^-1 . (FIG. 2).

Example 2 construction of BbTPS3 eukaryotic expression vector

The monoterpene synthase BbTPS3 cloned from blumea balsamifera (see the previous Chinese patent CN201910775971.6, the entire contents of which are incorporated herein) was modified according to the codon preference of Saccharomyces cerevisiae, and the modified method is a routine technical means in the art. An exemplary modified codon sequence of a monoterpene synthase gene is set forth in SEQ ID NO:1 is shown. The improved monoterpene synthase gene is obtained, a homologous arm primer is designed, and the improved monoterpene synthase gene is constructed to a BamHI site of a eukaryotic expression vector pESC-LEU in a homologous recombination mode. The specific operation is as follows:

(1) Primers BbTPS3-F 'and BbTPS3-R' with BamHI site homology arms are designed to carry out PCR amplification on monoterpene synthase BbTPS3 from pET32a (BbTPS 3 plasmid) (Chinese patent CN 201910775971.6), and a purified PCR product is obtained after recovery and purification. Wherein, the primer sequences are shown in Table 2 (sequences shown by underlining are vector homologous regions):

(2) The pESC-LEU vector (Agilent Technologies) was digested with BamHI, and the linearized vector backbone was recovered.

(3) The purified PCR product obtained in the step 1) is cloned to the linearized vector skeleton obtained in the step 2) according to the instruction of pEASY-Uni Seamless Cloning and Assembly Kit of Beijing all-style gold biotechnology, inc., so as to obtain a recombinant plasmid pESC-LEU:: bbTPS3.

The recombinant plasmid pESC-LEU:: bbTPS3 is transformed into Escherichia coli Trans5 alpha competent cells, an LB plate is coated, and positive clone PCR identification (purchased from Beijing all-type gold biotechnology Co., ltd.) is carried out to obtain pESC-LEU:: bbTPS3 recombinant bacteria, and pESC-LEU:: bbTPS3 recombinant plasmid is extracted by using an E.Z.N.ATM plasmid mini kit I (Omega Bio-Tek Co., ltd.).

EXAMPLE 3 fermentation of L-borneol

The constructed pESC-LEU is characterized in that BbTPS3 recombinant plasmid is transferred into an MD strain to carry out fermentation to detect the yield of the L-borneol, and the specific operation is as follows:

MD Yeast competent preparation

Yeast competent cells were prepared using ZYMO RESEARCH FROZEN-EZ Yeast Transformation II kit:

(1) Selecting a newly activated MD yeast single colony from an SD-Ura solid plate, inoculating the newly activated MD yeast single colony in 10mL SD-Ura liquid culture medium, and performing shake culture at the temperature of 30 ℃ until OD600= 0.8-1.0;

(2) Centrifuging at room temperature at 500g for 4min, and removing supernatant;

(3) Adding 10mL of Frozen-EZ Solution 1 suspended thalli, centrifuging at room temperature for 4min at 500g, and removing a supernatant;

(4) Adding 1mL of Frozen-EZ Solution 2 suspension thalli to obtain BY-Mono yeast competent cells, and subpackaging the BY-Mono yeast competent cells into sterilized 1.5mL of EP tubes with each tube being 50 mu L;

(5) Slowly cooling to-70 deg.C (4 deg.C, 1h; 20 deg.C, 1h; 40 deg.C, 1h; and storing at-70 deg.C), and prohibiting quick freezing of competent cells with liquid nitrogen.

2. The recombinant plasmid pESC-LEU is formed by transforming BbTPS3 into MD yeast competent cells

(1) Mixing 0.2-1 μ g of recombinant plasmid pESC-LEU (BbTPS 3 (less than 5 μ L) with 50 μ L of BY-Mono yeast competent cells;

(2) Adding 500 mu L of Frozen-EZ Solution 3, and violently and uniformly mixing;

(3) Incubating at 30 deg.C for 1-2h, mixing uniformly for 2-3 times;

(4) Taking 50-150 mu L of the incubated bacterial liquid, coating the incubated bacterial liquid on an SD-Ura-LEU solid plate, airing, placing the plate at 30 ℃ for inverted culture for 48h to obtain the recombinant yeast transferred with the recombinant plasmid pESC-LEU, wherein BbTPS3 is named as MD-B1. Fermentation was carried out and the L-borneol product was detected as in example 1. The initial strain obtained by fermentation contained 1.24 mg.L ^-1 Levo-borneol (figure 3).

Example 4 protein Structure optimization of the high-producing Module of L-borneol

The yeast codon-optimized BbTPS3 obtained in the invention is further modified. We have shown that BbTPS3 has no transit peptide but still has a prediction of transit peptide length based on the results of ChloroP1.1 (ChloroP (http:// www. Cbs. Dtu. Dk/services/ChloroP /)), and we have conducted truncation experiments with this as reference, and we have designed three truncation sites E14, R18 and N38 for truncation, which are named t14-BbTPS3, t18-BbTPS3 and t38-BbTPS3, respectively.

The protein truncated plasmids pESC-Leu: (t 14-BbTPS 3), pESC-Leu: (t 18-BbTPS 3) and pESC-Leu: (t 38-BbTPS 3) are transformed into yeast competent cells to obtain the strains MD-B3, MD-B5 and MD-B7, and fermentation is carried out to determine the yield of borneol (figure 3). On the other hand, on the basis of the truncated protein, the BbTPS3 selects a common Kozak sequence 'GCCACC', constructs in different truncated plasmid versions, designs a specific primer to carry out PCR amplification on the BbTPS3 (Table 3), and constructs plasmids pESC-LEU added with the Kozak sequence, namely BbTPS3K, pESC-LEU, t14-BbTPS3K, pESC-LEU, t18-BbTPS3K and pESC-LEU, t38-BbTPS3K. Transforming the constructed truncated plasmid into yeast competent cells to obtain strains MD-B2, MD-B4, MD-B6 and MD-B8, and further measuring the yield of borneol.

Comparison shows that the yeast specificity Kozak sequence 'AAAAAA' improves the borneol yield more, so that a truncated plasmid pESC-LEU with the highest borneol yield in BbTPS3 is constructed by t14-BbTPS3, a version added with the yeast specificity Kozak sequence 'AAAAAA' is obtained, and the plasmid pESC-LEU is obtained by t14-BbTPS3K2, so that the strain MD-B9 is obtained.

The specific operation is as follows:

(1) Truncated primers were designed and, as shown in Table 3, monoterpene synthase BbTPS3 was PCR amplified from pET32a:: bbTPS3 plasmid, recovered and purified to obtain purified PCR product. Wherein the primer sequences are shown in Table 3 (sequences shown by underlining are vector homologous regions):

(2) The pESC-LEU vector (Agilent Technologies, inc.) was digested with BamHI, and the linearized vector backbone was recovered.

(3) Taking the purified PCR product obtained in the step 1), and Cloning the purified PCR product to the linearized vector skeleton obtained in the step 2) according to the operation of the specification of pEASY-Uni Seamless Cloning and Assembly Kit of Beijing Omegand Biotechnology Limited company to obtain a recombinant plasmid pESC-LEU:: bbTPS3.

The recombinant plasmids pESC-LEU (T14-BbTPS 3), pESC-LEU (T18-BbTPS 3), pESC-LEU (t 38-BbTPS 3), pESC-LEU (T14-BbTPS 3K), pESC-LEU (T18-BbTPS 3K) and pESC-LEU (T38-BbTPS 3K) are transformed into escherichia coli Trans5 alpha competent cells, LB plates are coated, positive clone PCR identification (purchased from Beijing all-style gold biotechnology, inc.) is carried out, recombinant bacteria are obtained, and the recombinant plasmids are extracted by using an E.Z.N.ATM plasmid mini I (Omega-Tek company) kit.

The recombinant plasmid was transferred to MD strain by the method of example 3 to obtain new strains MD-B2, MD-B3, MD-B4, MD-B5, MD-B6, MD-B7, MD-B8, and MD-B9, and the yields are shown in FIG. 4A. As a result, the yield of L-borneol of the truncated MD-B3 and MD-B5 fusion proteins is improved, wherein the yield of the strains MD-B3 and MD-B5 is 2.13 mg.L respectively ^-1 And 1.39 mg. L ^-1 . In addition, the inventive method is characterized in thatThe yield of the strain MD-B9 optimized by the specific Kozak sequence of the yeast is improved and is 4.87 mg.L ^-1 。

Example 5 protein fusion to increase L-borneol production

In order to further improve the yield of borneol, we further construct a mutant ERG20 ^F96W/N127W And BbTPS3, and different connecting peptides are selected for connection, so that the structure of the fusion protein is optimized.

5 flexible connecting peptides were selected for experiments, GGGS, GSG, WRFSPKLQ, VIPFIS and YRSQI, respectively. BbTPS3 constructs pESC-LEU respectively as follows, ERG20 ^F96W/N127W -GGGS-BbTPS3，pESC-LEU::ERG20 ^F96W/N127W -GSG-BbTPS3，pESC-LEU::ERG20 ^F96W/N127W -WRFSPKLQ-BbTPS3，pESC-LEU::ERG20 ^F96W/N127W -VIPFIS-BbTPS3，pESC-LEU::ERG20 ^F96W/N127W -YRSKI-BbTPS 3, 5 fusion protein plasmids in total.

Meanwhile, selecting pESC-LEU as ERG20 ^F96W/N127W The influence of the sequence of the connecting peptide nucleic acid and the sequence of the protein before and after is inspected by-GGGS-t 14-BbTPS3K2, and respectively construct pESC-LEU ^F96W/N127W -GGGS-t14-BbTPS3K2-2，pESC-LEU::t14-BbTPS3K2-GGGS-ERG20 ^F96W/N127W 2 two fusion protein plasmids, the construction scheme is shown in FIG. 4B.

The 7 plasmids were transformed into yeast competent cells to obtain strains MD-B10, MD-B11, MD-B12, MD-B13, MD-B14, MD-B15, and MD-B15, which were then fermented to determine the yield of borneol (FIG. 4B).

To construct pESC-LEU ERG20 ^F96W/N127W The mutant ERG20 is exemplified by-GGGS-BbTPS 3 plasmid ^F96W/N127W The method is constructed to a BamHI site, bbTPS3 is constructed to a SalI site, and the middle is connected by a flexible connecting peptide "GGGS", and the experimental operation steps are as follows:

1) Carrying out double digestion on the plasmid pESC-LEU by using a restriction enzyme BamHI and a restriction enzyme SalI, placing the plasmid pESC-LEU in a constant-temperature metal bath at 37 ℃ for incubation for 1h, running agarose gel on a reaction product to obtain a single-purpose strip, and carrying out gel cutting recovery to obtain a linearized vector;

2) Specific primers with BamHI and SalI site homology arm sequences in pESC-LEU were used (Table)3) PCR amplification of ERG20 ^F96W/N127W The sequence, the reaction product is run on agarose gel to obtain a single-purpose band, and the band is cut and recovered to obtain ERG20 ^F96W/N127W DNA purification fragments;

3) The linearized vector was coupled with ERG20 ^F96W/N127W The DNA purified fragment is seamlessly spliced by utilizing a pEASY-Uni Seamless Cloning and Assembly Kit homologous recombination Kit, a reaction product is converted into a clone competent cell Trans1-T1, the PCR identification of positive bacteria is carried out, and the sequencing is carried out to obtain a plasmid pESC-LEU:: ERG20 ^F96W/N127W ；

4) ERG20 as the positive plasmid pESC-LEU obtained in 3) ^F96W/N127W Performing single enzyme digestion by using restriction enzyme SalI as a template, placing in a constant-temperature metal bath at 37 ℃ for incubation for 1h, running agarose gel on a reaction product to obtain a single-purpose strip, and performing gel cutting recovery to obtain a linearized vector;

5) PCR amplifying a BbTPS3 sequence by using a specific primer (table 3) with a SalI site homologous arm sequence in pESC-LEU and a flexible connecting peptide GGGS sequence, running agarose gel on a reaction product to obtain a single target strip, and performing gel cutting recovery to obtain a DNA purified fragment of the BbTPS 3;

6) Seamlessly splicing the linearized vector and the DNA purified fragment of BbTPS3 with flexible connecting peptide GGGS by using pEASY-Uni Senamless Cloning and Assembly Kit homologous recombination Kit, transforming and Cloning competent cells Trans1-T1 by reaction products, carrying out PCR identification on positive bacteria, and sequencing to obtain plasmid pESC-LEU:: ERG20 ^{F96W /N127W} -GGGS-BbTPS3。

BbTPS3 according to the method, the BbTPS3 fusion protein plasmid pESC-LEU is respectively constructed, ERG20 ^F96W/N127W -GGGS-BbTPS3，pESC-LEU::ERG20 ^F96W/N127W -GSG-BbTPS3，pESC-LEU::ERG20 ^F96W/N127W -WRFSPKLQ-BbTPS3，pESC-LEU::ERG20 ^F96W/N127W -VIPFIS-BbTPS3，pESC-LEU::ERG20 ^F96W/N127W YRSQI-BbTPS3, primers are shown in Table 3.

The above 7 well-constructed fusion protein plasmids were transformed into yeast competent cells as described in example 3, item 2, to obtain L-borneol-producing yeast strains MD-B10, MD-B11, MD-B12, MD-B13, MD-B14, MD-B15 and MD-B16, and further determining the yield of borneol, wherein the respective yield is 12.41 mg.L ^-1 、10.52mg·L ^-1 、12.68mg·L ^-1 、10.81mg·L ^-1 、9.10mg·L ^-1 、12.19mg·L ^-1 、9.16mg·L ^-1 。

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is made possible within the scope of the claims attached below.

Sequence listing

<110> Sichuan Hongda pharmaceutical Co Ltd

<120> recombinant yeast engineering bacterium for producing L-borneol

<130> KH20210323

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1671

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggttggtt tccagaagca ctcttgctcc acccaagtta ccgaaccaat catcaggagg 60

tcagctaact acccaccaag taggtggtct tacgaggtct tgcaatccgt caccaacaac 120

tacgttggcg agaagtacaa gatcacctcc aacaacttga aggagagggt caggatgatg 180

atctccaagg ataccgccat gaagaaccca ttgtccatgt tggagttggt cgacgacttg 240

cagagattgg gcgtttccta ccacttcaag gacgagatct ccaacgtctt gaagatgatc 300

tactcctacc actacgaggc ccacaacaat tggaacacct tggacttgaa cctaaaggcc 360

ttgggcttca ggttgttgag acaacacggt taccacatcc cacaggagat cttcaaggac 420

atcaccgacg aatccggtaa catcaaggct tccgttcaag acgacttcgt tgccatgttg 480

aacttgtacg aggcttcctt ctacgccgtt gacgacgaaa acatcatgga cgaagccaga 540

gagttcacca ggaagtgctt gaaggagaag ttggagaaga acaacatcgt caacaagtcc 600

atcatgatgt tgatctccca cgccttggaa cacccattgt tgttcaggat cccaaggttc 660

gagtccgttt ggttcatcga ggcttacaag accagggacg acatgatccc attgttgcta 720

gagttcgccg tcttggacta caacatcttg caaggtattc accaggagga cttgaagcac 780

gttagtaagt ggtgggtcgg tttgcattgg atcaagaact tggagttcgc cagggatagc 840

atggtcgagt gtttcagttg gtccgtagga gctaacccag aaccatcttt cagcgtcttg 900

aggaggaaca tgaccaagaa cttgaccttc acttccgtct tggacgacgt ttacgacgtt 960

tacggtacct tggacgagtt ggaacagttc accgaagcag ttaggaggtg ggatatgaac 1020

gcagctgaag gtttgccaga ctacatgaga atttgcttca tgggcttgta caacaccatc 1080

aacgagatgg cctacaacac cttcatcaac cacaagtcct tcgtcatccc atacttgagg 1140

aaggtctgga cagagttttg cgaagccaac ctacaagaag ctaggtggta ctactccggt 1200

tacatcccaa ccttcgagga gtacctaaag acttccgtta tcaccgttgc cgttccagtt 1260

atcgtcttgg ccgcttactt cttggaagct aacgacttgt ccaacgaggc tttcgacaac 1320

gttatccact cctccgctat catcttgagg ttgaccgacg atcaaggtac ttccgaagca 1380

gaattggcta gaggagacgt tccaaagtcc gttcagtgct acatgaacga aacaggcgct 1440

tccagaaacg aagccatcgc ctacatgaag aggttgatca tcaacgccca caagaccatc 1500

aacaaggaga ggatggcttg caagtcccca acattgcaga tcttcatgga gtgcgctacc 1560

aacttgggta gaatcggtca cgtcacctac gatcacggag atatgttcgg cgttccagat 1620

gattcccatc aatcccacca caactccttg ttgttgaagc caaagacctg a 1671

<210> 2

<211> 1632

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggaaccaa tcatcaggag gtcagctaac tacccaccaa gtaggtggtc ttacgaggtc 60

ttgcaatccg tcaccaacaa ctacgttggc gagaagtaca agatcacctc caacaacttg 120

aaggagaggg tcaggatgat gatctccaag gataccgcca tgaagaaccc attgtccatg 180

ttggagttgg tcgacgactt gcagagattg ggcgtttcct accacttcaa ggacgagatc 240

tccaacgtct tgaagatgat ctactcctac cactacgagg cccacaacaa ttggaacacc 300

ttggacttga acctaaaggc cttgggcttc aggttgttga gacaacacgg ttaccacatc 360

ccacaggaga tcttcaagga catcaccgac gaatccggta acatcaaggc ttccgttcaa 420

gacgacttcg ttgccatgtt gaacttgtac gaggcttcct tctacgccgt tgacgacgaa 480

aacatcatgg acgaagccag agagttcacc aggaagtgct tgaaggagaa gttggagaag 540

aacaacatcg tcaacaagtc catcatgatg ttgatctccc acgccttgga acacccattg 600

ttgttcagga tcccaaggtt cgagtccgtt tggttcatcg aggcttacaa gaccagggac 660

gacatgatcc cattgttgct agagttcgcc gtcttggact acaacatctt gcaaggtatt 720

caccaggagg acttgaagca cgttagtaag tggtgggtcg gtttgcattg gatcaagaac 780

ttggagttcg ccagggatag catggtcgag tgtttcagtt ggtccgtagg agctaaccca 840

gaaccatctt tcagcgtctt gaggaggaac atgaccaaga acttgacctt cacttccgtc 900

ttggacgacg tttacgacgt ttacggtacc ttggacgagt tggaacagtt caccgaagca 960

gttaggaggt gggatatgaa cgcagctgaa ggtttgccag actacatgag aatttgcttc 1020

atgggcttgt acaacaccat caacgagatg gcctacaaca ccttcatcaa ccacaagtcc 1080

ttcgtcatcc catacttgag gaaggtctgg acagagtttt gcgaagccaa cctacaagaa 1140

gctaggtggt actactccgg ttacatccca accttcgagg agtacctaaa gacttccgtt 1200

atcaccgttg ccgttccagt tatcgtcttg gccgcttact tcttggaagc taacgacttg 1260

tccaacgagg ctttcgacaa cgttatccac tcctccgcta tcatcttgag gttgaccgac 1320

gatcaaggta cttccgaagc agaattggct agaggagacg ttccaaagtc cgttcagtgc 1380

tacatgaacg aaacaggcgc ttccagaaac gaagccatcg cctacatgaa gaggttgatc 1440

atcaacgccc acaagaccat caacaaggag aggatggctt gcaagtcccc aacattgcag 1500

atcttcatgg agtgcgctac caacttgggt agaatcggtc acgtcaccta cgatcacgga 1560

gatatgttcg gcgttccaga tgattcccat caatcccacc acaactcctt gttgttgaag 1620

ccaaagacct ga 1632

<210> 3

<211> 1620

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgaggaggt cagctaacta cccaccaagt aggtggtctt acgaggtctt gcaatccgtc 60

accaacaact acgttggcga gaagtacaag atcacctcca acaacttgaa ggagagggtc 120

aggatgatga tctccaagga taccgccatg aagaacccat tgtccatgtt ggagttggtc 180

gacgacttgc agagattggg cgtttcctac cacttcaagg acgagatctc caacgtcttg 240

aagatgatct actcctacca ctacgaggcc cacaacaatt ggaacacctt ggacttgaac 300

ctaaaggcct tgggcttcag gttgttgaga caacacggtt accacatccc acaggagatc 360

ttcaaggaca tcaccgacga atccggtaac atcaaggctt ccgttcaaga cgacttcgtt 420

gccatgttga acttgtacga ggcttccttc tacgccgttg acgacgaaaa catcatggac 480

gaagccagag agttcaccag gaagtgcttg aaggagaagt tggagaagaa caacatcgtc 540

aacaagtcca tcatgatgtt gatctcccac gccttggaac acccattgtt gttcaggatc 600

ccaaggttcg agtccgtttg gttcatcgag gcttacaaga ccagggacga catgatccca 660

ttgttgctag agttcgccgt cttggactac aacatcttgc aaggtattca ccaggaggac 720

ttgaagcacg ttagtaagtg gtgggtcggt ttgcattgga tcaagaactt ggagttcgcc 780

agggatagca tggtcgagtg tttcagttgg tccgtaggag ctaacccaga accatctttc 840

agcgtcttga ggaggaacat gaccaagaac ttgaccttca cttccgtctt ggacgacgtt 900

tacgacgttt acggtacctt ggacgagttg gaacagttca ccgaagcagt taggaggtgg 960

gatatgaacg cagctgaagg tttgccagac tacatgagaa tttgcttcat gggcttgtac 1020

aacaccatca acgagatggc ctacaacacc ttcatcaacc acaagtcctt cgtcatccca 1080

tacttgagga aggtctggac agagttttgc gaagccaacc tacaagaagc taggtggtac 1140

tactccggtt acatcccaac cttcgaggag tacctaaaga cttccgttat caccgttgcc 1200

gttccagtta tcgtcttggc cgcttacttc ttggaagcta acgacttgtc caacgaggct 1260

ttcgacaacg ttatccactc ctccgctatc atcttgaggt tgaccgacga tcaaggtact 1320

tccgaagcag aattggctag aggagacgtt ccaaagtccg ttcagtgcta catgaacgaa 1380

acaggcgctt ccagaaacga agccatcgcc tacatgaaga ggttgatcat caacgcccac 1440

aagaccatca acaaggagag gatggcttgc aagtccccaa cattgcagat cttcatggag 1500

tgcgctacca acttgggtag aatcggtcac gtcacctacg atcacggaga tatgttcggc 1560

gttccagatg attcccatca atcccaccac aactccttgt tgttgaagcc aaagacctga 1620

<210> 4

<211> 1560

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgaacaact acgttggcga gaagtacaag atcacctcca acaacttgaa ggagagggtc 60

aggatgatga tctccaagga taccgccatg aagaacccat tgtccatgtt ggagttggtc 120

gacgacttgc agagattggg cgtttcctac cacttcaagg acgagatctc caacgtcttg 180

aagatgatct actcctacca ctacgaggcc cacaacaatt ggaacacctt ggacttgaac 240

ctaaaggcct tgggcttcag gttgttgaga caacacggtt accacatccc acaggagatc 300

ttcaaggaca tcaccgacga atccggtaac atcaaggctt ccgttcaaga cgacttcgtt 360

gccatgttga acttgtacga ggcttccttc tacgccgttg acgacgaaaa catcatggac 420

gaagccagag agttcaccag gaagtgcttg aaggagaagt tggagaagaa caacatcgtc 480

aacaagtcca tcatgatgtt gatctcccac gccttggaac acccattgtt gttcaggatc 540

ccaaggttcg agtccgtttg gttcatcgag gcttacaaga ccagggacga catgatccca 600

ttgttgctag agttcgccgt cttggactac aacatcttgc aaggtattca ccaggaggac 660

ttgaagcacg ttagtaagtg gtgggtcggt ttgcattgga tcaagaactt ggagttcgcc 720

agggatagca tggtcgagtg tttcagttgg tccgtaggag ctaacccaga accatctttc 780

agcgtcttga ggaggaacat gaccaagaac ttgaccttca cttccgtctt ggacgacgtt 840

tacgacgttt acggtacctt ggacgagttg gaacagttca ccgaagcagt taggaggtgg 900

gatatgaacg cagctgaagg tttgccagac tacatgagaa tttgcttcat gggcttgtac 960

aacaccatca acgagatggc ctacaacacc ttcatcaacc acaagtcctt cgtcatccca 1020

tacttgagga aggtctggac agagttttgc gaagccaacc tacaagaagc taggtggtac 1080

tactccggtt acatcccaac cttcgaggag tacctaaaga cttccgttat caccgttgcc 1140

gttccagtta tcgtcttggc cgcttacttc ttggaagcta acgacttgtc caacgaggct 1200

ttcgacaacg ttatccactc ctccgctatc atcttgaggt tgaccgacga tcaaggtact 1260

tccgaagcag aattggctag aggagacgtt ccaaagtccg ttcagtgcta catgaacgaa 1320

acaggcgctt ccagaaacga agccatcgcc tacatgaaga ggttgatcat caacgcccac 1380

aagaccatca acaaggagag gatggcttgc aagtccccaa cattgcagat cttcatggag 1440

tgcgctacca acttgggtag aatcggtcac gtcacctacg atcacggaga tatgttcggc 1500

gttccagatg attcccatca atcccaccac aactccttgt tgttgaagcc aaagacctga 1560

<210> 5

<211> 6

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gccacc 6

<210> 6

<211> 6

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaaaaa 6

<210> 7

<211> 1056

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaa 1056

<210> 8

<211> 2706

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaaggtg gaggtagtaa aaaaatggaa 1080

ccaatcatca ggaggtcagc taactaccca ccaagtaggt ggtcttacga ggtcttgcaa 1140

tccgtcacca acaactacgt tggcgagaag tacaagatca cctccaacaa cttgaaggag 1200

agggtcagga tgatgatctc caaggatacc gccatgaaga acccattgtc catgttggag 1260

ttggtcgacg acttgcagag attgggcgtt tcctaccact tcaaggacga gatctccaac 1320

gtcttgaaga tgatctactc ctaccactac gaggcccaca acaattggaa caccttggac 1380

ttgaacctaa aggccttggg cttcaggttg ttgagacaac acggttacca catcccacag 1440

gagatcttca aggacatcac cgacgaatcc ggtaacatca aggcttccgt tcaagacgac 1500

ttcgttgcca tgttgaactt gtacgaggct tccttctacg ccgttgacga cgaaaacatc 1560

atggacgaag ccagagagtt caccaggaag tgcttgaagg agaagttgga gaagaacaac 1620

atcgtcaaca agtccatcat gatgttgatc tcccacgcct tggaacaccc attgttgttc 1680

aggatcccaa ggttcgagtc cgtttggttc atcgaggctt acaagaccag ggacgacatg 1740

atcccattgt tgctagagtt cgccgtcttg gactacaaca tcttgcaagg tattcaccag 1800

gaggacttga agcacgttag taagtggtgg gtcggtttgc attggatcaa gaacttggag 1860

ttcgccaggg atagcatggt cgagtgtttc agttggtccg taggagctaa cccagaacca 1920

tctttcagcg tcttgaggag gaacatgacc aagaacttga ccttcacttc cgtcttggac 1980

gacgtttacg acgtttacgg taccttggac gagttggaac agttcaccga agcagttagg 2040

aggtgggata tgaacgcagc tgaaggtttg ccagactaca tgagaatttg cttcatgggc 2100

ttgtacaaca ccatcaacga gatggcctac aacaccttca tcaaccacaa gtccttcgtc 2160

atcccatact tgaggaaggt ctggacagag ttttgcgaag ccaacctaca agaagctagg 2220

tggtactact ccggttacat cccaaccttc gaggagtacc taaagacttc cgttatcacc 2280

gttgccgttc cagttatcgt cttggccgct tacttcttgg aagctaacga cttgtccaac 2340

gaggctttcg acaacgttat ccactcctcc gctatcatct tgaggttgac cgacgatcaa 2400

ggtacttccg aagcagaatt ggctagagga gacgttccaa agtccgttca gtgctacatg 2460

aacgaaacag gcgcttccag aaacgaagcc atcgcctaca tgaagaggtt gatcatcaac 2520

gcccacaaga ccatcaacaa ggagaggatg gcttgcaagt ccccaacatt gcagatcttc 2580

atggagtgcg ctaccaactt gggtagaatc ggtcacgtca cctacgatca cggagatatg 2640

ttcggcgttc cagatgattc ccatcaatcc caccacaact ccttgttgtt gaagccaaag 2700

acctga 2706

<210> 9

<211> 2703

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaaggta gcggaaaaaa aatggaacca 1080

atcatcagga ggtcagctaa ctacccacca agtaggtggt cttacgaggt cttgcaatcc 1140

gtcaccaaca actacgttgg cgagaagtac aagatcacct ccaacaactt gaaggagagg 1200

gtcaggatga tgatctccaa ggataccgcc atgaagaacc cattgtccat gttggagttg 1260

gtcgacgact tgcagagatt gggcgtttcc taccacttca aggacgagat ctccaacgtc 1320

ttgaagatga tctactccta ccactacgag gcccacaaca attggaacac cttggacttg 1380

aacctaaagg ccttgggctt caggttgttg agacaacacg gttaccacat cccacaggag 1440

atcttcaagg acatcaccga cgaatccggt aacatcaagg cttccgttca agacgacttc 1500

gttgccatgt tgaacttgta cgaggcttcc ttctacgccg ttgacgacga aaacatcatg 1560

gacgaagcca gagagttcac caggaagtgc ttgaaggaga agttggagaa gaacaacatc 1620

gtcaacaagt ccatcatgat gttgatctcc cacgccttgg aacacccatt gttgttcagg 1680

atcccaaggt tcgagtccgt ttggttcatc gaggcttaca agaccaggga cgacatgatc 1740

ccattgttgc tagagttcgc cgtcttggac tacaacatct tgcaaggtat tcaccaggag 1800

gacttgaagc acgttagtaa gtggtgggtc ggtttgcatt ggatcaagaa cttggagttc 1860

gccagggata gcatggtcga gtgtttcagt tggtccgtag gagctaaccc agaaccatct 1920

ttcagcgtct tgaggaggaa catgaccaag aacttgacct tcacttccgt cttggacgac 1980

gtttacgacg tttacggtac cttggacgag ttggaacagt tcaccgaagc agttaggagg 2040

tgggatatga acgcagctga aggtttgcca gactacatga gaatttgctt catgggcttg 2100

tacaacacca tcaacgagat ggcctacaac accttcatca accacaagtc cttcgtcatc 2160

ccatacttga ggaaggtctg gacagagttt tgcgaagcca acctacaaga agctaggtgg 2220

tactactccg gttacatccc aaccttcgag gagtacctaa agacttccgt tatcaccgtt 2280

gccgttccag ttatcgtctt ggccgcttac ttcttggaag ctaacgactt gtccaacgag 2340

gctttcgaca acgttatcca ctcctccgct atcatcttga ggttgaccga cgatcaaggt 2400

acttccgaag cagaattggc tagaggagac gttccaaagt ccgttcagtg ctacatgaac 2460

gaaacaggcg cttccagaaa cgaagccatc gcctacatga agaggttgat catcaacgcc 2520

cacaagacca tcaacaagga gaggatggct tgcaagtccc caacattgca gatcttcatg 2580

gagtgcgcta ccaacttggg tagaatcggt cacgtcacct acgatcacgg agatatgttc 2640

ggcgttccag atgattccca tcaatcccac cacaactcct tgttgttgaa gccaaagacc 2700

tga 2703

<210> 10

<211> 2709

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaatata gaagtcaaat caaaaaaatg 1080

gaaccaatca tcaggaggtc agctaactac ccaccaagta ggtggtctta cgaggtcttg 1140

caatccgtca ccaacaacta cgttggcgag aagtacaaga tcacctccaa caacttgaag 1200

gagagggtca ggatgatgat ctccaaggat accgccatga agaacccatt gtccatgttg 1260

gagttggtcg acgacttgca gagattgggc gtttcctacc acttcaagga cgagatctcc 1320

aacgtcttga agatgatcta ctcctaccac tacgaggccc acaacaattg gaacaccttg 1380

gacttgaacc taaaggcctt gggcttcagg ttgttgagac aacacggtta ccacatccca 1440

caggagatct tcaaggacat caccgacgaa tccggtaaca tcaaggcttc cgttcaagac 1500

gacttcgttg ccatgttgaa cttgtacgag gcttccttct acgccgttga cgacgaaaac 1560

atcatggacg aagccagaga gttcaccagg aagtgcttga aggagaagtt ggagaagaac 1620

aacatcgtca acaagtccat catgatgttg atctcccacg ccttggaaca cccattgttg 1680

ttcaggatcc caaggttcga gtccgtttgg ttcatcgagg cttacaagac cagggacgac 1740

atgatcccat tgttgctaga gttcgccgtc ttggactaca acatcttgca aggtattcac 1800

caggaggact tgaagcacgt tagtaagtgg tgggtcggtt tgcattggat caagaacttg 1860

gagttcgcca gggatagcat ggtcgagtgt ttcagttggt ccgtaggagc taacccagaa 1920

ccatctttca gcgtcttgag gaggaacatg accaagaact tgaccttcac ttccgtcttg 1980

gacgacgttt acgacgttta cggtaccttg gacgagttgg aacagttcac cgaagcagtt 2040

aggaggtggg atatgaacgc agctgaaggt ttgccagact acatgagaat ttgcttcatg 2100

ggcttgtaca acaccatcaa cgagatggcc tacaacacct tcatcaacca caagtccttc 2160

gtcatcccat acttgaggaa ggtctggaca gagttttgcg aagccaacct acaagaagct 2220

aggtggtact actccggtta catcccaacc ttcgaggagt acctaaagac ttccgttatc 2280

accgttgccg ttccagttat cgtcttggcc gcttacttct tggaagctaa cgacttgtcc 2340

aacgaggctt tcgacaacgt tatccactcc tccgctatca tcttgaggtt gaccgacgat 2400

caaggtactt ccgaagcaga attggctaga ggagacgttc caaagtccgt tcagtgctac 2460

atgaacgaaa caggcgcttc cagaaacgaa gccatcgcct acatgaagag gttgatcatc 2520

aacgcccaca agaccatcaa caaggagagg atggcttgca agtccccaac attgcagatc 2580

ttcatggagt gcgctaccaa cttgggtaga atcggtcacg tcacctacga tcacggagat 2640

atgttcggcg ttccagatga ttcccatcaa tcccaccaca actccttgtt gttgaagcca 2700

aagacctga 2709

<210> 11

<211> 2712

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaagtga taccttttat ttcaaaaaaa 1080

atggaaccaa tcatcaggag gtcagctaac tacccaccaa gtaggtggtc ttacgaggtc 1140

ttgcaatccg tcaccaacaa ctacgttggc gagaagtaca agatcacctc caacaacttg 1200

aaggagaggg tcaggatgat gatctccaag gataccgcca tgaagaaccc attgtccatg 1260

ttggagttgg tcgacgactt gcagagattg ggcgtttcct accacttcaa ggacgagatc 1320

tccaacgtct tgaagatgat ctactcctac cactacgagg cccacaacaa ttggaacacc 1380

ttggacttga acctaaaggc cttgggcttc aggttgttga gacaacacgg ttaccacatc 1440

ccacaggaga tcttcaagga catcaccgac gaatccggta acatcaaggc ttccgttcaa 1500

gacgacttcg ttgccatgtt gaacttgtac gaggcttcct tctacgccgt tgacgacgaa 1560

aacatcatgg acgaagccag agagttcacc aggaagtgct tgaaggagaa gttggagaag 1620

aacaacatcg tcaacaagtc catcatgatg ttgatctccc acgccttgga acacccattg 1680

ttgttcagga tcccaaggtt cgagtccgtt tggttcatcg aggcttacaa gaccagggac 1740

gacatgatcc cattgttgct agagttcgcc gtcttggact acaacatctt gcaaggtatt 1800

caccaggagg acttgaagca cgttagtaag tggtgggtcg gtttgcattg gatcaagaac 1860

ttggagttcg ccagggatag catggtcgag tgtttcagtt ggtccgtagg agctaaccca 1920

gaaccatctt tcagcgtctt gaggaggaac atgaccaaga acttgacctt cacttccgtc 1980

ttggacgacg tttacgacgt ttacggtacc ttggacgagt tggaacagtt caccgaagca 2040

gttaggaggt gggatatgaa cgcagctgaa ggtttgccag actacatgag aatttgcttc 2100

atgggcttgt acaacaccat caacgagatg gcctacaaca ccttcatcaa ccacaagtcc 2160

ttcgtcatcc catacttgag gaaggtctgg acagagtttt gcgaagccaa cctacaagaa 2220

gctaggtggt actactccgg ttacatccca accttcgagg agtacctaaa gacttccgtt 2280

atcaccgttg ccgttccagt tatcgtcttg gccgcttact tcttggaagc taacgacttg 2340

tccaacgagg ctttcgacaa cgttatccac tcctccgcta tcatcttgag gttgaccgac 2400

gatcaaggta cttccgaagc agaattggct agaggagacg ttccaaagtc cgttcagtgc 2460

tacatgaacg aaacaggcgc ttccagaaac gaagccatcg cctacatgaa gaggttgatc 2520

atcaacgccc acaagaccat caacaaggag aggatggctt gcaagtcccc aacattgcag 2580

atcttcatgg agtgcgctac caacttgggt agaatcggtc acgtcaccta cgatcacgga 2640

gatatgttcg gcgttccaga tgattcccat caatcccacc acaactcctt gttgttgaag 2700

ccaaagacct ga 2712

<210> 12

<211> 2718

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaatggc ggttctcgcc gaagcttcag 1080

aaaaaaatgg aaccaatcat caggaggtca gctaactacc caccaagtag gtggtcttac 1140

gaggtcttgc aatccgtcac caacaactac gttggcgaga agtacaagat cacctccaac 1200

aacttgaagg agagggtcag gatgatgatc tccaaggata ccgccatgaa gaacccattg 1260

tccatgttgg agttggtcga cgacttgcag agattgggcg tttcctacca cttcaaggac 1320

gagatctcca acgtcttgaa gatgatctac tcctaccact acgaggccca caacaattgg 1380

aacaccttgg acttgaacct aaaggccttg ggcttcaggt tgttgagaca acacggttac 1440

cacatcccac aggagatctt caaggacatc accgacgaat ccggtaacat caaggcttcc 1500

gttcaagacg acttcgttgc catgttgaac ttgtacgagg cttccttcta cgccgttgac 1560

gacgaaaaca tcatggacga agccagagag ttcaccagga agtgcttgaa ggagaagttg 1620

gagaagaaca acatcgtcaa caagtccatc atgatgttga tctcccacgc cttggaacac 1680

ccattgttgt tcaggatccc aaggttcgag tccgtttggt tcatcgaggc ttacaagacc 1740

agggacgaca tgatcccatt gttgctagag ttcgccgtct tggactacaa catcttgcaa 1800

ggtattcacc aggaggactt gaagcacgtt agtaagtggt gggtcggttt gcattggatc 1860

aagaacttgg agttcgccag ggatagcatg gtcgagtgtt tcagttggtc cgtaggagct 1920

aacccagaac catctttcag cgtcttgagg aggaacatga ccaagaactt gaccttcact 1980

tccgtcttgg acgacgttta cgacgtttac ggtaccttgg acgagttgga acagttcacc 2040

gaagcagtta ggaggtggga tatgaacgca gctgaaggtt tgccagacta catgagaatt 2100

tgcttcatgg gcttgtacaa caccatcaac gagatggcct acaacacctt catcaaccac 2160

aagtccttcg tcatcccata cttgaggaag gtctggacag agttttgcga agccaaccta 2220

caagaagcta ggtggtacta ctccggttac atcccaacct tcgaggagta cctaaagact 2280

tccgttatca ccgttgccgt tccagttatc gtcttggccg cttacttctt ggaagctaac 2340

gacttgtcca acgaggcttt cgacaacgtt atccactcct ccgctatcat cttgaggttg 2400

accgacgatc aaggtacttc cgaagcagaa ttggctagag gagacgttcc aaagtccgtt 2460

cagtgctaca tgaacgaaac aggcgcttcc agaaacgaag ccatcgccta catgaagagg 2520

ttgatcatca acgcccacaa gaccatcaac aaggagagga tggcttgcaa gtccccaaca 2580

ttgcagatct tcatggagtg cgctaccaac ttgggtagaa tcggtcacgt cacctacgat 2640

cacggagata tgttcggcgt tccagatgat tcccatcaat cccaccacaa ctccttgttg 2700

ttgaagccaa agacctga 2718

<210> 13

<211> 2706

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaaggtg gtggttctaa aaaaatggaa 1080

ccaatcatca ggaggtcagc taactaccca ccaagtaggt ggtcttacga ggtcttgcaa 1140

tccgtcacca acaactacgt tggcgagaag tacaagatca cctccaacaa cttgaaggag 1200

agggtcagga tgatgatctc caaggatacc gccatgaaga acccattgtc catgttggag 1260

ttggtcgacg acttgcagag attgggcgtt tcctaccact tcaaggacga gatctccaac 1320

gtcttgaaga tgatctactc ctaccactac gaggcccaca acaattggaa caccttggac 1380

ttgaacctaa aggccttggg cttcaggttg ttgagacaac acggttacca catcccacag 1440

gagatcttca aggacatcac cgacgaatcc ggtaacatca aggcttccgt tcaagacgac 1500

ttcgttgcca tgttgaactt gtacgaggct tccttctacg ccgttgacga cgaaaacatc 1560

atggacgaag ccagagagtt caccaggaag tgcttgaagg agaagttgga gaagaacaac 1620

atcgtcaaca agtccatcat gatgttgatc tcccacgcct tggaacaccc attgttgttc 1680

aggatcccaa ggttcgagtc cgtttggttc atcgaggctt acaagaccag ggacgacatg 1740

atcccattgt tgctagagtt cgccgtcttg gactacaaca tcttgcaagg tattcaccag 1800

gaggacttga agcacgttag taagtggtgg gtcggtttgc attggatcaa gaacttggag 1860

ttcgccaggg atagcatggt cgagtgtttc agttggtccg taggagctaa cccagaacca 1920

tctttcagcg tcttgaggag gaacatgacc aagaacttga ccttcacttc cgtcttggac 1980

gacgtttacg acgtttacgg taccttggac gagttggaac agttcaccga agcagttagg 2040

aggtgggata tgaacgcagc tgaaggtttg ccagactaca tgagaatttg cttcatgggc 2100

ttgtacaaca ccatcaacga gatggcctac aacaccttca tcaaccacaa gtccttcgtc 2160

atcccatact tgaggaaggt ctggacagag ttttgcgaag ccaacctaca agaagctagg 2220

tggtactact ccggttacat cccaaccttc gaggagtacc taaagacttc cgttatcacc 2280

gttgccgttc cagttatcgt cttggccgct tacttcttgg aagctaacga cttgtccaac 2340

gaggctttcg acaacgttat ccactcctcc gctatcatct tgaggttgac cgacgatcaa 2400

ggtacttccg aagcagaatt ggctagagga gacgttccaa agtccgttca gtgctacatg 2460

aacgaaacag gcgcttccag aaacgaagcc atcgcctaca tgaagaggtt gatcatcaac 2520

gcccacaaga ccatcaacaa ggagaggatg gcttgcaagt ccccaacatt gcagatcttc 2580

atggagtgcg ctaccaactt gggtagaatc ggtcacgtca cctacgatca cggagatatg 2640

ttcggcgttc cagatgattc ccatcaatcc caccacaact ccttgttgtt gaagccaaag 2700

acctga 2706

<210> 14

<211> 2706

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggtggtggtt ctaaaaaaat ggaaccaatc atcaggaggt cagctaacta cccaccaagt 60

aggtggtctt acgaggtctt gcaatccgtc accaacaact acgttggcga gaagtacaag 120

atcacctcca acaacttgaa ggagagggtc aggatgatga tctccaagga taccgccatg 180

aagaacccat tgtccatgtt ggagttggtc gacgacttgc agagattggg cgtttcctac 240

cacttcaagg acgagatctc caacgtcttg aagatgatct actcctacca ctacgaggcc 300

cacaacaatt ggaacacctt ggacttgaac ctaaaggcct tgggcttcag gttgttgaga 360

caacacggtt accacatccc acaggagatc ttcaaggaca tcaccgacga atccggtaac 420

atcaaggctt ccgttcaaga cgacttcgtt gccatgttga acttgtacga ggcttccttc 480

tacgccgttg acgacgaaaa catcatggac gaagccagag agttcaccag gaagtgcttg 540

aaggagaagt tggagaagaa caacatcgtc aacaagtcca tcatgatgtt gatctcccac 600

gccttggaac acccattgtt gttcaggatc ccaaggttcg agtccgtttg gttcatcgag 660

gcttacaaga ccagggacga catgatccca ttgttgctag agttcgccgt cttggactac 720

aacatcttgc aaggtattca ccaggaggac ttgaagcacg ttagtaagtg gtgggtcggt 780

ttgcattgga tcaagaactt ggagttcgcc agggatagca tggtcgagtg tttcagttgg 840

tccgtaggag ctaacccaga accatctttc agcgtcttga ggaggaacat gaccaagaac 900

ttgaccttca cttccgtctt ggacgacgtt tacgacgttt acggtacctt ggacgagttg 960

gaacagttca ccgaagcagt taggaggtgg gatatgaacg cagctgaagg tttgccagac 1020

tacatgagaa tttgcttcat gggcttgtac aacaccatca acgagatggc ctacaacacc 1080

ttcatcaacc acaagtcctt cgtcatccca tacttgagga aggtctggac agagttttgc 1140

gaagccaacc tacaagaagc taggtggtac tactccggtt acatcccaac cttcgaggag 1200

tacctaaaga cttccgttat caccgttgcc gttccagtta tcgtcttggc cgcttacttc 1260

ttggaagcta acgacttgtc caacgaggct ttcgacaacg ttatccactc ctccgctatc 1320

atcttgaggt tgaccgacga tcaaggtact tccgaagcag aattggctag aggagacgtt 1380

ccaaagtccg ttcagtgcta catgaacgaa acaggcgctt ccagaaacga agccatcgcc 1440

tacatgaaga ggttgatcat caacgcccac aagaccatca acaaggagag gatggcttgc 1500

aagtccccaa cattgcagat cttcatggag tgcgctacca acttgggtag aatcggtcac 1560

gtcacctacg atcacggaga tatgttcggc gttccagatg attcccatca atcccaccac 1620

aactccttgt tgttgaagcc aaagaccatg gcttcagaaa aagaaattag gagagagaga 1680

ttcttgaacg ttttccctaa attagtagag gaattgaacg catcgctttt ggcttacggt 1740

atgcctaagg aagcatgtga ctggtatgcc cactcattga actacaacac tccaggcggt 1800

aagctaaata gaggtttgtc cgttgtggac acgtatgcta ttctctccaa caagaccgtt 1860

gaacaattgg ggcaagaaga atacgaaaag gttgccattc taggttggtg cattgagttg 1920

ttgcaggctt actggttggt cgccgatgat atgatggaca agtccattac cagaagaggc 1980

caaccatgtt ggtacaaggt tcctgaagtt ggggaaattg ccatctggga cgcattcatg 2040

ttagaggctg ctatctacaa gcttttgaaa tctcacttca gaaacgaaaa atactacata 2100

gatatcaccg aattgttcca tgaggtcacc ttccaaaccg aattgggcca attgatggac 2160

ttaatcactg cacctgaaga caaagtcgac ttgagtaagt tctccctaaa gaagcactcc 2220

ttcatagtta ctttcaagac tgcttactat tctttctact tgcctgtcgc attggccatg 2280

tacgttgccg gtatcacgga tgaaaaggat ttgaaacaag ccagagatgt cttgattcca 2340

ttgggtgaat acttccaaat tcaagatgac tacttagact gcttcggtac cccagaacag 2400

atcggtaaga tcggtacaga tatccaagat aacaaatgtt cttgggtaat caacaaggca 2460

ttggaacttg cttccgcaga acaaagaaag actttagacg aaaattacgg taagaaggac 2520

tcagtcgcag aagccaaatg caaaaagatt ttcaatgact tgaaaattga acagctatac 2580

cacgaatatg aagagtctat tgccaaggat ttgaaggcca aaatttctca ggtcgatgag 2640

tctcgtggct tcaaagctga tgtcttaact gcgttcttga acaaagttta caagagaagc 2700

aaatag 2706

Claims (10)

1. A recombinant bacterium is a yeast containing or expressing blumea balsamifera monoterpene synthase BbTPS3 or blumea balsamifera monoterpene synthase BbTPS3 fusion protein in vivo;

the blumea balsamifera monoterpene synthase BbTPS3 fusion protein comprises blumea balsamifera monoterpene synthase BbTPS3 and farnesyl pyrophosphate synthase.

2. The recombinant bacterium according to claim 1, wherein the gene for expressing blumea balsamifera monoterpene synthase BbTPS3 is codon-optimized; preferably, the coding nucleic acid of blumea balsamifera monoterpene synthase BbTPS3 comprises a nucleic acid shown as SEQ ID NO. 1.

3. The recombinant bacterium according to claim 1, wherein the coding nucleic acid of blumea balsamifera monoterpene synthase BbTPS3 comprises a nucleic acid shown as SEQ ID NO 2, SEQ ID NO 3 or SEQ ID NO 4.

4. The recombinant bacterium according to any one of the preceding claims, wherein the recombinant bacterium further comprises a Kozak sequence having a nucleic acid sequence as set forth in SEQ ID No. 6.

5. The recombinant bacterium of any one of the preceding claims, wherein the nucleic acid encoding farnesyl pyrophosphate synthase comprises the nucleic acid shown in SEQ ID NO. 7.

6. The recombinant bacterium of any one of the preceding claims, wherein the blumea balsamifera monoterpene synthase BbTPS3 fusion protein further comprises a linker peptide for linking the blumea balsamifera monoterpene synthase BbTPS3 and the farnesyl pyrophosphate synthase; the connecting peptide is selected from GGGS, GSG, YRSQI, VIPFIS or WRFSPKLQ.

7. The recombinant bacterium according to any one of the preceding claims, wherein the nucleic acid encoding the blumea balsamifera monoterpene synthase BbTPS3 fusion protein is selected from the nucleic acids shown in any one of SEQ ID NO 8-14.

8. The recombinant bacterium according to any one of the preceding claims, wherein the in vivo containing or expressing blumea balsamifera monoterpene synthase or blumea balsamifera monoterpene synthase BbTPS3 fusion protein is introducing a nucleic acid encoding the blumea balsamifera monoterpene synthase or a nucleic acid encoding the blumea balsamifera monoterpene synthase BbTPS3 fusion protein into the yeast;

and/or, the step of introducing the coding nucleic acid of blumea balsamifera monoterpene synthase into the microzyme is to introduce a coding nucleic acid expression cassette containing the blumea balsamifera monoterpene synthase into the microzyme;

the step of introducing the coding nucleic acid of the blumea balsamifera monoterpene synthase fusion protein into the microzyme is to introduce a coding nucleic acid expression cassette containing the blumea balsamifera monoterpene synthase fusion protein into the microzyme;

and/or, the coding nucleic acid expression cassette containing blumea balsamifera monoterpene synthase is introduced into the yeast through a vector expressing the coding nucleic acid expression cassette of blumea balsamifera monoterpene synthase; the yeast is preferably introduced in plasmid form.

9. Recombinant strain according to any of the preceding claims, wherein the yeast is saccharomyces cerevisiae, preferably cen.

10. Use of the recombinant bacterium of any one of claims 1-9 for the production of levoborneol.

Images