CN115029257B

CN115029257B - Recombinant yarrowia lipolytica for producing beta-carotene and construction method and application thereof

Info

Publication number: CN115029257B
Application number: CN202210480414.3A
Authority: CN
Inventors: 章文明; 姜岷; 景艺文; 信丰学; 王靖楠; 蒋羽佳; 姜万奎
Original assignee: Nanjing Tech University
Current assignee: Nanjing Tech University
Priority date: 2022-05-05
Filing date: 2022-05-05
Publication date: 2023-09-26
Anticipated expiration: 2042-05-05
Also published as: CN115029257A

Abstract

The invention provides a recombinant yarrowia lipolytica producing beta-carotene, a construction method and application thereof, and a method for preparing the recombinant yarrowia lipolyticaYarrowia lipolytica) The expression cassette of geranylgeranyl diphosphate synthase CrtE, phytoene synthase/lycopene cyclase CrtYB, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl CoA reductase tHMGR and acetyl-CoA carboxylase ACC is introduced to obtain the recombinant yarrowia lipolytica strain. The construction method of the recombinant yarrowia lipolytica is simple in operation and high in efficiency, and can synthesize beta-carotene with high efficiency. The invention has great practical significance and economic value for the industrialization and commercialization of high-value terpenoid products.

Description

Recombinant yarrowia lipolytica for producing beta-carotene and construction method and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to recombinant yarrowia lipolytica with high beta-carotene yield, a construction method and application thereof.

Background

Yarrowia lipolytica is a non-conventional yeast belonging to the genus Yarrowia (Yarrowia) of the genus semi-ascomycetes (Hemiascomycetes). Yarrowia lipolytica is a microbial plant that produces products such as alkanes, terpenes, industrial proteins, and organic acids, and can accumulate high throughput acetyl-coa using a variety of inexpensive renewable substrates as carbon sources. Compared with other microorganisms, yarrowia lipolytica is safe and reliable, and can be used in various industries such as food, medicine and the like; the strain has high growth speed, strong stress resistance and simple culture, and is suitable for industrialization; the molecular operation platform is mature and the genetic tool is perfect. Most notable is that yarrowia lipolytica is a typical oleaginous yeast that can accumulate large amounts of oil, and has unique advantages for the synthesis of fat-soluble terpenoid compounds, and has broad development prospects.

The introduction of exogenous β -carotenoid synthesis modules into yarrowia lipolytica enables their heterologous synthesis of β -carotene. The prior art has genetically modified yarrowia lipolytica to obtain recombinant yarrowia lipolytica producing beta-carotene. The beta-carotene obtained after the product synthesis module is introduced has certain toxic effect on cells, and the cell injury caused by the increase of the beta-carotene yield also inhibits the further increase of the yield, so that the beta-carotene yield cannot be further improved.

Disclosure of Invention

The invention aims to provide a yarrowia lipolytica strain with high beta-carotene yield.

In order to achieve the technical purpose, the invention adopts the following technical scheme:

a recombinant yarrowia lipolytica strain producing beta-carotene is obtained by introducing into yarrowia lipolytica (Yarrowia lipolytica) expression cassettes of geranylgeranyl diphosphate synthase CrtE, phytoene synthase/lycopene cyclase CrtYB, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl CoA reductase tHMGR and acetyl-CoA carboxylase ACC.

As a preferred embodiment, the yarrowia lipolytica is a yarrowia lipolytica Po1f strain.

As a preferred embodiment, the genes for geranylgeranyl diphosphate synthase CrtE, phytoene synthase/lycopene cyclase CrtYB, phytoene desaturase CrtI are derived from Phaffia rhodozyma (Xanthophyllomyces denrorhous); the gene of the 3-hydroxy-3-methylglutaryl CoA reductase is derived from yarrowia lipolytica; the gene of acetyl-CoA carboxylase is derived from Cryptococcus (Cryptococcus podzolicus).

As a preferred embodiment, the gene sequence of the geranylgeranyl diphosphate synthase CrtE is shown in SEQ ID No:1 is shown in the specification; the coding gene sequence of the phytoene synthase/lycopene cyclase is shown as SEQ ID No:2 is shown in the figure; the coding gene sequence of the phytoene desaturase is shown as SEQ ID No:3 is shown in the figure; the coding gene sequence of the 3-hydroxy-3-methylglutaryl CoA reductase is shown as SEQ ID No:4 is shown in the figure; the coding gene sequence of the acetyl-CoA carboxylase is shown as SEQ ID No: shown at 5.

As a preferred embodiment, the promoter of the expression cassette is the TEFin promoter, TEF1 promoter or GPD promoter of yarrowia lipolytica; the terminator is a cyc1 terminator or an xpr2 terminator of yarrowia lipolytica.

As a preferred embodiment, the recombinant yarrowia lipolytica further expresses 1 or more marker genes; the marker gene is selected from hygromycin coding gene expression cassette of plasmid PAN 7-1.

It is another object of the present invention to provide the construction method of the recombinant yarrowia lipolytica strain as described above, wherein the expression cassettes of the geranylgeranyl diphosphate synthase CrtE, phytoene synthase/lycopene cyclase CrtYB, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl CoA reductase tggr and acetyl CoA carboxylase ACC are introduced into the yarrowia lipolytica strain in the form of plasmids and integrated on the genome of the yarrowia lipolytica strain.

As a preferred embodiment, the construction method includes:

inserting gene fragments of geranylgeranyl diphosphate synthase CrtE, phytoene synthase/lycopene cyclase CrtYB and phytoene desaturase CrtI into a plasmid 113-GPD-TEF by a one-step cloning method to obtain crtIEYB recombinant plasmid;

inserting a gene fragment of 3-hydroxy-3-methylglutaryl CoA reductase tHMGR into a 113-GPD-TEF plasmid containing a marker gene by a one-step cloning method to obtain a tHMGR recombinant plasmid;

inserting an acetyl-CoA carboxylase ACC gene fragment into a plasmid PKi-TEF by a one-step cloning method to obtain an ACC1 recombinant plasmid;

and (3) introducing the crtIEYB recombinant plasmid, the tHMGR recombinant plasmid and the acc1 recombinant plasmid into yarrowia lipolytica to obtain a recombinant yarrowia lipolytica strain.

It is a further object of the present invention to provide the use of the recombinant yarrowia lipolytica described above for the production of beta-carotene.

Culturing the recombinant yarrowia lipolytica strain by adopting YPD culture medium to obtain a fermentation product; extracting the fermentation product by adopting acetone and dimethyl sulfoxide to obtain beta-carotene.

The recombinant yarrowia lipolytica can express geranylgeranyl diphosphate synthase, phytoene synthase/lycopene cyclase, phytoene desaturase, 3-hydroxy-3-methylglutaryl CoA reductase and acetyl-CoA carboxylase, and the construction method is efficient and simple. Experiments prove that the recombinant yarrowia lipolytica can ferment and produce beta-carotene, and the efficient synthesis of the natural product beta-carotene in the yarrowia lipolytica is realized. The grease in the cells can enhance the flexibility of the cell membranes and simultaneously provide a storage space for beta-carotene, thereby reducing the damage to the cells. Therefore, the invention strengthens the upstream mevalonate pathway to increase the precursor substances of beta-carotene and strengthen the grease synthesis path of the yarrowia lipolytica while introducing the beta-carotene synthesis module into the original yarrowia lipolytica, can lead the engineering yarrowia lipolytica to realize the high yield of beta-carotene under the condition of synthesizing a large amount of grease, and has great practical significance and economic value for the industrialization and commercial application of high-value terpenoid products.

Drawings

FIG. 1 is a diagram of the structure of plasmid 113-GPD-TEF-crtIEYB, the crtI promoter is GPD, and the terminator is xpr2; the promoter of crtYB is TEF1 promoter, and the terminator is cyc1; the crtE promoter is TEFin, the terminator is cyc1, and the URA3 gene carried by this plasmid is used as a screening marker for yarrowia lipolytica.

FIG. 2 is a block diagram of plasmid PKi-TEF-crtYB, the crtYB promoter is TEF1 promoter, the terminator is cyc1, and AmpR carried during cloning of the plasmid is used for colony screening.

FIG. 3 is a block diagram of plasmid 113-GPD-TEF-hph, hph gene from plasmid PAN7-1, GPD promoter, xpr2 terminator, ampR carried during cloning of the plasmid for colony screening.

FIG. 4 is a block diagram of plasmid 113-GPD-TEF-hph-tHMGR, the hph gene promoter is GPD, and the terminator is xpr2; the promoter of tHMGR is TEFin and the terminator is cyc1, and the plasmid hph gene is used as a screening marker for yarrowia lipolytica.

FIG. 5 is a block diagram of the plasmid PKi-TEF-acc1, the acc1 promoter being the TEF1 promoter and the terminator being cyc1, the LEU2 gene carried by this plasmid being used as a selectable marker for yarrowia lipolytica.

FIG. 6 is a graph showing the detection of beta-carotene production by recombinant yarrowia lipolytica.

Detailed Description

The invention will be further illustrated with reference to specific examples.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Example 1 amplification of Gene elements and preparation of plasmids of interest

Preparation of the target Gene

According to the nucleotide sequence of the geranylgeranyl diphosphate synthase encoding gene crtE from X.densorrous provided on NCBI, the nucleotide sequence of the phytoene synthase/lycopene cyclase encoding gene crtYB and the nucleotide sequence of the phytoene desaturase encoding gene crtI are obtained through codon optimization, and the gene sequences are shown as SEQ ID No: 1. SEQ ID No: 2. SEQ ID No:3, the exogenous gene has better adaptability to yarrowia lipolytica chassis after the gene codon is optimized.

And (3) carrying out PCR amplification on the hph by taking the PAN7-1 plasmid as a template to obtain a gene fragment.

PCR amplification was performed on the basis of the gene sequence encoding 3-hydroxy-3-methylglutaryl CoA reductase from yarrowia lipolytica provided on NCBI using the yarrowia lipolytica genome as template, with the gene sequence of tHMGR as shown in SEQ ID No: 4.

Based on the acetyl-CoA carboxylase encoding gene sequence from C.diazolicus provided on NCBI, PCR amplification was performed using the C.diazolicus genome as a template. The gene sequence of acc1 is shown in SEQ ID No: shown at 5.

Construction of recombinant plasmid

1. Construction of recombinant plasmid 113-GPD-TEF-crtIEYB

The crtE, crtYB, crtI gene sequence is synthesized by general biological systems (Anhui) limited company, and each gene fragment is inserted into plasmid 113-GPD-TEF by a one-step cloning method to obtain recombinant plasmid 113-GPD-TEF-crtIEYB, and the structure of the recombinant plasmid is shown in table 1 and figure 1.

The recombinant plasmid 113-GPD-TEF-crtIEYB takes 113-GPD-TEF as a framework, and a crtI fragment is inserted into the sal I site of the plasmid 113-GPD-TEF to obtain recombinant plasmid 113-GPD-TEF-crtI; then inserting the crtE fragment into the swa I site of the recombinant plasmid 113-GPD-TEF-crtI to obtain the recombinant plasmid 113-GPD-TEF-crtIE; subsequently crtYB was inserted into the BstB I site of the plasmid pki-TEF,obtaining recombinant plasmid pki-TEF-crtYB, and finally, P in the recombinant plasmid _TEF -crtYB-T _cyc1 The expression cassette is inserted into the pme I site of the plasmid 113-GPD-TEF-crtIE to complete the construction of the recombinant plasmid 113-GPD-TEF-crtIEYB. The structure of the recombinant plasmid 113-GPD-TEF-crtIEYB is shown in FIG. 1. The specific construction steps are as follows:

the crtI fragment was amplified using crtI-F and crtI-R as primers and the crtI gene sequence as template, the primer sequences are shown in Table 2.

The crtE fragment was amplified using crtE-F and crtE-R as primers and the crtE gene sequence as template, the primer sequences being shown in Table 2.

The crtYB fragment was amplified using crtYB-F and crtYB-R as primers and crtYB gene sequence as a template, the primer sequences being shown in Table 2.

The PCR enzyme used for amplification was Phanta Max Super-Fidelity DNA Polymerase, nanjinouzan Biotechnology Co., ltd. The system is as follows:

system of	50uL
		Phanta Max Super-Fidelity DNA Polymerase	1uL
Distilled water	25uL
		DNTP	1uL
Upward leading	1uL
		Down-draft	1uL
Template	1uL

The amplified crtI, crtE, crtYB fragment was recovered, and purified and recovered by agarose gel electrophoresis.

Plasmid 113-GPD-TEF was digested with sal I, and the linearized vector fragment was recovered by agarose gel electrophoresis.

One-step cloning was performed using ClonExpress MuLtiS One Step Cloning Kit of the biological sciences company of Nanjinopran, the reaction system is as follows:

system of	20uL
		Exnase MuLtiS	2uL
5×CE MuLtiS Buffer	4uL
		Linearization carrier	A uL
Fragments	B uL
		Distilled water	Make up volume to 20uL

The usage amount of the linearization vector (x) and the insertion fragment (y) can be calculated by the following formula:

fragment optimum amount (A) = [0.04×fragment base pair number ] ng/Yng/uL. (Y is the concentration of the insert)

Vector optimum amount (B) = [0.02 x fragment base pair number ] ng/Xng/uL. (X is the concentration of linearization support)

The circular recombinant vector is transformed into E.coli DH5 alpha competent cells, and positive recombinant plasmid 113-GPD-TEF-crtI is obtained through screening of ampicillin resistance plates and verification of colony PCR and sequencing, and the plasmid structure is shown in Table 1.

Plasmid 113-GPD-TEF-crtI was digested with the restriction enzyme swa I, and the linearized vector fragment was recovered by agarose gel electrophoresis. The linearized vector 113-GPD-TEF-crtI was ligated to crtE using one-step cloning of ClonExpress MultiS One Step Cloning Kit from Nanjinouzan Biotechnology, inc., and the circular recombinant vector was transformed into E.coli DH 5. Alpha. Competent cells, which were screened by ampicillin-resistant plates and verified by colony PCR and sequencing to give positive recombinant plasmid 113-GPD-TEF-crtIE, the plasmid structure of which is shown in Table 1.

Plasmid pki-TEF was digested with BstB I, and the linearized vector fragment was recovered by agarose gel electrophoresis. The linearized vector pki-TEF was ligated with the crtYB fragment using one-step cloning of ClonExpress MultiS One Step Cloning Kit from the biological sciences company of nanking. The circular recombinant vector was transformed into E.coli DH 5. Alpha. Competent cells, screened by ampicillin-resistant plates and verified by colony PCR and sequencing to obtain positive recombinant plasmid pki-TEF-crtYB, the plasmid structure of which is shown in Table 1 and FIG. 2.

The crtYB expression cassette carrying the promoter and the terminator is amplified by taking the pcrtYB-F and the TcrtYB-R as primers and taking the recombinant plasmid pki-TEF-crtYB as a template, and the crtYB expression cassette is recovered by agarose gel electrophoresis gel purification, wherein the primer sequences are shown in Table 2.

Plasmid 113-GPD-TEF-crtIE was digested with pme I, and the linearized vector 113-GPD-TEF-crtIE was ligated with the crtYB expression cassette fragment using one-step cloning of ClonExpress MultiS One Step Cloning Kit from Nanjinopran Biotechnology Co., ltd. Transforming the circular recombinant vector into escherichia coli DH5 alpha competent cells, screening by an ampicillin resistant plate, and obtaining the positive recombinant plasmid 113-GPD-TEF-crtIEYB through colony PCR and sequencing verification.

2. Construction of recombinant plasmid 113-GPD-hph-TEF-tHMGR

The structure of the recombinant plasmid is shown in Table 1.

The recombinant plasmid 113-GPD-hph-TEF-tHMGR uses 113-GPD-TEF as a skeleton, and the hph fragment is inserted into Sal I site, and the tHMGR fragment is inserted into Sal I site.

The hph fragment was amplified using hph-F and hph-R as primers and plasmid PAN7-1 as template. The PCR enzyme used for amplification was Phanta Max Super-Fidelity DNA Polymerase, nanjinouzan Biotechnology Co., ltd. The fragment hph fragment was recovered and purified by agarose gel electrophoresis. The primer sequences are shown in Table 2.

Plasmid 113-GPD-TEF was digested with Sal I, and the linearized Sal I site-integrating plasmid was recovered by agarose gel electrophoresis.

One-step cloning was performed using ClonExpress MultiS One Step Cloning Kit of the biological sciences company of Nanjinouzan. The circular recombinant vector is transformed into E.coli DH5 alpha competent cells, and positive recombinant plasmid 113-GPD-hph-TEF is obtained through the screening of a plate with the resistance to the Carna and the verification of colony PCR and sequencing, and the plasmid structure is shown in Table 1 and figure 3.

Plasmid 113-GPD-hph-TEF was digested with restriction enzyme swa I, and linearized swa I site integrating plasmid was recovered by agarose gel electrophoresis.

The tHMGR fragment was amplified using tHMGR-F and tHMGR-R as primers and yarrowia lipolytica genome as template. The fragment tHMGR fragment was recovered by agarose gel electrophoresis and the primer sequences are shown in Table 2.

One-step cloning was performed using ClonExpress MultiS One Step Cloning Kit of the biological sciences company of Nanjinouzan. The linearized vector 113-GPD-hph-TEF was ligated with tHMGR fragment, the circular recombinant vector was transformed into E.coli DH 5. Alpha. Competent cells, and positive recombinant plasmid 113-GPD-hph-TEF-tHMGR was obtained by screening with ampicillin resistant plates and by colony PCR and sequencing verification, the plasmid structure was shown in Table 1 and FIG. 4.

3. Construction of recombinant plasmid pki-TEF-acc1

The structure of the recombinant plasmid is shown in Table 1 and FIG. 5.

The recombinant plasmid pki-TEF-acc1 takes pki-TEF as a framework, and the acc1 fragment is inserted into BstB I site. The structure is shown in figure 3.

The acc1 fragment is amplified by using acc1-F and acc1-R as primers and cryptococcus genome as template. The PCR enzyme used for amplification was Phanta Max Super-Fidelity DNA Polymerase, nanjinouzan Biotechnology Co., ltd. The primer sequences are shown in Table 2.

The fragment acc1 was recovered and purified by agarose gel electrophoresis.

Plasmid pki-TEF was digested with BstB I using restriction enzyme and agarose gel electrophoresis gel to recover linearized BstB I site-integrating plasmid.

One-step cloning was performed using ClonExpress MultiS One Step Cloning Kit of the biological sciences company of Nanjinouzan. The circular recombinant vector is transformed into escherichia coli DH5 alpha competent cells, and positive recombinant plasmid pki-TEF-acc1 is obtained through screening of ampicillin resistance plates and colony PCR and sequencing verification.

Table 1 insertion sequences in recombinant plasmids

Plasmid name	Insertion sequence
		113-GPD-TEF-crtI	crtI expression cassette (P) _GPD -crtI-T _xpr2 )
113-GPD-TEF-crtIE	crtE expression cassette (P) _TEFin -crtE-T _cyc1 )
		pki-TEF-crtYB	crtYB expression cassette (P) _TEF1 -crtYB-T _cyc1 )
113-GPD-TEF-crtIEYB	crtYB expression cassette
		113-GPD-hph-TEF	hph expression cassette (P) _GPD -hph-T _xpr2 )
113-GPD-hph-TEF-tHMGR	tHMGR expression cassette (P) _TEFin -tHMGR-T _cyc1 )
		pki-TEF-acc1	acc1 expression cassette (P) _TEF1 -acc1-T _cyc1 )

TABLE 2 primer sequences

Primer name	Sequence (5 '-3')
		crtI-F	AACACACATCAACAGTCGACGGATCCATGGGCAAAGAGAAG
crtI-R	GGCCATGGAGGTACGTCGACGAATTCTTAGAAGGCCAAAA
		crtE-F	GCAGTACTAACCGCAGATTTAAATGGATCCATGGACTACGCCAA
crtE-R	TAACTAATTACATGAATTTAAATGAATTCTTACAGTGGGATGTC
		crtYB-F	AGAATCATTCAAAGGTTCGAAGGATCCATGACTGCTTTGGCC
crtYB-R	TAACTAATTACATGATTCGAAGAATTCTTACTGACCCTCCCAAC
		PcrtYB-F	CGCAAGTGAGATGGTTTAAACGGTACCAAGGAAGCATGCGGT
TcrtYB-R	GCCAACCCGGTCTCTGTTTAAACGCAAATTAAAGCCTTCGAGCG
		hph-F	TTAAACACACATCAACAGTCGACATGCCTGAACTCACCGCGACGTCTG
hph-R	ACAGGCCATGGAGGTACGTCGACCTATTCCTTTGCCCTCGGACGAGTG
		tHMGR-F	GTACTAACCGCAGATTTAAATATGACCCAGTCTGTGAAGGTG
tHMGR-R	ACTAATTACATGAATTTAAATCTATGACCGTATGCAAATATTCG
		acc1-F	TTTTTGCAGTACTAACCGCAGATTTAAATATGGCCTCTGTTGCCACTAGC
acc1-R	GACATAACTAATTACATGAATTTAAATTTACTGCTGGAGCTGGGCAAGGA

EXAMPLE 2 construction of recombinant bacterium (one) construction of recombinant bacterium Yli-C

Plasmid 113-GPD-TEF-crtIEYB containing crtI-crtYB-crtE gene expression cassette is introduced into yarrowia lipolytica, and crtI-crtYB-crtE expression cassette is integrated at the Not I locus of genome to obtain recombinant bacterium Yli-C. The specific method comprises the following steps:

(1) competent cells were prepared after overnight culture of yarrowia lipolytica in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).

(2) 113-GPD-TEF-crtIEYB was introduced into yarrowia lipolytica competent cells using Zymogen Frozen EZ Yeast Transformation Kit II of Yeast transformation kit Zymo Research Corporation for homologous recombination.

(3) Screening with screening medium SD-Leu, single colony is grown for 3-4 days, and PCR is identified to correct positive clone, which is named as recombinant bacterium 1. Wherein the screening medium SD-Ura comprises: glucose 20g/L, yeast Nitrogen Base (YNB) 6.7g/L, 0.01. Mu. Mol/L (NH) ₄ ) ₂ Fe(SO ₄ ) ₂ 2g/L glucose, and a proper amount of amino acid mixture solution (uracil is removed).

Construction of recombinant bacterium Yli-CH

Plasmid 113-GPD-hph-TEF-tHMGR containing tHMGR and hph gene expression cassette was introduced into recombinant bacterium Yli-C, and linear plasmid 113-GPD-hph-TEF-tHMGR containing tHMGR and hph gene expression cassette was integrated into genome Not I site to obtain recombinant bacterium Yli-CH. The specific method comprises the following steps:

(1) recombinant Yli-C competent cells were prepared after overnight culture in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).

(2) 113-GPD-hph-TEF-tHMGR was introduced into competent cells of recombinant Yli-C using Zymogen Frozen EZ Yeast Transformation Kit II of Yeast transformation kit Zymo Research Corporation for homologous recombination.

(3) Screening with hygromycin plate, single colony is grown for 3-4 days, and PCR is identified to correct positive clone, named recombinant bacterium Yli-CH. Wherein the hygromycin selection medium comprises: glucose 20g/L, peptone 20g/L, yeast powder 5g/L, and one thousandth of hph (50 g/L).

Construction of recombinant bacterium Yli-CAH

The plasmid pki-TEF-acc1 containing the acc1 gene expression cassette is introduced into recombinant bacterium Yli-CH, and the acc1 expression cassette is integrated at the Not I site of the genome to obtain recombinant bacterium Yli-CAH. The specific method comprises the following steps:

(1) recombinant Yli-CH was cultured overnight in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose) to prepare competent cells.

(2) The pki-TEF-acc1 was introduced into competent cells of recombinant strain Yli-CH using Zymogen Frozen EZ Yeast Transformation Kit II of Yeast transformation kit Zymo Research Corporation for homologous recombination.

(3) Screening with screening medium SD-Leu, and growing single colony in 3-4 days, and identifying correct positive clone by PCR, named recombinant Yli-CAH. Wherein the screening culture medium SD-Leu is: glucose 20g/L, (NH) ₄ ) ₂ Fe(SO ₄ ) ₂ Yeast Nitrogen Base (YNB) 6.7g/L, 0.01. Mu. Mol/L glucose, 2g/L and an appropriate amount of amino acid mixture (leucine removed).

EXAMPLE 3 use of recombinant bacteria in the production of beta-carotene

1. Culturing engineering bacteria

Respectively using those of example 2Each recombinant strain produces beta-carotene. The specific method comprises the following steps: taking out the strain from the seed retaining tube, inoculating into a YPD test tube with an inoculum size of 1%, and culturing at 30deg.C for 24 hr to obtain seed solution; the seed solution was inoculated into 50mL of the fermentation medium at an inoculum size of 1%, and cultured with shaking at 25℃and 220rpm for 7 days. Exogenous addition of 2mM H at 24H fermentation ₂ O ₂ Sampling detection is carried out every 24 hours.

Wherein the fermentation medium contains 20g/L glucose, 10g/L yeast extract and 20g/L tryptone.

2. Extraction of beta-carotene

(1) The well-mixed fermentation broth was centrifuged at 12000rpm for 5min (washed twice with pure water) at 2 mL.

(2) After the water content was drained, the suspension was resuspended in 3mL of dimethyl sulfoxide (DMSO) (preheated at 60 ℃) and homogenized by shaking on a vortex shaker, followed by 5min in a 50℃water bath.

(3) 3mL of acetone was added and the mixture was subjected to a light-resistant water bath at 50℃for 10-15min.

(4) The sample was centrifuged at 12000rpm for 5min. Transferring the supernatant to a new centrifuge tube for light-shielding storage.

3. Quantitative analysis of beta-carotene

The concentration of beta-carotene was detected using high performance liquid chromatography. The liquid chromatography model used in this study was Agilent Technologies 1200 informatity series; the chromatographic column is as follows: acclaim ^TM 120 A C18 chromatographic column; the ultraviolet absorption wavelength is 450nm; the mobile phases were methanol, acetonitrile and dichloromethane (42:42:16); the flow rate is controlled to be 1.0mL/min; the column temperature was 30 ℃.

FIG. 6 is a HPLC detection chart of recombinant strain beta-carotene. After 7 days of fermentation, the recombinant Yli-CAH has the highest beta-carotene yield reaching 90mg/L, namely 93mg of beta-carotenoid is produced per liter of fermentation broth.

The recombinant Yli-C, the recombinant Yli-CH and the recombinant Yli-CAH have the yields of 34.5mg/L, 55mg/L and 93mg/L respectively.

Sequence listing

<110> university of Nanjing Industrial science

<120> beta-carotene-producing recombinant yarrowia lipolytica, construction method and application thereof

<130> xb22050501

<141> 2022-05-05

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1755

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgggcaaag agaaggacca agacaagcca actgctatca tcgttggttg tggtattggt 60

ggtatcgcta ctgctgctag attggccaaa gagggtttcc aggttaccgt gttcgaaaag 120

aacgactact ccggtggtag atgctccttg attgagagag atggttacag attcgaccag 180

ggtccatcct tgttgttgtt gccagacttg ttcaagcaga ccttcgagga cttgggtgag 240

aagatggaag attgggttga cctgatcaag tgcgagccaa actacgtttg tcacttccac 300

gacgaagaga ctttcacttt gtccactgac atggccttgc tgaagagaga ggtcgaaaga 360

ttcgaaggta aggacggttt cgacagattc ctgtccttca ttcaagaggc ccacagacac 420

tacgagttgg ctgttgttca tgtcctgcag aagaacttcc caggtttcgc tgctttcttg 480

agactgcagt tcatcggtca gattttggct ctgcacccat tcgagtccat ttggactaga 540

gtctgcagat acttcaagac cgacagactg agaagagtgt tctccttcgc cgttatgtac 600

atgggtcaat ctccatactc tgccccaggt acttactcct tgttgcagta cactgagctg 660

accgaaggta tctggtatcc aagaggtggt ttctggcagg ttccaaacac tttgttgcag 720

atcgtcaaga gaaacaaccc atccgccaag ttcaacttca acgctccagt ttctcaggtc 780

ttgttgtctc cagctaagga cagagctacc ggtgttagat tggaatctgg tgaagaacac 840

cacgccgacg ttgttatcgt taacgctgat ttggtttacg cctccgagca cttgattcca 900

gatgacgcta gaaacaagat cggtcagttg ggtgaagtca agagatcttg gtgggctgac 960

ttggttggtg gtaagaagtt gaagggttcc tgttcctcct tgtccttcta ctggtctatg 1020

gacagaatcg tcgatggtct tggtggtcac aacattttct tggccgagga cttcaagggt 1080

tctttcgaca ctatcttcga ggaactgggt ttgccagctg acccatcttt ttacgtcaac 1140

gtcccatcca gaatcgaccc atctgctgca cctgaaggta aagacgccat cgttattttg 1200

gttccatgcg gtcacatcga cgcttctaac ccacaagact acaacaagtt ggttgccaga 1260

gccagaaagt tcgtcatcca aactttgtcc gctaagttgg gtctgcctga cttcgagaag 1320

atgatcgttg ctgaaaaggt tcacgacgct ccatcttggg agaaagagtt taacctgaag 1380

gacggctcca ttttgggtct tgctcacaac ttcatgcagg tcttgggttt cagaccatcc 1440

actagacacc caaagtacga caagttgttc ttcgttggtg cctctactca tccaggtact 1500

ggtgttccaa tcgttttggc tggtgctaag ttgactgcca accaggtttt ggaatccttc 1560

gatagatctc cagctccaga tccaaacatg tccttgtctg ttccatacgg taagccactg 1620

aagtccaacg gtactggtat tgactcccag gtccagttga agttcatgga cttggagaga 1680

tgggtctact tgttggtctt gctgatcggt gctgttatcg ctagatccgt tggtgttttg 1740

gccttctaag aattc 1755

<210> 2

<211> 1131

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atggactacg ccaacatctt gaccgctatt ccattggagt tcactccaca ggacgacatc 60

gttttgttgg agccatacca ctacttgggt aagaacccag gtaaagagat cagatcccag 120

ttgatcgagg ccttcaacta ctggttggac gtcaagaaag aggacttgga ggttatccag 180

aacgtcgtcg gtatgttgca tactgcttct ctgttgatgg acgacgttga ggactcttcc 240

gttttgagaa gaggttctcc agtcgctcac ctgatctacg gtattccaca gactatcaac 300

accgccaact acgtctactt cttggcctac caagagatct tcaagctgag gccaactcca 360

attccaatgc cagttattcc accatcctct gcttccctgc aatcttctgt ttctagtgct 420

tcttcctctt cttccgcctc ctctgaaaac ggtggtactt ctactccaaa ctcacagatc 480

ccattctcca aggacaccta cttggacaag gttatcaccg acgagatgtt gtccttgcac 540

agaggtcaag gtttggagct gttttggaga gactccttga cttgtccatc cgaagaggaa 600

tacgtgaaga tggttctggg taagaccggt ggtttgttca gaatcgccgt cagattgatg 660

atggccaagt ccgaatgtga catcgacttc gttcagctgg tcaacctgat ctccatctac 720

ttccagatca gggacgacta tatgaacttg cagtcctctg agtacgccca caacaagaac 780

ttcgctgagg atttgactga gggcaagttc tctttcccaa ccattcactc cattcacgct 840

aacccatcct ccagattggt catcaacacc ttgcagaaga agtccacctc tccagaaatc 900

ttgcaccact gcgtcaacta catgagaact gagactcact ccttcgagta cacccaagag 960

gttttgaaca ctttgtccgg tgccttggaa agagagttgg gtagattgca aggtgagttc 1020

gctgaagcta actccaagat tgacttgggt gacgttgaat ccgagggtag aactggtaag 1080

aacgttaagt tggaggccat cttgaagaag ttggctgaca tcccactgta a 1131

<210> 3

<211> 2022

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgactgctt tggcctacta ccagatccac ttgatctaca ccttgccaat cttgggtttg 60

ttgggtctgt tgacttcccc aatcttgacc aagttcgaca tctacaagat ctccatcctg 120

gtgttcattg ctttctccgc tactactcca tgggactctt ggatcattag aaacggtgct 180

tggacttacc catctgctga atctggtcaa ggtgtgttcg gtactttctt ggacgttcca 240

tacgaagagt acgctttctt cgttatccag accgtcatca ccggtttggt ttacgttttg 300

gctaccagac acttgttgcc atccttggct ttgccaaaga ctagatcttc cgctttgtcc 360

ttggccttga aggctttgat tccactgcca atcatctacc tgttcactgc tcatccatct 420

ccatcaccag atcctttggt taccgaccac tacttctaca tgagagcctt gtccttgttg 480

atcaccccac caactatgtt gttggctgct ttgtctggtg aatacgcctt cgattggaag 540

tccggtagag ctaagtctac tatcgctgcc atcatgatcc caaccgtcta cttgatttgg 600

gttgactacg ttgctgttgg tcaggactcc tggtctatta acgacgagaa gatcgtcggt 660

tggagacttg gtggtgtttt gccaattgaa gaggctatgt tcttcctgct gaccaacttg 720

atgatcgtct tgggattgtc tgcctgtgac catactcaag ccttgtactt gctgcacggt 780

agaaccatct acggtaacaa gaagatgcca tcctcctttc cactgatcac tccacctgtg 840

ttgtccctgt tcttcagttc tagaccttac tcttcccagc caaagagaga cttggagttg 900

gccgttaagt tgctggaaga aaagtccagg tccttcttcg ttgcttctgc tggtttccca 960

tctgaggtca gagaaagatt ggttggtctg tacgccttct gtagagttac cgacgacttg 1020

attgactccc cagaggtttc ttctaaccca cacgctacta tcgacatggt gtccgatttc 1080

ttgaccttgt tgttcggtcc accattgcac ccatctcagc cagataagat tttgtcctct 1140

ccactgttgc caccatctca cccttctaga ccaactggta tgtacccatt gccaccacca 1200

ccatctttgt ctccagctga gttggttcag ttcctgactg agagagttcc agtccaatac 1260

cacttcgcct ttagattgct ggctaagttg cagggtctga tcccaagata cccattggac 1320

gagttgttga gaggttacac caccgacttg atcttcccat tgtctactga ggctgttcag 1380

gctagaaaga ccccaattga aactaccgct gacttgttgg actacggttt gtgtgttgct 1440

ggttccgttg ctgagttgtt ggtgtacgtt tcttgggctt ctgctccatc tcaagttcca 1500

gctaccattg aagagagaga ggctgttttg gttgcctcca gagaaatggg tactgccttg 1560

cagttggtca acattgccag agacattaag ggtgacgcta ccgagggtag attctacttg 1620

ccattgtcat tcttcggtct gagggacgaa tccaagttgg ctattccaac tgattggacc 1680

gagccaagac cacaagattt cgacaagttg ttgtctctgt ccccatcctc tactttgcca 1740

tcttctaacg cttccgagtc cttcagattc gagtggaaaa cttactcctt gccactggtt 1800

gcttacgctg aggatttggc taagcactcc tacaagggta tcgacagatt gccaactgag 1860

gttcaggctg gtatgagagc tgcttgtgct tcctacttgc tgatcggaag agagatcaag 1920

gttgtttgga agggtgatgt cggtgagaga agaactgttg caggttggag aagagtcaga 1980

aaggttttgt ccgttgtcat gtctggttgg gagggtcagt aa 2022

<210> 4

<211> 1503

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atgacccagt ctgtgaaggt ggttgagaag cacgttccta tcgtcattga gaagcccagc 60

gagaaggagg aggacacctc ttctgaagac tccattgagc tgactgtcgg aaagcagccc 120

aagcccgtga ccgagacccg ttctctggac gacctagagg ctatcatgaa ggcaggtaag 180

accaagcttc tggaggacca cgaggttgtc aagctctctc tcgagggcaa gcttcctttg 240

tatgctcttg agaagcagct tggtgacaac acccgagctg ttggcatccg acgatctatc 300

atctcccagc agtctaatac caagacttta gagacctcaa agcttcctta cctgcactac 360

gactacgacc gtgtttttgg agcctgttgc gagaacgtta ttggttacat gcctctcccc 420

gttggtgttg ctggccccat gaacattgat ggcaagaact accacattcc tatggccacc 480

actgagggtt gtcttgttgc ctcaaccatg cgaggttgca aggccatcaa cgccggtggc 540

ggtgttacca ctgtgcttac tcaggacggt atgacacgag gtccttgtgt ttccttcccc 600

tctctcaagc gggctggagc cgctaagatc tggcttgatt ccgaggaggg tctcaagtcc 660

atgcgaaagg ccttcaactc cacctctcga tttgctcgtc tccagtctct tcactctacc 720

cttgctggta acctgctgtt tattcgattc cgaaccacca ctggtgatgc catgggcatg 780

aacatgatct ccaagggcgt cgaacactct ctggccgtca tggtcaagga gtacggcttc 840

cctgatatgg acattgtgtc tgtctcgggt aactactgca ctgacaagaa gcccgcagcg 900

atcaactgga tcgaaggccg aggcaagagt gttgttgccg aagccaccat ccctgctcac 960

attgtcaagt ctgttctcaa aagtgaggtt gacgctcttg ttgagctcaa catcagcaag 1020

aatctgatcg gtagtgccat ggctggctct gtgggaggtt tcaatgcaca cgccgcaaac 1080

ctggtgaccg ccatctacct tgccactggc caggatcctg ctcagaatgt cgagtcttcc 1140

aactgcatca cgctgatgag caacgtcgac ggtaacctgc tcatctccgt ttccatgcct 1200

tctatcgagg tcggtaccat tggtggaggt actattttgg agccccaggg ggctatgctg 1260

gagatgcttg gcgtgcgagg tcctcacatc gagacccccg gtgccaacgc ccaacagctt 1320

gctcgcatca ttgcttctgg agttcttgca gcggagcttt cgctgtgttc tgctcttgct 1380

gccggccatc ttgtgcaaag tcatatgacc cacaaccggt cccaggctcc tactccggcc 1440

aagcagtctc aggccgatct gcagcgtcta caaaacggtt cgaatatttg catacggtca 1500

tag 1503

<210> 5

<211> 6708

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

atggcctctg ttgccactag cggcgctccc gccaacggcg gcgccggaca gtacgaccac 60

agtcgtgtcg cgcagttcat cggctccaac ccgattggcg tcgctccctc cggtcgggta 120

accgactttg tcaagtccca gggcggtcac agtgttgtga ccaaggtcct tattgccaac 180

aatggtatcg gtgccgtcaa ggaaattcgt tccgtccgca agtggtctta cgagaccttt 240

ggctctgacc gcatgatcga gttcactgcc atggccaccc ccgatgacct gcgtatcaac 300

gccgagtaca ttcgtatggc cgaccgctac gtcgaggttc ccggcggaag caacaacaac 360

aactacgcca acgtcgacct cattgttgac gttgccgagc gcgctggcgt ccacgccgtc 420

tgggctggtt ggggtcacgc gtcggagaac ccccgtctcc ccgagctcct cgccaagtcc 480

aatatcatct tcatcggtcc ccccggttcc gccatgcgtt cgcttggtga caagatttcg 540

tcgaccattg tcgctcagtc ggccgacgtc ccctgcatgc cgtggtccgg taccggcatc 600

gccgagaccg agctctctcc ccagggtttc gttactgtcc ccgacgtggc ctaccaggag 660

gcctgcgtca actcgtggga ggagggtctc gcccgcgccg agaccattgg ctaccccgtc 720

atgatcaagg cctctgaggg tggtggtggt aagggtattc gcaaggtcga agaccccgag 780

aagttcaagg tttcgttcca ggccgtcgcc tccgaggtgc ctggctcgcc tatctttgtt 840

atgaagctcg cctcggctgc ccgccacctc gaggttcagc tcatggccga ccagtacggt 900

aacgccattt ccctctttgg ccgtgactgc tcggtccagc gtcgccacca gaagatcatt 960

gaggaggccc ccgtcaccat cgccaagccc gacacgttcg aggagatgga gaaggcggcc 1020

gtccgtctcg ccaagctcgt cggctacgtg tcggctggta ccgtcgagta cctgttctcg 1080

cacgaggaca acaagttcta cttcctcgag ctcaaccccc gtctccaggt cgagcacccc 1140

acgactgaga tggtttcggg atgcaacatt cccgccatcc agctccaggt tgccatgggt 1200

atccccctcc accgcatccg cgacatccgt accctctacg gcatggaccc ccacggcgtc 1260

accgagattg actttgacgg caccaagccc gagtctgcgc acacccagcg caagcccaag 1320

cccaagggtc acgttattgc gtgccgtatc accggtgaga accccgacgc cggcttcaag 1380

ccctcgtccg gtgctcttac tgagctcaac ttccgctcca actcgaacgt ctggggttac 1440

ttctcggtct ctgctgccgg tggtctccac gagttcgccg actctcagtt cggccacatc 1500

ttcgcctacg gcatggagcg tagcgaggcc cgcaagtcga tggtcgtcgc tctcaaggaa 1560

ctctcgattc gtggtgaatt ccgcaccacc gtcgagtacc tcatcaagct gctcgagaag 1620

cccgagtttg aggacaacac tctcaccacc cagtggctcg acggccttat cgccgagggc 1680

atgacctcgg agcgccccga caccaccatc gctgttgtct gcggtgccgt tgtcaaggcc 1740

caggtcgcct acgaggcctg tgtcaccaag tacaagtcga tccttgaccg cggtcagatc 1800

ccttccaagg atgtccttca gaccttcttc aagaccgagt tcatctacga cggtgttcgc 1860

tactcgttcg ccatggccaa gtcggctccc ctccagttca ctctcttctt gaacggtggc 1920

cgtatctacg tcggtgtccg tcccctctcg gacggtggtc tcctcatctc gcttgagggt 1980

gcctcgcaca ctgtctacta ccgcgaggag gttggcgcca tggtcctctc agtcgactcc 2040

aagacctgca tgatcgagga cgagcgtgac cccactcagc tccgctcccc ctcgcccggt 2100

aagcttgtcc gctacctcat cgagtcgggc gagcacgtcg actctggcga cgcctacgcc 2160

gagattgagg tcatgaagat gatcatgccc gtcactgcca ccgagtctgg tatcgtccag 2220

ttcatgaagc agcccggcca gcagctcgcc cagggtgagc tcctcggtat cctcaccctc 2280

gacgacccca ccaaggtcaa gtttgccaag cccttcgagg gcctcctccc cacctttgag 2340

ctcaagaacg gccgctacgg caccaagcct caccagctcc tccgcgagca cctcgagatt 2400

ctctacgaca acctcgctgg ttacgacaac agcgctcagg tcctcccctc gctccgcctg 2460

gtcacctccc agctccgcga cgccgacctc ccttacgcca acgcccagga cgtcctctcc 2520

acgctttcgg gccgtatccc ccagaagctc gaggatgagg tccgtagcat cattgacacc 2580

tgccgcacct cgcagctcga gttcccctcg accaagctca agcgtgtcat ttcgaacttt 2640

atcgaggagc acgtcgacta caaggagcgc caggccgtta ccaacgccat tgctcccctc 2700

gaggtcctca tcgacgcctt cacctacggc ctcaaggtcc acgagtggca gatttacgcc 2760

gacctcctca actacttctc cgagattgag gagcccttca ccgacacgac ccacactcag 2820

gaggagatcg tgctcaagct ccgtgaggac aacaaggacc tcgacgccgt tgtcaagctc 2880

gtgctctcgc acagcaaggc cgcgtccaag gccaagctca tctttgccgt ccttgacctc 2940

gtcaaggccg agtcgcccaa gtcgtccatg accaccgagt ctggcgttca caaggccctt 3000

ggtcgcatgg ccgagctcga gggccgcccc acttccaagg tcgccctcaa ggccaaggag 3060

gtcctcattg tgggctcgct ccccacctac gaggagcgtt acggccagct tgagaagatc 3120

ctcaaggctt cggtcaccac ctcgtactac ggtgactcgg gcagcggcca ccgcctgccc 3180

tcgagcgacc tcctcaagga ggttaccgac tcgcgctaca ccgtcttcga cgttctctcg 3240

accttcttcg agcaccccga cccttgggtc gtccttgccg cccttgaggt ctacattcgc 3300

cgtgcttacc gcgtctacaa cgtccttgcc ctcgactacg agcccgtcgg ccccaacagc 3360

gaggccaaca ttgtcacctg gcgcttcaag atgggtggcc ccggccacga cgcctcgacc 3420

ccccgtgtcg actcgtcgcg cgacattact cgcattgcct cagtcagcga cctgaactac 3480

attgttcacg tcaagcagga gcccctccgc ttcggtctca tgacctcgta ctcgtcgctc 3540

gagcccctca aggctggctt ccccggcctc ctgtcgcgtt accccgtctt tgaccacgac 3600

gagtttgtcg agaagtacgg ccacagcgcc cgtcaccctc acgtcctcaa cgtcgccctc 3660

cgcctcttcg gcaaggagga ccaggacatg accgaccagg acctcaacct cgccttcacc 3720

gagctcacca acaagtacaa ggagcaggtc gtcggtgttg gtatccgtcg tatttcgttc 3780

ctcatctgcc gccccgactc gtacccttcg tacgtcactc tccgcgagag cgccgacggc 3840

tcgtggcgcg aggagcaggc tatccgcaac attgagcccg ccttcgccta ccagctcgag 3900

ctcagccgcc tgtccaactt caagatctcc cccttgcgct cgggcaaccg ccagatccac 3960

gtctaccacg ctgttggccg tgagaacact tcggacgttc gtttcttcgt ccgcgctctt 4020

ctccgccctg gccgcttcgt cggccagatg aagcagaccg agtacctcat ctcggagact 4080

gaccgcctcg tcggtgacat tctcgacacc cttgagatct ccatgtccga gtaccgccag 4140

gccgactgca accacatctc ggtcaactgc gtctactcgc tcaacgtcac tttcgaggac 4200

gtccaggagg cccttgctgg cttcattgag cgccacggca agcgtctctg gcgcctccgt 4260

gtcacccagg ctgagatccg cgttgtcatc gaggacgacg agggcaacat cctccccatc 4320

cgtgcgttca tcgagaacgt ttcgggcttc gtcgtcaagt acgaggcgta ccaggaggtc 4380

gccaacgaga agggcaacat gatcctcaag tcgatcggcg accagggcca gttccacctc 4440

cagcccgtca acttccccta ctcgaccaag gagtcgctcc agccccgtcg ttaccaggct 4500

cacgtcatcg gcaccaccta cgtctacgac ttccccgacc tcttccgtca ggccgtcgac 4560

aaggtttggc accaggtcca gcaggccctc cccaacgtca aggtcccctc ggacctcctc 4620

tcggccgctg agctcgttgt tgacgagcac ggtgagcttg tcgaggttgc ccgtcccccg 4680

ggactcaaca cctgcggtat ggtcgcgtgg gtctacacca tgaagacccc cgagtacccc 4740

aagggccgtc gcattgttgt catctccaac gacatcacct accagattgg ttcgttcggc 4800

cccgccgagg acgagtactt ctacaaggct acccagtacg ctcgcaagca cggtctcccc 4860

cgtgtctact tgtcggccaa ctcgggtgcc cgtatcggtc tcgccgacga ggtcatggct 4920

ctctttgacg ttgcctggcg cgaggtcggc aagcccgaga agggcttcga ctacctctac 4980

ctcacccctg ccagccttga caagctcaac gccatgggcg agggctctgt catcaccgac 5040

gagattgagg ttgacggcga gcgccgccac aagattaccg ccatcatcgg tctcaaggac 5100

ggcctcggtg tcgagtgtct caagggttcg ggtctcattg ccggtgagac ttcgcgcgcc 5160

tacgacgaca tcttcaccat ctctatggtc accgcccgtt cggtcggtat tggtgcctac 5220

ctcgtccgtc tcggccagcg tgtcgtccag gtcgagagcc agcccatcat cctcactggt 5280

gcccaggcca ttaacaaggt tctcggcaag gaggtctaca cctcgaacat ccagcttggt 5340

ggtccccaga tcatgtacaa gaacggtatc tcgcacttga ccgccggttc ggacctcgac 5400

ggtgccctgc agatcatcaa ctacctgacc tacatccccg ccaagaaggg ctctgccatc 5460

cccatcctcc ccactggcga ctcttgggac cgcaacgtcg actggaagcc caccaagggc 5520

ccttacgacc cccgcaactt tatcgctggt tgcgtcgagg aggtcgacgg tgtcgagacc 5580

ttccagaacg gtgttcttga ccgtggctcg tggttcgaga ccatgggcgg ttgggcgcag 5640

accattgtca ctggtcgtgg tcgcctcaac ggtatccccg ttgctgtcat tgctgccgag 5700

acccgcacca ttgagcgtgt cgaccccgcc gaccctgcca acgagaactc gaccgagtcc 5760

aaggtcgctc tcgccggtac tgtctggttc cctgacagct cgcgcaagac tgccactgcc 5820

attgaggacg ccaaccgtga gggtctccct ctcatcctgt ttgccaactt ccgtggcttc 5880

tcgggtggta tgtcggacat gctccaggcc atcctcaagg agggtgccaa gattgtcgac 5940

ggcctcagca gctacaagca gcccatcatt gtctaccttg tccccaacgg tgaactccgt 6000

ggtggtgcct gggtcgtgct cgacccctcg atcaaccccg agtacatgtc gatgatggtc 6060

gacaacgagt cgcgcggtgg tgtcctcgag cccgagggta ttgtcgaggt caagtaccgc 6120

aagcccagga tccaggccac catggcccgt ctcgaccccg agtacgcccg cctcaaggct 6180

gccgtcgacg accccaaggc caccgccgag cagaagaagg aggctaccgt cgccctcgag 6240

gcgcgcgaga agcacctcgg cccctcgttc caccaggtcg ccgtcgagtt tgccgacctc 6300

cacgaccgct cgggccgcat ggccgccaag gccgactgca agcccgtcga ctgggtcaac 6360

tcgcgtcgta ccatctactg gtcgctgcgc cgcaagctgt ccgaggttcg catcatgaag 6420

aagctctcgg ccgccaaccc caacctcacc taccccgagc gcaaggagat gttcgagcag 6480

cttgtcccca ccgagctcac cgacgacgcc gaggtcgctg ccttcctcga gaagtcgggc 6540

gacgccgtcg aggactttgt ccagcaggtc cgcgacgcgt actgctcgga caatgtcgtc 6600

gcctgggcct cgaccaacca gcgtggtgtc atggagggct tccagcgtat cctcgagtcg 6660

ctctcgcccc aggaccgctc cgtcctcctt gcccagctcc agcagtaa 6708

Claims

1. A recombinant yarrowia lipolytica strain producing beta-carotene is characterized in that the strain is introduced into yarrowia lipolyticaYarrowia lipolytica) Wherein the expression cassette of geranylgeranyl diphosphate synthase CrtE, phytoene synthase/lycopene cyclase CrtYB, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl CoA reductase tHMGR and acetyl coenzyme A carboxylase ACC are introduced;

the coding gene sequence of the geranylgeranyl diphosphate synthase CrtE is shown as SEQ ID No:1 is shown in the specification; the coding gene sequence of the phytoene synthase/lycopene cyclase is shown as SEQ ID No:2 is shown in the figure; the coding gene sequence of the phytoene desaturase is shown as SEQ ID No:3 is shown in the figure; the coding gene sequence of the 3-hydroxy-3-methylglutaryl CoA reductase is shown as SEQ ID No:4 is shown in the figure; the coding gene sequence of the acetyl-CoA carboxylase is shown as SEQ ID No: shown at 5.

2. The recombinant yarrowia lipolytica strain of claim 1, wherein the yarrowia lipolytica is a yarrowia lipolytica Po1f strain.

3. The recombinant yarrowia lipolytica strain of claim 1, wherein the promoter of the expression cassette is the TEFin promoter, TEF1 promoter or GPD promoter of yarrowia lipolytica; the terminator is a cyc1 terminator or an xpr2 terminator of yarrowia lipolytica.

4. The recombinant yarrowia lipolytica strain of claim 1, wherein the recombinant yarrowia lipolytica further expresses 1 or more marker genes; the marker gene is selected from hygromycin coding gene expression cassette of plasmid PAN 7-1.

5. The method for constructing a recombinant yarrowia lipolytica strain according to any one of claims 1-4, wherein the expression cassettes for geranylgeranyl diphosphate synthase CrtE, phytoene synthase/lycopene cyclase crtbb, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl CoA reductase tggr and acetyl CoA carboxylase ACC are introduced into the yarrowia lipolytica strain in the form of plasmids and integrated into the genome of the yarrowia lipolytica strain.

6. The method of construction according to claim 5, comprising:

inserting gene fragments of geranylgeranyl diphosphate synthase CrtE, phytoene synthase/lycopene cyclase CrtYB and phytoene desaturase CrtI into plasmid 113-GPD-TEF by a one-step cloning method to obtaincrtIEYBRecombinant plasmids;

3-hydroxy groupThe gene fragment of the gene-3-methylglutaryl CoA reductase tHMGR is inserted into the 113-GPD-TEF plasmid containing the marker gene by a one-step cloning method to obtaintHMGRRecombinant plasmids;

inserting acetyl-CoA carboxylase ACC gene fragment into plasmid PKi-TEF by using one-step cloning method so as to obtain the invented productacc1Recombinant plasmids;

the saidcrtIEYBRecombinant plasmid,tHMGRRecombinant plasmid,acc1The recombinant plasmid was introduced into yarrowia lipolytica to obtain a recombinant yarrowia lipolytica strain.

7. Use of the recombinant yarrowia lipolytica strain of any one of claims 1-4 for the production of beta-carotene.