CN115005099B

CN115005099B - Genetic transformation method of tartary buckwheat

Info

Publication number: CN115005099B
Application number: CN202210646308.8A
Authority: CN
Inventors: 吴琦; 肖欣; 李鑫; 赵佳利; 王磊; 赵海霞; 李成磊; 李洪有; 吴花拉
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2022-06-09
Filing date: 2022-06-09
Publication date: 2023-05-12
Anticipated expiration: 2042-06-09
Also published as: CN115005099A

Abstract

The invention relates to the field of plant tissue culture and genetic transformation, in particular to a genetic transformation method of tartary buckwheat, which comprises the following steps: (1) preparation of aseptic seedlings, (2) cultivation of agrobacterium, (3) preparation of explants, (4) infection and co-cultivation (5) adventitious bud induction cultivation (6) rooting cultivation. The method utilizes cotyledonary node as an initial explant, establishes a rapid and effective regeneration system through a direct organogenesis way, does not induce and differentiate callus, simplifies the culture process, and can obtain a tartary buckwheat regeneration plant in a short time; the tissue culture seedling plant cultivated by the method has high phenotype consistency and stably maintains the excellent characteristics of the parent body.

Description

Genetic transformation method of tartary buckwheat

Technical Field

The invention relates to plant tissue culture and genetic transformation, in particular to a genetic transformation method of tartary buckwheat.

Background

Tartary buckwheat is a plant of Fagopyrum genus of Polygonaceae family, and is called as "five cereals king" because of its rich nutritive value and pharmacological effect. The tartary buckwheat has the advantages that the contents of fat, protein, vitamins and minerals are higher than those of wheat and rice, the tartary buckwheat has the effects of reducing blood fat, reducing blood sugar and resisting aging, and various processed products are favored by consumers. Tartary buckwheat is cool-loving and barren-tolerant, is planted in a high-cold mountain area in southwest of China, and plays an important role in local development.

The Chinese tartary buckwheat germplasm resources are rich, but the planting is dispersed and the scale is small, and the problems of variety degradation, low yield and the like exist. Moreover, the tartary buckwheat is not suitable for cross breeding on the genetic background, the mutation breeding period is long, and the current increasingly urgent breeding requirements are difficult to meet. With the rapid development of modern biotechnology, modern biotechnology means represented by gene editing have become effective choices for crop improvement. Therefore, the establishment of a stable tartary buckwheat genetic transformation regeneration system technical platform becomes a key link for supporting the research of the tartary buckwheat frontier field. Although a certain progress is made in the aspects of the regeneration system and genetic transformation of the tartary buckwheat at home and abroad at present, the genetic transformation system of the tartary buckwheat is still immature due to the problems of complex genotype, low survival rate of regenerated plants and the like, and the acquisition of transgenic lines is very difficult.

The genetic transformation system of the tartary buckwheat cannot be established at a later time due to the low tissue culture efficiency of the tartary buckwheat. Therefore, a stable and efficient genetic transformation system of tartary buckwheat is needed to be established, and an effective way can be provided for deep development of basic research of tartary buckwheat biology and molecular auxiliary breeding research.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a genetic transformation method of tartary buckwheat, so as to at least achieve the advantages of simple culture flow, high consistency of phenotype of tissue culture seedling plants and stable maintenance of the excellent characteristics of a parent body.

The aim of the invention is realized by the following technical scheme:

a genetic transformation method of tartary buckwheat, comprising the following steps:

(1) Preparation of aseptic seedlings: inoculating sterilized tartary buckwheat seeds into an MS culture medium for culture to obtain aseptic seedlings;

(2) Culturing agrobacterium: inoculating agrobacterium to an agrobacterium activation culture medium for activation to obtain agrobacterium infection solution;

(3) Preparation of explants: the aseptic seedling is cut horizontally by an aseptic blade at a position of 2-5mm downwards at the junction of cotyledons, and hypocotyl areas and true leaf parts are removed to obtain cotyledon node explants;

(4) Infection and co-cultivation: the cotyledonary node explant is placed into the agrobacterium infection solution for dip dyeing, the water is absorbed by the infected explant, and the cotyledonary node explant is placed into a co-culture medium for dark culture, so that the co-culture cotyledonary node explant is obtained;

(5) Adventitious bud induction culture: inoculating the co-cultured cotyledonary node explant to an adventitious bud induction culture medium for culture to obtain a subculture cluster bud;

(6) Rooting culture: dividing the subculture cluster buds into single plants, and inoculating the single plants into a rooting medium for culture to obtain the tartary buckwheat transgenic plants.

Further, in step (1), the MS medium comprises the following components: 25-35g/L, MS g/L of sucrose, 4-5g/L of agar powder and 6-8g/L of agar powder; the pH value of the MS culture medium is regulated to 5.6-6.0, and the culture conditions are 20-25 ℃, the illumination intensity is 5000-6000lx, the illumination time is 14-16h/d and the illumination time is 10-15d.

Further, in the step (1), the specific sterilization method comprises the steps of soaking the tartary buckwheat seeds in 70% alcohol for 30s, cleaning with sterile water for 2-3 times, disinfecting with 0.1% mercuric chloride for 8min, cleaning with sterile water for 6-8 times, and then removing surface moisture.

Further, in step (2), the agrobacterium is LBA4404; the agrobacterium vector is pCHF3-YFP; the components of the agrobacterium activation culture medium comprise 4-6g/L of beef extract, 4-6g/L of peptone, 0.5-2g/L of yeast extract, 4-6g/L of sucrose and 0.2-0.8g/L of magnesium sulfate heptahydrate, and the pH value of the agrobacterium activation culture medium is regulated to 7.0-7.5.

Further, in the step (2), the agrobacterium is prepared into an agrobacterium solution, and inoculated on an agrobacterium activation medium for activation, and the OD of the agrobacterium solution ₆₀₀ 0.4-0.6.

Further, in the step (4), the components of the co-culture medium comprise 30g/L, MS of sucrose, 4.74g/L of agar powder, 7g/L of acetosyringone and 100mg/L of acetosyringone; the pH value of the co-culture medium is regulated to be 5.6-6.0, and the culture condition is dark culture at 22 ℃ for 2-3d.

Further, in the step (5), the components of the adventitious bud induction culture medium comprise 25-35g/L, MS powder 4-5g/L of sucrose, 6-8g/L of agar powder and 0.5-2.5mg/L of 6-benzylaminopurine; the pH value of the adventitious bud induction culture medium is regulated to 5.6-6.0, the culture condition is 20-25 ℃, the illumination intensity is 5000-6000lx, the illumination is 14-16h/d, and the culture is 15-25d.

Further, the components of the adventitious bud induction culture medium also comprise 50mg/L kanamycin and 50mg/L timentin.

Further, in the step (5), the culture is subcultured every 14 to 16 days during the period on the adventitious bud induction medium.

Further, in the step (6), the rooting medium comprises 25-35g/L, MS powder 4-5g/L of sucrose, 6-8g/L of agar powder and 1-2mg/L of indolebutyric acid; and adjusting the pH value of the rooting culture medium to be between 5.6 and 6.0, wherein the culture condition is 20 to 25 ℃, the illumination intensity is 5000 to 6000lx, the illumination is 14 to 16h/d, and the culture is 15 to 25d.

Furthermore, the rooting culture medium also comprises 40-60mg/L kanamycin and 40-60mg/L timentin.

The beneficial effects of the invention are as follows:

1. the invention uses cotyledonary node as initial explant, establishes a rapid and effective regeneration system through direct organogenesis, and simplifies the culture process without inducing and differentiating callus, thus obtaining the regenerated plant of tartary buckwheat in a short time.

2. According to the invention, the regeneration efficiency of the tartary buckwheat cotyledonary node is greatly improved by optimizing the culture medium for the induction of the adventitious bud of the tartary buckwheat cotyledonary node.

3. The invention obtains a transgenic positive strain by researching and optimizing a treatment mode and culture conditions in the transformation process through experiments, and smoothly establishes a stable agrobacterium-mediated tartary buckwheat genetic transformation system.

4. The tissue culture seedling plant cultivated by the method has high phenotype consistency and stably maintains the excellent characteristics of the parent.

Drawings

FIG. 1 is a full view of the present invention from cotyledonary node to transgenic plant;

FIG. 2 is a graph showing the effect of different concentrations of hormone on cotyledonary node germination rate in example 1;

FIG. 3 shows the germination rate of the agrobacterium transformed under different conditions in example 2;

FIG. 4 is a gel electrophoresis chart of PCR products of the regenerated plant of Fagopyrum tataricum in example 3, M-D2000 Marker; 1-plasmid; 2-ddH ₂ O;3-10, regenerating a single plant after transformation;

FIG. 5 is a comparison analysis of the sequencing results of the Tartary buckwheat PCR products in example 3;

FIG. 6 is a fluorescence observation of transgenic tartary buckwheat and wild type tartary buckwheat leaves of example 4;

FIG. 7 shows the growth of the epicotyl explant of comparative example 1 in adventitious bud induction medium;

FIG. 8 shows the expansion rates of the epicotyl and the hypocotyl in different shoot induction media in comparative example 1;

FIG. 9 shows the growth of hairy root explants in comparative example 2 in callus induction medium for 20 days;

FIG. 10 shows the expansion rate of hairy roots in different callus media in comparative example 2.

Detailed Description

The technical solution of the present invention will be described in further detail with reference to the accompanying drawings, but the scope of the present invention is not limited to the following description.

Example 1

Induction of adventitious buds of cotyledonary node

Preparation of aseptic seedlings: selecting full and insect-eye-free tartary buckwheat seeds, soaking the seeds in deionized water at 42 ℃ for 30min, peeling the seeds by using clean tweezers, sterilizing and inoculating the seeds into an MS culture medium; wherein, the sterilization mode is to soak the materials in an ultra-clean workbench with 70% ethanol for 30s, clean the materials with sterile water for 3 times, soak the materials with 0.1% mercuric chloride for 8min, and clean the materials with sterile water for 7 times. Placing the sterilized seeds on sterile filter paper, absorbing water, placing into MS culture medium, placing 10-13 seeds per bottle, dark culturing for 2-3d, and light culturing for 10-15d, wherein the MS culture medium comprises sucrose 30g/L, MS powder 4.74g/L and agar powder 7g/L;

preparation of explants: selecting a sterile seedling which is cultured for 15 days in the step 1 and is pollution-free and healthy, flatly cutting the seedling at the position of the joint of cotyledons by using a sterile blade at the position of 2mm downwards, and removing the hypocotyl area and the true leaf part to obtain a cotyledonary node explant;

adventitious bud induction culture: inoculating cotyledonary node onto adventitious bud induction culture medium with different hormone concentrations, illuminating with 5000lx intensity, illuminating with 16h/d, and culturing for 20d; during this period, subculture was performed 1 time every 15d.

Counting the germination rate and determining the optimal adventitious bud induction culture medium, the hormone proportion of the culture medium and the germination rate(bud induction rate) is shown in Table 1 and FIG. 2 of the specification. As can be seen from Table 1, J ₂ The highest germination rate of the culture medium is 94.44%.

TABLE 1 influence of regeneration Medium with different hormone ratios on budding Rate

Example 2

Genetic transformation of explants

Culturing Agrobacterium LBA4404 with plant expression vector pCHF3-YFP in YEB culture medium (50 mg/L rifampicin and 50mg/L kanamycin) containing beef extract 5g/L, peptone 5g/L, yeast extract 1g/L, sucrose 5g/L, magnesium sulfate heptahydrate 0.5g/L, and adjusting pH to 7.0-7.5 with NaOH; waiting for OD ₆₀₀ Centrifuging for 10min at 0.6-0.8, discarding supernatant, and re-suspending to OD with heavy suspension ₆₀₀ The values are respectively 0.3, 0.5 and 0.7, the time for infecting the explant treated in the step 1 is respectively 8min, 12min and 16min, the explant is gently swayed at intervals, the water content of the infected explant is absorbed, and the explant is placed into a co-culture medium filled with a piece of sterile filter paper, and the dark culture is carried out for 2-3d; the co-culture medium contains 100mg/L acetosyringone.

Adventitious bud induction culture: selecting cotyledonary node explants which are co-cultured for 2-3d; inoculating cotyledonary node onto adventitious bud induction culture medium, wherein the adventitious bud culture medium is MS basal medium, and 1mg/L of 6-benzyl amino purine (6-BA) is added, the illumination intensity is 5000lx, the illumination is 16h/d, and the culture is carried out for 20d; during the period, subculturing for 1 time every 15 d;

the germination rate after agrobacterium transformation was counted and the optimal treatment conditions were determined, and the germination rate is shown in fig. 3. As can be seen from FIG. 3, at OD ₆₀₀ The value is 0.5, and the highest bud ratio under the condition of infection time of 16min is 28.57%.

Rooting culture: dividing the cluster buds subjected to subculture elongation in the step (5) into single plants, inoculating the single plants into a rooting culture medium, and performing rooting induction to finally obtain a tartary buckwheat transgenic plant; the rooting culture medium MS culture medium is taken as a basic culture medium, IBA1.5mg/L is added, the illumination intensity is 5000-6000lx, the illumination is 16h/d, and the culture time is 15-25d.

Example 3

DNA extraction, screening marker gene PCR amplification and product sequencing of transgenic plant

And (3) taking a proper amount of tartary buckwheat leaves, placing the tartary buckwheat leaves in a mortar, adding liquid nitrogen, and fully grinding. 400. Mu.L of buffer FP1 and 6. Mu.L of RNaseA (10 mg/L) were added thereto, and the mixture was vortexed for 1min and left at room temperature for 10min. 130. Mu.L of buffer FP2 was added and mixed well and vortexed for 1min. Centrifuge at 12000rpm (. About.13400 Xg) for 5min and transfer the supernatant to a new centrifuge tube. 0.7 volumes of isopropanol was added to the supernatant and mixed well, at which point flocculent genomic DNA appeared. Centrifuge at 12000rpm (. About.13400 Xg) for 2min, discard supernatant and leave precipitate. 600 μl of 70% ethanol was added, vortexed for 5sec, centrifuged at 12000rpm (13400×g) for 2min, and the supernatant discarded. 600 μl of 70% ethanol was added again, vortexed for 5sec, centrifuged at 12000rpm (13400×g) for 2min, and the supernatant discarded. And (5) uncovering and inverting, and airing residual ethanol thoroughly at room temperature for 5-10 min. Adding proper amount of elution buffer TE, dissolving DNA in water bath at 65 deg.c for 10-60min, and mixing to obtain DNA solution. Taking 2 mu LDNA electrophoresis to check the quality of DNA, and preserving at-20 ℃.

And (3) taking the obtained DNA sample of the independent single plant as a template, and carrying out PCR amplification by using primers designed by a screening mark eYFP.

Amplification primers: eYFP-F: CATCCTGGTCGAGCTGGACG

eYFP-R：GGTCTTGTAGTTGCCGTCGTC

Amplification conditions: pre-denaturation at 98℃for 3min, denaturation at 98℃for 30s, annealing at 58℃for 30s, elongation at 72℃for 20s,32-33 cycles, and final elongation at 72℃for 5min.

Target fragment: 296bp

The PCR products were run on agarose gel electrophoresis, and the electrophoresis pattern is shown in FIG. 4. As can be seen from the electrophoretogram, 3 strains are transformation positive strains, and the positive rate of the regenerated strain is 37.5%.

The sequencing results of the PCR products are compared with the analysis of FIG. 5, and as can be seen from FIG. 5, the sequencing results of the PCR products are completely matched with the eYFP gene sequence.

Example 4

Fluorescent observation of transgenic tartary buckwheat and wild tartary buckwheat leaves

Observing the converted tartary buckwheat leaves and the wild tartary buckwheat leaves by using a laser confocal microscope,

under excitation of the eYFP channel (515 nm), obvious fluorescence can be observed; the blank was non-fluorescent, see figure 6. The result shows that the transferred exogenous gene is integrated into the genome of the tartary buckwheat leaf.

As shown in FIG. 3, the germination rate of cotyledonary node after infection with Agrobacterium under the optimal conditions was 28.57%, and as shown in FIG. 4, the positive rate of regenerated strain was 37.5%, and the transgenic efficiency was 10.71%.

Comparative example 1

Taking the upper and lower hypocotyls of tartary buckwheat as explants for genetic transformation, and the specific method comprises the following steps:

(2) Preparation of explants: cutting the aseptic seedling epicotyl and hypocotyl into small sections of 0.5cm by using an aseptic blade to obtain epicotyl and hypocotyl explants;

(3) Culturing agrobacterium: the method comprises the steps of carrying out a first treatment on the surface of the Culturing Agrobacterium LBA4404 carrying plant expression vector pCHF3-YFP plasmid in YEB culture medium (50 mg/L rifampicin and 50mg/L kanamycin) with beef extract 5g/L, peptone 5g/L, yeast extract 1g/L, sucrose 5g/L, magnesium sulfate heptahydrate 0.5g/L, and adjusting pH to 7.0-7.5 with NaOH;

(4) Infection and co-cultivation: agrobacterium till OD ₆₀₀ Centrifuging for 10min at 0.6-0.8, discarding supernatant, and re-suspending to OD with heavy suspension ₆₀₀ The values are respectively 0.3, 0.45 and 0.6, the time for infecting the explant treated in the step 2 is respectively 10min, 20min and 30min, the explant is gently swayed at intervals, the water content of the infected explant is absorbed, and the explant is placed into a co-culture medium filled with a piece of sterile filter paper, and the dark culture is carried out for 2-3d; the co-culture medium contains 100mg/L acetosyringone to obtain co-culture epicotyl and hypocotyl explants;

(5) Adventitious bud induction culture: the co-cultured epicotyl and hypocotyl explants were inoculated onto adventitious bud induction medium for culture, and subcultured once every 15d.

Experimental results: the embryogenic and hypocotyl were used as explants to form callus only on J1-J10 shoot induction medium, with no shoots differentiated at all times, see FIG. 7.

Comparative example 2

Taking hairy roots of tartary buckwheat as explants for genetic transformation, and the specific method comprises the following steps:

(2) Culturing agrobacterium: culturing Agrobacterium A4 with plant expression vector pCHF3-YFP plasmid in TY culture medium (50 mg/L rifampicin and 50mg/L kanamycin) containing peptone 5g/L, yeast extract 3g/L, and 1M sterile CaCl ₂ 10ml/L；

(3) Preparation of explants: trimming the aseptic seedlings by aseptic scissors, and reserving cotyledons and hypocotyls to obtain explants;

(4) Infection and co-cultivation: the explant is placed into the agrobacterium rhizogenes invasion solution for dip dyeing, the water is absorbed by the infected explant, and the explant is placed into a co-culture medium for dark culture, so that a co-culture explant is obtained;

(5) Inducing and culturing hairy roots: inoculating the co-culture explant to hairy root induction culture medium for culture, and carrying out secondary culture once in 15 days to obtain hairy roots;

(6) Cutting the hairy root into segments of 1.5-2cm, placing the segments on a callus induction culture medium for culture, and placing 5 explants on each bottle;

the hormone ratios of the callus induction medium used are shown in the following table:

experimental results: a small amount of callus was formed on the L1-L8 callus induction medium with hairy roots as explants, and the differentiation speed was slow, as shown in FIG. 9.

The foregoing is merely a preferred embodiment of the invention, and it is to be understood that the invention is not limited to the form disclosed herein but is not to be construed as excluding other embodiments, but is capable of numerous other combinations, modifications and environments and is capable of modifications within the scope of the inventive concept, either as taught or as a matter of routine skill or knowledge in the relevant art. And that modifications and variations which do not depart from the spirit and scope of the invention are intended to be within the scope of the appended claims.

Claims

1. The genetic transformation method of the tartary buckwheat is characterized by comprising the following steps of:

In the step (5), the adventitious bud induction culture medium comprises 25-35g/L, MS powder 4-5g/L of sucrose, 6-8g/L of agar powder and 1mg/L of 6-benzylaminopurine; the pH value of the adventitious bud induction culture medium is regulated to 5.6-6.0, the culture condition is 20-25 ℃, the illumination intensity is 5000-6000lx, the illumination is 14-16h/d, and the culture is 15-25d.

2. The genetic transformation method according to claim 1, wherein: in the step (1), the MS culture medium comprises the following components: 25-35g/L, MS g/L of sucrose, 4-5g/L of agar powder and 6-8g/L of agar powder; the pH value of the MS culture medium is regulated to 5.6-6.0, and the culture conditions are 20-25 ℃, the illumination intensity is 5000-6000lx, the illumination time is 14-16h/d and the illumination time is 10-15d.

3. The genetic transformation method according to claim 1, wherein: in the step (1), the specific sterilization method comprises the steps of soaking the tartary buckwheat seeds in 70% alcohol for 30s, washing with sterile water for 2-3 times, sterilizing with 0.1% mercuric chloride for 8min, washing with sterile water for 6-8 times, and then removing surface moisture.

4. The genetic transformation method according to claim 1, wherein: in the step (2), the agrobacterium is LBA4404; the agrobacterium vector is pCHF3-YFP; the components of the agrobacterium activation culture medium comprise 4-6g/L of beef extract, 4-6g/L of peptone, 0.5-2g/L of yeast extract, 4-6g/L of sucrose and 0.2-0.8g/L of magnesium sulfate heptahydrate, and the pH value of the agrobacterium activation culture medium is regulated to 7.0-7.5.

5. The genetic transformation method according to claim 1, wherein: in the step (2), the agrobacterium is prepared into an agrobacterium liquid, and then inoculated on an agrobacterium activation medium for activation, wherein the OD 600 of the agrobacterium liquid is 0.4-0.6.

6. The genetic transformation method according to claim 1, wherein: in the step (4), the components of the co-culture medium comprise 25-35g/L, MS powder 4-5g/L of sucrose, 6-8g/L of agar powder and 180-220mg/L of acetosyringone; the pH value of the co-culture medium is regulated to be 5.6-6.0, and the culture condition is that the co-culture medium is subjected to dark culture for 2-3d at 20-22 ℃.

7. The genetic transformation method according to claim 1, wherein: the adventitious bud induction culture medium also comprises 40-60mg/L kanamycin and 40-60mg/L timentin.

8. The genetic transformation method according to claim 1, wherein: in step (5), subculture is performed every 14 to 16 days during the period of the adventitious bud induction medium.

9. The genetic transformation method according to claim 1, wherein: in the step (6), the rooting medium comprises 25-35g/L, MS powder 4-5g/L of sucrose, 6-8g/L of agar powder and 1-2mg/L of indolebutyric acid; and adjusting the pH value of the rooting culture medium to be between 5.6 and 6.0, wherein the culture condition is 20 to 25 ℃, the illumination intensity is 5000 to 6000lx, the illumination is 14 to 16h/d, and the culture is 15 to 25d.