CN114958983A - Method for analyzing and detecting copy number of target gene mediated by lentivirus vector - Google Patents
Method for analyzing and detecting copy number of target gene mediated by lentivirus vector Download PDFInfo
- Publication number
- CN114958983A CN114958983A CN202111300619.0A CN202111300619A CN114958983A CN 114958983 A CN114958983 A CN 114958983A CN 202111300619 A CN202111300619 A CN 202111300619A CN 114958983 A CN114958983 A CN 114958983A
- Authority
- CN
- China
- Prior art keywords
- gene
- copy number
- psi
- detecting
- host cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for analyzing and detecting the copy number of a target gene mediated by a lentiviral vector. Specifically, the invention adopts a double fluorescent quantitative PCR method to detect a packaging sequence Psi containing a target gene transfer plasmid in a lentiviral vector system and a single copy gene in a host cell, and calculates to obtain the copy number/cell of the target gene in a sample. The method has wide universality, avoids the trouble of designing corresponding primers and probes aiming at different target genes, greatly shortens the time of research and development, and is suitable for all HIV-I slow virus vector systems from the first generation to the third generation at present.
Description
Technical Field
The invention relates to the field of biotechnology. Specifically, the invention relates to a universal method for analyzing and detecting the copy number of a target gene mediated by a lentiviral vector.
Background
Lentiviral vectors (lentivirus vectors) play an increasingly important role as tools for foreign gene transfer in the fields of scientific research and clinical research. Compared with the traditional plasmid transfection mode, the lentivirus vector has the advantages of convenient infection, high positive rate, high screening and cloning success rate and the like because the virus genome can be inserted into the host genome.
In the field of gene therapy, screening of the obtained positive clone cell line often requires evaluation of the copy number level of the introduced target gene. The current common method is to design a primer aiming at a target gene by a fluorescent quantitative PCR method, prepare a reference plasmid, and estimate the copy number of each cell according to the genome size of a host cell. The method is found to have inaccurate result and poor result repeatability at present; meanwhile, the method needs to be independently developed according to different genes, and is relatively complex.
Therefore, there is a need in the art to develop a highly accurate and versatile technology for detecting the copy number of a target gene of a lentiviral vector.
Disclosure of Invention
The invention aims to provide a method for analyzing and detecting the copy number of a target gene mediated by a lentiviral vector.
In a first aspect of the present invention, there is provided a method for detecting the copy number of a gene of interest introduced by a lentiviral vector in a host cell, the method comprising the steps of:
1) detecting the copy number of the Psi gene in the cell;
2) detecting the copy number of a single copy gene in a cell;
3) the copy number of the gene of interest in the cell is calculated according to the following formula:
copy number of the gene of interest/cell 2 × Psi copy number/single copy gene.
In a preferred embodiment, the method is a dual qPCR method.
In a preferred embodiment, the nucleotide sequence of the Psi gene is shown as SEQ ID NO. 1.
In a preferred embodiment, the host cell is a eukaryotic cell.
In another preferred embodiment, the host cell is a mammalian cell.
In another preferred embodiment, the host cell is selected from the group consisting of host cells from: rat, mouse, dog, rabbit, cat, cow, horse, monkey, human.
In another preferred embodiment, the host cell is a human cell.
In another preferred embodiment, the single copy gene is selected from the group consisting of: GAPDH, TERT, beta-ACTIN, beta-globin, RPPH 1.
In another preferred example, the single copy gene is a telomerase reverse transcriptase TERT gene having a nucleotide sequence shown in SEQ ID No. 2.
In another preferred embodiment, the lentiviral vector is any of the first to third generation HIV-I lentiviral vector systems.
In a preferred embodiment, the method comprises the following steps:
s1) providing a sample to be detected and a designed PCR reaction system, wherein the reaction system comprises a forward primer and a reverse primer of Psi gene, a forward primer and a reverse primer aiming at host cell single copy gene, a probe for detecting Psi gene and a probe for detecting host cell single copy gene;
s2) synthesizing the Psi gene and the host cell single copy gene into a plasmid vector, transforming and picking a single clone to obtain a reference substance, detecting the reference mass concentration, and converting the reference mass concentration into copy number by a formula:
plasmid copy number (copies/. mu.l) ═ 6.02x10 14 X plasmid concentration (ng/μ l)/(plasmid base number x 660);
s3) carrying out gradient dilution on the reference substance to prepare a standard substance, carrying out qPCR reaction on the standard substance by using the reaction system in the step S1) under proper conditions, and drawing a standard curve according to Ct values of Psi genes and host cell single copy genes generated by each standard substance and corresponding copy number logarithmic values;
s4) carrying out qPCR reaction on a sample to be detected by using the reaction system of S1) under proper conditions, and detecting a reaction product to obtain CT values of the Psi gene and the host cell single copy gene;
s5) calculating the copy number of the Psi gene and the single copy gene of the host cell based on the standard curve of the step S2) and the CT value of the step S4), and calculating the copy number of the target gene/cell according to a formula:
copy number of gene of interest/cell 2 × Psi copy number (copies/. mu.l)/single copy gene factor (copies/. mu.l);
wherein the nucleotide sequence of the Psi gene is shown as SEQ ID NO. 1.
In another preferred embodiment, the single copy gene is the TERT gene.
In another preferred embodiment, the nucleotide sequences of the forward primer and the reverse primer for the Psi gene are shown as SEQ ID NO 3, 4; nucleotide sequences of a forward primer and a reverse primer aiming at the TERT gene are shown as SEQ ID NO. 6 and SEQ ID NO. 7.
In another preferred example, the probe for detecting the Psi gene is shown as SEQ ID NO. 5; the probe for detecting the TERT gene is shown as SEQ ID NO. 8.
In another preferred embodiment, the reaction system of step S1) further comprises one or more components selected from the group consisting of:
(a) a buffer or buffer component for PCR amplification;
(b) polymerase for PCR amplification.
In another preferred embodiment, the polymerase is selected from the group consisting of: taq enzyme, Pfu enzyme, Tth enzyme.
In a second aspect of the invention, there is provided a combination of reagents for detecting the copy number of a gene of interest in a host cell, the combination of reagents comprising a forward primer and a reverse primer for the Psi gene, a forward primer and a reverse primer for a single copy gene in the host cell.
In a preferred embodiment, the nucleotide sequence of the Psi gene is shown as SEQ ID NO. 1.
In a preferred embodiment, the host cell is a eukaryotic cell.
In another preferred embodiment, the host cell is a mammalian cell.
In another preferred embodiment, the host cell is selected from the group consisting of host cells from: rat, mouse, dog, rabbit, cat, cow, horse, monkey, human.
In another preferred embodiment, the host cell is a human cell.
In another preferred embodiment, the single copy gene is selected from the group consisting of: FrIL-2, telomerase reverse transcriptase TERT, beta-ACTIN, beta-globin, RPPH1, GAPDH.
In another preferred embodiment, the single copy gene is the telomerase reverse transcriptase TERT gene.
In another preferred example, the nucleotide sequence of the telomerase reverse transcriptase TERT gene is shown in SEQ ID NO. 2.
In another preferred embodiment, the nucleotide sequences of the forward primer and the reverse primer for the Psi gene are shown as SEQ ID NO 3, 4; nucleotide sequences of a forward primer and a reverse primer aiming at the TERT gene are shown as SEQ ID NO. 6 and SEQ ID NO. 7.
In a preferred embodiment, the combination of reagents further comprises a probe for detecting the Psi gene and the single copy gene.
In a preferred embodiment, the probe for detecting the Psi gene is shown as SEQ ID NO. 5; the probe for detecting the TERT gene is shown as SEQ ID NO. 8.
In a third aspect of the present invention there is provided a PCR reaction system characterised in that it comprises the combination of reagents according to the second aspect of the invention together with other reagents required to carry out a PCR reaction.
In another preferred embodiment, the other reagents required for performing the PCR reaction further comprise buffers or buffer components for PCR amplification.
In another preferred embodiment, the reaction system further comprises a polymerase for PCR amplification.
In a fourth aspect of the present invention, there is provided a kit comprising a combination of a container and a reagent according to the second aspect of the present invention or a PCR reaction system according to the third aspect of the present invention.
In a fifth aspect of the invention there is provided a qPCR method comprising the step of performing a qPCR reaction using a combination of reagents according to the second aspect of the invention or a PCR reaction system according to the third aspect of the invention.
It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be repeated herein, depending on the space.
Drawings
The following drawings are included to illustrate specific embodiments of the invention and are not intended to limit the scope of the invention as defined by the claims.
FIG. 1 shows an amplification curve of the Psi gene.
FIG. 2 shows a standard curve fitted to the amplification signal of the Psi gene.
FIG. 3 shows the amplification curve of the TERT gene.
FIG. 4 shows a standard curve fitted to the amplification signal of TERT gene.
Detailed Description
The present inventors have conducted extensive and intensive studies and have developed a universal method for analyzing and detecting the copy number of a target gene mediated by a lentiviral vector for the first time. The method can be used for simultaneously detecting the Psi gene and the single copy gene of the host cell, not only improves the accuracy of the detection result, but also has wide universality, can be used for detecting different target genes by using the same reaction system, greatly shortens the time of research and development, and is suitable for all HIV-I slow virus vector systems from the first generation to the third generation at present. On the basis of this, the present invention has been completed.
Term(s) for
As used herein, the terms "Psi gene" and "packaging sequence Psi", "lentiviral transfer packaging signal sequence Psi" are used interchangeably and refer to the packaging sequence Psi on the gene transfer plasmid of interest in a lentiviral vector system.
In a specific embodiment, the nucleotide sequence of the Psi gene is shown as SEQ ID NO: 1.
Single copy gene
The single copy genes described herein have the meaning conventionally understood by those skilled in the art. That is, the number of copies in the genome is small, and only 1 or 2, preferably 1, genes are present. In the genome of eukaryotic cells, such as the human body, 60% of the sequence is composed of single copy genes, most of which are housekeeping genes that are constitutively expressed in the organism. Many genes for structural proteins, such as albumin, globin, are single copy. The sequences of the other 40% of the genome are repetitive sequences.
In particular embodiments, single copy genes useful in the present invention include, but are not limited to: TERT gene, beta-ACTIN, beta-globin, RPPH1, GAPDH. In a preferred embodiment, single copy genes for use in the present invention include, but are not limited to: the TERT gene. In a specific embodiment, the TERT gene is set forth in SEQ ID NO 2.
Host cell
The host cells described herein have meanings that are conventionally understood by those skilled in the art. The host cell described herein may be any host cell as long as the host cell is capable of introducing an exogenous gene.
In a specific embodiment, the host cell used in the present invention is a eukaryotic cell. In a preferred embodiment, the host cell used in the present invention is a mammalian cell. In a further preferred embodiment, the host cell used in the present invention is a host cell of mouse, rat, rabbit, horse, dog, cat, cow, monkey, human origin; more preferably a host cell of human origin.
Lentiviral vectors
The lentiviral vectors described herein have meanings that are conventionally understood by those skilled in the art. It refers to a viral vector derived from human immunodeficiency virus-1 (HIV-1). Under the assistance of lentivirus packaging plasmid and cell line, the lentivirus vector carrying exogenous gene is virus packaged into virus particle with infectivity, and the exogenous gene is expressed in cell or living tissue through infecting cell or living tissue.
The lentivirus vector can effectively integrate exogenous genes or exogenous shRNA into a host chromosome, thereby achieving the effect of persistently expressing a target sequence. Can effectively infect various cells such as neuron cells, liver cells, cardiac muscle cells, tumor cells, endothelial cells, stem cells and the like in the aspect of infection capacity, thereby achieving good gene therapy effect. For some cells which are difficult to transfect, such as primary cells, stem cells, undifferentiated cells and the like, the lentiviral vector is used, so that the transduction efficiency of the target gene or the target shRNA can be greatly improved, the probability of integrating the target gene or the target shRNA into the host cell genome is greatly increased, and the long-term and stable expression of the target gene or the target shRNA can be conveniently and quickly realized.
In a specific embodiment, the lentiviral vector described herein is a first to third generation HIV-1 lentiviral vector system. The constitution of the first to third generation HIV-1 lentiviral vector systems are well known to those skilled in the art, and are also commercially available, for example from Invitrogen, takara, etc.
Detection method
The invention provides a universal method for detecting the copy number/cell of a target gene of a lentiviral vector. Specifically, the method comprises the following steps:
s1) providing a sample to be detected and a designed PCR reaction system, wherein the reaction system comprises a forward primer and a reverse primer of Psi gene, a forward primer and a reverse primer aiming at host cell single copy gene, a probe for detecting Psi gene and a probe for detecting host cell single copy gene;
s2) synthesizing the Psi gene and the host cell single copy gene into a plasmid vector, transforming and picking a single clone to obtain a reference substance, detecting the reference mass concentration, and converting the reference mass concentration into copy number by a formula:
plasmid copy number (copies/. mu.l) ═ 6.02x10 14 X plasmid concentration (ng/μ l)/(plasmid base number x 660);
s3) carrying out gradient dilution on the reference substance to prepare a standard substance, carrying out qPCR reaction on the standard substance by using the reaction system in the step S1) under proper conditions, and drawing a standard curve according to Ct values of Psi genes and host cell single copy genes generated by each standard substance and corresponding copy number logarithmic values;
s4) carrying out qPCR reaction on a sample to be detected by using the reaction system of S1) under proper conditions, and detecting a reaction product to obtain CT values of the Psi gene and the host cell single copy gene;
s5) calculating the copy number of the Psi gene and the single copy gene of the host cell based on the standard curve of the step S2) and the CT value of the step S4), and calculating the copy number of the target gene/cell according to a formula:
copy number of gene of interest/cell 2 × Psi copy number (copies/. mu.l)/single copy gene factor (copies/. mu.l);
wherein the nucleotide sequence of the Psi gene is shown as SEQ ID NO. 1.
Primer and method for producing the same
The terms "primer" and "specific primer" as used herein have the meaning conventionally understood by those skilled in the art. The primers provided by the invention are not designed aiming at the target gene per se, but aiming at a lentivirus transfer packaging signal sequence Psi and a host cell single copy gene. In other words, the primers of the invention can specifically bind to the lentiviral transfer packaging signal sequence Psi and a single copy of a host cell gene, such as the TERT gene.
In view of the teachings of the present invention and the general knowledge in the art, those skilled in the art will appreciate that a variety of primer pairs can be designed for the Psi gene and the host cell single copy gene. Therefore, the primer set of the present invention is not limited to the primer set specifically obtained in the examples.
In a preferred embodiment, the primers are designed for the segment of the Psi gene shown in SEQ ID NO.1 and the segment of the human cell TERT gene shown in SEQ ID NO. 2.
In the most preferred embodiment, the nucleotide sequence of the primer pair 1 is shown as SEQ ID NO 3 and 4; the nucleotide sequence of the primer pair 2 is shown as SEQ ID NO 6 and 7.
Probe needle
The term "probe" as used herein has the meaning conventionally understood by those skilled in the art, i.e., a short piece of single-stranded DNA or RNA fragment for detecting a nucleic acid sequence complementary thereto.
In view of the teachings of the present invention and the general knowledge in the art, those skilled in the art will understand that, knowing the primer pair, one can design a probe autonomously based on the template sequence between the forward primer and the reverse primer binding site and test the technical effect of the probe and primer pair. In specific embodiments, one of ordinary skill in the art can design the probe specifically as desired, and the probe can be in a liquid phase or immobilized on a solid phase; the binding may be performed before amplification or after amplification. Therefore, the probe of the present invention is not limited to the probe specifically disclosed in the examples. The primer set of the present invention is not limited to the use of the probe set specifically disclosed in the examples.
In a specific embodiment, the probes of the invention include a Psi gene specific probe, the sequence of which is shown in SEQ ID NO. 5, and a TERT gene specific probe, the sequence of which is shown in SEQ ID NO. 8.
Reaction system
The invention also provides a reaction system for detecting the Psi gene and the TERT gene, wherein the reaction system comprises the primers, the probes and other components required by PCR, such as Taq enzyme, dNTP, Mg 2+ And so on.
In a specific embodiment, the detection reagent of the present invention comprises primer set 1 shown in SEQ ID NO. 3 and 4, probe set 1 shown in SEQ ID NO. 5, primer set 2 shown in SEQ ID NO. 6 and 7, and probe set 2 shown in SEQ ID NO. 8.
On the basis of the detection method, the invention also provides a PCR kit, and the kit comprises a container and the primer pair of the invention positioned in the container.
In a specific embodiment, the PCR kit of the present invention further comprises other components necessary for performing PCR and instructions for using the kit for PCR detection.
The main advantages of the invention include:
the invention provides a universal method for detecting the copy number of a target gene of a lentiviral vector. The method realizes the aim of detecting the copy number of a target gene by detecting the copy number of a packaging sequence Psi and a host cell single copy gene. The invention has the following advantages:
1) the detection method has the advantages that the Psi gene and the host cell single copy gene are simultaneously detected by a double qPCR method, and the accuracy of the detection result is improved.
2) Has wide universality, avoids the trouble of designing corresponding primers and probes aiming at different target genes, greatly shortens the time of research and development, and is suitable for all HIV-I slow virus vector systems from the first generation to the third generation at present.
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.
Example 1
Preparation of reference for gene copy number quantification
Synthesizing a lentivirus transfer packaging signal sequence Psi and a partial sequence of a human cell single copy gene TERT into a plasmid vector pMD19-T, transforming, selecting a single clone, sequencing and identifying to obtain a reference substance.
Wherein the selected packaging signal sequence Psi is 126bp in total, and the sequence numbered SEQ ID No.1 is as follows:
5’-ctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtc-3’。
wherein the TERT part is 710bp in total, and the SEQ ID No.2 has the following sequence:
5’-ctccagcgtcactgggctgcctgtctgctcgccccggtggaggggtgtctgtcccttcactgaggcccagacgcagctgagtcggaagctcccggggacgacgctgactgccctggaggccgcagccaacccggcactgccctcagacttcaagaccatcctggactgatggccacccgcccacagccaggccgagagcagacaccagcagccctgtcacgccgggctctacgtcccagggagggaggggcggcccacacccaggcccgcaccgctgggagtctgaggcctgagtgagtgtttggccgaggcctgcatgtccggctgaaggctgagtgtccggctgaggcctgagcgagtgtccagccaagggctgagtgtccagcacacctgccgtcttcacttccccacaggctggcgctcggctccaccccagggccagcttttcctcaccaggagcccggcttccactccccacataggaatagtccatccccagattcgccattgttcacccctcgccctgccctcctttgccttccacccccaccatccaggtggagaccctgagaaggaccctgggagctctgggaatttggagtgaccaaaggtgtgccctgtacacaggcgaggaccctgcacctggatgggggtccctgtgggtcaaattggggggaggtgctgtgggagtaaaatactgaatatatgag-3’。
copy number assignment method of gene copy number quantitative reference substance
Measuring absorbance value at 260nm by ultraviolet spectrophotometry, calculating to obtain mass concentration of reference substance, diluting to 1.2ng/μ l, and converting into copy number by formula to obtain concentration of 3.10 × 10 8 copies/. mu.l. Wherein the synthetic plasmid size of the quantitative reference substance is 3528 bp.
The formula: plasmid copy number (copies/. mu.l) ═ 6.02x10 14 Plasmid concentration (ng/. mu.l)/(number of plasmid bases x 660)
Dual qPCR architecture
Primers and probes are respectively designed aiming at the packaging sequence Psi and the TERT gene, and the primers and the probes which have no mutual interference and the detection sensitivity and the specificity can meet the expected requirements are selected. The primer and probe sequences are shown in Table 1. The optimal working concentrations and preparation methods of the primers and probe reaction solutions are shown in Table 2. The single well reaction solution formulation for qPCR MIX is shown in table 3.
TABLE 1
| Name (R) | Sequence of |
| SEQ ID No.3 | 5’-GACGCAGGACTCGGCTTG-3’ |
| SEQ ID No.4 | 5’-GACGCTCTCGCACCCATC-3’ |
| SEQ ID No.5 | FAM 5’-TCACCAGTCGCCGCCCCT-3’TAMRA |
| SEQ ID No.6 | 5’-AATAGTCCATCCCCAGATTCGC-3’ |
| SEQ ID No.7 | 5’-AGAGCTCCCAGGGTCCTT-3’ |
| SEQ ID No.8 | CY5 5’-CTCGCCCTGCCCTCCTTTGCCTT-3’BHQ3 |
TABLE 2
TABLE 3
| Composition of | Single hole reaction |
| qPCR Reaction Buffer | 15.9μl |
| Primer&Probe MIX | 2.8μl |
| Sterilized water | 1.3μl |
| Total volume | 20μl |
qPCR Reaction Buffer: primer & Probe MIX contains Taq enzyme, dNTP, Mg2+, the Primer and the Probe of the present invention.
Preparation of Standard Curve
Using DNA diluent or sterilized water to perform 10-fold gradient dilution on the gene copy number quantitative reference substance, and specifically operating as follows:
firstly, a quantitative reference substance and a DNA diluent are placed on ice to be melted, and after the quantitative reference substance and the DNA diluent are completely melted, the quantitative reference substance and the DNA diluent are slightly shaken and uniformly mixed, and are quickly centrifuged for 10s in a short time.
② 6 clean 1.5ml centrifuge tubes marked as ST0, ST1, ST2, ST3, ST4 and ST5 respectively.
③ diluting the quantitative reference substance by 10 times with DNA diluent in ST0 tube to obtain ST0, shaking and mixing uniformly, and then centrifuging rapidly for 10 s.
Separately, 90. mu.l of a DNA diluent was added to tubes ST1, ST2, ST3, ST4, ST5 and ST 6.
The dilution was performed 5 times in sequence as in Table 4.
TABLE 4
The PCR system consisted of 30. mu.l, with 10. mu.l of the marker or sample and 20. mu.l of qPCR MIX.
Setting a two-step reaction program: pre-denaturation at 95 ℃ for 10 min; at 95 ℃ for 15s, at 60 ℃ for 1min, for 40 cycles; the reaction volume was 30. mu.l.
As a result: the Psi amplification curve is shown in FIG. 1. A standard curve to which the Psi gene amplification signal was fitted is shown in FIG. 2. The amplification curve for the TERT gene is shown in FIG. 3. The standard curve to which the TERT gene amplification signal was fitted is shown in FIG. 4.
The linearity and amplification efficiency of the method are shown in Table 5. At 3.10x10 6 -3.10x10 2 Good linearity within range, R 2 >0.99, the amplification efficiency is 110%>E％>90% of the requirements.
TABLE 5
Tolerance analysis
The specificity and tolerance of the method of the invention are verified by adding host cell genomic DNA with different concentrations into a PCR reaction system.
As a result: tolerance results as shown in table 6, the method can tolerate 30ng of human genomic DNA.
TABLE 6
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Huzhou Zhongke Nutrition and health Innovation center; huzhou Shenke Biotechnology Ltd
<120> method for analyzing and detecting the copy number of a lentivirus vector-mediated target gene
<130> P2021-1077
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 126
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ctctctcgac gcaggactcg gcttgctgaa gcgcgcacgg caagaggcga ggggcggcga 60
ctggtgagta cgccaaaaat tttgactagc ggaggctaga aggagagaga tgggtgcgag 120
agcgtc 126
<210> 2
<211> 710
<212> DNA
<213> Intelligent (Homo sapiens)
<400> 2
ctccagcgtc actgggctgc ctgtctgctc gccccggtgg aggggtgtct gtcccttcac 60
tgaggcccag acgcagctga gtcggaagct cccggggacg acgctgactg ccctggaggc 120
cgcagccaac ccggcactgc cctcagactt caagaccatc ctggactgat ggccacccgc 180
ccacagccag gccgagagca gacaccagca gccctgtcac gccgggctct acgtcccagg 240
gagggagggg cggcccacac ccaggcccgc accgctggga gtctgaggcc tgagtgagtg 300
tttggccgag gcctgcatgt ccggctgaag gctgagtgtc cggctgaggc ctgagcgagt 360
gtccagccaa gggctgagtg tccagcacac ctgccgtctt cacttcccca caggctggcg 420
ctcggctcca ccccagggcc agcttttcct caccaggagc ccggcttcca ctccccacat 480
aggaatagtc catccccaga ttcgccattg ttcacccctc gccctgccct cctttgcctt 540
ccacccccac catccaggtg gagaccctga gaaggaccct gggagctctg ggaatttgga 600
gtgaccaaag gtgtgccctg tacacaggcg aggaccctgc acctggatgg gggtccctgt 660
gggtcaaatt ggggggaggt gctgtgggag taaaatactg aatatatgag 710
<210> 3
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gacgctctcg cacccatc 18
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
aatagtccat ccccagattc gc 22
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
<210> 8
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ctcgccctgc cctcctttgc ctt 23
Claims (10)
1. A method for detecting the copy number of a gene of interest in a host cell, said gene of interest being introduced by a lentiviral vector, said method comprising the steps of:
1) detecting the copy number of the Psi gene in the cell;
2) detecting the copy number of a single copy gene in a cell;
3) the copy number of the gene of interest in the cell is calculated according to the following formula:
copy number of the gene of interest/cell 2 × Psi copy number/single copy gene.
2. The method of claim 1, wherein the nucleotide sequence of the Psi gene is as set forth in SEQ ID NO 1.
3. The method of claim 1, wherein the single copy gene is selected from the group consisting of: GAPDH, TERT, beta-ACTIN, beta-globin, RPPH 1.
4. The method of claim 3, wherein the single copy gene is the telomerase reverse transcriptase TERT gene having the nucleotide sequence set forth in SEQ ID No. 2.
5. The method of any one of claims 1 to 4, wherein the lentiviral vector is any one of a first to third generation HIV-I lentiviral vector system.
6. A combination of reagents for detecting the copy number of a gene of interest in a host cell, said combination of reagents comprising a forward primer and a reverse primer for the Psi gene, a forward primer and a reverse primer for a single copy gene in said host cell.
7. The combination of agents of claim 6, wherein the single copy gene is selected from the group consisting of: FrIL-2, telomerase reverse transcriptase TERT, beta-ACTIN, beta-globin, RPPH1, GAPDH.
8. A PCR reaction system comprising a combination of reagents according to claim 6 or 7 and further reagents required to carry out a PCR reaction.
9. A kit comprising a combination of a container and a reagent according to claim 6 or 7 or a PCR reaction system according to claim 8.
10. A qPCR method comprising the step of performing a qPCR reaction using the combination of reagents according to claim 6 or 7 or the PCR reaction system according to claim 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111300619.0A CN114958983B (en) | 2021-11-04 | 2021-11-04 | Method for analyzing and detecting copy number of target gene mediated by lentivirus vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111300619.0A CN114958983B (en) | 2021-11-04 | 2021-11-04 | Method for analyzing and detecting copy number of target gene mediated by lentivirus vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114958983A true CN114958983A (en) | 2022-08-30 |
| CN114958983B CN114958983B (en) | 2023-03-24 |
Family
ID=82974969
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111300619.0A Active CN114958983B (en) | 2021-11-04 | 2021-11-04 | Method for analyzing and detecting copy number of target gene mediated by lentivirus vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114958983B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500690A (en) * | 2020-04-15 | 2020-08-07 | 深圳科诺医学检验实验室 | Method for detecting copy number of virus vector in CAR-T cell genome |
| CN111918972A (en) * | 2018-01-31 | 2020-11-10 | 朱诺治疗学股份有限公司 | Methods and reagents for assessing the presence or absence of replication competent viruses |
| WO2021180665A1 (en) * | 2020-03-09 | 2021-09-16 | Janssen Pharmaceutica Nv | Compositions and methods for quantifying integration of recombinant vector nucleic acid |
-
2021
- 2021-11-04 CN CN202111300619.0A patent/CN114958983B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111918972A (en) * | 2018-01-31 | 2020-11-10 | 朱诺治疗学股份有限公司 | Methods and reagents for assessing the presence or absence of replication competent viruses |
| US20210164062A1 (en) * | 2018-01-31 | 2021-06-03 | Juno Therapeutics, Inc. | Methods and reagents for assessing the presence or absence of replication competent virus |
| WO2021180665A1 (en) * | 2020-03-09 | 2021-09-16 | Janssen Pharmaceutica Nv | Compositions and methods for quantifying integration of recombinant vector nucleic acid |
| US20210332448A1 (en) * | 2020-03-09 | 2021-10-28 | Janssen Pharmaceutica Nv | Compositions and methods for quantifying integration of recombinant vector nucleic acid |
| CN111500690A (en) * | 2020-04-15 | 2020-08-07 | 深圳科诺医学检验实验室 | Method for detecting copy number of virus vector in CAR-T cell genome |
Non-Patent Citations (2)
| Title |
|---|
| T.WILTSHIRE等: "Detection of lentiviral constructs for release testing of CAR- T cells using digital droplet PCR", 《CYTOTHERAPY》 * |
| 何宗顺等: "水稻穗大小决定基因PSI的遗传分析及克隆", 《分子植物育种》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114958983B (en) | 2023-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105018646B (en) | A kind of primer, probe and the kit of detection bovine epizootic fever virus | |
| Perez et al. | PCR-based detection of gene transfer vectors: application to gene doping surveillance | |
| CN114958983B (en) | Method for analyzing and detecting copy number of target gene mediated by lentivirus vector | |
| CN110241264B (en) | Quantitative detection kit for Hepatitis B Virus (HBV) DNA | |
| CN112795699A (en) | Universal primer, probe and detection method for detecting different subtypes of HIV-1 virus by RT-RAA fluorescence method | |
| JP4388061B2 (en) | Nucleic acid primer set for LAMP amplification for detecting hepatitis E virus | |
| CN111961718A (en) | Clopidogrel medication gene detection kit and use method thereof | |
| JP2023552693A (en) | System for detecting target gene mutations and viral genomes, and methods for producing and using the same | |
| RU2689718C1 (en) | Method for detecting genome of rotavirus infection agent in farm animals | |
| CN113293202A (en) | Real-time fluorescent quantitative PCR kit for quantitatively detecting mRNA content in organism, detection method and application | |
| CN111206117A (en) | Kit for detecting human immunodeficiency virus | |
| Timmer et al. | The polymerase chain reaction | |
| JP6853523B2 (en) | PCR using helicase | |
| CN111378730A (en) | Multiple reverse transcription polymerase chain reaction detection reagent buffer solution and application thereof | |
| CN111593138A (en) | Duck hepatitis B virus recombinant polymerase isothermal amplification detection method | |
| CN111172319A (en) | Primer pair for detecting porcine epidemic diarrhea virus, kit and application thereof | |
| Tung et al. | Rapid screening of roundup ready soybean in food samples by a hand-held PCR device | |
| CN113444841B (en) | Fox retrovirus SYBR Green I fluorescent RT-PCR kit and use method thereof | |
| CN112322782B (en) | Primer group, kit and method for quickly detecting KSHV through polymerase helix reaction | |
| CN108753990B (en) | Whole-genome microsatellite marker of Charybdis feriatus, screening method and application | |
| RU2814548C1 (en) | Test system for detecting dna of causative agent of mannheimiosis (mannheimia haemolytica) in biological material of animals and fodders using real-time polymerase chain reaction | |
| KR102291584B1 (en) | Molecular diagnosis method for disease diagnosis of companion animals and livestock | |
| WO2007088506A2 (en) | Kit for the amplification of nucleic acids | |
| KR101680706B1 (en) | Primer set and/or probe specific for Schmallenberg virus, Akabane virus and Aino virus, and use thereof | |
| Gorna et al. | DEVELOPMENT AND EVALUATION OF A MULTIPLEX CONVENTIONAL RT-PCR FOR SIMULTANEOUS DETECTION AND TYPING OF FMDV IN WEST AFRICA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 1007-1, Floor 10, Building 3, No. 1366, Hongfeng Road, Huzhou City, Zhejiang Province, 313001 (independent application) Applicant after: Huzhou Shenke Biotechnology Co.,Ltd. Address before: 313000 1007-1, floor 10, building 3, No. 1366, Hongfeng Road, Huzhou City, Zhejiang Province Applicant before: HUZHOU SHENKE BIOLOGICAL TECHNOLOGY Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |