CN114940975B - TED-deleted cell line and application thereof - Google Patents

TED-deleted cell line and application thereof Download PDF

Info

Publication number
CN114940975B
CN114940975B CN202210699814.3A CN202210699814A CN114940975B CN 114940975 B CN114940975 B CN 114940975B CN 202210699814 A CN202210699814 A CN 202210699814A CN 114940975 B CN114940975 B CN 114940975B
Authority
CN
China
Prior art keywords
ted
cells
gene
cell line
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210699814.3A
Other languages
Chinese (zh)
Other versions
CN114940975A (en
Inventor
王晓礽
贾雪
何昆仑
王琛
赵诚辉
杨晶
吴珏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chinese PLA General Hospital
Original Assignee
Chinese PLA General Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chinese PLA General Hospital filed Critical Chinese PLA General Hospital
Priority to CN202210699814.3A priority Critical patent/CN114940975B/en
Publication of CN114940975A publication Critical patent/CN114940975A/en
Application granted granted Critical
Publication of CN114940975B publication Critical patent/CN114940975B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0684—Cells of the urinary tract or kidneys
    • C12N5/0686—Kidney cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/15—Humanized animals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0356—Animal model for processes and diseases of the central nervous system, e.g. stress, learning, schizophrenia, pain, epilepsy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Environmental Sciences (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a TED-deleted cell line and application thereof. In particular, the TED-deleted cell line has the following properties: an anti-hypoxic environment and/or a neuropsychiatric related disease inhibiting effect in an hypoxic environment.

Description

TED-deleted cell line and application thereof
Technical Field
The invention belongs to the field of biological medicine, and particularly relates to a TED-deleted cell line and application thereof.
Background
When the plain crowd enters low-oxygen environments such as high altitude, deep sea and the like, the oxygen deficiency reaction which possibly endangers life such as headache, dizziness, hypodynamia, poor sleep, acute cerebral edema, pulmonary edema and the like can be caused, and the animals living on the high altitude and the high altitude, deep sea for a long time usually endure the oxygen deficiency without oxygen deficiency injury reaction.
The research on the hypoxia-tolerant molecular mechanism is very important for the selection of special occupational population, and the prevention and treatment of hypoxia injury response. The selection of special professional people such as soldiers, athletes and the like is not only concerned about the hypoxia tolerance phenotype, but also concerned about the physical phenotype of the soldiers, athletes and the like in the hypoxia environment, environmental factors and physical factors often influence each other in a screening mechanism, and the molecular marker screening is inaccurate. To explore the molecular mechanism of hypoxia tolerance and to improve the screening accuracy of conversion of core molecular markers to physical phenotypes in hypoxic environments, it is desirable to develop a stable cell line that is itself hypoxia tolerant.
In order to obtain the hypoxia tolerant cell strain, cells can be separated from the hypoxia tolerant organism, but the separation of the cells from the hypoxia tolerant organism not only involves ethical problems, but also has long time consumption, complicated operation, easy pollution, short culture algebra and no contribution to long-term molecular mechanism research.
293T cells are derived from human embryonic kidney cells, are easy to culture and high in transfection efficiency, are cells which are commonly used for researching a disease molecular mechanism, and do not relate to ethical problems. However, 293T cells are not tolerant to hypoxia and are easy to die under hypoxia conditions, which is not beneficial to research on hypoxia tolerance mechanism under long-term hypoxia conditions. There is no stable construction of hypoxia-tolerant 293T cell lines.
The Tibetan enrichment gene deletion (Tibetan-enriched deletion, TED) sequence is a non-coding sequence that is located on human chromosome 2.
CRISPR/Cas gene editing technology is an emerging genetic engineering technology, which is a DNA cleavage technology mediated by guide RNAs, an editing system that has been developed for Cas differences. Genome editing can accurately and directionally modify genome. The CRISPR/Cas editing technique can achieve at least the following 4 precise edits: the first is site-directed knockout of the gene, and Cas protein recognizes and cleaves the target under the direction of guide RNA (gRNA), creating a double-stranded DNA break; the fragmented DNA is usually repaired with non-homologous end joining (NHEJ); frame shift mutations are readily generated during repair to disrupt this gene. The second is to make homologous substitutions to the target to replace the target sequence or site-directed insertion. In the generation of double-stranded DNA breaks, homologous substitution or site-directed insertion may occur if a homologous repair template is present nearby. Homologous substitution is less efficient and becomes lower as the length of the sequence to be substituted increases. The third is single base editing, which is a gene editing method that uses the CRISPR/Cas system to target deaminase to a specific site in the genome to modify a specific base. Fourth is a genome-directed editing technique. The guide editing is an editing method in which reverse transcriptase is combined with Cas9 nickase, and point mutation, insertion or deletion mutation is performed according to a transcription template under the guidance of single-stranded guide RNA.
Disclosure of Invention
According to the invention, a CRISPR/Cas9 technology is utilized to stably delete a non-coding gene TED (Tibetan enrichment deletion sequence, tibetan enriched deletion, TED) sequence in a cell gene, so as to obtain a stable transgenic cell strain with hypoxia tolerance. The cell strain can survive under the anoxic condition, has the advantages of easy culture and high transfection efficiency, can be used for researching an anoxic-resistant molecular mechanism for a long time, and has a good application prospect in the aspect of hypoxia environment simulation research; the screening accuracy of the conversion of the core molecular marker into the physical performance phenotype in the anoxic environment is further improved.
In order to achieve the technical purpose, the invention provides the following technical scheme:
in a first aspect, the invention provides the use of a TED gene in the construction of a cell line or animal model that is resistant to and/or exhibits neuropsychiatric related disease inhibiting effects in an anoxic environment.
Preferably, the use is specifically to make a TED gene knockout cell line by knocking out the TED gene construction cell line so that the TED gene knockout cell line exhibits hypoxia-tolerant characteristics.
Preferably, the knockout refers to a full length deletion of the TED gene; more specifically, the cell line or animal model has at least one chromosome deletion as set forth in any of SEQ ID NOs.1-3.
Preferably, the TED-deleted homozygous or heterozygous cell line grows normally in an anaerobic environment, as demonstrated by the specific embodiments of the invention.
Preferably, the anoxic environment comprises an oxygen content of less than 5%, 4%, 3%, 2%, 1%.
More specifically, the anoxic environment comprises an oxygen content of 1%; more specifically, as applied in the examples, the culture atmosphere consisted of 1% oxygen, 5% carbon dioxide, 94% nitrogen.
The TED is 'Tibetan enrichment gene deletion (Tibetan-enriched deletion, TED)', the TED sequence is a gene sequence at 46,694,276-46,697,683 on human chromosome 2, and the TED is a non-coding sequence.
The term "wild type" refers to a nucleic acid molecule that may be found in nature, including DNA or RNA, whose nucleotide sequence may be obtained by genetic engineering techniques such as genomic sequencing, polymerase Chain Reaction (PCR), and the like. Preferably, the sequence of the TED wild-type according to the invention is shown in SEQ ID NO. 4.
In another aspect, the invention provides a TED deleted cell line in which at least one chromosome of the cell line lacks a fragment as set forth in any of SEQ ID NOs.1-3.
Preferably, the cell line is heterozygous or homozygous.
As used herein, the term "heterozygote" refers to a homologous chromosome in which the two alleles at the same locus are not identical genotypes, i.e., there are two genotypes of TED in the cell line of the invention.
More specifically, in the TED-deleted cell line:
1) One chromosome lacks the nucleic acid sequence shown in SEQ ID NO. 1, and the other chromosome lacks the nucleic acid sequence shown in SEQ ID NO. 2;
2) One chromosome lacks the nucleic acid sequence shown as SEQ ID NO. 3, and the other chromosome is wild type, and the wild type comprises a TED gene wild type.
Preferably, the TED-deleted cell line has the following properties: an anti-hypoxic environment and/or a neuropsychiatric related disease inhibiting effect in an hypoxic environment.
In another aspect, the invention provides a method of making a cell or animal model that is resistant to and/or exhibits neuropsychiatric related disease inhibiting effects in an hypoxic environment, the method comprising specific gene editing of a TED of a cell or animal using Cas9 protein and a gRNA having the sequence set forth in SEQ ID No.:5 and/or SEQ ID No.: 6.
Preferably, the anoxic environment comprises an oxygen content of less than 5%, 4%, 3%, 2%, 1%.
More specifically, the anoxic environment comprises an oxygen content of 1%; more specifically, as applied in the examples, the culture atmosphere consisted of 1% oxygen, 5% carbon dioxide, 94% nitrogen.
Preferably, the gene editing of the present invention is CRISPR technology.
The gene editing tools in the CRISPR technology include guide RNAs (grnas), cas proteins (e.g., cas9, cpf1, cas12b, etc.), which can recognize and cleave target DNA under the guidance of the guide RNAs. Preferably, the target DNA of the invention is TED.
As is well known in the art, transformation of Cas protein or its coding sequence, guide RNA or its coding sequence into a cell can effect editing of the intracellular genome, the types of editing including gene knockout.
Preferably, the method comprises transferring into the cell any one of the following components:
1) Cas9 protein and gRNA;
2) Coding sequences for Cas9 gene and gRNA.
Preferably, the coding sequence is constructed in a suitable vector.
Preferably, the vector is an expression vector.
The term expression vector is an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any element that ensures self-replication. Alternatively, the vector may be one that is integrated into the genome when introduced into the host cell and replicated together with the chromosome(s) into which it has been integrated.
Preferably, the expression vector may further comprise a promoter and a transcription termination sequence operably linked.
In some embodiments, the vectors of the invention comprise regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal Ribosome Entry Sites (IRES) and other expression control elements (e.g., transcription termination signals, or polyadenylation signals, and poly U sequences, etc.).
That is, preferably, the coding sequences for the Cas9 gene and gRNA are constructed on a vector.
The term "coding" refers to the inherent properties of a particular nucleotide sequence in a polynucleotide, such as a gene (DNA), cDNA or mRNA, as a template for the synthesis of other polymers and macromolecules in biological processes having defined nucleotide sequences (i.e., rRNA, tRNA and mRNA) or defined amino acid sequences and the biological properties that they produce.
Preferably, the method of transferring comprises: agrobacterium transformation, gene gun, microinjection, electric shock, ultrasound, and polyethylene glycol (PEG) mediated methods.
Preferably, the present invention uses a shock method (electroporation) in a specific embodiment.
The term "vector" is intended to encompass an element that allows the vector to integrate into the host cell genome or to replicate autonomously in the cell independent of the genome. The vector may contain any element that ensures self-replication. It typically carries a gene that is not part of the central metabolism of the cell and is typically in the form of double stranded DNA. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. If a vector is used, the choice of vector will depend on methods for transforming host cells that are well known to those skilled in the art. For example, a plasmid vector may be used.
Vectors suitable for use in the present invention include plasmids available from commercial sources such as, but not limited to: pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, uppsala, sweden), GEM1 (PromegaBiotec, madison, WI, USA), pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174pBluescript IIKS, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, pSVL (Pharmacia), pOG44, etc.
Preferably, the cell is an animal cell, such as those derived from humans, gorillas, monkeys, horses, cattle, sheep, pigs, donkeys, camels, dogs, rabbits, cats, rats, mice, fish, birds, or insects as is well known in the art.
Preferably, the animal is a mammal, such as a human, gorilla, monkey, horse, cow, sheep, pig, donkey, camel, dog, rabbit, cat, rat, mouse, fish, bird or insect as is well known in the art.
More specifically, the cell is a human cell, an ex vivo human cell.
Preferably, the cells of the invention do not include embryonic cells.
More preferably, the cell is a commercially available human cell line.
Preferably, the human cell line comprises 293 cells, 293T cells, 293FT cells, 293LTV cells, 293EBNA cells and other clones isolated from 293 cells; SW480 cells, u87MG cells, HOS cells, C8166 cells, MT-4 cells, molt-4 cells, heLa cells, HT1080 cells, TE671 cells.
Most preferably, the human cell line is a 293T cell or a derived cell line thereof.
The 293T cell is a human embryo kidney cell strain, is a cell line commonly used in biomedical technology, is less tolerant to anoxic environments, and limits the application of the cell in the anoxic environments such as simulated plateau, high altitude, deep sea and the like.
Preferably, the method produces a cell line that is the aforementioned TED deletion; the genotype of TED in the cell line is selected from any one or two of a first TED mutant, a second TED mutant, a third TED mutant or a TED wild type. More specifically, the cell line has the following characteristics: an anti-hypoxic environment and/or a neuropsychiatric related disease inhibiting effect in an hypoxic environment.
In another aspect, the invention provides the use of the aforementioned TED-deleted cell lines in the study of hypoxia-tolerant molecular mechanisms.
In another aspect, the invention provides a TED-specific gene editing system, kit, or composition comprising a Cas9 protein and a gRNA; the sequence of the gRNA is shown as SEQ ID NO. 5 or SEQ ID NO. 6.
The Cas9 protein of the present invention may also be replaced with other Cas proteins (e.g., cas9, cpf1, cas12b, naturally occurring proteins with Cas 9-like activity, or recombinant proteins). Cas proteins recognize TED and undergo gene editing under the guidance of guide RNAs (gRNA, sgRNA), resulting in partial deletion of TED genes.
In another aspect, the invention provides the use of a TED-specific gene editing reagent, a system as described above, a kit or a composition for the preparation of a product that exhibits neuropsychiatric related disease inhibiting effects in an hypoxia-tolerant environment.
In another aspect, the invention also provides a method for screening hypoxia tolerance markers using the cells provided by the invention.
Drawings
FIG. 1 shows the results of gene sequencing of the TED mutant.
FIG. 2 shows the growth state of the TED mutant homozygote cells.
FIG. 3 shows the growth state of the TED mutant heterozygote cells.
FIG. 4 shows the cell damage of TED mutant cells in hypoxic environment.
FIG. 5 shows the results of analysis of signal pathways in TED mutant cells.
Detailed Description
The present invention is further described in terms of the following examples, which are given by way of illustration only, and not by way of limitation, of the present invention, and any person skilled in the art may make any modifications to the equivalent examples using the teachings disclosed above. Any simple modification or equivalent variation of the following embodiments according to the technical substance of the present invention falls within the scope of the present invention.
Experimental materials used in the present invention
(1) 293T cells
(2) Culture medium: DMEM high sugar medium, 10% fbs
(3) Knocking out a primer:
gRNA-C2:GATAAAAGGTCTCGATATA-GGGG
gRNA-D1:AATACTGTGCTAGCTAACA-AGGG
(4) Sequencing primer:
upstream primer GACTCTTTAATGGCACCTACAGTG
Downstream primer GTGACCATGTAAATGATCTCACAGC
EXAMPLE 1 preparation of 293T cells mutated with TED Gene
The 293T cell doubling time, the clone formation rate and mycoplasma contamination were examined. The experimental result shows that the 293T cell line has normal doubling time and no pollution, and can be used for subsequent experiments.
Cells were transfected and Cas9 protein and PUC-gRNA plasmids were transfected into suspended 293T cells by electrotransfection. After electrotransformation, 2 96-well plates are laid, monoclonal is selected, TED gene fragments are amplified and sequenced by PCR, and 293T cell strains positive for TED gene knockout (large fragment deletion) are selected.
Sequencing results (sequencing results are shown in FIG. 1) show that a homozygous cell is obtained: the sequence of a deletion fragment on one chromosome is shown as SEQ ID NO. 1, the sequence of a deletion fragment on the other chromosome is shown as SEQ ID NO. 2, and the TED genes on both chromosomes are completely knocked out (the whole gene sequence of the TED genes is deleted), so that the homozygous cell is called homozygote (also called-/-type in subsequent experiments). The homozygote cells were expanded, and the growth state of the expanded and cultured cells under a microscope is shown in FIG. 2. The homozygote cells are normal in growth state and can be used for subsequent experiments.
A heterozygote cell (+/-type) was also obtained in which one chromosome was not edited (i.e., contained the sequence of all wild-type TEDs, the wild-type sequence of the TED gene was shown as SEQ ID NO: 4) and the sequence of the deleted fragment on the other chromosome was shown as SEQ ID NO:3, and the TED gene was completely knocked out. The heterozygous cells (+/-type) were expanded, and the growth state of the expanded cultured cells under a microscope was shown in FIG. 3. The growth state is normal, and can be used for subsequent experiments.
Example 2 hypoxia tolerance characteristics of TED Gene mutants
Lactate Dehydrogenase (LDH) is a living intracytoplasmic enzyme that releases LDH into the culture medium when cells are damaged and cell membrane permeability changes. The activity of the enzyme in the culture broth is thus proportional to the number of cell lines lysed.
293T cells (i.e., wild-type 293T cells as a control) that were not genetically edited and the TED gene mutants (+/-and-/-types obtained in example 1 were cultured under an anaerobic environment (1% oxygen, 5% carbon dioxide, 94% nitrogen). Cell lines in an anoxic environment were subjected to Lactate Dehydrogenase (LDH) detection using an LDH kit (Nanjing, cat# A020-2).
The detection results of LDH are shown in fig. 4: the TED gene mutant strains +/-type and-/-type obviously reduce cell damage after hypoxia, and indicate that the TED gene mutant strain has good hypoxia tolerance effect.
EXAMPLE 3 neuropsychiatric disease-inhibiting Effect of TED Gene mutant in anoxic Environment
The change in cell pathways in 293T cells not subjected to gene editing and the TED gene mutant strains (+/-type and-/-type obtained in example 1 were analyzed.
As a result of the analysis, as shown in fig. 5, the left signal pathway represents that it was inhibited, and the most obvious 3 pathways (GnRH encryption, long-term decompression and Glutamatergic synapse) were inhibited after 48 hours of hypoxia compared to the wild type, -/-type cells, whereas +/-type cells did not have this function.
The comparison of the results proves that the TED gene mutant strain-/-type shows the inhibition effect of the mental-related diseases in the anoxic environment.
Sequence listing
<110> general Hospital for liberation of Chinese people
<120> a TED-deleted cell line and use thereof
<141> 2022-06-20
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 4241
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gttagctagc acagtattaa gctttgtcag tagatagcac tggagagacg tcactggagg 60
aaggggcttc tcttcctggt tcttgagtgc cttccttttt tcctactctg gcaaagctct 120
aatgcttggc ccacatgtag aacacttagt gactgtcacc cccagaaaac ttcagtagca 180
ccttggggaa gctccccaaa aagtttccca gctaaggttc tcttcagtaa cttcctggca 240
ggttcaatgg caggaagctt accaatgagt tttgttcaca tccagcactt accagggttg 300
acctgtttga ccttgacctc agcaaacttt tatgccattc agtgcttcag ccataccatc 360
tccaaagagg ggcacctctt ctaagtttat tctagtctag atatattaga gttctctttt 420
accctctaag tagtaaccag tcccctgttc ctagttaata attctttata ttctaccttc 480
cctgttggaa ttattgtgtg gtttctgtct cctgactagg ccctgactga tacaacactc 540
atacacgtgc attcacccac ttgcctgtat actcccttct ccctcctcag tctgatttct 600
ccaatgaatc cttggagcac cctgagtcaa gtctttctct tggatagtac ttatgtcagc 660
cagggttcag ccaggaaaac agaaaccaca ctaagtattt caagcaggaa gggattgaat 720
acagagactt tagtaccgaa atcctagctt cacctcttcc tagctgtgta actgtgggca 780
ggtaacttct gtcggcaact cagtttccac ttctctaaag ataaaagtaa taatggtacc 840
taactcatag attgctctga aaattaagta aaatgatccg tgaaaaattc tcagtgtctg 900
gtacatggtt agtgcccgat aaatgtaagc gattattact gttactatta taatcttcta 960
aacacttcaa gacatctgag gaaagtgttc aaagccacaa cagagtctga agctgaggca 1020
gttagaaaag gaagaggaca tttttgcagt aagatgtcca ttcctggttg aaggaagact 1080
accctggatt ggaggtagag ggaggtggca aggatatgac caagtggctc aaagatacct 1140
gtctgtcctc aacttgaaca agttatacat actaaacttt cttcacctgt gctgagcaaa 1200
ggtctctcct ccagacatct ttttacattt ttagttgaaa agataggcca gacgcagtgg 1260
ctcacaccta taatcccagc tctttgggag gctgaggtgg gaggatcact tgcatccagg 1320
agtttgagac cagcctgggc aacatagcca gaccccatct ctgggatcaa aaaatcaaaa 1380
atcaaaaatt agccaggcat ggtggcatgt gcctacagac ccagctactt gggaggctga 1440
gattggatga ttgcttggac tgggagaggt caaagctaca gtgagccata atctcaccac 1500
tgcactccag cctgggtgac agagtgagac tgtgtcaaaa aaattatata tataaaatat 1560
atatgcatat atataatgca tataaattac atatatgtat attatgtaca tggtttaaaa 1620
aaaagtcaaa gagtacaaaa tggtattata gttaagaatc agtctccttc tgacccccaa 1680
cccctcagct ctctgaccac agacagccac catgaagcag tttcttgtat cttttcagac 1740
atactctact atattttcat attttaatac atatggaaga actgttcttg ctttcctagt 1800
aaataacata tcttggggcc aagctcggtg gctcacacct gtaattccag cagtttggaa 1860
ggctgatgca ggaggatctc ttgagcccag gaggtcaagg cggcaattga gccatgacag 1920
tgccaatgca ccccagccta agtgacagag tgagaccctg tcctgaaaaa aaaaaaaaaa 1980
tcttgaagaa caaggtattt gcactgatga agctactgta ttctcatttt ttctttcgtc 2040
ttgttctttt tagcatctac atggtattca taaggatgca gcactaattg tttaaccaga 2100
tcccttctgg tggaaatttg tttccagtct tttgctgtta caaataacgc tgtaatacac 2160
ctctatggat atgctaattt ttatgaggca gaaaatcctc tcacctctga agagttacag 2220
gccccaaaga ccatctttgt aatattgtat aaagacacag ggaaaggaga tgggaagcct 2280
gcattccagt catggaatgc tcaaccacta acatcctttg catgcagaga cgcatcacct 2340
catctgcccg agtgactcga ttttcttgtt tatcaggcag catcactgta cctgctttaa 2400
atggcctcac aagggcattg tgagaatcaa atgagataat gtacatgaaa gcctgtgcgc 2460
gctgtactaa tacacaagtc tctcatctgg ttgtgaaatc tagaattgat acgttgctct 2520
gtgaatgtgc ccatcaatct tcaacatggt gcttgctact cccactgtcc cttctaaggg 2580
aaactgaccc atctgcagct cctgctgaca gacaatccga ggctgctgtg cactgtgccg 2640
tatcaccctg ccctccccat ccttccactt caccagactg aactgggctg ggcaccttcc 2700
ccatctgata atgatcctca tcatctgttg cctctatgtt tcctctctgc ccttccccta 2760
ggaggcatac ctccatgaaa ctgcattaat tcattaacca aaacaataca aagcaacaca 2820
gagtctagca ttctcatttt cctgtctcta gataccagtc cttcagggaa ttttccagaa 2880
gttgagaaga ctggttgcat gagccttggg ttggtttggc actcgtgaca gtgtgaaaag 2940
agcctccgcc tcctccactg agctcagaga aaggtttata gtaaagccat ttgcaggggt 3000
aagggagaca ggatcacatg gtagcccaat aacaggcttc cctagaatga aaagctctgt 3060
cccagtagag ataagccagg ttattctgat tcctgccctt ggaaaggtct accaggaaat 3120
catgagtgac ttaagtagga caaacaacac agaaggcata ccgagaggcc atacagttga 3180
ggctatgaag aaccattaga agctgaagtt atgagtaagc tgaagtcagg aggaagcagg 3240
aaccttgcct acagtgaagt atgaggttgg aggttgtggg ttgacggggg tgaggaaggc 3300
tgttgatggg aagtgagggg acacggagaa gcagaaacac cgaaatcagc tgagttatac 3360
gaatgacaag gcacatgtga agctgcacca actctggctg ctggtctcag aattgccctg 3420
aatccagcac agtccctgct aggccagctc atccctcatc cctgttgctg ggctcccacg 3480
tgttcttgtc tcctttaccc ttgcatatgg ctttactata cacttccttt ctctgaactc 3540
aacagagaaa gcagaagctc ttttcatact gtcaccagtg ccaaaccgac ccaaggctcg 3600
taagacctgt ttcctccact tctgggaagt tccctaaagg acaggggtct agagacaggg 3660
aaatgagaat gctagactgt atgttgcttt ggaatacatt gctctgctta atgaattagt 3720
acactttcat ggaggtctgc ctcctagggg aagggcagag aggagaaaca gaaggcaaca 3780
gatgatgagg atcaattgac actttactca tgctgatcct ttcctctcac ccaaatccca 3840
cccacccttc atgttccctc ttccaccaaa ccttcctcag ctactccagg cacatcaacc 3900
ctgatccttt ttttttttga gttagtcaga ctctgtcacc caggttgaag tgcagtggca 3960
agatcacagc tcacttaagt gggctcaagc gatcctcaca cctccacctt tcaagtagct 4020
aggaccccga gtacatgcta ccatgcccag ctaatttttt ttttttttta tagaggtgga 4080
ttcccactat gttgcccagg ctggtcttga actcctgggc tcaagcgatc ttctagactc 4140
agcctcacaa agtactggga ttacaggcat gagaccctga gccctgacct cttgactcct 4200
atggtacatt gcctgattgg ccccagttct tcatccccta t 4241
<210> 2
<211> 4252
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
gttagctagc acagtattaa gctttgtcag tagatagcac tggagagacg tcactggagg 60
aaggggcttc tcttcctggt tcttgagtgc cttccttttt tcctactctg gcaaagctct 120
aatgcttggc ccacatgtag aacacttagt gactgtcacc cccagaaaac ttcagtagca 180
ccttggggaa gctccccaaa aagtttccca gctaaggttc tcttcagtaa cttcctggca 240
ggttcaatgg caggaagctt accaatgagt tttgttcaca tccagcactt accagggttg 300
acctgtttga ccttgacctc agcaaacttt tatgccattc agtgcttcag ccataccatc 360
tccaaagagg ggcacctctt ctaagtttat tctagtctag atatattaga gttctctttt 420
accctctaag tagtaaccag tcccctgttc ctagttaata attctttata ttctaccttc 480
cctgttggaa ttattgtgtg gtttctgtct cctgactagg ccctgactga tacaacactc 540
atacacgtgc attcacccac ttgcctgtat actcccttct ccctcctcag tctgatttct 600
ccaatgaatc cttggagcac cctgagtcaa gtctttctct tggatagtac ttatgtcagc 660
cagggttcag ccaggaaaac agaaaccaca ctaagtattt caagcaggaa gggattgaat 720
acagagactt tagtaccgaa atcctagctt cacctcttcc tagctgtgta actgtgggca 780
ggtaacttct gtcggcaact cagtttccac ttctctaaag ataaaagtaa taatggtacc 840
taactcatag attgctctga aaattaagta aaatgatccg tgaaaaattc tcagtgtctg 900
gtacatggtt agtgcccgat aaatgtaagc gattattact gttactatta taatcttcta 960
aacacttcaa gacatctgag gaaagtgttc aaagccacaa cagagtctga agctgaggca 1020
gttagaaaag gaagaggaca tttttgcagt aagatgtcca ttcctggttg aaggaagact 1080
accctggatt ggaggtagag ggaggtggca aggatatgac caagtggctc aaagatacct 1140
gtctgtcctc aacttgaaca agttatacat actaaacttt cttcacctgt gctgagcaaa 1200
ggtctctcct ccagacatct ttttacattt ttagttgaaa agataggcca gacgcagtgg 1260
ctcacaccta taatcccagc tctttgggag gctgaggtgg gaggatcact tgcatccagg 1320
agtttgagac cagcctgggc aacatagcca gaccccatct ctgggatcaa aaaatcaaaa 1380
atcaaaaatt agccaggcat ggtggcatgt gcctacagac ccagctactt gggaggctga 1440
gattggatga ttgcttggac tgggagaggt caaagctaca gtgagccata atctcaccac 1500
tgcactccag cctgggtgac agagtgagac tgtgtcaaaa aaattatata tataaaatat 1560
atatgcatat atataatgca tataaattac atatatgtat attatgtaca tggtttaaaa 1620
aaaagtcaaa gagtacaaaa tggtattata gttaagaatc agtctccttc tgacccccaa 1680
cccctcagct ctctgaccac agacagccac catgaagcag tttcttgtat cttttcagac 1740
atactctact atattttcat attttaatac atatggaaga actgttcttg ctttcctagt 1800
aaataacata tcttggggcc aagctcggtg gctcacacct gtaattccag cagtttggaa 1860
ggctgatgca ggaggatctc ttgagcccag gaggtcaagg cggcaattga gccatgacag 1920
tgccaatgca ccccagccta agtgacagag tgagaccctg tcctgaaaaa aaaaaaaaaa 1980
tcttgaagaa caaggtattt gcactgatga agctactgta ttctcatttt ttctttcgtc 2040
ttgttctttt tagcatctac atggtattca taaggatgca gcactaattg tttaaccaga 2100
tcccttctgg tggaaatttg tttccagtct tttgctgtta caaataacgc tgtaatacac 2160
ctctatggat atgctaattt ttatgaggca gaaaatcctc tcacctctga agagttacag 2220
gccccaaaga ccatctttgt aatattgtat aaagacacag ggaaaggaga tgggaagcct 2280
gcattccagt catggaatgc tcaaccacta acatcctttg catgcagaga cgcatcacct 2340
catctgcccg agtgactcga ttttcttgtt tatcaggcag catcactgta cctgctttaa 2400
atggcctcac aagggcattg tgagaatcaa atgagataat gtacatgaaa gcctgtgcgc 2460
gctgtactaa tacacaagtc tctcatctgg ttgtgaaatc tagaattgat acgttgctct 2520
gtgaatgtgc ccatcaatct tcaacatggt gcttgctact cccactgtcc cttctaaggg 2580
aaactgaccc atctgcagct cctgctgaca gacaatccga ggctgctgtg cactgtgccg 2640
tatcaccctg ccctccccat ccttccactt caccagactg aactgggctg ggcaccttcc 2700
ccatctgata atgatcctca tcatctgttg cctctatgtt tcctctctgc ccttccccta 2760
ggaggcatac ctccatgaaa ctgcattaat tcattaacca aaacaataca aagcaacaca 2820
gagtctagca ttctcatttt cctgtctcta gataccagtc cttcagggaa ttttccagaa 2880
gttgagaaga ctggttgcat gagccttggg ttggtttggc actcgtgaca gtgtgaaaag 2940
agcctccgcc tcctccactg agctcagaga aaggtttata gtaaagccat ttgcaggggt 3000
aagggagaca ggatcacatg gtagcccaat aacaggcttc cctagaatga aaagctctgt 3060
cccagtagag ataagccagg ttattctgat tcctgccctt ggaaaggtct accaggaaat 3120
catgagtgac ttaagtagga caaacaacac agaaggcata ccgagaggcc atacagttga 3180
ggctatgaag aaccattaga agctgaagtt atgagtaagc tgaagtcagg aggaagcagg 3240
aaccttgcct acagtgaagt atgaggttgg aggttgtggg ttgacggggg tgaggaaggc 3300
tgttgatggg aagtgagggg acacggagaa gcagaaacac cgaaatcagc tgagttatac 3360
gaatgacaag gcacatgtga agctgcacca actctggctg ctggtctcag aattgccctg 3420
aatccagcac agtccctgct aggccagctc atccctcatc cctgttgctg ggctcccacg 3480
tgttcttgtc tcctttaccc ttgcatatgg ctttactata cacttccttt ctctgaactc 3540
aacagagaaa gcagaagctc ttttcatact gtcaccagtg ccaaaccgac ccaaggctcg 3600
taagacctgt ttcctccact tctgggaagt tccctaaagg acaggggtct agagacaggg 3660
aaatgagaat gctagactgt atgttgcttt ggaatacatt gctctgctta atgaattagt 3720
acactttcat ggaggtctgc ctcctagggg aagggcagag aggagaaaca gaaggcaaca 3780
gatgatgagg atcaattgac actttactca tgctgatcct ttcctctcac ccaaatccca 3840
cccacccttc atgttccctc ttccaccaaa ccttcctcag ctactccagg cacatcaacc 3900
ctgatccttt ttttttttga gttagtcaga ctctgtcacc caggttgaag tgcagtggca 3960
agatcacagc tcacttaagt gggctcaagc gatcctcaca cctccacctt tcaagtagct 4020
aggaccccga gtacatgcta ccatgcccag ctaatttttt ttttttttta tagaggtgga 4080
ttcccactat gttgcccagg ctggtcttga actcctgggc tcaagcgatc ttctagactc 4140
agcctcacaa agtactggga ttacaggcat gagaccctga gccctgacct cttgactcct 4200
atggtacatt gcctgattgg ccccagttct tcatccccta tatcgagacc tt 4252
<210> 3
<211> 4211
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
gctagcacag tattaagctt tgtcagtaga tagcactgga gagacgtcac tggaggaagg 60
ggcttctctt cctggttctt gagtgccttc cttttttcct actctggcaa agctctaatg 120
cttggcccac atgtagaaca cttagtgact gtcaccccca gaaaacttca gtagcacctt 180
ggggaagctc cccaaaaagt ttcccagcta aggttctctt cagtaacttc ctggcaggtt 240
caatggcagg aagcttacca atgagttttg ttcacatcca gcacttacca gggttgacct 300
gtttgacctt gacctcagca aacttttatg ccattcagtg cttcagccat accatctcca 360
aagaggggca cctcttctaa gtttattcta gtctagatat attagagttc tcttttaccc 420
tctaagtagt aaccagtccc ctgttcctag ttaataattc tttatattct accttccctg 480
ttggaattat tgtgtggttt ctgtctcctg actaggccct gactgataca acactcatac 540
acgtgcattc acccacttgc ctgtatactc ccttctccct cctcagtctg atttctccaa 600
tgaatccttg gagcaccctg agtcaagtct ttctcttgga tagtacttat gtcagccagg 660
gttcagccag gaaaacagaa accacactaa gtatttcaag caggaaggga ttgaatacag 720
agactttagt accgaaatcc tagcttcacc tcttcctagc tgtgtaactg tgggcaggta 780
acttctgtcg gcaactcagt ttccacttct ctaaagataa aagtaataat ggtacctaac 840
tcatagattg ctctgaaaat taagtaaaat gatccgtgaa aaattctcag tgtctggtac 900
atggttagtg cccgataaat gtaagcgatt attactgtta ctattataat cttctaaaca 960
cttcaagaca tctgaggaaa gtgttcaaag ccacaacaga gtctgaagct gaggcagtta 1020
gaaaaggaag aggacatttt tgcagtaaga tgtccattcc tggttgaagg aagactaccc 1080
tggattggag gtagagggag gtggcaagga tatgaccaag tggctcaaag atacctgtct 1140
gtcctcaact tgaacaagtt atacatacta aactttcttc acctgtgctg agcaaaggtc 1200
tctcctccag acatcttttt acatttttag ttgaaaagat aggccagacg cagtggctca 1260
cacctataat cccagctctt tgggaggctg aggtgggagg atcacttgca tccaggagtt 1320
tgagaccagc ctgggcaaca tagccagacc ccatctctgg gatcaaaaaa tcaaaaatca 1380
aaaattagcc aggcatggtg gcatgtgcct acagacccag ctacttggga ggctgagatt 1440
ggatgattgc ttggactggg agaggtcaaa gctacagtga gccataatct caccactgca 1500
ctccagcctg ggtgacagag tgagactgtg tcaaaaaaat tatatatata aaatatatat 1560
gcatatatat aatgcatata aattacatat atgtatatta tgtacatggt ttaaaaaaaa 1620
gtcaaagagt acaaaatggt attatagtta agaatcagtc tccttctgac ccccaacccc 1680
tcagctctct gaccacagac agccaccatg aagcagtttc ttgtatcttt tcagacatac 1740
tctactatat tttcatattt taatacatat ggaagaactg ttcttgcttt cctagtaaat 1800
aacatatctt ggggccaagc tcggtggctc acacctgtaa ttccagcagt ttggaaggct 1860
gatgcaggag gatctcttga gcccaggagg tcaaggcggc aattgagcca tgacagtgcc 1920
aatgcacccc agcctaagtg acagagtgag accctgtcct gaaaaaaaaa aaaaaatctt 1980
gaagaacaag gtatttgcac tgatgaagct actgtattct cattttttct ttcgtcttgt 2040
tctttttagc atctacatgg tattcataag gatgcagcac taattgttta accagatccc 2100
ttctggtgga aatttgtttc cagtcttttg ctgttacaaa taacgctgta atacacctct 2160
atggatatgc taatttttat gaggcagaaa atcctctcac ctctgaagag ttacaggccc 2220
caaagaccat ctttgtaata ttgtataaag acacagggaa aggagatggg aagcctgcat 2280
tccagtcatg gaatgctcaa ccactaacat cctttgcatg cagagacgca tcacctcatc 2340
tgcccgagtg actcgatttt cttgtttatc aggcagcatc actgtacctg ctttaaatgg 2400
cctcacaagg gcattgtgag aatcaaatga gataatgtac atgaaagcct gtgcgcgctg 2460
tactaataca caagtctctc atctggttgt gaaatctaga attgatacgt tgctctgtga 2520
atgtgcccat caatcttcaa catggtgctt gctactccca ctgtcccttc taagggaaac 2580
tgacccatct gcagctcctg ctgacagaca atccgaggct gctgtgcact gtgccgtatc 2640
accctgccct ccccatcctt ccacttcacc agactgaact gggctgggca ccttccccat 2700
ctgataatga tcctcatcat ctgttgcctc tatgtttcct ctctgccctt cccctaggag 2760
gcatacctcc atgaaactgc attaattcat taaccaaaac aatacaaagc aacacagagt 2820
ctagcattct cattttcctg tctctagata ccagtccttc agggaatttt ccagaagttg 2880
agaagactgg ttgcatgagc cttgggttgg tttggcactc gtgacagtgt gaaaagagcc 2940
tccgcctcct ccactgagct cagagaaagg tttatagtaa agccatttgc aggggtaagg 3000
gagacaggat cacatggtag cccaataaca ggcttcccta gaatgaaaag ctctgtccca 3060
gtagagataa gccaggttat tctgattcct gcccttggaa aggtctacca ggaaatcatg 3120
agtgacttaa gtaggacaaa caacacagaa ggcataccga gaggccatac agttgaggct 3180
atgaagaacc attagaagct gaagttatga gtaagctgaa gtcaggagga agcaggaacc 3240
ttgcctacag tgaagtatga ggttggaggt tgtgggttga cgggggtgag gaaggctgtt 3300
gatgggaagt gaggggacac ggagaagcag aaacaccgaa atcagctgag ttatacgaat 3360
gacaaggcac atgtgaagct gcaccaactc tggctgctgg tctcagaatt gccctgaatc 3420
cagcacagtc cctgctaggc cagctcatcc ctcatccctg ttgctgggct cccacgtgtt 3480
cttgtctcct ttacccttgc atatggcttt actatacact tcctttctct gaactcaaca 3540
gagaaagcag aagctctttt catactgtca ccagtgccaa accgacccaa ggctcgtaag 3600
acctgtttcc tccacttctg ggaagttccc taaaggacag gggtctagag acagggaaat 3660
gagaatgcta gactgtatgt tgctttggaa tacattgctc tgcttaatga attagtacac 3720
tttcatggag gtctgcctcc taggggaagg gcagagagga gaaacagaag gcaacagatg 3780
atgaggatca attgacactt tactcatgct gatcctttcc tctcacccaa atcccaccca 3840
cccttcatgt tccctcttcc accaaacctt cctcagctac tccaggcaca tcaaccctga 3900
tccttttttt ttttgagtta gtcagactct gtcacccagg ttgaagtgca gtggcaagat 3960
cacagctcac ttaagtgggc tcaagcgatc ctcacacctc cacctttcaa gtagctagga 4020
ccccgagtac atgctaccat gcccagctaa tttttttttt tttttataga ggtggattcc 4080
cactatgttg cccaggctgg tcttgaactc ctgggctcaa gcgatcttct agactcagcc 4140
tcacaaagta ctgggattac aggcatgaga ccctgagccc tgacctcttg actcctatgg 4200
tacattgcct g 4211
<210> 4
<211> 3409
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gaagctcccc aaaaagtttc ccagctaagg ttctcttcag taacttcctg gcaggttcaa 60
tggcaggaag cttaccaatg agttttgttc acatccagca cttaccaggg ttgacctgtt 120
tgaccttgac ctcagcaaac ttttatgcca ttcagtgctt cagccatacc atctccaaag 180
aggggcacct cttctaagtt tattctagtc tagatatatt agagttctct tttaccctct 240
aagtagtaac cagtcccctg ttcctagtta ataattcttt atattctacc ttccctgttg 300
gaattattgt gtggtttctg tctcctgact aggccctgac tgatacaaca ctcatacacg 360
tgcattcacc cacttgcctg tatactccct tctccctcct cagtctgatt tctccaatga 420
atccttggag caccctgagt caagtctttc tcttggatag tacttatgtc agccagggtt 480
cagccaggaa aacagaaacc acactaagta tttcaagcag gaagggattg aatacagaga 540
ctttagtacc gaaatcctag cttcacctct tcctagctgt gtaactgtgg gcaggtaact 600
tctgtcggca actcagtttc cacttctcta aagataaaag taataatggt acctaactca 660
tagattgctc tgaaaattaa gtaaaatgat ccgtgaaaaa ttctcagtgt ctggtacatg 720
gttagtgccc gataaatgta agcgattatt actgttacta ttataatctt ctaaacactt 780
caagacatct gaggaaagtg ttcaaagcca caacagagtc tgaagctgag gcagttagaa 840
aaggaagagg acatttttgc agtaagatgt ccattcctgg ttgaaggaag actaccctgg 900
attggaggta gagggaggtg gcaaggatat gaccaagtgg ctcaaagata cctgtctgtc 960
ctcaacttga acaagttata catactaaac tttcttcacc tgtgctgagc aaaggtctct 1020
cctccagaca tctttttaca tttttagttg aaaagatagg ccagacgcag tggctcacac 1080
ctataatccc agctctttgg gaggctgagg tgggaggatc acttgcatcc aggagtttga 1140
gaccagcctg ggcaacatag ccagacccca tctctgggat caaaaaatca aaaatcaaaa 1200
attagccagg catggtggca tgtgcctaca gacccagcta cttgggaggc tgagattgga 1260
tgattgcttg gactgggaga ggtcaaagct acagtgagcc ataatctcac cactgcactc 1320
cagcctgggt gacagagtga gactgtgtca aaaaaattat atatataaaa tatatatgca 1380
tatatataat gcatataaat tacatatatg tatattatgt acatggttta aaaaaaagtc 1440
aaagagtaca aaatggtatt atagttaaga atcagtctcc ttctgacccc caacccctca 1500
gctctctgac cacagacagc caccatgaag cagtttcttg tatcttttca gacatactct 1560
actatatttt catattttaa tacatatgga agaactgttc ttgctttcct agtaaataac 1620
atatcttggg gccaagctcg gtggctcaca cctgtaattc cagcagtttg gaaggctgat 1680
gcaggaggat ctcttgagcc caggaggtca aggcggcaat tgagccatga cagtgccaat 1740
gcaccccagc ctaagtgaca gagtgagacc ctgtcctgaa aaaaaaaaaa aaatcttgaa 1800
gaacaaggta tttgcactga tgaagctact gtattctcat tttttctttc gtcttgttct 1860
ttttagcatc tacatggtat tcataaggat gcagcactaa ttgtttaacc agatcccttc 1920
tggtggaaat ttgtttccag tcttttgctg ttacaaataa cgctgtaata cacctctatg 1980
gatatgctaa tttttatgag gcagaaaatc ctctcacctc tgaagagtta caggccccaa 2040
agaccatctt tgtaatattg tataaagaca cagggaaagg agatgggaag cctgcattcc 2100
agtcatggaa tgctcaacca ctaacatcct ttgcatgcag agacgcatca cctcatctgc 2160
ccgagtgact cgattttctt gtttatcagg cagcatcact gtacctgctt taaatggcct 2220
cacaagggca ttgtgagaat caaatgagat aatgtacatg aaagcctgtg cgcgctgtac 2280
taatacacaa gtctctcatc tggttgtgaa atctagaatt gatacgttgc tctgtgaatg 2340
tgcccatcaa tcttcaacat ggtgcttgct actcccactg tcccttctaa gggaaactga 2400
cccatctgca gctcctgctg acagacaatc cgaggctgct gtgcactgtg ccgtatcacc 2460
ctgccctccc catccttcca cttcaccaga ctgaactggg ctgggcacct tccccatctg 2520
ataatgatcc tcatcatctg ttgcctctat gtttcctctc tgcccttccc ctaggaggca 2580
tacctccatg aaactgcatt aattcattaa ccaaaacaat acaaagcaac acagagtcta 2640
gcattctcat tttcctgtct ctagatacca gtccttcagg gaattttcca gaagttgaga 2700
agactggttg catgagcctt gggttggttt ggcactcgtg acagtgtgaa aagagcctcc 2760
gcctcctcca ctgagctcag agaaaggttt atagtaaagc catttgcagg ggtaagggag 2820
acaggatcac atggtagccc aataacaggc ttccctagaa tgaaaagctc tgtcccagta 2880
gagataagcc aggttattct gattcctgcc cttggaaagg tctaccagga aatcatgagt 2940
gacttaagta ggacaaacaa cacagaaggc ataccgagag gccatacagt tgaggctatg 3000
aagaaccatt agaagctgaa gttatgagta agctgaagtc aggaggaagc aggaaccttg 3060
cctacagtga agtatgaggt tggaggttgt gggttgacgg gggtgaggaa ggctgttgat 3120
gggaagtgag gggacacgga gaagcagaaa caccgaaatc agctgagtta tacgaatgac 3180
aaggcacatg tgaagctgca ccaactctgg ctgctggtct cagaattgcc ctgaatccag 3240
cacagtccct gctaggccag ctcatccctc atccctgttg ctgggctccc acgtgttctt 3300
gtctccttta cccttgcata tggctttact atacacttcc tttctctgaa ctcaacagag 3360
aaagcagaag ctcttttcat actgtcacca gtgccaaacc gacccaagg 3409
<210> 5
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
gataaaaggt ctcgatata 19
<210> 6
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
aatactgtgc tagctaaca 19

Claims (17)

  1. Use of a TED gene in the construction of a cell line resistant to an anoxic environment, said use being the construction of a cell line by knocking out the TED gene such that the TED gene knocked out cell line exhibits anoxic characteristics, said knockout being performed on a commercially available human cell line, said TED being a Tibetan enriched gene deleted Tibetan-enriched deletion.
  2. 2. The use of claim 1, wherein the knockout TED gene comprises a deletion in at least one chromosome as set forth in SEQ ID NO: 1-3.
  3. 3. The use of claim 1, wherein the anoxic environment comprises an oxygen content of less than 5 percent.
  4. 4. The use of claim 1, wherein the anoxic environment comprises an oxygen content of less than 4 percent.
  5. 5. The use of claim 1, wherein the anoxic environment comprises an oxygen content of less than 3 percent.
  6. 6. The use of claim 1, wherein the anoxic environment comprises an oxygen content of less than 2 percent.
  7. 7. The use of claim 1, wherein the anoxic environment comprises an oxygen content of less than 1 percent.
  8. 8. A TED-deleted cell line, wherein at least one chromosome of the commercial human cell line is deleted as set forth in SEQ ID NO:1-3, wherein the TED is Tibetan enrichment gene deletion Tibetan-enriched deletion.
  9. 9. The cell line of claim 8, wherein:
    1) A chromosome deletion as shown in SEQ ID NO:1, and the other chromosome is deleted with the nucleotide sequence shown in SEQ ID NO:2, said nucleic acid sequence; or alternatively, the first and second heat exchangers may be,
    2) A chromosome deletion as shown in SEQ ID NO:3, the other chromosome is wild type, and the wild type comprises a TED gene wild type.
  10. 10. The cell line of claim 9, wherein the TED gene wild type has the sequence set forth in SEQ ID NO: 4.
  11. 11. A method of making a cell resistant to an anaerobic environment, the method comprising specific gene editing of a TED of the cell using Cas9 protein and gRNA; the sequence of the gRNA is shown as SEQ ID NO:5 and SEQ ID NO:6, the cell is a commercial human cell line, and the TED is Tibetan-enriched deletion deleted from Tibetan enrichment genes.
  12. 12. The method of claim 11, comprising transferring into the cell any one of the following components:
    1) Cas9 protein and gRNA;
    2) Coding sequences for Cas9 gene and gRNA.
  13. 13. The method of claim 12, wherein the coding sequences for the Cas9 gene and the gRNA are constructed on a vector.
  14. 14. The method of claim 12, wherein the method of transferring any one of the following components into a cell comprises a gene gun method, a microinjection method, an electric shock method, an ultrasonic method, and a polyethylene glycol mediated method:
    1) Cas9 protein and gRNA;
    2) Coding sequences for Cas9 gene and gRNA.
  15. 15. The method of claim 14, which is a shock method.
  16. 16. The method of claim 11, wherein the human cell line comprises 293 cells, 293T cells, 293FT cells, 293LTV cells, 293EBNA cells, and other clones isolated from 293 cells; SW480 cells, u87MG cells, HOS cells, C8166 cells, MT-4 cells, molt-4 cells, heLa cells, HT1080 cells or TE671 cells.
  17. 17. Use of the TED-deleted cell line of claim 8 in the study of hypoxia-tolerant molecular mechanisms.
CN202210699814.3A 2022-06-20 2022-06-20 TED-deleted cell line and application thereof Active CN114940975B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210699814.3A CN114940975B (en) 2022-06-20 2022-06-20 TED-deleted cell line and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210699814.3A CN114940975B (en) 2022-06-20 2022-06-20 TED-deleted cell line and application thereof

Publications (2)

Publication Number Publication Date
CN114940975A CN114940975A (en) 2022-08-26
CN114940975B true CN114940975B (en) 2023-07-25

Family

ID=82911379

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210699814.3A Active CN114940975B (en) 2022-06-20 2022-06-20 TED-deleted cell line and application thereof

Country Status (1)

Country Link
CN (1) CN114940975B (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU9028298A (en) * 1997-08-21 1999-03-08 Quark Biotech, Inc. Hypoxia-regulated genes
CN105695486A (en) * 2016-01-29 2016-06-22 西南交通大学 Cell model for screening drugs with anti-chronic hypoxic pathological change activity, and application and use method thereof
CN107384858A (en) * 2017-08-17 2017-11-24 成都康景生物科技有限公司 A kind of preparation method and applications of hypoxic tolerance type mescenchymal stem cell

Also Published As

Publication number Publication date
CN114940975A (en) 2022-08-26

Similar Documents

Publication Publication Date Title
CN107858373B (en) Construction method of endothelial cell conditional knockout CCR5 gene mouse model
Zhou et al. Programmable base editing of the sheep genome revealed no genome-wide off-target mutations
CN111549072B (en) VISTA gene humanized animal cell, animal model construction method and application
CN110951787A (en) Immunodeficiency mouse, preparation method and application thereof
CN111690689B (en) Construction method and application of humanized CCR2 gene modified animal model
JP4292401B2 (en) Utilization of histamine receptor H3 gene involved in regulation of body weight or food intake
CN114277055A (en) Non-human animal humanized by IL1B and IL1A genes and construction method and application thereof
Chao et al. Precise and rapid validation of candidate gene by allele specific knockout with CRISPR/Cas9 in wild mice
CN114940975B (en) TED-deleted cell line and application thereof
CN113429486A (en) Construction method and application of genetically modified non-human animal
CN112725379A (en) Construction method and application of humanized CD40 gene modified animal model
US20050054597A1 (en) Method and system for rapidly conferring a desired trait to an organism
CN113355355B (en) Construction method and application of IL23A and/or IL12B gene humanized non-human animal
CN110904114B (en) Application of Gnb2 gene coding sequence and Gnb2 gene coding sequence in constructing mouse model
CN114134152A (en) GLP1R gene humanized non-human animal and construction method and application thereof
CN115011606A (en) Construction method and application of CD37 gene humanized non-human animal
CN111972355A (en) Mouse model of GSDIa type glycogen storage disease and construction method thereof
US20050003536A1 (en) Method and system for rapidly conferring a desired trait to an organism
CN114410691B (en) Construction method and application of SLC35E1 gene knockout mouse animal model
EP1319709A1 (en) Disruption of the glutathione S-transferase-omega-1 gene
CN113481238B (en) Method for preparing IL-2Rg knockout non-human animal model and application thereof
JPH03201990A (en) Changing of gene to achieve object
US8173859B2 (en) Epilepsy model animal
CN117051041A (en) Construction method and application of EIF2S3 gene conditional whole-body knockout mouse model
Li et al. CRISPR/Cas9-Mediated Gene Correction in Osteopetrosis Patient-Derived iPSCs

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant