CN114875060A - Use of dORF in enhancing translation of upstream coding genes - Google Patents

Abstract

The invention discloses an application of dORF in enhancing upstream coding gene translation, belonging to the technical field of genetic engineering. According to the invention, through carrying out ribosome imprinting sequencing on 0-day, 5-day, 10-day and 20-day ovules of Asian cotton and seedlings treated by 14-day and four abiotic stresses (ultraviolet, salt, high temperature and low temperature), a large amount of ribosome signals exist in a non-coding region of a gene, Western blotting and transient transformation experiments prove that an open reading frame with coding capacity exists in the non-coding region of the gene, and an open reading frame dORF with coding capacity in a downstream 3' UTR region of the gene can enhance the translation capacity of an upstream gene, and the same phenomenon also exists in other monocotyledons and dicotyledons. Based on the function of dORF, the gene can be used as an element to regulate the translation efficiency of the gene, plays a role in a transgenic or stably expressed gene system, and has great application potential and application prospect.

Description

Use of dORF in enhancing translation of upstream coding genes

Technical Field

The invention relates to the technical field of genetic engineering, in particular to application of dORF in enhancing upstream coding gene translation.

Background

In recent years, with the development of sequencing technology, the research on protein level has made a great breakthrough. With the continued sophistication of ribosome-imprinted sequencing techniques and mass spectrometry sequencing methods, the conclusion that each eukaryotic messenger rna (mrna) encodes a protein has also been revised. Ribosome imprinting analysis revealed that the non-coding regions 5 'UTR and 3' UTR of many genes have the potential to encode proteins, whereas in many species and viruses, it has been demonstrated that long non-coding RNAs (lncRNAs) can also encode proteins. In most cases, an open reading frame having a coding ability located in the 5' UTR region of a gene, which is called uORF (upstream open reading frame), can inhibit the translation ability of a downstream gene.

An open reading frame having a coding ability in the 3' UTR region of the gene, called dORF (down stream open reading frame), has not been systematically studied with respect to its related characteristics and functions in plants and animals. The data of the invention discovers that dORF (down stream open reading frame) can promote the translation capability of upstream genes in plants, and the regulation of the translation level of the genes by the dORF can possibly become a new modification mode, so that the dORF has very important biological significance in the cultivation of high-yield plant varieties and the improvement of the response to stress.

Disclosure of Invention

The invention proves that the dORF (down stream open reading frame) endogenous to the plant has the capability of promoting the translation of the upstream gene, and the dORF can be used as a new mode for regulating the translation level of the upstream coding gene.

The invention relates to a method for culturing the ovules of Asian cotton in four different development stages: the ribosome imprinting sequencing was performed on seedlings treated at 0, 5, 10, 20, and 14 days and under four abiotic stresses (uv, salt, high, low), and the quality of the data was first evaluated with a significant periodicity of 3-nt, indicating that the acquisition was valid data. In the next step, the Asian cotton genome-wide sorf (small open reading frame) is fully annotated, and a large number of open reading frames with coding potential exist in the non-coding region of the coding gene. To further understand the significance of the existence of these open reading frames with coding potential, the present invention has analyzed its essential features. The open reading frame uORF having the coding ability at the upstream and the open reading frame dORF having the coding ability at the downstream have a shorter amino acid length of about 100 amino acids as compared with the coding region of the gene; the translation ability is weak compared with the coding region of the gene.

In order to explore the biological significance and potential functions of the Asian cotton sorf, the invention firstly compares the translation efficiency of the gene containing uORF with the gene without uORF under the condition of the same transcription level. 3000 cases were randomly selected in the present invention, and it was found that the translation efficiency of the gene containing uORF was significantly lower than that of the gene not containing uORF, which is in accordance with the currently known conclusion, whereas dORF showed the opposite tendency, and the translation efficiency of the gene containing dORF was significantly higher than that of the gene not containing dORF, which indicates that dORF functions in the opposite way to that of uORF.

In order to demonstrate the presence of dORF and to enhance the translation efficiency of upstream genes, the present invention confirmed the in vitro translation of dORF using Tricine-SDS-PAGE under in vitro conditions using a tobacco transient transformation system by fusing a commercial FLAG tag to the dORF sequence. In order to demonstrate that dORF functions to enhance the translation efficiency of an upstream gene, the present invention compares the translation efficiency of upstream genes, which have been selected for the gene encoding firefly enzyme, by deleting the dORF sequence. By examining the activity of fluorescence, it was found that in the case where deletion of the dORF sequence renders the dORF untranslated, the fluorescence activity decreased significantly, indicating that the untranslated expression of the dORF affected the level of translation of the upstream gene. In order to determine whether dORF passes through the transcription process and thereby affects the translation product of the gene, the present invention uses rt-qpcr to quantify gene transcription levels and found that there is no difference in the transcription level of the fluorescent gene compared to the unaltered dORF sequence. It was shown that the presence of dORF did enhance the translation efficiency of the upstream gene without affecting the transcription level of the upstream gene.

From the above, it can be seen that the dORF of plants has utility for enhancing translation of the gene encoding upstream thereof.

Further, the plant includes monocotyledons and dicotyledons.

Further, the plant includes Asian cotton, rice, tomato.

A method for enhancing the translation efficiency of a target gene by inserting a dORF from a plant into the 3' UTR region of the target gene.

Further, the sequence of dORF includes but is not limited to the sequence shown in SEQ ID NO.2, SEQ ID NO.5, SEQ ID NO.8 and SEQ ID NO. 11.

Compared with the prior art, the invention has the following advantages and effects:

the invention discovers for the first time that the presence of dORF in plants can promote the translation efficiency of upstream coding genes, and proves the function of dORF translation and the function of enhancing the translation efficiency of upstream genes under in vitro conditions. Based on the function of dORF, the gene can be used as an element to regulate the translation efficiency of the gene, plays a role in a transgenic or stably expressed gene system, and has great application potential and application prospect. The present study shows that dORF with translation potential can raise the translation efficiency of upstream gene in both monocotyledonous and dicotyledonous plants.

Drawings

FIG. 1 is the results of a 3-nt periodic analysis of the ribosome imprinting database by bioinformatics.

FIG. 2 is a distribution map of data from a bioinformatics statistical ribosome imprinting database on the Asian cotton genome.

FIG. 3 is a graph showing the trend of translation efficiency of genes containing uORF or dORF, respectively, versus genes not containing uORF or dORF, respectively, under the condition that there is no difference in the transcription level by bioinformatics analysis.

FIG. 4 is a schematic diagram of a PGX-5dual vector. In the figure, 35S: a strong promoter; LUC: luciferase, firefly luciferase; sal, spe: a restriction enzyme site; REN: renilla luciferase; HA: a commercial label.

FIG. 5 is a visualization of the structural map of the four examples Ga13g02057, Ga01g00361, Ga05g01077, Ga05g01995 genes and ribosome imprinting and polyA-seq sequencing data, showing that the 3' UTR region of these genes contains dORF (the dashed box is the annotated dORF position).

FIG. 6 is a schematic representation of the product of the synthetic sequence attached to PGX-5 dual. In the figure, dORF: the complete 3' UTR sequences for the four genes Ga13g02057, Ga01g00361, Ga05g01077, Ga05g01995 were ligated to the vector using sal I and spe I restriction sites, respectively; delete: the annotated dORF sequence was deleted for the 3' UTR sequences of the four genes Ga13g02057, Ga01g00361, Ga05g01077, Ga05g01995 and the other sequences were ligated to the vector without alteration using sal I and spe I restriction sites, respectively.

FIG. 7 is a schematic diagram of the vector construction products of dORF fused with FLAG tag annotated by the gene Ga11g02302 and a Tricine-SDS-page result chart. In the figure, the dORF FLAG: the Ga11g02302 annotated dORF fusion FLAG tag was ligated to the vector using sal I and spe I restriction sites; control: empty vector, dORF: vector containing Ga11g02302 annotated dORF fused with FLAG.

FIG. 8 is a graph showing the results of experiments of dual fluorescence detection of 4 genes, rt-qPCR, and western blot. In the figure, LUC/REN activity: firefly enzyme activity/renilla luciferase activity; LUC mRNA level: firefly enzyme RNA expression levels; delete: the dORF sequence of the 3' UTR of the gene is deleted, and other sequences are not changed; UTR: a genetically intact 3' UTR sequence; sample: a protein sample; a contral: internal reference, renilla luciferase.

FIG. 9 is a graph showing the tendency of translation efficiency of genes containing uORF or dORF, respectively, compared to genes not containing uORF or dORF, under the condition of no difference in transcription level by bioinformatics analysis using rice ribosome imprinting and RNA-seq sequencing data.

FIG. 10 is a graph of the translational efficiency trends of genes containing uORF or dORF versus genes not containing uORF or dORF, respectively, under conditions of no difference in transcription level analyzed by bioinformatics using tomato ribosomal imprinting and RNA-seq sequencing data.

Detailed Description

The following examples further illustrate the present invention but are not to be construed as limiting thereof. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

In the following examples, unless otherwise specified, all methods are conventional.

The cotton and tobacco are cultivated according to the following method in the following examples:

planting cotton materials in a greenhouse: removing cotton seed hulls from cotton seeds, placing in a small pot containing vermiculite, transferring into a greenhouse at 28 deg.C, culturing for 14 days, and respectively treating as follows: (1) adjusting the temperature of the incubator to 50 ℃, putting the cotton for 14 days into the incubator for 5 hours, quickly washing the cotton by pure water, putting the cotton into liquid nitrogen for quick freezing, and preserving the sample at-80 ℃; (2) adjusting the temperature of the incubator to 4 ℃, putting the cotton for 14 days into the incubator for 15 hours, quickly washing the cotton by pure water, putting the cotton into liquid nitrogen for quick freezing, and preserving the sample at-80 ℃; (3) preparing 500mM NaCl, pouring 20mL of the NaCl into a small pot for culturing seedlings, culturing for 24 hours at 28 ℃, quickly washing with pure water, putting into liquid nitrogen for quick freezing, and preserving a sample at-80 ℃; (4) the ultraviolet intensity of the incubator is adjusted to 1.24 mu mol m ^-2 s ^-1 Culturing at 28 deg.C for 2 hr, rapidly washing with pure water, quickly freezing in liquid nitrogen, and storing at-80 deg.C; (5) cotton seedlings growing normally for 14 days were quickly washed with pure water and put into liquid nitrogen for quick freezing, and the samples were stored at-80 ℃.

Planting tobacco materials in a greenhouse: uniformly spreading tobacco seeds in a small pot containing vermiculite, transferring into a greenhouse at 28 deg.C, and culturing for 4-5 weeks.

Example 1 annotation and functional discovery of Asian Cotton dORF

Analysis of ribosome imprinting data

The quality of sequencing data was assessed by ribosome-imprinted sequencing of ovules from Asian cotton at four different developmental stages (0, 5, 10, 20 days) and 14 day and four abiotic stress (UV, salt, high, low).

1. Quality control of original sequencing data: and removing a sequencing joint (AGATCGGAAGAG) of the original sequencing data (rawdata) and a sequence with the length being more than 40bp after removing the joint by using the second generation sequencing quality control software cutadapt to obtain the filtered cleardata.

2. Removal of rRNA, tRNA, snRNA contamination: sequence alignment software bowtie was used to align clean with rRNA, tRNA, snRNA in the Rfam database (https:// Rfam. xfam. org /), allowing up to two mismatches, leaving unaligned sequences.

3. Alignment of sequences to the reference genome: the unaligned sequence was aligned with the Asian cotton reference genome using the sequence alignment software STAR, allowing up to two mismatches, the sequence and annotation files for the reference genome were from MaGenDB (http:// magen. whu. edu. cn /), resulting in the final alignment file.

4. Ribosome imprinting library construction quality control: distribution of sequences across the genome was checked using read _ distribution. py script of rseqc and periodicity of the ribosomic sequencing data was checked using ribotricers.

The results are shown in FIG. 1, and the sequencing data has a significant periodicity of 3-nt, indicating that valid data was obtained.

(II) uORF and dORF annotation and functional discovery

1. Prediction of open reading frame: the open reading frames with potential coding capacity were predicted using PRICE, and annotated information for uORF and dORF was obtained.

The results are shown in FIG. 2, with 75.65% of the sequencing data being distributed in the coding region of the Asian cotton genome, 0.48% in the intron region, 4.43% in the 5 'UTR region, 2.96% in the 3' UTR region, and 16.48% in the other regions.

2. Quantitative analysis of genes at the transcription level and the translation level and calculation of translation efficiency: quantifying the RNA-seq data and the ribo-seq data by using salmon, and calculating the expression values of the genes at the transcription level and the translation level; the translation efficiency of the gene (translation efficiency log2 (expression value of transcription level of gene/expression value of translation level of gene)) was calculated. 3000 examples were randomly picked and analyzed as follows.

3. Effect of dORF on gene translation efficiency: genes were randomly sampled based on expression values at RNA level, and the difference in translation efficiency between genes with dORF and genes with similar RNA level but without dORF was counted.

As a result, as shown in FIG. 3, in the randomly selected example, the translation efficiency of the gene containing uORF was significantly lower than that of the gene not containing uORF, whereas dORF showed the opposite tendency, and the translation efficiency of the gene containing dORF was significantly higher than that of the gene not containing dORF.

Demonstration of (tri) dORF function

1. Construction of vectors

The vector is selected from a double-fluorescent vector PGX (Guoyong Xu, uORF-mediated transformation induced plant resistance with out fluorescence costs, 2017), and is modified as follows: the Wuhan Olympic department, Dingsheng, Biotech, Inc. was entrusted with adding sal I and spe I restriction sites behind the vector LUC gene sequence, and the vector was named PGX-5 dual.

The results are shown in FIG. 4, with the addition of sal I and spe I restriction sites after the LUC gene.

2. Selecting 3' UTR sequence containing dORF annotation gene for artificial synthesis

Through the analysis of (one) and (two), the following 4 genes were selected: ga13g02057, Ga01g00361, Ga05g01077 and Ga05g 01995. These 4 genes all contained annotations of dORF, and the Wuhan Odoku Dingsheng Biotech Co., Ltd was entrusted to the synthesis of the 3' UTR sequence of the 4 genes, and the dORF sequence annotated according to bioinformatics was deleted and ligated to the vector PGX-5dual using sal I and spe I restriction sites. Synthesizing complete 3 ' UTR sequences of genes, namely Ga13g02057-3 ' UTR (SEQ ID NO.1), Ga01g00361-3 ' UTR (SEQ ID NO.4), Ga05g01077-3 ' UTR (SEQ ID NO.7) and Ga05g01995-3 ' UTR (SEQ ID NO. 10); the sequences of bioinformatics annotated dORF in these sequences are shown as SEQ ID NO.2, SEQ ID NO.5, SEQ ID NO.8 and SEQ ID NO.11, respectively. The sequences deleted for dORF were synthesized and named Ga13g02057-dORF-delete (SEQ ID NO.3), Ga01g00361-dORF-delete (SEQ ID NO.6), Ga05g01077-dORF-delete (SEQ ID NO.9), Ga05g01995-dORF-delete (SEQ ID NO.12), respectively. The synthesized sequence contains sal I and spe I enzyme cutting sites at both ends.

FIG. 5 is a visualization of four gene ribosome imprinting and polyA-seq sequencing data showing that the four genes contain annotations of dORF, and FIG. 6 is a schematic representation of the products of ligation of the synthesized sequences onto a vector.

2. Transfer of successfully ligated vector into Agrobacterium GV3101

The constructed plasmid is transferred into agrobacterium (geophile) GV3101, and agrobacterium strain containing target gene is obtained through screening. The method for transferring the agrobacterium tumefaciens comprises the following steps:

(1) the agrobacterium tumefaciens stored at the temperature of minus 80 ℃ is taken to be in a sensitive state at room temperature or palm for a moment until part of the agrobacterium tumefaciens is melted, and the agrobacterium tumefaciens is inserted into ice when the agrobacterium tumefaciens is in an ice-water mixed state.

(2) Add 1. mu.g plasmid DNA per 100. mu.L competence, dial the tube bottom by hand and mix well, stand on ice for 5 minutes, liquid nitrogen for 5 minutes, water bath for 5 minutes at 37 ℃ and ice bath for 5 minutes in sequence.

(3) 700. mu.L of LB without antibiotics was added and cultured with shaking at 28 ℃ for 2-3 hours.

(4) Centrifuging at 6000rpm for one minute to collect bacteria, collecting supernatant of about 100 μ L, lightly blowing to remove heavy suspended bacteria, spreading on LB plate containing corresponding antibiotics, and culturing in 28 deg.C incubator for 2-3 days.

3. Tobacco system transient transformation

(1) Selecting a single clone to be cultured in 5mL LB liquid medium with shaking at 28-30 ℃. 100. mu.g/mL gentamicin (carried by Agrobacterium strain GV 3101) and 50. mu.g/mL kanamycin (carried by the vector) were added to LB.

(2) 1mL of overnight cultured Agrobacterium was transferred to 25mL of LB liquid medium (plus gentamicin and kanamycin, plus autoclaved acetosyringone). The OD value of the overnight-cultured bacterial suspension was measured, and the OD value was adjusted to 0.4 using LB medium.

(3) The cells were collected by centrifugation at 5000g for 15 minutes and resuspended in a resuspension solution (10mM MgCl) ₂ 10mM MES, 5mM AS) was suspended and the final OD600 was 0.4.

(4) Standing at room temperature for 2-3h, and injecting tobacco cultured in 28 deg.C greenhouse for 4-5 weeks. The suspension was filled into a 5mL syringe and the liquid was injected into the tobacco leaf from the lower skin of the leaf by pressing the syringe with the thumb. After injection, the mixture is cultured in an incubator at 28 ℃ for 2-3 days, and the leaves are quickly frozen in liquid nitrogen and stored at-80 ℃.

4. Extraction of tobacco protein

The leaf of tobacco into which the inoculum was injected was cut and placed in a mortar pre-cooled with liquid nitrogen, liquid nitrogen was added, the mixture was rapidly ground to a powder, the powder was transferred to a 1.5mL EP tube, and 1mL of a protein extract (10mM Tric-HCl pH 8.0, 20mM EDTA pH 8.0, 1mM PMSF, 1mM DTT, 1% Triton-100) was added and lysed on ice for 30 min. Centrifuge at 12000rpm for 10min at 4 ℃ and transfer the supernatant to a new 1.5mL EP tube, the supernatant being tobacco total protein.

5. Tricine-SDS-page in vitro demonstration of dORF translation

To demonstrate translation of dORF, Wuhan Odoku Dingsheng Biotech Limited was committed to synthesize the 3' UTR sequence of gene Ga11g02302 and to fuse the FLAG tag (SEQ ID NO.13) in front of the stop codon of the annotated dORF sequence, ligated to PGX-5dual vector using sal I and spe I restriction sites, protein was extracted by tobacco transient transformation method (see 3, 4) using Tricine-SDS-page (Hermann)

Tricine-SDS-PAGE, 2006) using FLAG-Tag as primary antibody (warham's biosystems FLAG-Tag mouse mAb) and coat anti-mouse (agrisa) as secondary antibody, with empty vector as control, to demonstrate the true translation of dORF.

Ga11g02302 annotated dORF fusion FLAG tagged vector construction product schematic and Tricine-SDS-page results are shown in FIG. 7, where the FLAG tag-fused dORF is indeed capable of translation.

6. Dual fluorescence detection

Dual fluorescence detection was performed using the Dual Luciferase Reporter Assay Kit of Nanjing Novowed.

Taking 50mg of tobacco leaf, grinding with liquid nitrogen, cracking with 200 μ L of lysate, centrifuging at 12000rpm for 5min, and taking the supernatant. Respectively adding 20 mu L of supernatant into a black enzyme label plate, firstly adding 100 mu L of Luciferase Assay Reagent II, measuring by using an enzyme label instrument after 2s, and then adding 100 mu L of Stop and Glo Reagent for measurement. By double fluorescence detection, a significant reduction in activity of the upstream LUC gene with deletion of the dORF sequence was found compared to the intact 3' UTR sequence (figure 8).

7. Western blot detection of Luciferase protein content

The extraction method of tobacco protein is described in 4, and western blot is used for detecting the protein content of LUC gene. The internal reference is a PGX-5dual fused HA-labeled REN renilla protein, the primary internal reference antibody is HA-Tag (HA-Tag mouse mAb) of Wuhan Dynah organism, the secondary antibody is Goat anti-mouse (Agrisa), the western blot of the internal reference is consistent with the LUC protein method, and the method comprises the following steps:

(1)20 μ L of the protein sample was mixed with 4 μ L of 5 XSDS-Loding buffer (Beijing gold), and denatured at 99 ℃ for 5 min;

(2) performing polyacrylamide gel electrophoresis on the denatured sample, and performing 90V voltage for 30min and 150V voltage for 1 hour;

(3) cutting a nitrocellulose membrane with the same size as the polyacrylamide gel, six filter papers with the same size as the sponge, and placing the filter papers and the sponge in the film transfer liquid for later use;

(4) treating the cellulose nitrate membrane with anhydrous ethanol for 10-20s, transferring into pure water for 2-3min, and standing to obtain solution for membrane transfer (formula shown below);

(5) a layer of sponge, three layers of filter paper, a nitrocellulose membrane, polyacrylamide gel, three layers of filter paper and a layer of sponge;

(6) placing a clamp into a membrane transferring groove insect, enabling the black surface of the clamp to face the black surface of the groove and the white surface to face the red surface of the groove, adding a membrane transferring liquid, covering the cover, placing the groove into an ice box, carrying out 200mA constant current, and carrying out electrophoresis for 2 h;

(7) sealing with 5% liposuction milk powder for 2h, and washing membrane with TBST formula below) for 3 times, each for 5 min;

(8) adding primary antibody working solution (Agrisa, LUC | Luciferase), incubating at room temperature for 2h, washing membrane with TBST for 3 times, each time for 5 min;

(9) adding secondary antibody working solution (Agrisa, Goat anti-Rabbit), incubating at room temperature for 2h, washing membrane with TBST for 3 times, each time for 5 min;

(10) uniformly spreading the developing solution on the film, and closing the developing box;

(11) opening the developing box in the developing chamber, drawing out a negative film, folding upwards to serve as a mark, firstly closing the developing box for timing exposure for 1min, then turning the negative film up and down, closing the developing box for exposure for 2min, putting the film into a developing instrument, and waiting for a film developing result.

The formula of the film transfer liquid is as follows: 8.8618g of glycine was weighed into a 1L beaker, 60mL of absolute ethanol was added to the beaker, and ddH was added thereto with thorough stirring and dissolution ₂ O the solution was made up to 600 mL.

TBST formula: weigh 8.8g NaCl into a 1L beaker, add 20mL 1M Tris-HCl (pH 8) and 800mL ddH to the beaker ₂ O, fully stirring and dissolving, addingAdding 0.5mL of Tween-20, mixing, adding ddH ₂ O the solution was made up to 1L for further use.

The results are shown in FIG. 8, and the amount of protein of the upstream LUC gene deleted of dORF sequence is significantly reduced compared to the entire 3' UTR sequence.

8. Detection of expression level of LUC Gene by RT-PCR

Total Plant RNA from tobacco plants was extracted using a polysaccharide polyphenol Plant total RNA extraction Kit (purchased from Tiangen, RNAprep Pure Plant Plus Kit (Polysaccharides & Polyphenonics-rich)) and reverse transcribed using a reverse transcription Kit (purchased from Beijing Quanji (EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix) to obtain cDNA. expression of LUC was detected using PCR with primers LUC-F, LUC-R, REN-F, REN-R (Table 1). The results show that there was no significant difference in the transcription level of the LUC gene compared to the complete 3' UTR sequence by deleting the dORF sequence (FIG. 8).

TABLE 1

Name of primer	Primer sequence (5 '-3')
		LUC-F	GGATTACAAGATTCAAAGTGCG
LUC-R	TGATACCTGGCAGATGGAAC
		REN-F	CCTGGGACGAGTGGCCTGACA
REN-R	AGTTGCGGACAATCTGGACGAC

Example 2 analysis of the function of uORF and dORF of other plant species

To demonstrate that The phenomenon of dORF enhancing translation of The upstream encoded gene is widespread in plant species, analysis of The translation efficiency of The DNA sequence and RNA-seq data (Tomato data sources: Hsin-Yen Larry Wu, Gaoyuanan Song, Justin W.Walley, Polly Yingshan Hsu (2019) The Tomato translation line modified by Transcriptome Assembly and Rice Profile plant phosphor. Sep; 181(1): 367-380. Published modified line 2019Jun 27.doi: 10.1104/pp.19.00541; Rice data sources: Yang X, Cui J, SoB, Yu Y, Mo B and Liu L (of conversion High specificity Riborne Ribose, Rice 577. Folson, F.7. and F.11. The results of The analysis were consistent with The results of The first and second plant ORF (Folson DNA) analysis, and The RNA-seq ID No. DNA sequencing, DNA-DNA sequence, DNA sequence, DNA sequence, DNA.

The specific results are shown in FIGS. 9 and 10: the translation efficiency of the gene containing uORF is significantly lower than that of the gene not containing uORF; whereas dORF shows the opposite trend, the translation efficiency of the gene containing dORF is significantly higher compared to the gene not containing dORF.

Sequence listing

<110> Wuhan university

<120> use of dORF in enhancing translation of upstream coding gene

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 564

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 1

gtcgactaaa gcaatacggg ggaatcgaaa gggcacaaga gttcgcaaaa gagaaagctg 60

atattgcaat caagagtctc caatgtcttc ttcaaagcga tttctggtta gggcttgaag 120

atatggtgat gtttaatcta gaaaggattg attagtttaa ctaatccaaa acaagcaaca 180

tgatacatga cagataaata ttgcatgaag ttgaagcctg taccaatata gaacagcttc 240

ttaggatatt aattggttcc ttgtcactgg ttgtatattc atacaaggct ttgagctttg 300

acttgagctc ctagtttcaa tgtcttcaaa ttataaattt gtctgagaaa aaataatttc 360

tctgttaaat taaattgatg aacaataaag tctttgtggt catcaatatt aagctaataa 420

acttctatta tgtatataag gaaacctatg ttataggggt ttctcttttt cttcttaaaa 480

gtatttgtgt ttgacgttta tatgaaaaag tgtgaattgg ctttgattgc tttcaattta 540

taatggttaa tattctagac tagt 564

<210> 2

<211> 35

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 2

atatggtgat gtttaatcta gaaaggattg attag 35

<210> 3

<211> 529

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 3

gtcgactaaa gcaatacggg ggaatcgaaa gggcacaaga gttcgcaaaa gagaaagctg 60

atattgcaat caagagtctc caatgtcttc ttcaaagcga tttctggtta gggcttgaag 120

tttaactaat ccaaaacaag caacatgata catgacagat aaatattgca tgaagttgaa 180

gcctgtacca atatagaaca gcttcttagg atattaattg gttccttgtc actggttgta 240

tattcataca aggctttgag ctttgacttg agctcctagt ttcaatgtct tcaaattata 300

aatttgtctg agaaaaaata atttctctgt taaattaaat tgatgaacaa taaagtcttt 360

gtggtcatca atattaagct aataaacttc tattatgtat ataaggaaac ctatgttata 420

ggggtttctc tttttcttct taaaagtatt tgtgtttgac gtttatatga aaaagtgtga 480

attggctttg attgctttca atttataatg gttaatattc tagactagt 529

<210> 4

<211> 239

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 4

gtcgacagaa agcgaagaag attaccggga cagccgaaga agatgatgag attctctaca 60

tattgataac atttttagaa cctatattgc atgttgttct tcatgttata tacttttgag 120

aacccattgc atatctttct tcatgatata tttctatttt tggaaccaat tgcatatttg 180

aactatttgt agacttcatt caaacatgca aatatattta gttaaaaatg gacactagt 239

<210> 5

<211> 57

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 5

aagcgaagaa gattaccggg acagccgaag aagatgatga gattctctac atattga 57

<210> 6

<211> 182

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 6

gtcgacagat aacattttta gaacctatat tgcatgttgt tcttcatgtt atatactttt 60

gagaacccat tgcatatctt tcttcatgat atatttctat ttttggaacc aattgcatat 120

ttgaactatt tgtagacttc attcaaacat gcaaatatat ttagttaaaa atggacacta 180

gt 182

<210> 7

<211> 1024

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 7

gtcgaccatg ctatatacac aagttagcca ttggattttt gagaaaatat ttctttgtta 60

ttttatttgt tctggagagt atttttggcg gaataggcca aacataggta ggttgtgtta 120

gtactaggtc acagtttatt ccttgattgg atttcatgcg tttgtacaga aaatgaaaaa 180

tcaaatgaag tttgtagatg agagtgcatt ggtcctcttt cagctttctt gatggacctc 240

actagcttgt tcctaagcaa atatatgctg gtaattttgt catatttctc ctcattttag 300

ctttaaacca gatgagttgt catcaaatat tcaactccca agttttaaat tgtgtctcac 360

tccacctatg ctctataaaa ataattttaa ccagtacaaa gttcctgtgt tagttgggtg 420

tcatttacta ttattattgc agagagttga aatctccctt tgaatggtag ttgtcatatg 480

actttgagaa aggatggtgt aattcatcaa cttatataac aatctcaccg gatataagat 540

atctttccaa agtcttatct cctcaaccaa caatggatcc acctcctcta cctccaactc 600

caccaccgac gacaccgctg ctagctccgt cacctccaga aggagggtta tgggaatcat 660

ggtaagatgt tctctccatt gttattgcat tttacttgtg catgaagaaa caaacaggga 720

aacatttctg acatttcaag ggctgctgcc tggttcccta tctgtttgca gtttgtggtt 780

tctgtgttgc tgtggaatat tcagaagctg ctgccctcca ctgtttgaac cagggccacc 840

tcctccgtag atctgcattc ttttttctct ttttggaatg tatgagtatt ttacaaggat 900

ttaattattt ggaacatgat gattggttct tgtggtttgt cattcttctt attatctgct 960

aatctatgta gcaactgaga ttagtgatgc aaaatttatg aatttatagc tttcttctac 1020

tagt 1024

<210> 8

<211> 278

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 8

atggatccac ctcctctacc tccaactcca ccaccgacga caccgctgct agctccgtca 60

cctccagaag gagggttatg ggaatcatgg taagatgttc tctccattgt tattgcattt 120

tacttgtgca tgaagaaaca aacagggaaa catttctgac atttcaaggg ctgctgcctg 180

gttccctatc tgtttgcagt ttgtggtttc tgtgttgctg tggaatattc agaagctgct 240

gccctccact gtttgaacca gggccacctc ctccgtag 278

<210> 9

<211> 746

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 9

gtcgaccatg ctatatacac aagttagcca ttggattttt gagaaaatat ttctttgtta 60

ttttatttgt tctggagagt atttttggcg gaataggcca aacataggta ggttgtgtta 120

gtactaggtc acagtttatt ccttgattgg atttcatgcg tttgtacaga aaatgaaaaa 180

tcaaatgaag tttgtagatg agagtgcatt ggtcctcttt cagctttctt gatggacctc 240

actagcttgt tcctaagcaa atatatgctg gtaattttgt catatttctc ctcattttag 300

ctttaaacca gatgagttgt catcaaatat tcaactccca agttttaaat tgtgtctcac 360

tccacctatg ctctataaaa ataattttaa ccagtacaaa gttcctgtgt tagttgggtg 420

tcatttacta ttattattgc agagagttga aatctccctt tgaatggtag ttgtcatatg 480

actttgagaa aggatggtgt aattcatcaa cttatataac aatctcaccg gatataagat 540

atctttccaa agtcttatct cctcaaccaa caatctgcat tcttttttct ctttttggaa 600

tgtatgagta ttttacaagg atttaattat ttggaacatg atgattggtt cttgtggttt 660

gtcattcttc ttattatctg ctaatctatg tagcaactga gattagtgat gcaaaattta 720

tgaatttata gctttcttct actagt 746

<210> 10

<211> 1977

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 10

gtcgacgaat gagatgtgtg tacggaaaag aatcgatcaa atgttcaata acaagtattc 60

atgcatattg aagatggata gaaagctttg ttggggtgat atatcagatt atcagagtcg 120

aagggaaaag cggtgtaaat aaaaacacct aacagaagcg tgtaacagtg tcattcggac 180

cggctggttt tgcagtggtg aatggatatt tttttgttgg gttagtgcac actttaatgt 240

agtataaaat gttgttttgt tttgtaatac aaatatttgt gttatatctt tttgttcatt 300

gtgtttatgc tatatataca tatcaggttt aaagaattat ttattaacat attaataatt 360

tatgctacat aaataatgca tttattttat ttatattaaa atatattata ttaaaaatgt 420

taatcactgt tagtaaaatt gattaaggtg ttaaaaaaat tgtaataaat aattaccttt 480

tttgtgtaaa taatattata tttgtgtaat agttttcctt ttttctaaag aaagccaaaa 540

agaaagtaaa tcgttggtga ataaattatc aataaatgaa aaaagggtca ataatatttg 600

ctggactccc tccctgaccg tcggtgtttc aaacagaagc agagcaactg ttttggtcgg 660

actcttttgg tggtttgttc cgatgttcaa agattgtggg tattggatct cgttttcttc 720

tcaatgttga cgcgtctgca gagtaacaaa cttttctcca aggtttgtat agttaaatgg 780

ggtttccttt ctacactttc gcttgcgtcg tattatctga cttattgttc tcgcgatctg 840

cgtttttatt tttaggttct tctgagtcgt tacaaaaacg ggtttcccaa tcttatctct 900

gggtctcaat ttttaagagg ttttaacgag attacaaagc ataggttttc tgtaatgtcg 960

ggtgaaaatc taagaagcct atctaacagt gcttccccga ggaattaccg agtcgtagtg 1020

gctgcaactc gtgaaatggg gatagggaaa gatggcaagt tgccatggag attgccttct 1080

gatctcaaat tcttcaagga acttacagtg acaacatcag atcctgagaa gaagaatgct 1140

gtagtaatgg gtagaaaaac ctgggagagt attccacttg agtttagacc tttacccggt 1200

cgcctgaatg ttgtccttac tcgttcccag agttctgata ttacaactgg agaaaatgtt 1260

gtaatatgtg ggagcattcc atcagctttg gaactattag ccgaggttcc ttattgtttt 1320

gcaatagaga aggtgtttgt cattggcggt ggccagatat tcaggtagat tttttagtaa 1380

aagttgttga atttcattgc atatttgttg gggaaagata atgttttgat gttttacaat 1440

gcagggaaac actcaatgct tcaggttgcg aagccattca cattactgaa attgggacaa 1500

gcattgaatg cgataccttc attccttcaa ttgactcgtc ttgtttccag ctgtggtact 1560

cttcgaagcc attggaagaa aataatgtcc ggttttcatt tgcaacttat gttcgtgtta 1620

gatctaggac aactgataat tatgaggtaa aagacttgag tttcttgccc aggatgattg 1680

ttgagagacg agatgaatga gtcaattagt aaataatact gagacttgtt catgaaacta 1740

tctcaagtga caagcaagac ccttgactgg ttagatacag aattcatttg cctaggtagt 1800

cttaaacctt ggttctctat gactctactg ctctttgcct tacattttat tgttgttgct 1860

gatgtttaaa tgtaaatatg agcatcatcc ccagtccacg ttgtgatttt gtacaatgta 1920

agtctatctt tgcagatctt ttcatcttct tatataacta aggtatttac tactagt 1977

<210> 11

<211> 48

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 11

atgttcaaag attgtgggta ttggatctcg ttttcttctc aatgttga 48

<210> 12

<211> 1929

<212> DNA

<213> Asian cotton (Asiatic cotton)

<400> 12

gtcgacgaat gagatgtgtg tacggaaaag aatcgatcaa atgttcaata acaagtattc 60

atgcatattg aagatggata gaaagctttg ttggggtgat atatcagatt atcagagtcg 120

aagggaaaag cggtgtaaat aaaaacacct aacagaagcg tgtaacagtg tcattcggac 180

cggctggttt tgcagtggtg aatggatatt tttttgttgg gttagtgcac actttaatgt 240

agtataaaat gttgttttgt tttgtaatac aaatatttgt gttatatctt tttgttcatt 300

gtgtttatgc tatatataca tatcaggttt aaagaattat ttattaacat attaataatt 360

tatgctacat aaataatgca tttattttat ttatattaaa atatattata ttaaaaatgt 420

taatcactgt tagtaaaatt gattaaggtg ttaaaaaaat tgtaataaat aattaccttt 480

tttgtgtaaa taatattata tttgtgtaat agttttcctt ttttctaaag aaagccaaaa 540

agaaagtaaa tcgttggtga ataaattatc aataaatgaa aaaagggtca ataatatttg 600

ctggactccc tccctgaccg tcggtgtttc aaacagaagc agagcaactg ttttggtcgg 660

actcttttgg tggtttgttc cgcgcgtctg cagagtaaca aacttttctc caaggtttgt 720

atagttaaat ggggtttcct ttctacactt tcgcttgcgt cgtattatct gacttattgt 780

tctcgcgatc tgcgttttta tttttaggtt cttctgagtc gttacaaaaa cgggtttccc 840

aatcttatct ctgggtctca atttttaaga ggttttaacg agattacaaa gcataggttt 900

tctgtaatgt cgggtgaaaa tctaagaagc ctatctaaca gtgcttcccc gaggaattac 960

cgagtcgtag tggctgcaac tcgtgaaatg gggataggga aagatggcaa gttgccatgg 1020

agattgcctt ctgatctcaa attcttcaag gaacttacag tgacaacatc agatcctgag 1080

aagaagaatg ctgtagtaat gggtagaaaa acctgggaga gtattccact tgagtttaga 1140

cctttacccg gtcgcctgaa tgttgtcctt actcgttccc agagttctga tattacaact 1200

ggagaaaatg ttgtaatatg tgggagcatt ccatcagctt tggaactatt agccgaggtt 1260

ccttattgtt ttgcaataga gaaggtgttt gtcattggcg gtggccagat attcaggtag 1320

attttttagt aaaagttgtt gaatttcatt gcatatttgt tggggaaaga taatgttttg 1380

atgttttaca atgcagggaa acactcaatg cttcaggttg cgaagccatt cacattactg 1440

aaattgggac aagcattgaa tgcgatacct tcattccttc aattgactcg tcttgtttcc 1500

agctgtggta ctcttcgaag ccattggaag aaaataatgt ccggttttca tttgcaactt 1560

atgttcgtgt tagatctagg acaactgata attatgaggt aaaagacttg agtttcttgc 1620

ccaggatgat tgttgagaga cgagatgaat gagtcaatta gtaaataata ctgagacttg 1680

ttcatgaaac tatctcaagt gacaagcaag acccttgact ggttagatac agaattcatt 1740

tgcctaggta gtcttaaacc ttggttctct atgactctac tgctctttgc cttacatttt 1800

attgttgttg ctgatgttta aatgtaaata tgagcatcat ccccagtcca cgttgtgatt 1860

ttgtacaatg taagtctatc tttgcagatc ttttcatctt cttatataac taaggtattt 1920

actactagt 1929

<210> 13

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atgatgaaga cgactatgac tttggtgtgg attatggatt acaaggacga cgatgacaag 60

tga 63

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggattacaag attcaaagtg cg 22

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tgatacctgg cagatggaac 20

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cctgggacga gtggcctgac a 21

<210> 17

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

agttgcggac aatctggacg ac 22

Claims (6)

1. Use of a dORF from a plant for enhancing translation of an upstream coding gene.

2. Use according to claim 1, characterized in that: the plant comprises monocotyledons and dicotyledons.

3. Use according to claim 1, characterized in that: the plant comprises Asian cotton, rice and tomato.

4. Use according to claim 1, characterized in that: the sequence of dORF includes the sequence shown in SEQ ID NO.2, SEQ ID NO.5, SEQ ID NO.8 and SEQ ID NO. 11.

5. A method for enhancing the translation efficiency of a target gene, comprising: the method is to insert the dORF of the plant into the 3' UTR region of the target gene.

6. A method of enhancing the translation efficiency of a target gene according to claim 5, wherein: the sequence of dORF includes the sequence shown in SEQ ID NO.2, SEQ ID NO.5, SEQ ID NO.8 and SEQ ID NO. 11.

Images