CN114828830A

CN114828830A - Pharmaceutical composition and treatment agent

Info

Publication number: CN114828830A
Application number: CN202080085055.0A
Authority: CN
Inventors: 惠口豊; 野吕正树; 金海俊; 井本淳一
Original assignee: Fujifilm Corp; Bonac Corp
Current assignee: Fujifilm Corp; Bonac Corp
Priority date: 2019-12-10
Filing date: 2020-12-09
Publication date: 2022-07-29
Also published as: JPWO2021117770A1; WO2021117770A1

Abstract

The present invention addresses the problem of providing a pharmaceutical composition and a treatment agent that combine an artificial siRNA capable of inhibiting the expression of a hepatitis B virus gene and a lipid that is excellent in nucleic acid delivery. The present invention provides a pharmaceutical composition comprising an artificial siRNA capable of inhibiting expression of a hepatitis b virus gene, a lipid which is a compound represented by formula (1) or a salt thereof, cholesterol, and a lipid having a polyethylene glycol structure, wherein the artificial siRNA comprises a nucleic acid molecule comprising a base sequence represented by the following sequence a, and in the sequence a, P represents a specific linker molecule. In the formula (1), R ² ～R ¹² A, b, c and d have the meanings defined in the specification. (sequence A)5 '-CGUCUGUGCCUUCUCAUCUUCAU-P-AUGAAGAUGAGAAGGCACAGACGGG-3'

Description

Pharmaceutical composition and treatment agent

Technical Field

The present invention relates to a pharmaceutical composition and a treatment agent containing a nucleic acid molecule and a lipid that effectively inhibit the expression of Hepatitis B Virus (HBV) genes.

Background

Hepatitis b virus together with hepatitis c virus is the main cause of chronic hepatitis. Among the current treatments for chronic hepatitis b, there are Interferon (IFN) therapy and nucleic acid analogue formulation therapy. The effective rate of IFN therapy is limited to 30-40% and is accompanied by strong side effects. Another nucleic acid analog preparation improves liver function by silencing hepatitis upon administration, but it must be taken for a long period of time since hepatitis recurs in most cases due to withdrawal. Therefore, development of novel therapeutic agents different from the conventional therapeutic methods is required (non-patent documents 1 and 2).

Non-patent document 3 summarizes the possible mechanism of action of a therapeutic agent for chronic hepatitis b. Among them, the inhibition of translation of whole viral proteins based on siRNA is expected to completely block the function as HBV virus.

Nucleic acid drugs are expected to be next-generation drugs, targeting molecules such as mRNA and miRNA that cannot be considered in conventional low-molecular drugs and antibody drugs.

On the other hand, since a technology capable of delivering nucleic acids to cells has been developed, the development of nucleic acid drugs is active. As one of the nucleic acid delivery techniques, a method of administering nucleic acid-containing particles in which nucleic acid is contained in particles (liposome or lipid particle) is known. In this technique, nucleic acid-containing particles are prepared using a lipid having an amino group or the like and becoming a cation at low pH, and delivery of nucleic acid is achieved by imparting an appropriate charge to the particles. For example, as a compound contained in lipid particles, patent document 1 discloses a compound having an ester group, an acetal group, or the like as a linking group for linking an aliphatic group and an amino group. Patent document 2 discloses a compound having a vinyloxy group, an amide group, an oxime group, or the like as a linking group for linking an aliphatic group and an amino group. In the present specification, a lipid having an amino group or the like and being cationic at low pH may be referred to as a cationic lipid.

In addition, studies have been made to change the type and composition ratio of the lipid compound used in the production of the nucleic acid-containing particles. Patent document 3 describes a nucleic acid-lipid particle including: (a) a nucleic acid; (b) a cationic lipid constituting from about 50 mol% to about 85 mol% of the total lipid present in the particle; (c) non-cationic lipid constituting about 13 mol% to about 49.5 mol% of the total lipid present in the particle; and (d) a complexed lipid that inhibits aggregation of the particles comprising from about 0.5 mol% to about 2 mol% of the total lipid present in the particles. Patent document 4 describes a lipid preparation containing 40 to 65% of a cationic lipid having a specific structure, 5 to 10% of a neutral lipid, 25 to 40% of a sterol, and 0.5 to 10% of a PEG or PEG-modified lipid.

Documents of the prior art

Patent document

Patent document 1: international laid-open publication No. 2010/054401 pamphlet

Patent document 2: international laid-open publication No. 2010/054405 pamphlet

Patent document 3: international laid-open publication No. 2009/127060 pamphlet

Patent document 4: international laid-open publication No. 2010/144740 pamphlet

Non-patent document

Non-patent document 1: gastroenterology & Hepatology 2016; 12(11)679-689

Non-patent document 2: journal of Hepatology 2016; 64, S41-S48

Non-patent document 3: cold Spring Harb Perspectrum Med.2015; 5(4) a021501

Disclosure of Invention

Problems to be solved by the invention

For the treatment of hepatitis B, nucleic acid drugs that can strongly inhibit the proliferation of hepatitis B virus are desired.

On the other hand, a technique for delivering nucleic acids using a lipid having an amino group is not sufficient, and a technique capable of delivering nucleic acids more efficiently is required.

Means for solving the problems

Accordingly, an object of the present invention is to provide a pharmaceutical composition and a treatment agent, the pharmaceutical composition combining an artificial siRNA capable of inhibiting expression of a hepatitis b virus gene and a lipid excellent in nucleic acid delivery, wherein the artificial siRNA includes a nucleic acid molecule composed of a base sequence represented by the following sequence a.

(sequence A)5 '-CGUCUGUGCCUUCUCAUCUUCAU-P-AUGAAGAUGAGAAGGCACAGACGGG-3'

That is, means for solving the problem are as follows.

[1] A pharmaceutical composition comprising an artificial siRNA capable of inhibiting the expression of a hepatitis B virus gene, a lipid which is a compound represented by formula (1) or a salt thereof, cholesterol, and a lipid having a polyethylene glycol structure, wherein the artificial siRNA comprises a nucleic acid molecule comprising a base sequence represented by the following sequence A.

(sequence A)

5’-CGUCUGUGCCUUCUCAUCUUCAU-P-AUGAAGAUGAGAAGGCACAGACGGG-3’

In the formula, P represents:

[ chemical formula 1]

[ chemical formula 2]

In the formula, X represents-NR ¹ -or-O-,

R ¹ represents a hydrogen atom, a C6-24 hydrocarbon group, or R ²¹ -L ¹ -R ²² -a group represented by R ²¹ Represents a C1-24 hydrocarbon group, L ¹ represents-O (CO) O-, -O (CO) -, - (CO) O-, -O, or

[ chemical formula 3]

R ²² Represents a C1-18 hydrocarbon linking group belonging to a divalent linking group,

R ² and R ³ Each independently represents a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or R ³¹ -L ² -R ³² -a group represented by R ³¹ Represents a C1-24 hydrocarbon group, L ² represents-O (CO) O-, -O (CO) -, - (CO) O-, -O, or

[ chemical formula 4]

R ³² Represents a C1-18 hydrocarbon linking group belonging to a divalent linking group,

R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ⁹ 、R ¹⁰ 、R ¹¹ and R ¹² Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms which may be substituted,

R ⁴ and R ⁵ 、R ¹⁰ And R ⁵ 、R ⁵ And R ¹² 、R ⁴ And R ⁶ 、R ⁵ And R ⁶ 、R ⁶ And R ⁷ 、R ⁶ And R ¹⁰ 、R ¹² And R ⁷ And R ⁷ And R ⁸ Any one or more of which may be connected to each other to form a 4-to 7-membered ring which may contain an O atom,

the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is a hydroxyl group, a carboxyl group or-NR ⁴⁵ R ⁴⁶ Amino, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ A group shown, R ⁴¹ 、R ⁴² 、R ⁴³ 、R ⁴⁴ 、R ⁴⁵ And R ⁴⁶ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms,

the substituent on the substituted or unsubstituted aryl and the substituted or unsubstituted heteroaryl is alkyl, hydroxyl, carboxyl, -NR with a carbon number of 1-18 ⁴⁵ R ⁴⁶ Amino, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ A group shown, R ⁴¹ 、R ⁴² 、R ⁴³ 、R ⁴⁴ 、R ⁴⁵ And R ⁴⁶ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms,

a. b, c and d independently represent an integer of 0 to 3, wherein a + b is 1 or more and c + d is 1 or more.

[2] The pharmaceutical composition according to [1], wherein the lipid having a polyethylene glycol structure is a lipid having a diacylglycerol structure and a polyethylene glycol structure.

[3] The pharmaceutical composition according to any one of [1] or [2], wherein the content of the lipid as the compound represented by formula (1) or a salt thereof is 40 to 70 mol% with respect to the total lipid.

[4] The pharmaceutical composition according to any one of [1] to [3], wherein the content of cholesterol is 25 to 60 mol% based on the total lipid.

[5] The pharmaceutical composition according to any one of [1] to [4], wherein the content of the lipid having a polyethylene glycol structure is 0.5 to 10 mol% with respect to the total lipid.

[6] The pharmaceutical composition according to any one of [1] to [5], wherein the content of the artificial siRNA capable of inhibiting the expression of a hepatitis B virus gene is 1 to 25% by mass based on the total lipid.

[7] A therapeutic agent for hepatitis B, which comprises the pharmaceutical composition according to any one of [1] to [6 ].

[8] A remedy for liver cirrhosis or liver cancer, which comprises the pharmaceutical composition according to any one of [1] to [6 ].

[A] A method for treating hepatitis B, which comprises the step of administering the pharmaceutical composition according to any one of [1] to [6] to a subject.

[B] A method for treating liver cirrhosis or liver cancer, which comprises a step of administering the pharmaceutical composition according to any one of [1] to [6] to a subject.

[C] The pharmaceutical composition according to any one of [1] to [6], which is used for the treatment of hepatitis B.

[D] The pharmaceutical composition according to any one of [1] to [6], which is used in the treatment of liver cirrhosis or liver cancer.

[E] Use of the pharmaceutical composition according to any one of [1] to [6] for producing a therapeutic agent for hepatitis B.

[F] Use of the pharmaceutical composition according to any one of [1] to [6] for producing a treatment agent for liver cirrhosis or liver cancer.

Effects of the invention

By using the pharmaceutical composition of the present invention, the expression of hepatitis b virus genes can be suppressed, and a therapeutic effect on hepatitis b and related diseases can be effectively exerted.

Drawings

Fig. 1 shows relative values of cell activity (cell activity) against HBV assay in PXB cells 27 days after infection versus no agent added wells.

Detailed Description

The pharmaceutical composition of the present invention comprises an artificial siRN a (hereinafter, sometimes referred to as artificial siRNA) capable of inhibiting expression of a hepatitis b virus gene, a lipid which is a compound represented by formula (1) or a salt thereof, a nonionic lipid, and a lipid having a nonionic hydrophilic polymer structure, wherein the artificial siRN a comprises a nucleic acid molecule comprising a base sequence represented by sequence a.

The pharmaceutical composition of the present invention preferably contains lipid particles. Lipid particles refer to particles composed of components classified as lipids.

The structure of the lipid particle may be any structure selected from a lipid aggregate obtained by aggregating lipids, a micelle, and a liposome, but is not limited thereto.

When the pharmaceutical composition of the present invention contains lipid particles, the lipid constituting the lipid particles preferably contains a lipid which is a compound represented by formula (1) or a salt thereof, a nonionic lipid, and a lipid having a nonionic hydrophilic polymer structure. In addition, the artificial siRNA is preferably encapsulated in the lipid particle.

The form of the lipid particle can be confirmed by observation with an electron microscope, structural analysis with X-rays, or the like. For example, it can be confirmed that a lipid particle has a structure having a lipid bilayer membrane structure (lamellar structure) and an inner water layer, such as a liposome, or has a structure having a core with a high electron density inside the particle and filled with a constituent component represented by a lipid, by a method using Cryo transmission electron microscope observation (CryoTEM method). The presence or absence of a lipid bilayer membrane structure (lamellar structure) of lipid particles can also be confirmed by small angle X-ray scattering (SAXS) measurement.

The particle size of the lipid particle is not particularly limited, but is preferably 10 to 1000nm, more preferably 30 to 500nm, and further preferably 50 to 250 nm. The particle diameter of the lipid particle can be measured by a usual method (for example, dynamic light scattering method, laser diffraction method, etc.).

The pharmaceutical composition of the present invention contains an artificial siRNA capable of inhibiting the expression of a hepatitis B virus gene. The artificial siRNA comprises a nucleic acid molecule consisting of a base sequence represented by the following sequence A.

Sequence A:

5 '-CGUCUGUGCCUUCUCAUCUUCAU (SEQ ID NO: 1) -P-AUGAAGAUGAGAAGGCACAGACGGG (SEQ ID NO: 2) -3'

In the formula, P represents:

[ chemical formula 5]

The nucleic acid molecule comprising the base sequence represented by the sequence A can be synthesized by a commercially available nucleic acid synthesizer based on the phosphoramidite method. As the RNA amidate (RNA Amidite), for example, EMM amidate (international publication No. 2013/027843) can be used, and deprotection of amidate can be performed by a conventional method. The linker molecule represented by P can be introduced into the oligomer by using the following L-proline diamide amidate.

[ chemical formula 6]

In the pharmaceutical composition of the present invention, the content of the artificial siRNA with respect to the total lipid is preferably 1% by mass to 25% by mass, more preferably 1.5% by mass to 20% by mass, and still more preferably 2% by mass to 15% by mass.

The pharmaceutical composition of the present invention contains a lipid as a compound represented by formula (1) or a salt thereof.

[ chemical formula 7]

In the formula, X represents-NR ¹ -or-O-,

[ chemical formula 8]

[ chemical formula 9]

R ⁴ and R ⁵ 、R ¹⁰ And R ⁵ 、R ⁵ And R ¹² 、R ⁴ And R ⁶ 、R ⁵ And R ⁶ 、R ⁶ And R ⁷ 、R ⁶ And R ¹⁰ 、R ¹² And R ⁷ And R ⁷ And R ⁸ In (1)More than one group can be connected with each other to form a 4-7 membered ring which can contain O atom,

the substituent of the substituted or unsubstituted aryl and the substituted or unsubstituted heteroaryl is alkyl, hydroxyl, carboxyl, -NR with a carbon number of 1-18 ⁴⁵ R ⁴⁶ Amino, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ A group shown, R ⁴¹ 、R ⁴² 、R ⁴³ 、R ⁴⁴ 、R ⁴⁵ And R ⁴⁶ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms,

As R ¹ In the (C) C6-C24 hydrocarbon group, and R ² And R ³ The hydrocarbon group having 3 to 24 carbon atoms in (b) is preferably an alkyl group, an alkenyl group or an alkynyl group, and more preferably an alkyl group or an alkenyl group. The alkyl group having 6 to 24 carbon atoms and the alkyl group having 3 to 24 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. The alkyl group having 6 to 24 carbon atoms is preferably an alkyl group having 6 to 20 carbon atoms, and the alkyl group having 3 to 24 carbon atoms is more preferably an alkyl group having 6 to 20 carbon atoms. Specific examples thereof include hexyl group, heptyl group, octyl group, nonyl group, decyl group, undecyl group, dodecyl group, tridecyl group, trimethyldodecyl group (preferably 3,7, 11-trimethyldodecyl group), tetradecyl group, pentadecyl group, hexadecyl group, tetramethylhexadecyl group (preferably 3,7,11, 15-tetramethylhexadecyl group), heptadecyl group, octadecyl group, nonadecyl group, and eicosyl group. The alkenyl group having 6 to 24 carbon atoms and the alkenyl group having 3 to 24 carbon atoms may be a straight chain or a branched chain,may be a chain or ring. The alkenyl group having 6 to 24 carbon atoms is preferably an alkenyl group having 6 to 20 carbon atoms, and the alkenyl group having 3 to 24 carbon atoms is more preferably an alkenyl group having 6 to 20 carbon atoms, and specific examples thereof include hexenyl, heptenyl, octenyl, nonenyl, decenyl, undecenyl, dodecenyl, dodecadienyl, tridecenyl, tetradecenyl, pentadecenyl, hexadecenyl (preferably (Z) -hexadec-9-enyl), hexadecadienyl, heptadecenyl (preferably (Z) -heptadec-8-enyl), heptadecadienyl (preferably (8Z,11Z) -heptadec-8, 11-dienyl), octadecenyl (preferably (Z) -octadec-9-enyl), and octadecadienyl (preferably (9Z,12Z) -octadeca-9, 12-dienyl), nonadecenyl, eicosenyl (preferably (Z) -eicosa-11-enyl), eicosadienyl (preferably (11,14) -eicosa-11, 14-dienyl), and the like. The alkynyl group having 6 to 24 carbon atoms is preferably an alkynyl group having 6 to 20 carbon atoms, and the alkynyl group having 3 to 24 carbon atoms is more preferably an alkynyl group having 6 to 20 carbon atoms. Specific examples thereof include hexynyl, heptynyl, octynyl, nonynyl, decynyl, undecylynyl, dodecynyl, tetradecynyl, pentadecynyl, hexadecylynyl, heptadecynyl, and octadecynyl. Preferably, the alkenyl groups each have 1 or 2 double bonds, and preferably the alkynyl groups each have 1 or 2 triple bonds.

As R ²¹ And R ³¹ The hydrocarbon group having 1 to 24 carbon atoms in (A) is preferably an alkyl group having 10 to 24 carbon atoms, an alkenyl group having 10 to 24 carbon atoms or an alkynyl group having 10 to 24 carbon atoms. The alkyl group having 10 to 24 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. The alkyl group having 10 to 24 carbon atoms is preferably an alkyl group having 12 to 24 carbon atoms. Specific examples thereof include decyl, undecyl, dodecyl, tridecyl, trimethyldodecyl (preferably 3,7, 11-trimethyldodecyl), tetradecyl, pentadecyl, hexadecyl, tetramethylhexadecyl (preferably 3,7,11, 15-tetramethylhexadecyl), heptadecyl, octadecyl, 2-butylhexyl, 2-butyloctyl, 1-pentylhexyl, 2-pentylheptyl, 3-pentyloctyl, 1-hexylheptyl, 1-hexylnonyl, 2-hexyloctyl, 2-hexyldecyl, 3-hexylnonyl, 1-heptyloctyl, 2-heptyloctyl-heptylnonyl, 2-heptylundecyl, 3-heptyldecyl, 1-octylnonyl, 2-octyldecyl, 2-octyldodecyl, 3-octylundecyl, 2-nonylundecyl, 3-nonyldodecyl, 2-decyldodecyl, 2-decyltetradecyl, 3-decyltridecyl, 2- (4, 4-dimethylpentan-2-yl) -5,7, 7-trimethyloctyl and the like. The alkenyl group having 10 to 24 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. Specific examples thereof include decenyl group, undecenyl group, dodecenyl group, tridecenyl group (preferably, (Z) -tridec-8-enyl group), tetradecenyl group (preferably tetradec-9-enyl group), pentadecenyl group (preferably (Z) -pentadec-8-enyl group), hexadecenyl group (preferably (Z) -hexadec-9-enyl group), hexadecadienyl group, heptadecenyl group (preferably (Z) -heptadec-8-enyl group), heptadecenyl group (preferably (8Z,11Z) -heptadec-8, 11-dienyl group), octadecenyl group (preferably (Z) -octadec-9-enyl group), octadecadienyl group (preferably (9Z,12Z) -octadec-9, 12-dienyl) and the like. The alkynyl group having 10 to 24 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. Specific examples thereof include decynyl, undecylenyl, dodecylenyl, tetradecynyl, pentadecynyl, hexadecylenyl, heptadecynyl, and octadecynyl. Preferably, the alkenyl groups each have 1 or 2 double bonds, and preferably the alkynyl groups each have 1 or 2 triple bonds.

As R ²² And R ³² The C1-18 hydrocarbon linking group as the divalent linking group in (1) is preferably C1-18 alkylene or C2-18 alkenylene. The alkylene group having 1 to 18 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. The carbon number is preferably 1 to 12, more preferably 1 to 10, and further preferably 2 to 10. Specific examples thereof include methylene, ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, heptamethylene, octamethylene, nonamethylene, decamethylene, undecamethylene, dodecamethylene, and the like. The C2-18 alkenylene group may be a linear chain or a branched chain, or a chain or a ring. The number of carbon atoms is preferably 1 to 12, more preferably 2 to 10.

As L ¹ Preferred ranges of (A) are-O (CO) O-, -O (CO), or- (CO) O-, more preferably-O (CO) -or- (CO) O-.

As L ² Preferred ranges of (A) are-O (CO) O-, -O (CO), or- (CO) O-, more preferably-O (CO) -or- (CO) O-.

R ⁴ 、R ⁶ 、R ⁹ 、R ¹⁰ 、R ¹¹ And R ¹² The alkyl group having 1 to 18 carbon atoms which may be substituted in (1 to 18) may be a linear or branched alkyl group, or a chain or cyclic alkyl group. The carbon number is preferably 1 to 12. Specific examples thereof include methyl, ethyl, propyl, isopropyl, cyclopropyl, butyl, isobutyl, tert-butyl, cyclobutyl, pentyl, cyclopentyl, hexyl, cyclohexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl and the like. The substituent when the alkyl group has a substituent is preferably a hydroxyl group, a carboxyl group, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ The group shown is more preferably-O (CO) -R ⁴² Or- (CO) O-R ⁴³ The groups shown.

R ⁵ 、R ⁷ And R ⁸ The alkyl group having 1 to 18 carbon atoms which may be substituted in (1 to 18) may be a linear or branched alkyl group, or a chain or cyclic alkyl group. The carbon number is preferably 1 to 12, more preferably 1 to 8. Specific examples thereof include methyl, ethyl, propyl, isopropyl, cyclopropyl, butyl, isobutyl, tert-butyl, cyclobutyl, pentyl, cyclopentyl, hexyl, cyclohexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl and the like. The substituent when the alkyl group has a substituent is preferably a hydroxyl group, a carboxyl group, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ The group shown is more preferably-O (CO) -R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ The groups shown.

Examples of the 4 to 7-membered ring which may contain an O atom include an azetidine ring, a pyrrolidine ring, a piperidine ring, a morpholine ring and an azepane ring, and a 6-membered ring is preferable, and a piperidine ring and a morpholine ring are preferable.

With respect to R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ⁹ 、R ¹⁰ 、R ¹¹ And R ¹² The aryl group in the case where the substituent of the optionally substituted alkyl group having 1 to 18 carbon atoms is a substituted or unsubstituted aryl group is preferably 6 to 22 carbon atoms, more preferably 6 to 18 carbon atoms, and still more preferably 6 to 10 carbon atoms. Specific examples thereof include phenyl, naphthyl, anthryl, phenanthryl and the like. As the substituent on the aryl group, an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, -NR is preferable ⁴⁵ R ⁴⁶ Amino, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ The group shown is more preferably a hydroxyl group or a carboxyl group. Specific examples of the substituted aryl group include a hydroxyphenyl group and a carboxyphenyl group.

With respect to R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ⁹ 、R ¹⁰ 、R ¹¹ And R ¹² The heteroaryl group in the case where the substituent of the optionally substituted alkyl group having 1 to 18 carbon atoms is a substituted or unsubstituted heteroaryl group preferably has 1 to 12 carbon atoms, more preferably 1 to 6 carbon atoms. Specific examples thereof include pyridyl, pyrazolyl, imidazolyl, benzimidazolyl, thiazolyl, oxazolyl and the like. The substituent on the heteroaryl group is preferably an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group or a group, -NR ⁴⁵ R ⁴⁶ Amino, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ The group shown is more preferably a hydroxyl group or a carboxyl group. Specific examples of the substituted or unsubstituted heteroaryl group include a hydroxypyridinyl group, a carboxypyridinyl group, and a pyridonyl group.

As R ⁴¹ 、R ⁴² 、R ⁴³ 、R ⁴⁴ 、R ⁴⁵ And R ⁴⁶ The hydrocarbon group of (1) to (18) carbon atoms is preferably an alkyl group of 1 to (18) carbon atoms, an alkenyl group of 2 to (18) carbon atoms or an alkynyl group of 2 to (18) carbon atoms, and more preferably an alkyl group of 1 to (18) carbon atoms or an alkenyl group of 2 to (18) carbon atoms. The alkyl group having 1 to 18 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. Carbon number is preferred3 to 18, more preferably 5 to 18. Specific examples thereof include propyl, isopropyl, cyclopropyl, butyl, isobutyl, tert-butyl, cyclobutyl, pentyl, cyclopentyl, hexyl, cyclohexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, trimethyldodecyl (preferably 3,7, 11-trimethyldodecyl), tetradecyl, pentadecyl, hexadecyl, heptadecyl, and octadecyl. The alkenyl group having 2 to 18 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. The carbon number is preferably 3 to 18, more preferably 5 to 18. Specifically, there may be mentioned allyl, isoprenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl (preferably (Z) -2-nonenyl or (E) -2-nonenyl), decenyl, undecenyl, dodecenyl, dodecadienyl, tridecenyl (preferably (Z) -tridec-8-enyl), tetradecenyl (preferably tetradec-9-enyl), pentadecenyl (preferably (Z) -pentadec-8-enyl), hexadecenyl (preferably (Z) -hexadec-9-enyl), hexadecadienyl, heptadecenyl (preferably (Z) -heptadec-8-enyl), heptadecadienyl (preferably (8Z,11Z) -heptadec-8, 11-dienyl), octadecenyl (preferably (Z) -octadec-9-enyl), octadecadienyl (preferably (9Z,12Z) -octadec-9, 12-dienyl), etc. The alkynyl group having 2 to 18 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. The carbon number is preferably 3 to 18, more preferably 5 to 18. Specific examples thereof include propargyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl, decynyl, undecylynyl, dodecylynyl, tetradecynyl, pentadecynyl, hexadecylynyl, heptadecynyl, and octadecynyl.

X represents-NR ¹ When is, R ¹ Preferably represents a C6-24 hydrocarbon group, or R ²¹ -L ¹ -R ²² -a group as shown. In this case, R is preferably ² And R ³ One of them is a hydrogen atom; r ² And R ³ The other of the two (C) represents a C6-24 hydrocarbon group, or R ³¹ -L ² -R ³² -a group as shown.

When X represents-O-, R ² And R ³ Each independently represents a C6-24 hydrocarbon group or R ³¹ -L ² -R ³² -a group as shown.

R ⁴ 、R ⁶ 、R ⁹ 、R ¹⁰ 、R ¹¹ And R ¹² Preferably a hydrogen atom.

R ⁵ Preferably hydrogen atom, C1-18 alkyl, optionally substituted by-O (CO) -R ⁴² Or- (CO) O-R ⁴³ Substituted alkyl group having 1 to 18 carbon atoms, alkyl group having 1 to 18 carbon atoms which may be substituted with aryl group, alkyl group having 1 to 18 carbon atoms which may be substituted with hydroxyl group, and when it is alkyl group, it may be bonded with R ⁴ 、R ⁶ 、R ¹⁰ And R ¹² Are linked to each other to form a ring which may contain an O atom. Wherein, the preferred alkyl group is C1-18 alkyl group, which may be substituted by-O (CO) -R ⁴² Or- (CO) O-R ⁴³ Substituted alkyl group having 1 to 18 carbon atoms, alkyl group having 1 to 12 carbon atoms which may be substituted with aryl group, alkyl group having 1 to 8 carbon atoms which may be substituted with hydroxyl group, more preferably alkyl group having 1 to 18 carbon atoms, alkyl group which may be substituted with-O (CO) -R ⁴² Or- (CO) O-R ⁴³ A substituted alkyl group having 1 to 18 carbon atoms.

Preferably R ⁷ And R ⁸ Each independently hydrogen atom, C1-C18 hydrocarbon group, may be replaced by-O (CO) -R ⁴² Or- (CO) O-R ⁴³ A substituted alkyl group having 1 to 18 carbon atoms, an alkyl group having 1 to 8 carbon atoms which may be substituted with an aryl group, an alkyl group having 1 to 8 carbon atoms which may be substituted with a hydroxyl group, or R ⁷ And R ⁸ Are connected to form a 4-7 membered ring which may contain an O atom.

R ⁵ And R ⁷ Or R ⁸ Do not connect to each other and do not form a ring.

a + b is preferably 1 or 2, more preferably 1. c + d is preferably 1 or 2, more preferably 1.

The compound represented by the formula (1) is preferably a compound represented by the following formula (1-1).

[ chemical formula 10 ]

R ²⁴ Represents a hydrogen atom, a C6-24 hydrocarbon group, or R ²¹ -L ¹ -R ²² -a group represented by R ²¹ Represents a C1-24 hydrocarbon group, L ¹ represents-O (CO) O-, -O (CO) -, - (CO) O-, -O, or

[ chemical formula 11]

R ²² Represents a divalent hydrocarbon linking group having 1 to 18 carbon atoms.

R ²⁵ Represents a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or R ³¹ -L ² -R ³² -a group represented by R ³¹ Represents a C1-24 hydrocarbon group, L ² represents-O (CO) O-, -O (CO) -, - (CO) O-, -O, or

[ chemical formula 12]

R ³² Represents a divalent hydrocarbon linking group having 1 to 18 carbon atoms.

R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ¹⁰ And R ¹² Each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms,

R ⁴ and R ⁵ 、R ¹⁰ And R ⁵ 、R ⁵ And R ¹² 、R ⁴ And R ⁶ 、R ⁵ And R ⁶ 、R ⁶ And R ⁷ 、R ⁶ And R ¹⁰ 、R ¹² And R ⁷ And R ⁷ And R ⁸ Any one or more of them may be connected to each other to form a 4-7 membered ring which may contain an O atom. Among them, R is preferred ⁵ And R ⁷ Or R ⁸ Do not connect to each other and do not form a ring.

Number of carbons which may be substitutedThe substituent on the alkyl group of 1-18 is hydroxyl, carboxyl, -NR ⁴⁵ R ⁴⁶ Amino, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ A group shown, R ⁴¹ 、R ⁴² 、R ⁴³ 、R ⁴⁴ 、R ⁴⁵ And R ⁴⁶ Each independently represents a C1-18 hydrocarbon group, and the substituents on the substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl are C1-18 alkyl, hydroxy, carboxy, -NR ⁴⁵ R ⁴⁶ Amino, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ A group shown, R ⁴¹ 、R ⁴² 、R ⁴³ 、R ⁴⁴ 、R ⁴⁵ And R ⁴⁶ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

R in the formula (1-1) ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ¹⁰ And R ¹² The definitions and preferred ranges of (A) are the same as in formula (1).

R of the formula (1-1) ²⁴ Preferably an alkyl group or alkenyl group having 6 to 24 carbon atoms. The alkyl group having 6 to 24 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. The alkyl group having 6 to 24 carbon atoms is preferably an alkyl group having 8 to 20 carbon atoms. Specific examples thereof include octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, trimethyldodecyl (preferably 3,7, 11-trimethyldodecyl), tetradecyl, pentadecyl, hexadecyl, tetramethylhexadecyl (preferably 3,7,11, 15-tetramethylhexadecyl), heptadecyl, octadecyl, nonadecyl and eicosyl groups. The alkenyl group having 6 to 24 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. The alkenyl group having 6 to 24 carbon atoms is preferably an alkenyl group having 8 to 20 carbon atoms. Specific examples thereof include octenyl, nonenyl, decenyl, undecenyl, dodecenyl, tridecenyl, tetradecenyl, pentadecenyl, hexadecenyl (preferably (Z) -hexadec-9-enyl), and hexadecadienylAn alkenyl group, a heptadecenyl group (preferably, (Z) -heptadeca-8-enyl group), a heptadecadienyl group (preferably, (8Z,11Z) -heptadeca-8, 11-dienyl group), an octadecenyl group (preferably, (Z) -octadec-9-enyl group), an octadecadienyl group (preferably, (9Z,12Z) -octadec-9, 12-dienyl group), a nonadecenyl group, an eicosenyl group (preferably, (Z) -eicos-11-enyl group), a docosadienyl group (preferably, (11,14) -eicos-11, 14-dienyl group), and the like.

Preferably, the alkenyl groups each have 1 or 2 double bonds.

R of the formula (1-1) ²⁵ Preferably an alkyl group or alkenyl group having 6 to 24 carbon atoms. The alkyl group having 6 to 24 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. The alkyl group having 6 to 24 carbon atoms is preferably an alkyl group having 7 to 20 carbon atoms. Specific examples thereof include hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, trimethyldodecyl (preferably 3,7, 11-trimethyldodecyl), tetradecyl, pentadecyl, hexadecyl, tetramethylhexadecyl (preferably 3,7,11, 15-tetramethylhexadecyl), heptadecyl, and octadecyl. The alkenyl group having 6 to 24 carbon atoms may be a straight chain or a branched chain, or may be a chain or a ring. The alkenyl group having 6 to 24 carbon atoms is preferably an alkenyl group having 8 to 20 carbon atoms. Specific examples thereof include octenyl, nonenyl, decenyl, undecenyl, dodecenyl, dodecadienyl, tridecenyl, tetradecenyl, pentadecenyl, hexadecenyl (preferably (Z) -hexadec-9-enyl), hexadecadienyl, heptadecenyl (preferably (Z) -heptadec-8-enyl), heptadecadienyl (preferably (8Z,11Z) -heptadec-8, 11-dienyl), octadecenyl (preferably (Z) -octadec-9-enyl), octadecenyl (preferably (9Z,12Z) -octadec-9, 12-dienyl), nonadecenyl, eicosenyl (preferably (Z) -eicos-11-enyl), Eicosadienyl (preferably (11,14) -eicosa-11, 14-dienyl), and the like.

Preferably, the alkenyl groups each have 1 or 2 double bonds.

In a preferred manner, in the case of the preferred mode,

x represents-O-;

R ² 、R ³ 、R ³¹ 、L ² and R ³² Is synonymous with the definition in formula (1),

R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ⁹ 、R ¹⁰ 、R ¹¹ and R ¹² The definitions of the substituents on the alkyl group having 1 to 18 carbon atoms which may be substituted, the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted, the substituted or unsubstituted aryl group, and the substituted or unsubstituted heteroaryl group, which each independently represent a hydrogen atom or an alkyl group having 1 to 18 carbon atoms which may be substituted, are the same as those in the formula (1),

a + b is 1, and c + d is 1 or 2.

In a more preferred embodiment, the compound represented by formula (1) is a compound represented by formula (2) below.

[ chemical formula 13]

In the formula, R ² And R ³ Each independently represents a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or R ³¹ -L ² -R ³² -a group of formula (I) as shown,

R ³¹ represents a hydrocarbon group having 1 to 24 carbon atoms,

L ² represents-O (CO) O-, -O (CO) -, - (CO) O-, -O, or

[ chemical formula 14]

R ⁵ represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms,

R ⁷ and R ⁸ Each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms,

number of carbons which may be substitutedThe substituent on the alkyl group of 1-18 is hydroxyl, carboxyl, -NR ⁴⁵ R ⁴⁶ Amino, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ The radicals shown are, for example,

R ⁴¹ 、R ⁴² 、R ⁴³ 、R ⁴⁴ 、R ⁴⁵ and R ⁴⁶ Each independently represents a C1-18 hydrocarbon group, and the substituents on the substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl are C1-18 alkyl, hydroxy, carboxy, -NR ⁴⁵ R ⁴⁶ Amino, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ The radicals shown are, for example,

R ⁴¹ 、R ⁴² 、R ⁴³ 、R ⁴⁴ 、R ⁴⁵ and R ⁴⁶ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and e represents 2 or 3.

R ² 、R ³ 、R ⁵ 、R ⁷ And R ⁸ Is the same as defined in formula (1).

In the formula (2), R is preferred ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, R ⁵ Wherein the substituent on the optionally substituted alkyl group having 1 to 18 carbon atoms is a hydroxyl group, a substituted or unsubstituted aryl group, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ A group shown, R ⁴¹ 、R ⁴² 、R ⁴³ 、R ⁴⁴ 、R ⁴⁵ And R ⁴⁶ Each independently represents a C1-18 hydrocarbon group, and the substituent on the substituted or unsubstituted aryl group is a C1-18 alkyl group, hydroxyl group, carboxyl group, -NR ⁴⁵ R ⁴⁶ Amino, -O (CO) O-R ⁴¹ 、-O(CO)-R ⁴² 、-(CO)O-R ⁴³ or-O-R ⁴⁴ A group shown, R ⁴¹ 、R ⁴² 、R ⁴³ 、R ⁴⁴ 、R ⁴⁵ And R ⁴⁶ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

In the formula (2), R is more preferred ² And R ³ Each independently represents a hydrocarbon group having 3 to 24 carbon atoms or R ³¹ -L ² -R ³² -a group shown, L ² represents-O (CO) or- (CO) O-, R ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is an unsubstituted aryl group, -O (CO) -R ⁴² Or- (CO) O-R ⁴³ ，R ⁴² And R ⁴³ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

In the formula (2), R is more preferred ² And R ³ Each independently represents a hydrogen atom or a hydrocarbon group having 3 to 24 carbon atoms, R ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is an unsubstituted aryl group, -O (CO) -R ⁴² Or- (CO) O-R ⁴³ A group shown, R ⁴² And R ⁴³ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

In the formula (2), R is preferred ² And R ³ At least one of (A) represents R ³¹ -L ² -R ³² A group represented by, L ² represents-O (CO) or- (CO) O-, R ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is an unsubstituted aryl group, -O (CO) -R ⁴² Or- (CO) O-R ⁴³ A group shown, R ⁴² And R ⁴³ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

In the formula (2), R is more preferred ² And R ³ Each independently represents R ³¹ -L ² -R ³² -a group shown, L ² represents-O (CO) or- (CO) O-, R ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is an unsubstituted aryl group, -O (CO) -R ⁴² Or- (CO) O-R ⁴³ A group shown, R ⁴² And R ⁴³ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

In the formula (2), R is preferred ² And R ³ One of them represents R ³¹ -L ² -R ³² -a group represented by R ² And R ³ The other represents a C3-24 hydrocarbon group, L ² represents-O (CO) or- (CO) O-, R ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is an unsubstituted aryl group, -O (CO) -R ⁴² Or- (CO) O-R ⁴³ A group shown, R ⁴² And R ⁴³ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

In the formula (2), R is more preferred ² And R ³ One of them represents R ³¹ -L ² -R ³² -a group represented by R ² And R ³ The other of them represents a hydrocarbon group having 6 carbon atoms, L ² represents-O (CO) or- (CO) O-, R ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is-O (CO) -R ⁴² Or- (CO) O-R ⁴³ A group shown, R ⁴² And R ⁴³ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

In the formula (2), R is more preferred ² And R ³ One of them represents R ³¹ -L ² -R ³² -a group represented by R ² And R ³ The other of them represents a hydrocarbon group having 6 carbon atoms, L ² represents-O (CO) or- (CO) O-, R ⁵ R represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms.

In the formula (2), R is more preferred ² And R ³ One of them represents R ³¹ -L ² -R ³² -a group represented by R ² And R ³ The other of (A) and (B) represents a hydrocarbon group having 6 carbon atoms, L ² represents-O (CO) or- (CO) O-, R ⁵ R represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and e represents 2.

In the formula (2), R is more preferred ² And R ³ One of them represents R ³¹ -L ² -R ³² -a group represented by R ² And R ³ The other represents a C3-5 hydrocarbon group, L ² represents-O (CO) or- (CO) O-, R ⁵ R represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms.

In the formula (2), R is more preferred ² And R ³ One of them represents R ³¹ -L ² -R ³² -a group represented by R ² And R ³ The other represents a C3-5 hydrocarbon group, L ² represents-O (CO) or- (CO) O-, R ⁵ R represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and e represents 2.

In the formula (2), R is more preferred ² And R ³ One of them represents R ³¹ -L ² -R ³² -a group represented by R ² And R ³ The other of them represents a hydrocarbon group having 6 carbon atoms, L ² represents-O (CO) or- (CO) O-, R ⁵ Represents a hydrogen atom or a substituted alkyl group having 1 to 18 carbon atoms, R ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and the substituent on the substituted alkyl group having 1 to 18 carbon atoms is-O (CO) -R ⁴² Or- (CO) O-R ⁴³ A group shown, R ⁴² And R ⁴³ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

In the formula (2), R is more preferred ² And R ³ One of them represents R ³¹ -L ² -R ³² -a group represented by R ² And R ³ The other of them represents a hydrocarbon group having 6 carbon atoms, L ² represents-O (CO) or- (CO) O-, R ⁵ Represents a hydrogen atom or a substituted alkyl group having 1 to 18 carbon atoms, R ⁷ And R ⁸ Each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and the substituent on the substituted alkyl group having 1 to 18 carbon atoms is-O (CO) -R ⁴² Or-(CO)O-R ⁴³ A group shown, R ⁴² And R ⁴³ Each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and e represents 2.

The compound represented by formula (1) may form a salt.

Examples of the salt of a basic group include salts with inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, and sulfuric acid; salts with organic carboxylic acids such as formic acid, acetic acid, citric acid, oxalic acid, fumaric acid, maleic acid, succinic acid, malic acid, tartaric acid, aspartic acid, trichloroacetic acid, and trifluoroacetic acid; and salts with sulfonic acids such as methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, mesitylenesulfonic acid, and naphthalenesulfonic acid.

Examples of the salt in the acidic group include salts with alkali metals such as sodium and potassium; salts with alkaline earth metals such as calcium and magnesium; an ammonium salt; and salts with nitrogen-containing organic bases such as trimethylamine, triethylamine, tributylamine, pyridine, N-dimethylaniline, N-methylpiperidine, N-methylmorpholine, diethylamine, dicyclohexylamine, procaine, dibenzylamine, N-benzyl- β -phenylethylamine, 1-diphenylhydroxymethylamine, and N, N' -dibenzylethylenediamine.

Among the above salts, preferable salts include pharmacologically acceptable salts.

A method for producing the compound represented by the formula (1) will be described.

The compound represented by formula (1) can be produced by combining known methods, and for example, can be produced by the following production method.

[ production method 1]

[ chemical formula 15 ]

In the formula ^a And R ^b Represents a leaving group; r ^c 、R ^d And R ^e Represents an amino-or imino-protecting group; r ¹ 、R ² 、R ³ 、R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ⁹ 、R ¹⁰ 、R ¹¹ And R ¹² Have the same meanings as described above; examples of the "leaving group" include a chloro group, a fluoro group, a bromo group, a trichloromethoxy group, a 4-nitro-phenoxy group, a 2, 4-dinitrophenoxy group, a 2,4, 6-trichlorophenoxy group, a pentafluorophenoxy group, a 2,3,5, 6-tetrafluorophenoxy group, an imidazolyl group, a triazolyl group, a 3, 5-dioxo-4-methyl-1, 2, 4-oxadiazolidinyl group, and an N-hydroxysuccinimidyl group. Examples of the amino-protecting group and the imino-protecting group include a tert-butoxycarbonyl group, a benzyloxycarbonyl group, a 2-nitrobenzenesulfonyl group, and a benzyl group.

(1-1)

As the compound of the formula [3], for example, 4-nitrophenyl chloroformate, 1' -carbonyldiimidazole, triphosgene, phosgene and the like are known.

The compound of formula [4] can be produced by reacting the compound of formula [2] with the compound of formula [3] in the presence of a base.

The solvent used in the reaction is not particularly limited as long as it does not affect the reaction, and examples thereof include halogenated hydrocarbons, ethers, esters, amides, nitriles, sulfoxides, and aromatic hydrocarbons, and these solvents may be used in combination.

Preferred solvents include ethers, and tetrahydrofuran is more preferred. The amount of the solvent used is not particularly limited, and may be 1 to 500 times (v/w) the amount of the compound of the formula [2 ].

Examples of the base used in this reaction include an inorganic base and an organic base. The base is preferably an organic base, and specific examples thereof include triethylamine, N-diisopropylethylamine, 4-methylmorpholine, pyridine, and N, N-dimethylaminopyridine.

The amount of the base to be used may be 1 to 50 times by mol, preferably 1 to 10 times by mol, based on the compound of the formula [2 ].

The amount of the compound of the formula [3] used is not particularly limited, and may be 0.3 to 10 times (v/w) the amount of the compound of the formula [2 ].

The reaction is carried out at-30 to 150 ℃ and preferably 0 to 100 ℃ for 5 minutes to 48 hours.

(1-2)

Examples of the compound of the formula [5] include (9Z,12Z) -bis ((9Z,12Z) -octadeca-9, 12-dien-1-yl) amine and dihexadecyl amine.

The compound of the formula [6] can be produced by reacting the compound of the formula [4] with the compound of the formula [5] in the presence of a base.

Preferred solvents include ethers, and tetrahydrofuran is more preferred. The amount of the solvent used is not particularly limited, and may be 1 to 500 times (v/w) the amount of the compound of the formula [4 ].

The amount of the base to be used may be 1 to 50 times by mol, preferably 1 to 10 times by mol, based on the compound of the formula [4 ].

The amount of the compound of the formula [5] used is not particularly limited, and may be 1 to 10 times (v/w) the amount of the compound of the formula [4 ].

(1-3)

As the compound of formula [2A ], for example, tert-butyl (2- ((tert-butoxycarbonyl) amino) ethyl) (2-hydroxyethyl) carbamate, tert-butyl (2- ((2-hydroxyethyl) (methyl) amino) ethyl) carbamate, and the like are known.

The compound of the formula [6A ] can be produced by reacting a compound of the formula [2A ] with a compound of the formula [3] in the presence of a base, and then reacting a compound of the formula [4A ] with a compound of the formula [5] in the presence of a base.

The reaction may be carried out according to production methods (1-1) and (1-2).

(1-4)

The compound of the formula [6] can be produced by deprotecting the compound of the formula [6A ].

The reaction may be carried out, for example, according to the method described in T.W.Greene et al, Protective Groups in Organic Synthesis thesis 4 th edition, pages 696 to 926, 2007, John Wiley & Sons, INC.

[ production method 2]

[ chemical formula 16]

In the formula ^a And R ^b Represents a leaving group; r is ^c 、R ^d And R ^e Represents an amino-or imino-protecting group; r ¹ 、R ² 、R ³ 、R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ⁹ 、R ¹⁰ 、R ¹¹ And R ¹² Have the same meaning as above "; examples of the leaving group include a chloro group, a fluoro group, a bromo group, a trichloromethoxy group, a 4-nitro-phenoxy group, a 2, 4-dinitrophenoxy group, a 2,4, 6-trichlorophenoxy group, a pentafluorophenoxy group, a 2,3,5, 6-tetrafluorophenoxy group, an imidazolyl group, a triazolyl group, a 3, 5-dioxo-4-methyl-1, 2, 4-oxadiazolidinyl group, and an N-hydroxysuccinimidyl group. Examples of the amino-protecting group and the imino-protecting group include a tert-butoxycarbonyl group, a benzyloxycarbonyl group, a 2-nitrobenzenesulfonyl group, and a benzyl group.

(2-1)

The compound of the formula [8] can be produced by reacting the compound of the formula [7] with the compound of the formula [3] in the presence of a base.

This reaction can be carried out according to production method (1-1).

(2-2)

The compound of formula [9] can be produced by reacting the compound of formula [8] with the compound of formula [2] in the presence of a base.

Preferred solvents include ethers, and tetrahydrofuran is more preferred. The amount of the solvent used is not particularly limited, and may be 1 to 500 times (v/w) the amount of the compound of the formula [8 ].

The amount of the base to be used may be 1 to 50 times by mol, preferably 1 to 10 times by mol, based on the compound of the formula [8 ].

The amount of the compound of the formula [2] used is not particularly limited, and may be 1 to 10 times (v/w) the amount of the compound of the formula [8 ].

(2-3)

Examples of the compound of the formula [2A ] include tert-butyl (2- ((tert-butoxycarbonyl) amino) ethyl) (2-hydroxyethyl) carbamate and tert-butyl (2- ((2-hydroxyethyl) (methyl) amino) ethyl) carbamate.

The compound of the formula [9] can be produced by reacting the compound of the formula [8] with the compound of the formula [2A ] in the presence of a base, and then deprotecting the compound of the formula [9A ] in the presence of a base.

The reaction can be carried out according to the production methods (2-2) and (1-4).

[ production method 3]

[ chemical formula 17 ]

In the formula ^a 、R ^b And R ^g Represents a leaving group; r ^f Represents an alkyl group having 1 to 18 carbon atoms; r ¹ 、R ² 、R ³ 、R ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ⁹ 、R ¹⁰ 、R ¹¹ 、R ¹² And R ⁴² Have the same meanings as described above; examples of the "leaving group" include a chloro group, a fluoro group, a bromo group, a trichloromethoxy group, a 4-nitro-phenoxy group, a 2, 4-dinitrophenoxy group, a 2,4, 6-trichlorophenoxy group, a pentafluorophenoxy group, a 2,3,5, 6-tetrafluorophenoxy group, an imidazolyl group, a triazolyl group, a 3, 5-dioxo-4-methyl-1, 2, 4-oxadiazolidinyl group, and an N-hydroxysuccinimidyl group.

(3-1)

The compound of formula [8] can be produced by reacting the compound of formula [7] with the compound of formula [3] in the presence of a base.

This reaction can be carried out according to production method (1-1).

(3-2)

As the compound of the formula [2B ], for example, 2 '- ((2- (diethylamino) ethyl) azanediyl) bis (ethane-1-ol) and 2, 2' - ((3- (diethylamino) propyl) azanediyl) bis (ethane-1-ol) are known.

The compound of the formula [9B ] can be produced by reacting the compound of the formula [8] with the compound of the formula [2B ] in the presence of a base.

This reaction can be carried out according to production method (2-2).

(3-3)

As the compound of formula [10A ], for example, dodecanoic acid, decanoic acid, nonanoic acid, octanoic acid and the like are known.

The compound of the formula [9C ] can be produced by reacting the compound of the formula [9B ] with the compound of the formula [10A ] in the presence of a condensing agent or an acid halide in the presence of a base.

Preferred solvents include ethers, and tetrahydrofuran is more preferred. The amount of the solvent used is not particularly limited, and may be 1 to 500 times (v/w) the amount of the compound of the formula [9B ].

The amount of the base to be used may be 1 to 50 times by mol, preferably 1 to 10 times by mol, based on the compound of the formula [9B ].

Examples of the condensing agent used in this reaction include carbodiimides such as N, N' -dicyclohexylcarbodiimide and 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide; carbonyl groups such as carbonyldiimidazole; acid azides such as diphenylphosphoryl azide; acid cyanides such as diethyl cyanophosphate; 2-ethoxy-1-ethoxycarbonyl-1, 2-dihydroquinoline; o-benzotriazol-1-yl-1, 1,3, 3-tetramethyluronium hexafluorophosphate, O- (7-azabenzotriazol-1-yl) -1,1,3, 3-tetramethyluronium hexafluorophosphate, and the like.

Examples of the acid halide used in the reaction include carboxylic acid halides such as acetyl chloride and trifluoroacetyl chloride; sulfonyl halides such as methanesulfonyl chloride and p-toluenesulfonyl chloride; chloroformates such as ethyl chloroformate and isobutyl chloroformate, and the like.

The amount of the compound of the formula [10A ] used is not particularly limited, and may be 1 to 10 times (v/w) the amount of the compound of the formula [9B ].

(3-4)

Examples of the compound of the formula [10B ] include dodecanoyl chloride, decanoyl chloride, nonanoyl chloride, and octanoyl chloride.

The compound of the formula [9C ] can be produced by reacting a compound of the formula [9B ] with a compound of the formula [10B ] in the presence of a base.

The compound of the formula [10B ] can be produced by reacting the compound of the formula [10A ] with sulfuryl chloride, oxalyl chloride or the like.

Examples of the base used in this reaction include an inorganic base and an organic base.

The amount of the compound of the formula [10B ] used is not particularly limited, and may be 1 to 10 times (v/w) the amount of the compound of the formula [2B ].

Next, the synthesis of the compound of formula [2] as a raw material for producing the compound of the present invention will be described.

[ production method 4]

[ chemical formula 18 ]

In the formula ^h And R ⁱ Represents a leaving group; r ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ⁹ 、R ¹⁰ 、R ¹¹ And R ¹² Have the same meanings as described above; examples of the "leaving group" include a chloro group, a bromo group, an iodo group, a methanesulfonyl group, a 4-toluenesulfonyl group, a chloromethanesulfonyl group, and a trifluoromethanesulfonyl group.

(4-1)

As the compound of the formula [12], for example, 2-chloro-N, N-dimethylethane-1-amine, 4- (2-chloroethyl) morpholine, 2-chloro-N, N-diethylethane-1-amine, 2-bromo-N, N-diethylethane-1-amine, 3-chloro-N, N-diethylethane-1-amine and the like are known.

The compound of the formula [2] can be produced by reacting the compound of the formula [11] with the compound of the formula [12] in the presence or absence of a base.

The solvent used in the reaction is not particularly limited as long as it does not affect the reaction, and examples thereof include alcohols, halogenated hydrocarbons, ethers, esters, amides, nitriles, sulfoxides, aromatic hydrocarbons, and water, and these solvents may be used in combination.

The amount of the solvent used is not particularly limited, and may be 1 to 500 times (v/w) the amount of the compound of the formula [11 ].

Examples of the base used in this reaction include an inorganic base and an organic base. The amount of the base to be used may be 1 to 10000 times by mol, preferably 1 to 5000 times by mol, based on the compound of the formula [11 ].

The amount of the compound of the formula [12] used is not particularly limited, and may be 1 to 10 times (v/w) the amount of the compound of the formula [11 ].

(4-2)

As the compound of the formula [14], for example, 2-bromoethane-1-ol, 3-bromopropane-1-ol and the like are known.

The compound of the formula [2] can be produced by reacting the compound of the formula [13] with the compound of the formula [14] in the presence or absence of a base.

This reaction can be carried out according to production method (4-1).

[ production method 5]

[ chemical formula 19 ]

In the formula ^j Represents a leaving group; r ^k Represents an alkyl group having 1 to 18 carbon atoms; r ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ⁹ 、R ¹⁰ 、R ¹¹ 、R ¹² And R ⁴³ Have the same meanings as described above; examples of the "leaving group" include a chloro group, a bromo group, an iodo group, a methanesulfonyl group, a 4-toluenesulfonyl group, a chloromethanesulfonyl group, and a trifluoromethanesulfonyl group.

(5-1)

As the compound of the formula [15A ], for example, heptyl acrylate and the like are known.

The compound of formula [2] can be produced by reacting a compound of formula [2C ] with a compound of formula [15A ] in the presence or absence of a base.

Preferable solvents include ethers and nitriles, and tetrahydrofuran and acetonitrile are more preferable.

The amount of the solvent used is not particularly limited, and may be 1 to 500 times (v/w) the amount of the compound of the formula [2C ].

The amount of the base to be used may be 1 to 10000 times by mol, preferably 1 to 5000 times by mol, based on the compound of the formula [2C ].

The amount of the compound of the formula [15A ] used is not particularly limited, and may be 1 to 10 times (v/w) the amount of the compound of the formula [13 ].

(5-2)

As the compound of the formula [15B ], for example, 3-chloropropionic acid heptyl ester and the like are known.

The compound of formula [2] can be produced by reacting a compound of formula [2C ] with a compound of formula [15B ] in the presence or absence of a base.

This reaction can be carried out according to production method (4-1).

[ production method 6]

[ chemical formula 20 ]

In the formula ^g And R ^l Represents a leaving group; r ^m Represents an alkyl group having 1 to 18 carbon atoms; r ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ⁹ 、R ¹⁰ 、R ¹¹ 、R ¹² And R ⁴² Have the same meanings as described above; examples of the "leaving group" include a chloro group, a bromo group, an iodo group, a methanesulfonyl group, a 4-toluenesulfonyl group, a chloromethanesulfonyl group, a trifluoromethanesulfonyl group, a trichloromethoxy group, a 4-nitro-phenoxy group, a 2, 4-dinitrophenoxy group, a 2,4, 6-trichlorophenoxy group, a pentafluorophenoxy group, a 2,3,5, 6-tetrafluorophenoxy group, an imidazolyl group, a triazolyl group, a 3, 5-dioxo-4-methyl-1, 2, 4-oxadiazolyl group, and an N-hydroxysuccinimidyl group.

(6-1)

As the compound of the formula [10A ], for example, dodecanoic acid, decanoic acid, nonanoic acid, octanoic acid and the like are known.

The compound of the formula [2] can be produced by reacting the compound of the formula [2B ] with the compound of the formula [10A ] in the presence of a condensing agent or an acid halide in the presence of a base.

This reaction can be carried out according to production method (3-3).

(6-2)

The compound of formula [2] can be produced by reacting a compound of formula [2B ] with a compound of formula [10B ] in the presence of a base.

This reaction can be carried out according to production method (3-4).

(6-3)

As the compound of the formula [16], for example, 3-chloropropionate heptyl ester and the like are known.

The compound of the formula [2] can be produced by reacting a compound of the formula [2C ] with a compound of the formula [16] in the presence or absence of a base.

This reaction can be carried out according to production method (4-1).

[ production method 7]

[ chemical formula 21 ]

In the formula ⁿ 、R ^o And R ^p Represents an alkyl group having 1 to 17 carbon atoms; r ⁴ 、R ⁵ 、R ⁶ 、R ⁷ 、R ⁸ 、R ⁹ 、R ¹⁰ 、R ¹¹ 、R ¹² 、R ⁴² And R ⁴³ Have the same meanings as described above. "

(7-1)

As the compound of the formula [17A ], for example, formaldehyde, acetaldehyde, propionaldehyde, butyraldehyde, valeraldehyde, caproaldehyde, heptaldehyde, octaldehyde and the like are known.

The compound of formula [2] can be produced by reacting a compound of formula [2C ] with a compound of formula [17A ] in the presence of a reducing agent, in the presence or absence of a reduction catalyst, in the presence or absence of an acid.

Examples of the acid used in this reaction include inorganic acids and organic acids.

The amount of the acid to be used may be 0.01 to 10000 times by mol, preferably 0.05 to 100 times by mol, based on the compound of the formula [2C ].

Examples of the reducing agent used in this reaction include sodium triacetoxyborohydride, sodium cyanoborohydride, 2-methylpyridine borane, formic acid, hydrogen, and the like.

Examples of the reduction catalyst used in this reaction include palladium-carbon, palladium hydroxide-carbon, platinum-carbon, rhodium-carbon, and ruthenium-carbon.

The amount of the compound of the formula [17A ] used is not particularly limited, and may be 1 to 10 times (v/w) the amount of the compound of the formula [13 ].

(7-2)

As the compound of the formula [17B ], for example, 2-oxoethyl octanoate, 2-oxoethyl nonanoate and the like are known.

The compound of formula [2] can be produced by reacting a compound of formula [2C ] with a compound of formula [17B ] in the presence of a reducing agent, in the presence or absence of a reduction catalyst, in the presence or absence of an acid.

This reaction can be carried out according to production method (7-1).

(7-3)

As the compound of the formula [17C ], for example, heptyl 3-oxopropionate, octyl 3-oxopropionate and the like are known.

The compound of formula [2] can be produced by reacting the compound of formula [2C ] with the compound of formula [17C ] in the presence of a reducing agent, in the presence or absence of a reduction catalyst, in the presence or absence of an acid.

This reaction can be carried out according to production method (7-1).

In the case where an isomer (for example, an optical isomer, a geometric isomer, a tautomer, or the like) exists in the compound used in the above-mentioned production method, these isomers may be used. In addition, when a solvate, a hydrate, and a crystal of various shapes are present, the solvate, the hydrate, and the crystal of various shapes thereof may also be used.

Among the compounds used in the above-mentioned production methods, for example, compounds having an amino group, a hydroxyl group, a carboxyl group, or the like may be protected with a conventional protecting group in advance, and after the reaction, the protecting group may be removed by a method known per se.

The compound obtained by the above-mentioned production method can be derived into another compound by carrying out a reaction known per se, such as condensation, addition, oxidation, reduction, rearrangement, substitution, halogenation, dehydration or hydrolysis, or by appropriately combining these reactions.

In the pharmaceutical composition of the present invention, the content of the lipid as the compound represented by formula (1) or a salt thereof is preferably 40 to 70 mol%, more preferably 45 to 65 mol%, and still more preferably 50 to 60 mol% with respect to the total lipid.

The pharmaceutical composition of the present invention contains cholesterol.

By containing cholesterol, the membrane fluidity can be reduced, and a stabilization effect of lipid particles can be obtained.

In the pharmaceutical composition of the present invention, the content of cholesterol is preferably 25 mol% to 60 mol%, more preferably 30 mol% to 55 mol%, still more preferably 35 mol% to 55 mol%, and particularly preferably 40 mol% to 50 mol% with respect to the total lipid.

The pharmaceutical composition of the present invention contains a lipid having a polyethylene glycol structure. By containing a lipid having a polyethylene glycol structure, a dispersion stabilizing effect of lipid particles can be obtained.

The lipid having a polyethylene glycol structure is not particularly limited, and examples thereof include PEG-modified phosphoethanolamine, diacylglycerol PEG derivatives, dialkylglycerol PEG derivatives, cholesterol PEG derivatives, ceramide PEG derivatives, and the like. Among them, diacylglycerol PEG is preferable. That is, the lipid having a polyethylene glycol structure is preferably a lipid having a diacylglycerol structure and a polyethylene glycol structure, and more preferably an acyl group having a diacylglycerol structure is an acyl group having 12 to 22 carbon atoms.

The weight average molecular weight of the PEG chain of the polyethylene glycol derivative is preferably 500 to 5000, and more preferably 750 to 3000.

In the pharmaceutical composition of the present invention, the content of the lipid having a nonionic hydrophilic polymer is preferably 0.5 to 10 mol%, more preferably 0.5 to 5 mol%, even more preferably 0.5 to 3 mol%, and most preferably 0.5 to 2 mol% based on the total lipid.

The pharmaceutical composition of the present invention may contain a zwitterionic lipid. As the zwitterionic lipid, a phospholipid is preferred. The phospholipid is not particularly limited, and examples thereof include phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, and the like, and phosphatidylcholine and phosphatidylethanolamine are preferable.

Examples of the phosphatidylcholine include, but are not particularly limited to, soybean lecithin (SPC), hydrogenated soybean lecithin (HSPC), egg yolk lecithin (EPC), hydrogenated egg yolk lecithin (EPC), 1, 2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1, 2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), and 1, 2-dioleoyl-sn-glycero-3-phosphocholine (DOPC). Among them, distearoyl phosphatidylcholine (DSPC), 1, 2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1, 2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC) are preferable.

The phosphatidylethanolamine is not particularly limited, and examples thereof include 1, 2-dimyristoyl-sn-glycero-3-phosphatidylethanolamine (DMPE), 1, 2-dipalmitoyl-sn-glycero-3-phosphatidylethanolamine (dppe), 1, 2-distearoyl-sn-glycero-3-phosphatidylethanolamine (DSPE), 1, 2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE), 1, 2-dilinoleoyl-sn-glycero-3-phosphatidylethanolamine (ddlepe), 1, 2-diphytanoyl-sn-glycero-3-phosphatidylethanolamine (d (phy) PE), and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphatidylethanolamine (POPE) )1, 2-ditetradecyl-sn-glycero-3-phosphatidylethanolamine, 1, 2-dihexadecyl-sn-glycero-3-phosphatidylethanolamine, 1, 2-dioctadecyl-sn-glycero-3-phosphatidylethanolamine, 1, 2-diphyt-sn-glycero-3-phosphatidylethanolamine, and the like.

Among these phospholipids, Distearoylphosphatidylcholine (DSPC), 1, 2-dipalmitoyl-sn-glycero-3-phosphorylcholine (DPPC), 1, 2-dimyristoyl-sn-glycero-3-phosphorylcholine (DMP C), 1, 2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE) are more preferable, Distearoylphosphatidylcholine (DSPC), 1, 2-dipalmitoyl-sn-glycero-3-phosphorylcholine (DPPC) are further preferable, and Distearoylphosphatidylcholine (DSPC) is most preferable.

In the pharmaceutical composition of the present invention, the content of the zwitterionic lipid is preferably 0 mol% to 30 mol%, more preferably 0 mol% to 20 mol%, and still more preferably 0 mol% to 10 mol% with respect to the total lipid.

The method for producing the pharmaceutical composition of the present invention will be described.

The method for producing the pharmaceutical composition is not limited, and the pharmaceutical composition can be produced by dissolving all or a part of the oil-soluble components in the lipid-classified components such as the lipid represented by the formula (1) or a salt thereof, the nonionic lipid, and the lipid having a nonionic hydrophilic polymer structure in an organic solvent or the like to prepare an oil phase, dissolving the water-soluble components such as artificial siRNA in water to prepare an aqueous phase, and mixing the oil phase and the aqueous phase. The mixing may be carried out by a micromixer, an emulsifier such as a homogenizer, an ultrasonic emulsifier, a high-pressure jet emulsifier, or the like.

Alternatively, the lipid-containing solution may be prepared by drying the lipid-containing solution under reduced pressure using an evaporator or the like, spray-drying the solution using a spray dryer or the like, to prepare a dried mixture containing the lipid, adding the mixture to an aqueous solvent, and emulsifying the mixture using the emulsifying machine or the like.

An example of a method for producing a pharmaceutical composition includes a method including the steps of:

a step (a) in which a lipid component classified into lipids, such as a lipid that is a compound represented by formula (1) or a salt thereof, a nonionic lipid, and a lipid having a nonionic hydrophilic polymer structure, is dissolved in an organic solvent to obtain an oil phase;

a step (b) of mixing the oil phase obtained in the step (a) with an aqueous phase containing a water-soluble component such as artificial siRNA;

a step (c) of diluting the mixed solution containing the oil phase and the aqueous phase obtained in the step (b) to obtain a dispersion of lipid particles;

a step (d) of removing the organic solvent from the lipid particle dispersion obtained in step (c);

and (e) adjusting the concentration of the lipid particle dispersion obtained in step (d).

The step (a) includes a step of dissolving the constituent components classified into lipids in an organic solvent (alcohol such as ethanol, ester, or the like). The total lipid concentration after dissolution in the organic solvent is not particularly limited, but is usually 1 to 100mmol/L, preferably 5 to 50mmol/L, and more preferably 10 to 30 mmol/L.

In the step (b), the aqueous phase can be obtained by dissolving the artificial siRNA in water or a buffer. If necessary, an antioxidant or the like may be added. The ratio (mass ratio) of mixing the aqueous phase and the oil phase is preferably 5: 1-1: 1, more preferably 4: 1-2: 1.

in the step (d), the method for removing the organic solvent from the lipid particle dispersion is not particularly limited, and a general method can be used, and the organic solvent can be removed by, for example, dialysis using a phosphate buffered saline.

In the step (e), the concentration of the dispersion obtained in the step (d) may be adjusted. In the case of dilution, phosphate buffered saline, physiological saline, or the like may be used as a diluent to dilute the solution to an appropriate concentration. In the case of concentration, the dispersion obtained in step (d) may be concentrated by ultrafiltration using an ultrafiltration membrane or the like. The concentrated dispersion may be used as it is, or the diluted solution may be used after concentration to adjust the concentration to a desired level.

In order to prepare the lipid particle dispersion of the present invention into a pharmaceutical composition, sterile filtration is preferably performed. As a method of filtration, insoluble substances can be removed from a dispersion liquid of lipid particles using a hollow fiber membrane, a reverse osmosis membrane, a membrane filter, or the like. In the present invention, there is no particular limitation, and filtration is preferably performed through a filter having a pore size capable of sterilization (preferably, a 0.2 μm filter sterilization filter). The step of performing sterile filtration is preferably performed after the step (c) or the step (d).

The dispersion liquid of the lipid particles of the present invention may be subjected to freeze-drying as needed.

The pharmaceutical composition of the present invention may be added with additives including a pharmaceutically acceptable medium such as an aqueous solution, salts, preservatives, buffers, and the like.

The pharmaceutical composition of the present invention can be used as a treatment agent.

According to the present invention, there is provided a method for treating hepatitis b, comprising a step of administering the pharmaceutical composition of the present invention to a subject.

According to the present invention, there is provided a method for treating liver cirrhosis or liver cancer, comprising a step of administering the pharmaceutical composition of the present invention to a subject.

According to the present invention, there is provided a pharmaceutical composition of the invention for use in the treatment of hepatitis b.

According to the present invention, there is provided a pharmaceutical composition of the present invention for use in the treatment of cirrhosis or liver cancer.

According to the present invention, there is provided a use of the pharmaceutical composition of the present invention for the manufacture of a treatment agent for hepatitis b.

According to the present invention, there is provided a use of the pharmaceutical composition of the present invention for manufacturing a treatment agent for liver cirrhosis or liver cancer.

The subject of the treatment agent includes humans and mammals other than humans. Examples of mammals other than humans include monkeys, dogs, cats, cows, horses, mice, rats, and the like.

The treatment can be any treatment or therapy that achieves a desired therapeutic effect, such as blocking or slowing of progression of the condition, including a decrease in the rate of progression, cessation of the rate of progression, improvement of the condition, cure or remission (whether partial or complete), prevention, slowing, alleviation or cessation of one or more symptoms and/or signs of the condition, or prolongation of survival of the subject or subject as predicted in the absence of the treatment.

Treatment also includes prophylaxis. For example, by treating a subject who is susceptible to or at risk of developing or relapsing from hepatitis b, liver cirrhosis, or liver cancer, the onset or relapse of hepatitis b, liver cirrhosis, or liver cancer in the subject can be prevented or delayed.

The disease to be treated is hepatitis B. In addition, the target disease as a treatment agent can also be applied to cirrhosis or liver cancer which is a disease associated with hepatitis b.

The route of administration when the pharmaceutical composition of the present invention is administered is not particularly limited, and administration can be carried out by any method. Examples of administration methods include oral administration and parenteral administration (intra-articular administration, intravenous administration, intra-arterial administration, subcutaneous administration, intradermal administration, intravitreal administration, intraperitoneal administration, intramuscular administration, intravaginal administration, intravesical administration, intramedullary administration, pulmonary administration, rectal administration, colonic administration, buccal administration, nasal administration, intracerebral bulbar intracisternal administration, inhalation, etc.), but parenteral administration is preferable. The parenteral administration is preferably intravenous injection, subcutaneous injection, intradermal injection, intraperitoneal injection or intramuscular injection.

As the dose, for example, for one administration, the dose can be selected in the range of 0.01mg to 100mg per 1kg body weight of the subject.

Examples

Unless otherwise stated, purification by column chromatography was performed using an automatic purification apparatus ISOLERA (Biotage) or a medium-pressure liquid chromatograph YFLC W-prep 2XY (santa corporation).

In the case where no description is given, Chro [ example matrilex Q-Pack SI 50 (Fuji Silysia chemical Co., Ltd.), HI-FLASH COLU MNS W001, W002, W003, W004 or W005 (Shanshan Corp.) is used as a carrier in silica gel column chromatography.

As the NH silica gel, Chromatorex Q-Pack NH 60 (Fuji Silysia chemical Co., Ltd.) was used.

The NMR spectrum was measured using Bruker AV300 (manufactured by Bruker corporation) or Bruker AV400 (manufactured by Bruker corporation) using tetramethylsilane as an internal standard, and the total delta value was expressed in ppm.

MS spectra were measured using an ACQUITY SQD LC/MS system (manufactured by Waters).

< Synthesis of Compound >

Production example 1

(1)

[ chemical formula 22 ]

To a mixture of 2- (ethylamino) ethane-1-ol (4.0g), 2-bromo-N, N-diethylethane-1-amine hydrobromide (17.6g) and ethanol (80mL), potassium carbonate (18.6g) was added, and the mixture was stirred under reflux with heating for 7 hours. The reaction mixture was cooled to room temperature, insoluble materials were filtered off, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane, NH silica gel) to give 2- ((2- (diethylamino) ethyl) (ethyl) amino) ethan-1-ol (6.5g) as a pale yellow oil.

MSm/z(M+H)：189.

[ chemical formula 23 ]

To a mixture of benzaldehyde (30.0g), 6-bromohexane-1-ol (56.1g), triethylsilane (67.5mL) and toluene (300mL) was added boron trifluoride diethyl ether complex (46.2mL) under ice cooling, and the mixture was stirred at that temperature for 40 minutes. Water was added to the reaction mixture, and the organic layer was separated, washed with a saturated aqueous sodium bicarbonate solution, and then the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to give (((6-bromohexyl) oxy) methyl) benzene (73.5g) as a colorless oil.

¹ H-NMR(CDCl ₃ )δ：7.38-7.23(5H,m),4.50(2H,s),3.47(2H,t,J＝6.6Hz),3.40(2H,t,J＝6.6Hz),1.92-1.81(2H,m),1.68-1.58(2H,m),1.52-1.35(4H,m).

A mixture of (((6-bromohexyl) oxy) methyl) benzene (66.7g) and tetrahydrofuran (200mL) was added dropwise to a mixture of magnesium (7.5g) and tetrahydrofuran (40mL) and stirred at room temperature for 1 hour. A mixture of ethyl formate (8.3g) and tetrahydrofuran (100mL) was added to the reaction mixture under ice-cooling, and stirred at that temperature for 1 hour. The reaction mixture was poured into a 10% aqueous sulfuric acid solution (330mL) under ice-cooling, hexane (300mL) was added, the organic layer was separated, dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. To the resulting residue were added tetrahydrofuran (200mL), ethanol (100mL) and 10mol/L aqueous potassium hydroxide solution, and the mixture was stirred at 40 ℃ for 1 hour. Hexane (200mL) and water (100mL) were added to the reaction mixture, and the organic layer was separated, dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to give 1, 13-bis (benzyloxy) tridecan-7-ol (25.3g) as a colorless oil.

¹ H-NMR(CDCl ₃ )δ：7.36-7.24(10H,m),4.50(4H,s),3.61-3.54(1H,m),3.46(4H,t,J＝6.6Hz),1.68-1.56(4H,m),1.48-1.26(16H,m).

A mixture of 1, 13-bis (benzyloxy) tridecan-7-ol (24.0g), 10% palladium hydroxide on carbon (10.0g), and methanol (240mL) was stirred under a hydrogen atmosphere at 50 ℃ for 3 hours. The reaction mixture was cooled to room temperature, and after insoluble matter was removed by filtration through celite, the solvent was distilled off under reduced pressure. Ethyl acetate (40mL) was added to the resulting residue, and the solid was collected by filtration, washed with ethyl acetate, and dried under reduced pressure to give tridecane-1, 7, 13-triol (11.7g) as a white solid.

¹ H-NMR(CDCl ₃ )δ：3.70-3.55(5H,m),1.64-1.24(20H,m).

(3)

[ chemical formula 24 ]

To a mixture of tridecane-1, 7, 13-triol, 2-hexyl decanoate, triethylamine, 4-dimethylaminopyridine and N, N-dimethylformamide was added 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride and stirred at room temperature for 15 hours. Water and ethyl acetate were added to the reaction mixture, and the organic layer was separated, washed with a saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (EtOAc-hexane) to obtain 7-hydroxytridecane-1, 13-diylbis (2-hexyldecanoate) as a colorless oil.

4-Nitrophenyl chloroformate was added to a mixture of 7-hydroxytridecane-1, 13-diylbis (2-hexyldecanoate), triethylamine and tetrahydrofuran, and the mixture was stirred at room temperature for 1 hour. Water and ethyl acetate were added to the reaction mixture, and the organic layer was separated, washed with a saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to obtain 7- (((4-nitrophenoxy) carbonyl) oxy) tridecane-1, 13-diylbis (2-hexyldecanoate) as a pale yellow oil.

¹ H-NMR(CDCl ₃ )δ：8.28(2H,dd,J＝7.2H,2,1Hz),7.39(2H,dd,J＝7.2Hz,2.1Hz),4.86-4.76(1H,m),4.07(4H,t,J＝6.6Hz),2.36-2.25(2H,m),1.72-1.20(68H,m),0.87(12H,t,J＝6.0Hz).

(4)

[ chemical formula 25 ]

To a mixture of 7- (((4-nitrophenoxy) carbonyl) oxy) tridecane-1, 13-diylbis (2-hexyldecanoate), 2- ((2- (diethylamino) ethyl) (ethyl) amino) ethan-1-ol, triethylamine and tetrahydrofuran was added 4-dimethylaminopyridine, which was stirred under reflux with heating for 8 hours. The reaction mixture was cooled to room temperature, water and ethyl acetate were added, the organic layer was separated, washed with a saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (methanol-ethyl acetate) and silica gel column chromatography (ethyl acetate-hexane, NH silica gel) to obtain 7- (((2- ((2- (diethylamino) ethyl) (ethyl) amino) ethoxy) carbonyl) oxy) tridecane-1, 13-diylbis (2-hexyldecanoate) as a colorless oil.

¹ H-NMR(CDCl ₃ )δ：4.73-4.61(1H,m),4.17(2H,t,J＝6.6Hz),4.05(4H,t,J＝6.6Hz),2.76(2H,t,J＝6.6Hz),2.67-2.46(10H,m),2.36-2.23(2H,m),1.68-1.16(68H,m),1.09-0.97(9H,m),0.94-0.81(12H,m).MSm/z(M+H)：924.

Production example 2

(1)

[ chemical formula 26 ]

To a mixture of 2- (isopropylamino) ethane-1-ol (2.0g), 2-bromo-N, N-diethylethane-1-amine hydrobromide (7.6g) and ethanol (20mL) was added potassium carbonate (8.0g), and the mixture was stirred under reflux with heating for 7 hours. The reaction mixture was cooled to room temperature, insoluble materials were filtered off, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane, NH silica gel) to obtain 2- ((2- (diethylamino) ethyl) (isopropyl) amino) ethan-1-ol (3.5g) as a pale yellow oil.

MSm/z(M+H)：203.

(2)

[ chemical formula 27 ]

A mixture of 10-ethoxy-10-oxodecanoic acid, thionyl chloride and N, N-dimethylformamide was stirred under heating reflux for 1 hour 30 minutes. The solvent was distilled off under reduced pressure to give ethyl 10-chloro-10-oxodecanoate as a crude product as a pale yellow oil.

A1.0 mol/L decyl magnesium bromide-diethyl ether solution was added dropwise to a tetrahydrofuran suspension of zinc (II) chloride at-78 ℃ and, after warming to 0 ℃, stirred at that temperature for 30 minutes. To the reaction mixture were added tetrakis (triphenylphosphine) palladium (0) and ethyl 10-chloro-10-oxodecanoate, and the mixture was stirred at 0 ℃ for 1 hour. To the reaction mixture were added 1.0mol/L aqueous hydrochloric acid solution and ethyl acetate, and the organic layer was separated, washed with saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to obtain 10-oxoeicosanoic acid ethyl ester as a brown oil.

Tetraisopropyl orthotitanate was added to a mixture of ethyl 10-oxoeicosanoate and 2-butyloctan-1-ol, and stirred at 110 ℃ for 17 hours. To the reaction mixture were added water and ethyl acetate, and the organic layer was separated, dried over anhydrous sodium sulfate, and then the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to obtain 10-oxoeicosanoic acid 2-butyl octyl ester as a pale yellow solid.

To a mixture of 10-oxoeicosanoic acid 2-butyloctyl ester, methanol and tetrahydrofuran was added sodium borohydride under ice-cooling, and stirred at room temperature for 1 hour. After the reaction mixture was poured into a mixture of ice and water, a 1.0mol/L aqueous hydrochloric acid solution was added to the mixture, and the organic layer was separated, dried over anhydrous sodium sulfate, and then the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to obtain 10-hydroxyeicosanoic acid 2-butyloctyl ester as a white solid.

4-nitrophenyl chloroformate was added to a mixture of 2-butyloctyl 10-hydroxyeicosanoic acid, triethylamine and tetrahydrofuran, and the mixture was stirred at room temperature for 3 hours. Water and ethyl acetate were added to the reaction mixture, and the organic layer was separated, washed with a saturated aqueous sodium chloride solution, dried over sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to obtain 2-butyloctyl 10- (((4-nitrophenoxy) carbonyl) oxy) eicosanoate as a colorless oil.

To a mixture of 10- (((4-nitrophenoxy) carbonyl) oxy) eicosanoic acid 2-butyloctyl ester, 2- ((2- (diethylamino) ethyl) (isopropyl) amino) ethan-1-ol, triethylamine and tetrahydrofuran was added 4-dimethylaminopyridine, which was stirred under heating and reflux. The reaction mixture was cooled to room temperature, water and ethyl acetate were added, the organic layer was separated, washed with a saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (methanol-ethyl acetate) and silica gel column chromatography (ethyl acetate-hexane, NH silica gel) to give 12-decyl-3-ethyl-6-isopropyl-10-oxo-9, 11-dioxa-3, 6-diaza-heneicosane-21- (2-butyloctyl) ester as a colorless oil.

¹ H-NMR(CDCl ₃ )δ：4.73-4.61(1H,m),4.10(2H,t,J＝6.6Hz),3.97(2H,d,J＝6.0Hz),2.99-2.83(1H,m),2.68(2H,t,J＝6.6Hz),2.62-2.41(8H,m),2.29(2H,t,J＝7.2Hz),1.69-1.47(7H,m),1.40-1.19(42H,m),1.10-0.96(12H,m),0.94-0.83(9H,m).

MSm/z(M+H)：726.

Production example 3

(1)

[ chemical formula 28 ]

To a mixture of 2, 2' -azobis (ethane-1-ol) (2.0g), 2-bromo-N, N-diethylethane-1-amine hydrobromide (7.4g) and ethanol (40mL) was added potassium carbonate (7.9g), and the mixture was stirred under reflux with heating for 8 hours. The reaction mixture was cooled to room temperature, insoluble materials were filtered off, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane, NH silica gel) to obtain 2, 2' - ((2- (diethylamino) ethyl) azanediyl) bis (ethan-1-ol) (2.3g) as a pale yellow oil.

MSm/z(M+H)：205.

(2)

[ chemical formula 29 ]

A mixture of 10-methoxy-10-oxodecanoic acid, thionyl chloride and N, N-dimethylformamide was stirred under heating reflux for 1 hour. The solvent was distilled off under reduced pressure to give methyl 10-chloro-10-oxodecanoate as a brown oil.

¹ H-NMR(CDCl ₃ )δ：3.67(3H,s),2.88(2H,t,J＝7.2Hz),2.30(2H,t,J＝7.2Hz),1.75-1.57(4H,m),1.38-1.25(8H,m).

A1.0 mol/L hexylmagnesium bromide-diethyl ether solution was added dropwise to a tetrahydrofuran suspension of zinc (II) chloride at-78 ℃ and, after warming to 0 ℃, stirred at that temperature for 30 minutes. After tetrakis (triphenylphosphine) palladium (0) was added to the reaction mixture under ice-cooling, methyl 10-chloro-10-oxodecanoate was added dropwise at that temperature, and stirred at that temperature for 1 hour. To the reaction mixture were added 1.0mol/L aqueous hydrochloric acid solution and ethyl acetate, and the organic layer was separated, washed with saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to obtain methyl 10-oxohexadecanoate as a white solid.

¹ H-NMR(CDCl ₃ )δ：3.67(3H,s),2.38(4H,t,J＝7.2Hz),2.30(2H,t,7.2Hz),1.65-1.49(6H,m),1.35-1.20(14H,m),0.88(3H,t,J＝7.2Hz).

To a mixture of methyl 10-oxohexadecanoate and 2-butyloctane-1-ol was added tetraisopropyl orthotitanate, and the mixture was stirred at 110 ℃ for 1 hour. Water was added to the reaction mixture, and after stirring at room temperature for 15 minutes, the mixture was purified by silica gel column chromatography (ethyl acetate-hexane) to obtain 2-butyloctyl 10-oxohexadecanoate as a colorless oil.

¹ H-NMR(CDCl ₃ )δ：3.97(2H,d,J＝5.6Hz),2.38(4H,t,J＝7.6Hz),2.29(2H,t,J＝7.6Hz),1.65-1.50(7H,m),1.35-1.20(30H,m),0.92-0.83(9H,m).

To a mixture of 2-butyloctyl 10-oxohexadecanoate, methanol and tetrahydrofuran was added sodium borohydride under ice-cooling, and stirred at that temperature for 30 minutes. After the reaction mixture was poured into a mixture of ice and water, 1.0mol/L aqueous hydrochloric acid solution and ethyl acetate were added to separate an organic layer, which was then washed with saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and then the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to obtain 2-butyloctyl 10-hydroxyhexadecanoate as a colorless oil.

¹ H-NMR(CDCl ₃ )δ：3.97(2H,d,J＝6.0Hz),3.61-3.54(1H,m),2.30(2H,t,J＝7.6Hz),1.65-1.56(3H,m),1.48-1.22(38H,m),0.92-0.83(9H,m).

4-nitrophenyl chloroformate was added to a mixture of 2-butyloctyl 10-hydroxyhexadecanoate, triethylamine and tetrahydrofuran, and stirred at room temperature for 4 hours. To the reaction mixture were added water and ethyl acetate, and the organic layer was separated, washed with water, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to obtain 2-butyloctyl 10- (((4-nitrophenoxy) carbonyl) oxy) hexadecanoate as a colorless oil.

¹ H-NMR(CDCl ₃ )δ：8.28(2H,dd,J＝7.2Hz,2.1Hz),7.39(2H,dd,J＝7.2Hz,2.1Hz),4.86-4.76(1H,m),3.97(2H,d,J＝5.7Hz),2.30(2H,t,J＝7.2Hz),1.74-1.20(41H,m),0.92-0.85(9H,m).

(3)

[ chemical formula 30 ]

To a mixture of 2-butyloctyl 10- (((4-nitrophenoxy) carbonyl) oxy) hexadecanoate, 2' - ((2- (diethylamino) ethyl) azanediyl) bis (ethan-1-ol), triethylamine and tetrahydrofuran was added 4-dimethylaminopyridine, and the mixture was stirred at 80 ℃ for 8 hours. The reaction mixture was cooled to room temperature, water and ethyl acetate were added, the organic layer was separated, washed with a saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (methanol-ethyl acetate) and silica gel column chromatography (ethyl acetate-hexane, NH silica gel) to give 3-ethyl-12-hexyl-6- (2-hydroxyethyl) -10-oxo-9, 11-dioxa-3, 6-diaza-heneicosane-21- (2-butyloctyl) ester as a colorless oil.

¹ H-NMR(CDCl ₃ )δ：4.75-4.61(1H,m),4.21(2H,t,J＝6.6Hz),3.97(2H,d,J＝5.7Hz),3.55(2H,t,J＝5.1Hz),2.89(2H,t,J＝6.6Hz),2.76-2.65(4H,m),2.64-2.41(6H,m),2.30(2H,t,J＝8.1Hz),1.72-1.45(7H,m),1.40-1.20(34H,m),1.13-0.98(6H,m),0.96-0.81(9H,m).

MSm/z(M+H)：672.

(4)

[ chemical formula 31 ]

To a mixture of 3-ethyl-12-hexyl-6- (2-hydroxyethyl) -10-oxo-9, 11-dioxa-3, 6-diaza-heneicosane-21- (2-butyloctyl) ester, octanoic acid, triethylamine, 4-dimethylaminopyridine and dichloromethane was added 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride and stirred at room temperature for 6 hours. Water and ethyl acetate were added to the reaction mixture, and the organic layer was separated, washed with water, dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (methanol-ethyl acetate) and silica gel column chromatography (ethyl acetate-hexane, NH silica gel), whereby 3-ethyl-12-hexyl-6- (2- (octanoyloxy) ethyl) -10-oxo-9, 11-dioxa-3, 6-diaza-heneicosane-21- (2-butyloctyl) ester was obtained as a colorless oil.

¹ H-NMR(CDCl ₃ )δ：4.71-4.62(1H,m),4.20-4.08(4H,m),3.97(2H,d,J＝5.6Hz),2.89-2.77(4H,m),2.73-2.42(8H,m),2.29(4H,t,J＝7.6Hz),1.68-1.48(9H,m),1.39-1.18(42H,m),1.10-0.98(6H,m),0.94-0.81(12H,m).

MSm/z(M+H)：798.

Production example 4

(1)

[ chemical formula 32 ]

10- (((4-nitrophenoxy) carbonyl) oxy) hexadecanoic acid 2-hexyldecyl ester was obtained as a colorless oil in the same manner as in example 3(2) except that 2-hexyldecan-1-ol was used in place of 2-butyloctane-1-ol used in production example 3.

¹ H-NMR(CDCl ₃ )δ：8.28(2H,dd,J＝7.2Hz,2.4Hz),7.39(2H,dd,J＝7.2Hz,2.4Hz),4.85-4.77(1H,m),3.97(2H,d,J＝5.6Hz),2.30(2H,t,J＝7.6Hz),1.72-1.20(49H,m),0.92-0.85(9H,m).

(2)

[ chemical formula 33 ]

To a mixture of 2-hexyldecyl 10- (((4-nitrophenoxy) carbonyl) oxy) hexadecanoate, 2- ((2- (diethylamino) ethyl) (isopropyl) amino) ethan-1-ol, triethylamine and tetrahydrofuran was added 4-dimethylaminopyridine, which was stirred at 80 ℃ for 8 hours. The reaction mixture was cooled to room temperature, water and ethyl acetate were added, the organic layer was separated, washed with a saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (methanol-ethyl acetate) and silica gel column chromatography (ethyl acetate-hexane, NH silica gel) to give 3-ethyl-12-hexyl-6-isopropyl-10-oxo-9, 11-dioxa-3, 6-diaza-heneicosane-21- (2-hexyldecyl) ester as a colorless oil.

¹ H-NMR(CDCl ₃ )δ：4.72-4.61(1H,m),4.10(2H,t,J＝6.6Hz),3.97(2H,d,J＝5.7Hz),2.97-2.87(1H,m),2.68(2H,t,J＝6.6Hz),2.62-2.40(8H,m),2.29(2H,t,J＝7.2Hz),1.69-1.49(7H,m),1.40-1.19(42H,m),1.12-0.95(12H,m),0.93-0.82(9H,m).MSm/z(M+H)：726.

< preparation of Artificial siRNA >

Production example 5

(1) Synthesis of Single-stranded nucleic acid molecules

The single-stranded nucleic acid molecules shown below were synthesized by an AB13900 nucleic acid synthesizer (trade name, Applied Biosystems) based on the phosphoramidite method. In the above synthesis, EMM amidate (international publication No. 2013/027843) was used as RNA amidate (the same applies hereinafter). Deprotection of the amide compound is carried out according to a conventional method. The synthesized single-stranded nucleic acid molecule was purified by HPLC.

As the single-stranded nucleic acid molecules, HBV gene expression suppression sequences represented by the following sequence A and sequence B were synthesized as described above, respectively. In each single-stranded nucleic acid molecule, P is a linker molecule represented by the following formula,

[ chemical formula 34 ]

[ chemical formula 35 ]

The L-proline diamide amidate compound represented by the above formula is introduced into the oligomer. In each sequence, the underlined portion is a gene expression-inhibiting sequence.

(sequence A)

5' -CGUCUGUGCCUUCUCAUCUUCAU (SEQ ID NO: 1) -P-AUGAAGAUGAGAAGGCACAGACGGG(SEQ ID NO: 2) -3'

(sequence B)

5' -CGUCUGUGCCUUCUCAUCUUCCC (SEQ ID NO: 3) -P-GGGAAGAUGAGAAGGCACAGACGGG(SEQ ID NO: 4) -3'

1.In vitro (in vitro) assay

< preparation of lipid particle containing nucleic acid >

Reference examples 101 to 103 used 7- (((2- ((2- (diethylamino) ethyl) (ethyl) amino) ethoxy) carbonyl) oxy) tridecane-1, 13-diylbis (2-hexyldecanoate) produced in production example 1 or 12-decyl-3-ethyl-6-isopropyl-10-oxo-9, 11-dioxa-3, 6-diaza-heneicosane-21- (2-butyloctyl) ester produced in production example 2 as the cationic lipid.

In comparative example 101, a lipid having the following structure (comparative compound a) synthesized by the method described in patent document 4 was used as the cationic lipid.

[ chemical formula 36 ]

The cationic lipid, DSPC (1,2-Distearoyl-sn-glycero-3-phosphocholine (1, 2-stearoyl-sn-glyco-3-phosphocholine) as a phospholipid, COATSOME MC-8080 (NOF corporation), Cholesterol (product name: Cholesterol HP; Nippon Seikagaku Co., Ltd.), and DMG-PEG2000 (product name: SuNBRIGHT (R) GM-020 (NOF corporation)) as a PEG lipid were dissolved in ethanol at a molar ratio shown in Table 1 to give an oil phase at a total lipid concentration of 20 mmol/L.

Biomacromolecules 2013 in comparative examples 101 and 102; 14,3903-3915, and comparative example 103 and reference examples 101 to 103 in which 5mg of each of the single-stranded nucleic acids having the sequence B prepared in preparation example 5 (hereinafter referred to as siRNA01) was dissolved in 1mL of sterile water and diluted with 10mmol/L of acetic acid buffer solution having a pH of 4 so that the nucleic acid concentration became 19.7. mu. mol/L, an aqueous phase was obtained. Then, the mixture was mixed in a micro mixer (see japanese patent No. 5288254) using a syringe pump so that the volume ratio of the aqueous phase to the oil phase was set to the following ratio: oil phase 3: 1, the mixture was diluted 2-fold with Phosphate Buffered Saline (PBS). Further, ethanol was removed by dialysis using PBS, to obtain a dispersion of nucleic acid lipid particles. The resulting dispersion was filtered through a 0.22 μm diameter filter (Minisart 16534-K, manufactured by Sartorius corporation) and sterilized. The mass ratio of siRNA to total lipid at the time of mixing is described in table 1.

TABLE 1

< measurement of particle size and siRNA Inclusion Rate >

< measurement of particle size >

The particle diameter of the lipid particle containing siRNA01 was measured in a state of a stock solution of a lipid particle dispersion by using a particle diameter measuring system ELS-Z2 (Otsuka Denshi).

< evaluation of encapsulation efficiency of siRNA >

(quantification of Total nucleic acid concentration)

To 60. mu.L of the nucleic acid-retaining lipid particle, 30. mu.L of 3mol/L aqueous sodium acetate solution and 9. mu.L of glycogen were added, followed by 1.5mL of ethanol to dissolve the lipid and precipitate only the nucleic acid. Then, centrifugation was performed to remove the supernatant. After air-drying for 15 minutes or more, water was added to redissolve it, and the total nucleic acid concentration was quantified by concentration measurement using Nan oDrop NF1000(Thermo Fisher Scientific).

(quantification of nucleic acid concentration in the external aqueous phase)

Quantification was performed using the Quant-iT RiboGreen RNA Assay Kit (Thermo Fisher Scientific) according to the protocol. First, the 20 × TE buffer contained in the kit was diluted with water to prepare a 1 × TE buffer. Wherein TE represents Tris/EDTA (ethylenediaminetetraacetic acid). In order to quantify only nucleic acid in the external aqueous phase, the lipid particle dispersion holding nucleic acid was diluted to 10000 times with 1 × TE buffer.

The nucleic acid concentration in the outer aqueous phase was quantified by adding 100. mu.L of the lipid particle dispersion diluted 10000 times to a 96-well plate, adding 100. mu.L of RiboGreen reagent (reagent contained in the above-mentioned Quanti-iT RiboGreen RNA Assay Kit) diluted 2000 times with 1 XTE buffer to the sample, and measuring the fluorescence (excitation wavelength: 485nm, fluorescence wavelength: 535nm) using a microplate reader InfiniEF 200 (TECAN).

(calculation of Inclusion ratio)

The nucleic acid inclusion rate of the nucleic acid lipid particles was calculated according to the following formula using the results of the quantification of the total nucleic acid concentration obtained in the above step and the nucleic acid concentration in the external aqueous phase.

Nucleic acid inclusion rate (%) (total nucleic acid concentration-nucleic acid concentration in external aqueous phase) ÷ total nucleic acid concentration × 100

The results are shown in Table 2.

TABLE 2

	Inner packaging Rate (%)	Particle size (nm)
			Comparative example 101	66	74
Comparative example 102	83	73
			Comparative example 103	80	95
Reference example 101	91	95
			Reference example 102	100	63
Reference example 103	87	86

< in vitro test >

An anti-HBV assay in PXB cells was performed as follows using the nucleic acid-encapsulating lipid particle dispersion of the present invention.

(PXB-anti-HBV analysis in cells)

anti-HBV activity was evaluated using fresh human hepatocytes (PXB cells, manufactured by Phoenixbio) collected from a PXB mouse (human hepatocyte chimera mouse) according to the following procedure.

The following medium was used as the medium.

DMEM (manufactured by Sigma) + 0.25. mu.g/mL insulin (manufactured by Fuji film and Wako Junyaku Co., Ltd.) + 1% penicillin/streptomycin (manufactured by Sigma-Aldrich Co.) +20mmol/L HEPES (manufactured by Sigma-Aldrich Co.) + 15. mu.g/mL L-proline (manufactured by Sigma-Aldrich Co.) +50nmol/L dexamethasone (manufactured by Sigma-Aldrich Co.) +5ng/mL EGF (manufactured by Peprotech Co.) +0.1mmol/L ascorbic acid film 2 phosphoric acid (manufactured by Fuji film and Wako Junyaku K.) + 10% FBS + 2% DMSO 2%

Then, a drug adjusted to a concentration 20 times the test concentration by D-PBS (-) (manufactured by Fuji film and Wako pure chemical industries, Ltd.) was added to the culture medium to prepare test solutions of various concentrations of each drug.

(1) Will be at 7X 10 ⁴ Cells/well PXB cells seeded in 96-well microtiter plates using 5% CO ₂ Incubators were incubated at 37 ℃ until day of infection.

(2) HBV (genotype C _ JPNAT) derived from PXB-cell culture supernatant was suspended in the above-mentioned medium containing 4% PEG-8000, added to the plate of (1) to reach 10 copies/cell, allowed to infect (100. mu.L/well), and 5% CO was used ₂ Incubate the incubator at 37 ℃ for 1 day.

(3) Culture supernatant on day 1 after infection was removed, and the above medium was added to a plate (100. mu.L/well) with 5% CO ₂ Incubate the incubator at 37 ℃ for 1 day.

(4) Culture supernatants were removed on day 2 post infection, and the above media were added to plates (100. mu.L/well) with 5% CO ₂ Incubate the incubator at 37 ℃ for 5 days.

(5) Culture supernatants were removed at day 7 post infection, and the media was added to plates (100. mu.L/well) with 5% CO ₂ Incubate the incubator at 37 ℃ for 5 days.

(6) Culture supernatants were removed at day 12 post infection, and the media was added to plates (100. mu.L/well) with 5% CO ₂ Incubate the incubator at 37 ℃ for 5 days.

(7) Removing culture supernatant on day 17 after infectionThe test solution was added to the plate (100. mu.L/well) with 5% CO ₂ Incubators were incubated at 37 ℃. In a control without drug addition, the above medium was added to the plate (100. mu.L/well) with 5% CO ₂ Incubators were incubated at 37 ℃. After 6 hours of treatment with the test solution, the culture supernatant was removed, and the above medium was added to a plate (100. mu.L/well) and treated with 5% CO ₂ Incubate the incubator at 37 ℃ for 5 days. Media changes were similarly performed for the control without drug addition.

(8) The culture supernatant on day 22 after infection was recovered, and the above medium was added to a plate (100. mu.L/well) with 5% CO ₂ Incubate the incubator at 37 ℃ for 5 days. Media changes were similarly performed for the control without drug addition.

(9) Culture supernatants were recovered at day 27 post infection. To the remaining cells, 100. mu.L/well of CellTiter 96Aqueous One Solution Cell Proliferation Assay (manufactured by Promega corporation) diluted 10-fold with D-PBS (-) was added and the mixture was washed with 5% CO ₂ After staining the cells in the incubator at 37 ℃ for 1 to 2 hours, the absorbance at 490 and 655nm was measured to evaluate the cell activity. The T/C% of cell activity was calculated by the method shown in the following formula.

[ mathematical formula 1]

(10) The recovered HBsAg in the culture supernatant at 22 th and 27 th days after infection was absolutely quantified using Lumipulse (registered trademark) HBsAg-HQ (manufactured by Rebio, Fuji). Relative values (%) to controls without drug addition were calculated, respectively. The concentrations were plotted as logarithms and relative values as real numbers, and IC of the agents was calculated using FORECAST function (1-fold regression method) of Microsoft Office Excel 2007 ₅₀ 。

The results are shown in table 3 and fig. 1. In fig. 1, the cell activity 27 days after infection is expressed as a relative value to the wells to which no drug was added. The mean and standard deviation of 3 wells are shown.

TABLE 3

Although the single-stranded nucleic acids of sequence B and the single-stranded nucleic acids of sequence a used in reference examples 101 to 103 have different structures, they are similar to each other, and excellent effects are obtained in the above-described experiments as compared with comparative examples 101 and 102.

2.In vivo (in vivo) assay I

< preparation of lipid particle containing nucleic acid >

Reference example 201 used 7- (((2- ((2- (diethylamino) ethyl) (ethyl) amino) ethoxy) carbonyl) oxy) tridecane-1, 13-diylbis (2-hexyldecanoate) produced in production example 1 and reference example 202 used 12-decyl-3-ethyl-6-isopropyl-10-oxo-9, 11-dioxa-3, 6-diaza-heneicosane-21- (2-butyloctyl) ester produced in production example 2 as cationic lipids.

In comparative example 201 and comparative example 202, a lipid (comparative compound a) having the following structure synthesized by the method described in patent document 4 was used as the cationic lipid.

[ chemical formula 37 ]

The cationic lipid, DSPC (1,2-Distearoyl-sn-glycero-3-phosphocholine (1, 2-stearoyl-sn-glyco-3-phosphocholine) as a phospholipid, COATSOME MC-8080 (product name), Cholesterol (product name: Cholesterol HP; Nippon Seikagaku Co., Ltd.), and DMG-PEG2000 (product name: SuNBRIGHT (R) GM-020 (product name: NOF corporation)) as a PEG lipid were dissolved in ethanol at a molar ratio shown in Table 4 to give an oil phase at a total lipid concentration of 20 mmol/L.

In comparative example 201, the nucleic acid having the sequence C shown below, comparative example 202 and reference examples 201 and 202, siRNA 015 mg produced in production example 5 was dissolved in 1mL of sterile water, and diluted with 10mmol/L of an acetic acid buffer solution having a pH of 4 so that the nucleic acid concentration became 19.7. mu. mol/L, to obtain an aqueous phase. Then, the mixture was mixed in a micro mixer (see japanese patent No. 5288254) using a syringe pump so that the volume ratio of the aqueous phase to the oil phase was set to the following ratio: oil phase 3: 1, the mixture was diluted 2-fold with Phosphate Buffered Saline (PBS). Further, ethanol was removed by dialysis using PBS, to obtain a dispersion of nucleic acid lipid particles. The resulting dispersion was filtered through a 0.22 μm diameter filter (Minisart 16534-K, manufactured by Sart orius), concentrated through an ultrafiltration membrane using an Amicon Ultra centrifugal filter unit (manufactured by Merck), and diluted with PBS to a desired concentration to obtain an administration preparation. The mass ratio of siRNA to total lipid at the time of mixing is shown in table 4.

Nucleic acids of sequence C shown below were synthesized in the same manner as in preparation example 5.

(sequence C)

GUACCGCACGUCAUUCGUAUCCC (SEQ ID NO: 5) -P-GGGAUACGAAUGACGUGCGGUACGU (SEQ ID NO: 6)

TABLE 4

The preparations used in comparative examples 201 and 202 and reference examples 201 and 202 were prepared 2 times by the above method, and the results of measuring the particle size and the siRNA inclusion rate are shown in table 5.

TABLE 5

	Inner packaging Rate (%)	Particle size (nm)
			Comparative example 201	80～86	87～96
Comparative example 202	71～86	92～94
			Reference example 201	74～87	93～97
Reference example 202	81～89	108～118

< in vivo test >

(in vivo efficacy test of human hepatocyte chimera mouse)

PXB mice (human hepatocyte-chimeric mice) having an HBV genotype C infection and a male age of more than 25 weeks and a body weight of more than 17g after 10 weeks were divided into 5 groups (2 or 3 mice each) and used.

The preparations of reference example 201, reference example 202, comparative example 202 and comparative example 201 of the negative control were intravenously administered at 1mg/kg 2 times per week and 4 weeks per week, respectively. The remaining 1 group was used as a control group, and the phosphate buffer solution was intravenously administered 2 times a week for 4 weeks. The day of initial administration was regarded as day 0, and blood was collected from the orbital venous plexus on days 2, 6, 13 and 20 under anesthesia with sevoflurane. Further, the final administration was performed on day 25, and the abdominal cavity was opened under sevoflurane anesthesia 30 minutes after the administration, and blood was collected from the inferior vena cava. Serum was separated from the collected Blood and purified using QIAamp (registered trademark) DNA Blood Mini Kit (manufactured by QIAGEN). The amount of HBV-DNA in the resulting solution was absolutely quantified by the real-time PCR method. The amount of HBsAg in serum was determined absolutely by chemiluminescence enzyme immunoassay using Lumipulse (registered trademark) HBsAg-HQ (manufactured by Rebio, Fuji). The results are shown in Table 6.

TABLE 6

HBV-DNA in serum (copies/mL)

HBsAg in serum (IU/mL)

NC: not calculated (since N is 2, it cannot be calculated)

By the administration of the preparation, HBV-DNA and HBsAg in serum were reduced, and the drug effect was also confirmed in human hepatocyte-chimeric mice.

The single-stranded nucleic acid of sequence B used in reference examples 201 and 202 had a similar structure to that of sequence a, although it was different in structure, and exhibited superior drug efficacy as compared with comparative examples 201 and 202.

3.In vivo test II

< preparation of nucleic acid-encapsulating lipid particle >

In example 301, 3-ethyl-12-hexyl-6-isopropyl-10-oxo-9, 11-dioxa-3, 6-diaza-heneicosane-21- (2-hexyldecyl) ester produced in production example 4 and in example 302, 3-ethyl-12-hexyl-6- (2- (octanoyloxy) ethyl) -10-oxo-9, 11-dioxa-3, 6-diaza-icosane-21- (2-butyloctyl) ester produced in production example 3 were used as cationic lipids.

The cationic lipid, DSPC (1,2-Distearoyl-sn-glycero-3-phosphocholine (1, 2-stearoyl-sn-glyco-3-phosphocholine) as a phospholipid, COATSOME MC-8080 (product name), Cholesterol (product name: Cholesterol HP; Nippon Seikagaku Co., Ltd.), and DMG-PEG2000 (product name: SuNBRIGHT (R) GM-020 (product name: NOF corporation)) as a PEG lipid were dissolved in ethanol at a molar ratio shown in Table 7 to give an oil phase at a total lipid concentration of 20 mmol/L.

5mg of the single-stranded nucleic acid of sequence A (hereinafter referred to as siRNA02) prepared in preparation example 5 was dissolved in 1mL of sterile water, and the solution was diluted with 50mmol/L of citric acid buffer solution having a pH of 4 in example 301 and 10mmol/L of acetic acid buffer solution having a pH of 4 in preparation example 302 to give a nucleic acid concentration of 19.7. mu. mol/L, respectively, to obtain an aqueous phase. Then, the mixture was mixed in a micro mixer (see japanese patent No. 5288254) using a syringe pump so that the volume ratio of the aqueous phase to the oil phase was set to the following ratio: oil phase 3: 1, the mixture was diluted 2-fold with Phosphate Buffered Saline (PBS). Further, ethanol was removed by dialysis using PBS, to obtain a dispersion of nucleic acid lipid particles. The obtained dispersion was sterilized by filtration through a 0.22 μm diameter filter (Minisart 16534-K, manufactured by Sartorius), concentrated by an ultrafiltration membrane using an Amicon Ultra centrifugal filter unit (manufactured by Merck), and then diluted with PBS to a desired concentration to obtain an administration preparation. The mass ratio of siRNA to total lipid at the time of mixing is shown in table 6.

TABLE 7

< measurement of particle size and siRNA Inclusion Rate >

The formulations used in examples 301 and 302 were prepared 3 times by the above method, and the results of measuring the particle size and the siRNA inclusion rate are shown in table 8.

TABLE 8

	Inner packaging Rate (%)	Particle size (nm)
			Example 301	88～93	115～124
Example 302	89～94	105～120

< in vivo test >

(test of in vivo efficacy in human hepatocyte chimera mice)

PXB mice (human hepatocyte-chimeric mice) having an HBV genotype C infection and a male age of 9 weeks or more and a body weight of 15g or more after the infection were divided into 3 groups (3 mice each).

The formulations of example 301 and example 302 were administered intravenously at 1mg/kg 2 times a week and 6 weeks, respectively. The remaining 1 group was used as a control group, and the phosphate buffer solution was intravenously administered 2 times a week for 6 weeks. The day of initial administration was regarded as day 0, and blood was collected from the orbital venous plexus under anesthesia using sevoflurane on days 1, 6, 14, 20, 27 and 37. Further, the final administration was performed on day 37, and the abdominal cavity was opened under sevoflurane anesthesia 30 minutes after the administration, and blood was collected from the inferior vena cava. Serum was separated from the collected Blood and purified using QIAamp (registered trademark) DN A Blood Mini Kit (manufactured by QIAGEN). The amount of HBV-DNA in the resulting solution was absolutely quantified by the real-time PCR method. The amount of HBsAg in serum was determined absolutely by chemiluminescence enzyme immunoassay using Lumipulse (registered trademark) HBsAg-HQ (manufactured by Rebio, Fuji). The results are shown in Table 9.

TABLE 9

HBV-DNA in serum (copies/mL)

HBsAg in serum (IU/mL)

By administration of the preparation of the present invention, HBV-DNA and HBsAg in serum were reduced, and the drug effect was also confirmed in human hepatocyte-chimeric mice.

Industrial applicability

The pharmaceutical composition of the present invention can efficiently deliver artificial siRNA, and has an excellent translational inhibition effect. Therefore, the pharmaceutical composition of the present invention is useful as a medicament.

Sequence listing

<110> Fuji film Co., Ltd

BONAC Corp.

<120> pharmaceutical composition and treatment agent

<130> 19F02547W1

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> description of Artificial sequences synthetic RNA

<400> 1

cgucugugcc uucucaucuu cau 23

<210> 2

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> description of Artificial sequences synthetic RNA

<400> 2

augaagauga gaaggcacag acggg 25

<210> 3

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> description of Artificial sequences synthetic RNA

<400> 3

cgucugugcc uucucaucuu ccc 23

<210> 4

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> description of Artificial sequences synthetic RNA

<400> 4

gggaagauga gaaggcacag acggg 25

<210> 5

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> description of Artificial sequences synthetic RNA

<400> 5

guaccgcacg ucauucguau ccc

23

<210> 6

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> description of Artificial sequences synthetic RNA

<400> 6

gggauacgaa ugacgugcgg uacgu 25

Claims

1. A pharmaceutical composition comprising an artificial siRNA capable of inhibiting expression of a hepatitis B virus gene, a lipid which is a compound represented by formula (1) or a salt thereof, cholesterol, and a lipid having a polyethylene glycol structure, wherein the artificial siRNA comprises a nucleic acid molecule comprising a base sequence represented by the following sequence A,

(sequence A)

5’-CGUCUGUGCCUUCUCAUCUUCAU-P-AUGAAGAUGAGAAGGCACAGACGGG-3’

In the formula, P represents:

[ chemical formula 1]

[ chemical formula 2]

In the formula, X represents-NR ¹ -or-O-,

[ chemical formula 3]

[ chemical formula 4]

R ⁴ and R ⁵ 、R ¹⁰ And R ⁵ 、R ⁵ And R ¹² 、R ⁴ And R ⁶ 、R ⁵ And R ⁶ 、R ⁶ And R ⁷ 、R ⁶ And R ¹⁰ 、R ¹² And R ⁷ And R ⁷ And R ⁸ Any one or more of them may be connected to each other to form a 4-to 7-membered ring which may contain an O atom,

2. The pharmaceutical composition according to claim 1, wherein the lipid having a polyethylene glycol structure is a lipid having a diacylglycerol structure and a polyethylene glycol structure.

3. The pharmaceutical composition according to any one of claims 1 or 2, wherein the content of lipid as the compound represented by formula (1) or a salt thereof is 40 to 70 mol% with respect to the total lipid.

4. A pharmaceutical composition according to any one of claims 1 to 3 wherein cholesterol is present in an amount of 25 to 60 mole% based on total lipid.

5. A pharmaceutical composition according to any one of claims 1 to 4, wherein the content of the lipid having a polyethylene glycol structure is 0.5 to 10 mol% with respect to the total lipid.

6. The pharmaceutical composition according to any one of claims 1 to 5, wherein the content of the artificial siRNA capable of suppressing the expression of hepatitis B virus gene is 1 to 25% by mass based on the total lipid.

7. A remedy for hepatitis B, which comprises the pharmaceutical composition according to any one of claims 1 to 6.

8. A remedy for liver cirrhosis or liver cancer, which contains the pharmaceutical composition according to any one of claims 1 to 6.