CN114807362B - Diagnostic kit for colorectal cancer or adenoma - Google Patents

Diagnostic kit for colorectal cancer or adenoma Download PDF

Info

Publication number
CN114807362B
CN114807362B CN202110107656.3A CN202110107656A CN114807362B CN 114807362 B CN114807362 B CN 114807362B CN 202110107656 A CN202110107656 A CN 202110107656A CN 114807362 B CN114807362 B CN 114807362B
Authority
CN
China
Prior art keywords
chr9
region
methylation
gene
adenoma
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110107656.3A
Other languages
Chinese (zh)
Other versions
CN114807362A (en
Inventor
张良禄
董兰兰
周谛晗
孙帆
吴志诚
万康康
李婷婷
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuhan Aimisen Life Technology Co ltd
Original Assignee
Wuhan Aimisen Life Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wuhan Aimisen Life Technology Co ltd filed Critical Wuhan Aimisen Life Technology Co ltd
Priority to CN202110107656.3A priority Critical patent/CN114807362B/en
Priority to PCT/CN2021/120581 priority patent/WO2022160750A1/en
Publication of CN114807362A publication Critical patent/CN114807362A/en
Application granted granted Critical
Publication of CN114807362B publication Critical patent/CN114807362B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a diagnosis kit for colorectal cancer or adenoma, and relates to the technical field of tumor diagnosis. The kit disclosed by the invention contains a reagent for detecting methylation of a target gene, wherein the target gene comprises a C9orf50 gene. The diagnosis kit disclosed by the invention takes the C9orf50 gene as a marker, and has higher sensitivity and specificity by detecting methylation results to diagnose or assist diagnosis of colorectal cancer or adenoma; the invention provides a new idea for diagnosing colorectal cancer or adenoma.

Description

Diagnostic kit for colorectal cancer or adenoma
Technical Field
The invention relates to the technical field of tumor diagnosis, in particular to a diagnosis kit for colorectal cancer or adenoma.
Background
Colorectal cancer is one of the most common malignant tumors worldwide, and the five-year survival rate can reach 90% if early detection is performed, and is less than 10% if later detection is performed. Colorectal cancer usually develops from benign precancerous polyps, which are locally growing or the accumulation of abnormal cells within the intestinal mucosa protruding into the intestinal lumen. Over time, dividing cells in these polyps may accumulate enough genetic changes to gain the ability to invade the intestinal wall, which is an indication of the onset of colorectal cancer, and eventually they may spread to regional lymph nodes and distant metastatic sites. Fortunately, only a small fraction of polyps eventually develop into cancer, and for those already developing into cancer, the progression usually takes years or even decades, so early detection can reduce the incidence of colorectal cancer.
There are two main types of potential malignant polyps: adenomas and sessile serrated polyps, both types are different from the risk of developing colorectal cancer. In general, most adenomas have tubular histological features of small, circular atypical glands, but as the adenoma grows, areas of long filiform structure are usually formed, described in pathological reports as villous or microtubule. As the name suggests, adenomas are characterized by dysplasia (low degree of fibrosis and structural abnormality). Tubular and villous adenomas, especially those with a villus content of 25%, are generally larger in size and have the potential for larger crypt cancer cells, whereas sessile serrated polyps are flat like carpets. Sessile serrated polyps include sessile serrated adenomas, traditional serrated adenomas and mixed polyps, all of which are associated with the development of colorectal cancer. As the size of polyps increases, the risk of adenomas developing colorectal cancer increases, with 60% -70% of colorectal cancers developing from adenomas. The remaining 25% to 35% of CRC develops from sessile serrated polyps.
From the above, it can be seen that increasing the detection rate of adenoma is extremely important for reducing the incidence and mortality of colorectal cancer, and most of the detection markers disclosed in the prior art have low detection rates of colorectal cancer and adenoma, and low sensitivity and specificity.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide a diagnostic kit for colorectal cancer or adenoma. The kit provided by the invention uses the C9orf50 gene as a marker, and diagnosis or auxiliary diagnosis is carried out on colorectal cancer or adenoma by detecting methylation of the gene, so that the kit has higher sensitivity and specificity; the invention provides a new idea for diagnosing colorectal cancer or adenoma.
The invention is realized in the following way:
in one aspect, the invention provides a kit for diagnosis or assisted diagnosis of colorectal or adenoma comprising reagents for detecting methylation of a gene of interest, said gene of interest being the C9orf50 gene.
The C9orf50 gene is located on the negative sense strand of human chromosome 9, with GRCh38.p13 as the reference genome, and specific positions are 129,612,225bp-129,622,275bp, and the positions of the sites or regions referred to herein are all referenced to GRCh38.p13.
The invention discovers that the C9orf50 gene is used as a marker, diagnosis or auxiliary diagnosis can be carried out on colorectal cancer or adenoma by detecting methylation occurrence, and the kit has higher sensitivity and specificity and effectively improves the detection rate of colorectal cancer or adenoma.
In an alternative embodiment, the target region detected by the agent is the full length region of chr9:129619882-129620879 of the C9orf50 gene or a partial region thereof.
The methylation of different areas on the C9orf50 gene is used for diagnosis, the sensitivity and the specificity are different, and the colorectal cancer or adenoma diagnosis is performed by the full-length area of chr9:129619882-129620879 or a partial area thereof, so that the sensitivity and the specificity can be improved.
In alternative embodiments, the target region is selected from any one or a combination of several of the following regions (1) - (5);
region (1): full length or partial region of chr9: 129620154-129620400;
region (2): full length or partial region of Chr9: 129620272-129620431;
region (3): full length or partial region of Chr9: 129620551-129620722;
region (4): full length or partial region of Chr9: 129620328-129620513;
region (5): full length of Chr9:129620018-129620103 or a partial region thereof.
The above regions (1) - (5) or partial regions thereof are used as methylation detection regions, have higher sensitivity and specificity, and are beneficial to improving the accuracy of diagnosis results.
In alternative embodiments, the target region is the positive strand of the chr9:129620154-129620400 region, the positive strand of the chr9:129620272-129620431 region, the positive strand of the chr9:129620551-129620722 region, the negative strand of the chr9:129620328-129620513 region, or the negative strand of the chr9:129620018-129620103 region.
In alternative embodiments, the target region is the Chr9:129620154, chr9:129620166, chr9:129620184, chr9:129620186, chr9:129620192, chr9:129620386, chr9:129620395, chr9:129620397, and Chr9:129620400 sites on the forward strand of the Chr9:129620154-129620400 region.
In alternative embodiments, the target region is the Chr9:129620282, chr9:129620294, chr9:129620355, chr9:129620358, chr9:129620367, chr9:129620410, and Chr9:129620427 sites on the forward strand of the Chr9:129620272-129620431 region.
In alternative embodiments, the target region is the Chr9:129620555, chr9:129620561, chr9:129620564, chr9:129620598, chr9:129620609, chr9:129620611, chr9:129620613, chr9:129620709, chr9:129620714, and Chr9:129620717 sites on the forward strand of the Chr9:129620551-129620722 region.
In alternative embodiments, the target region is the Chr9:129620512, chr9:129620502, chr9:129620499, chr9:129620491, chr9:129620486, chr9:129620484, chr9:129620465, chr9:129620345, chr9:129620342, chr9:129620340, and Chr9:129620332 sites on the negative strand of the Chr9:129620328-129620513 region.
In alternative embodiments, the target region is the Chr9:129620089, chr9:129620086, chr9:129620078, chr9:129620057, chr9:129620055, chr9:129620035, and Chr9:129620024 sites on the negative strand of the Chr9:129620018-129620103 region.
Based on the present disclosure, one of skill in the art can employ any technique known in the art for detecting methylation of a combination of one or more of the above sites to diagnose colorectal or adenoma, whichever technique is employed, is within the scope of the present invention.
In alternative embodiments, the agent effects detection of methylation of the target gene by one or more of the following methods:
methylation-specific PCR, quantitative methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.
Based on the present disclosure, one of ordinary skill in the art will readily recognize the detection of methylation of a target region using a variety of methods and corresponding reagents. The detection method is not limited to the above, and other methods and corresponding reagent detection are adopted to fall within the protection scope of the invention.
In alternative embodiments, the reagent detects methylation of the target gene by methylation-specific PCR.
In alternative embodiments, the agent comprises one or a combination of several of the following nucleic acid combinations:
the reagent comprises one or a combination of several of the following nucleic acid combinations:
a nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 4-6; the nucleic acid combination allows detection of methylation in region (1) above.
A nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 7-9; the nucleic acid combination allows detection of methylation of the above region (2).
A nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 13-15; the nucleic acid combination allows detection of methylation in region (3) above.
A nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 22-24; the nucleic acid combination allows detection of methylation of the above region (4).
A nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 28-30; the nucleic acid combination detects methylation of the above region (5).
On the premise that the detection area is disclosed, other primers and probes for detecting methylation of the target area, which are not described in the invention, can be designed by a person skilled in the art and are used for methylation detection of the C9orf50 gene so as to diagnose or assist diagnosis of colorectal cancer or adenoma, and the design of the primers and/or the probes does not need creative labor, so that the primers and/or the probes belong to the protection scope of the invention.
In an alternative embodiment, the sample to be tested by the kit is selected from any one of plasma, serum, stool and tissue. The kit provided by the invention can detect methylation of target genes extracted from samples such as blood plasma, serum, feces, tissues and the like.
In another aspect, the invention provides the use of a reagent for detecting methylation of a target gene, which is the C9orf50 gene, in the preparation of a kit for diagnosis or assisted diagnosis of colorectal cancer or adenoma.
In an alternative embodiment, the target region detected by the agent is the full length region of chr9:129619882-129620879 of the C9orf50 gene or a partial region thereof.
In alternative embodiments, the target region is selected from any one or a combination of several of the following regions (1) - (5);
region (1): full length or partial region of chr9: 129620154-129620400;
region (2): full length or partial region of Chr9: 129620272-129620431;
region (3): full length or partial region of Chr9: 129620551-129620722;
region (4): full length or partial region of Chr9: 129620328-129620513;
region (5): full length of Chr9:129620018-129620103 or a partial region thereof.
In alternative embodiments, the target region is the positive strand of the chr9:129620154-129620400 region, the positive strand of the chr9:129620272-129620431 region, the positive strand of the chr9:129620551-129620722 region, the negative strand of the chr9:129620328-129620513 region, or the negative strand of the chr9:129620018-129620103 region.
In alternative embodiments, the target region is the Chr9:129620154, chr9:129620166, chr9:129620184, chr9:129620186, chr9:129620192, chr9:129620386, chr9:129620395, chr9:129620397, and Chr9:129620400 sites on the forward strand of the Chr9:129620154-129620400 region.
In alternative embodiments, the target region is the Chr9:129620282, chr9:129620294, chr9:129620355, chr9:129620358, chr9:129620367, chr9:129620410, and Chr9:129620427 sites on the forward strand of the Chr9:129620272-129620431 region.
In alternative embodiments, the target region is the Chr9:129620555, chr9:129620561, chr9:129620564, chr9:129620598, chr9:129620609, chr9:129620611, chr9:129620613, chr9:129620709, chr9:129620714, and Chr9:129620717 sites on the forward strand of the Chr9:129620551-129620722 region.
In alternative embodiments, the target region is the Chr9:129620512, chr9:129620502, chr9:129620499, chr9:129620491, chr9:129620486, chr9:129620484, chr9:129620465, chr9:129620345, chr9:129620342, chr9:129620340, and Chr9:129620332 sites on the negative strand of the Chr9:129620328-129620513 region.
In alternative embodiments, the target region is the Chr9:129620089, chr9:129620086, chr9:129620078, chr9:129620057, chr9:129620055, chr9:129620035, and Chr9:129620024 sites on the negative strand of the Chr9:129620018-129620103 region.
In alternative embodiments, the agent effects detection of methylation of the target gene by one or more of the following methods:
methylation-specific PCR, quantitative methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.
In alternative embodiments, the reagent detects methylation of the target gene by methylation-specific PCR.
In alternative embodiments, the agent comprises one or a combination of several of the following nucleic acid combinations:
a nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 4-6;
a nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 7-9;
a nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 13-15;
a nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 22-24;
a nucleic acid combination comprising the nucleotides set forth in SEQ ID No. 28-30.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a ROC curve for region a, region b, region c, region d, region e and region f, distinguishing colorectal adenoma samples from normal samples;
FIG. 2 is a ROC curve for region g, region h, region i and region j distinguishing colorectal adenoma samples from normal samples;
FIG. 3 is a ROC curve for region a, region b, region c, region d, region e and region f distinguishing colorectal cancer samples from normal samples;
fig. 4 is a ROC curve for distinguishing colorectal cancer samples from normal samples for region g, region h, region i, and region j.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
The features and capabilities of the present invention are described in further detail below in connection with the examples.
Example 1
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 1, wherein the nucleotide combination 1 comprises nucleotides shown in SEQ ID NO.1-3, and the specific sequence table 1. The nucleotide combination 1 can detect methylation of the positive strand (region a) of the chr9:129619882-129620048 region on the C9orf50 gene;
the base sequence of the positive strand of region a is as follows:
TAGTCATGTGGCCTCGGGGTGATGGCAGACCAGCCCTCAAGGACGGGTTGCGAGGGCTCTGAGATACTCAGCTAACATTAGCATCCTTCTAGCCTGGGTGGTGGGGTGGTGGGTGCGGGGACACAAGGGACCACCCCCCACCGGAAATGACTCGGGCCCGCCCCCCG。
the nucleotides shown in SEQ ID Nos. 1-3 detect methylation of cytosine at positions of the forward strand of the region, chr9:129619896, chr9:129619925, chr9:129619932, chr9:129620034, chr9:129620040 and chr9: 129620047.
Example 2
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 2, wherein the nucleotide combination 2 comprises nucleotides shown in SEQ ID NO.4-6, and the specific sequence table 1. This nucleotide combination 2 detects methylation of the positive strand (region b) of the chr9:129620154-129620400 region of the C9orf50 gene.
The base sequence of the positive strand in region b is as follows:
CGCCCAAGAAGTCGGGGTCCTCCCTGGCCACGCGCCTCCGGGGGCGCTCGCGCTCTCCAGGCCCTGGCTGCCTGGGCGCCGATTCCCGGGACGCGCCGGCCGACAGCAGGGGAGGCGGCAGCAGGGACCGCAGCAGCCCCCGCTTCCGCACGGCCCGCCGGGTCGCGGTGAGCAAGGCGGGCAGGCGCGGCGGGAGGCGTCCGACGCCCACCCCGGGCTTGGCGTCCCCTTCCGGCCACCACGCGGC。
the nucleotides shown in SEQ ID Nos. 4-6 detect methylation of cytosine at positions of the forward strand of the region, where the positions are Chr9:129620154, chr9:129620166, chr9:129620184, chr9:129620186, chr9:129620192, chr9:129620386, chr9:129620395, chr9:129620397 and Chr9: 129620400.
Example 3
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 3, wherein the nucleotide combination 3 comprises nucleotides shown in SEQ ID NO.7-9, and the specific sequence table 1. The nucleotide combination 3 can detect methylation of the forward strand (region C) of the Chr9:129620272-129620431 region on the C9orf50 gene.
The base sequence of the positive strand in region c is as follows:
CAGCAGGGACCGCAGCAGCCCCCGCTTCCGCACGGCCCGCCGGGTCGCGGTGAGCAAGGCGGGCAGGCGCGGCGGGAGGCGTCCGACGCCCACCCCGGGCTTGGCGTCCCCTTCCGGCCACCACGCGGCGCCGCCCCCCGGGATCCTCCAGTCCCCGGAG。
the nucleotides shown in SEQ ID Nos. 7-9 allow for the detection of methylation of cytosine at positions of the forward strand of the region, chur 9:129620282, chur 9:129620294, chur 9:129620355, chur 9:129620358, chur 9:129620367, chur 9:129620410 and Chur 9: 129620427.
Example 4
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 4, wherein the nucleotide combination 4 comprises nucleotides shown in SEQ ID NO.10-12, and the specific sequence table 1. The nucleotide combination 4 can detect methylation of the forward strand (region d) of the Chr9:129620469-129620541 region of the C9orf50 gene.
The base sequence of the positive strand in region d is as follows:
TCAGCTTGGGCAGCCGCGGGTCGCTGCTGCGTCGGAAGTCTCCGTCGCCAGGGAGCCCCTTGGGCGCCAGGTC。
the nucleotides shown in SEQ ID Nos. 10-12 detect methylation of cytosine at positions of the forward strand of the region, where the positions are Chur 9:129620483, chur 9:129620485, chur 9:129620498, chur 9:129620501, chur 9:129620511, chur 9:129620514 and Chur 9: 129620533.
Example 5
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 5, wherein the nucleotide combination 5 comprises nucleotides shown in SEQ ID NO.13-15, and the specific sequence table 1. This nucleotide set 5 detects methylation of the forward strand of the Chr9:129620551-129620722 region (region e) of the C9orf50 gene.
The base sequence of the positive strand in region e is as follows:
TGGGCGAAGTCGACGCCAGAACATGCTTGGCCCCGCACTCAGCTCACCGCACCCTCAGCGCGCGTGGGTGGGGGGCGCCGGCTGAGGTGGGGAGGGCATAGTCCAGCCCCAGGCCATAGTGCCCCGGGCGGGGCAGCGCGGTGCGGGGTGAACGCCACCGGCCCGGCGGACA。
the nucleotides shown in SEQ ID Nos. 13-15 detect methylation of cytosine at positions of the forward strand of the region, where the positions are Chr9:129620555, chr9:129620561, chr9:129620564, chr9:129620598, chr9:129620609, chr9:129620611, chr9:129620613, chr9:129620709, chr9:129620714 and Chr9: 129620717.
Example 6
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 6, wherein the nucleotide combination 6 comprises nucleotides shown in SEQ ID NO.16-18, and the specific sequence table 1. The nucleotide combination 6 can detect methylation of the forward strand (region f) of the Chr9:129620729-129620879 region of the C9orf50 gene.
The base sequence of the forward strand in region f is as follows:
GGCTTCAGGCGAGAGCTCCCAGAGCCTCTGTTTCCTCACCTGAAAAATGGTGACAGCAAGAGTAGCCAACTTTGGGGGTTGCTGTGACGTTTAAATGAGCAAGTACATGCCAGTCTTAGAACAGCAAGCTCGGTACAGTGCCAGGCACGCTGG。
the nucleotides shown in SEQ ID Nos. 16-18 detect methylation of cytosine at positions chr9:129620738, chr9:129620816, chr9:129620859 and chr9:129620876 on the forward strand of the region.
Example 7
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 7, wherein the nucleotide combination 7 comprises nucleotides shown in SEQ ID NO.19-21, and the specific sequence table 1. This nucleotide combination 7 detects methylation of the negative strand (region g) of the Chr9:129620550-129620735 region on the C9orf50 gene.
The base sequence of the negative strand in region g is as follows:
TGAAGCCACTCGCTGTCCGCCGGGCCGGTGGCGTTCACCCCGCACCGCGCTGCCCCGCCCGGGGCACTATGGCCTGGGGCTGGACTATGCCCTCCCCACCTCAGCCGGCGCCCCCCACCCACGCGCGCTGAGGGTGCGGTGAGCTGAGTGCGGGGCCAAGCATGTTCTGGCGTCGACTTCGCCCAG。
the nucleotides shown in SEQ ID Nos. 19-21 allow for the detection of methylation of cytosine at positions of the negative strand of the region, chr9:129620725, chr9:129620718, chr9:129620715, chr9:129620695, chr9:129620690, chr9:129620688, chr9:129620680, chr9:129620565, chr9:129620562 and Chr9: 129620556.
Example 8
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 8, wherein the nucleotide combination 8 comprises nucleotides shown in SEQ ID NO.22-24, and the specific sequence table 1. This nucleotide set 8 detects methylation of the negative strand (region h) of the Chr9:129620328-129620513 region on the C9orf50 gene.
The base sequence of the negative strand in region h is as follows:
ACGGAGACTTCCGACGCAGCAGCGACCCGCGGCTGCCCAAGCTGACCCCGCCCGCGCTCCGAGCGGCTCTGGGCGCGCGGGGCTCCGGGGACTGGAGGATCCCGGGGGGCGGCGCCGCGTGGTGGCCGGAAGGGGACGCCAAGCCCGGGGTGGGCGTCGGACGCCTCCCGCCGCGCCTGCCCGCCT。
the nucleotides shown in SEQ ID Nos. 22-24 allow for the detection of methylation of cytosine at positions of the negative strand of the region, chr9:129620512, chr9:129620502, chr9:129620499, chr9:129620491, chr9:129620486, chr9:129620484, chr9:129620465, chr9:129620345, chr9:129620342, chr9:129620340 and chr9: 129620332.
Example 9
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 9, wherein the nucleotide combination 9 comprises nucleotides shown in SEQ ID NO.25-27, and the specific sequence table 1. This nucleotide combination 9 allows detection of methylation of the negative strand (region i) of the Chr9:129620165-129620291 region on the C9orf50 gene.
The base sequence of the negative strand of region i is as follows:
GGCTGCTGCGGTCCCTGCTGCCGCCTCCCCTGCTGTCGGCCGGCGCGTCCCGGGAATCGGCGCCCAGGCAGCCAGGGCCTGGAGAGCGCGAGCGCCCCCGGAGGCGCGTGGCCAGGGAGGACCCCGA。
the nucleotides shown in SEQ ID Nos. 25-27 allow the methylation of cytosines at positions Chr9:129620283, chr9:129620205, chr9:129620185 and Chr9:129620167 on the negative strand of this region to be detected.
Example 10
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 10, wherein the nucleotide combination 10 comprises nucleotides shown in SEQ ID NO.28-30, and the specific sequence table 1. This nucleotide set 10 detects methylation of the negative strand (region j) of the Chr9:129620018-129620103 region on the C9orf50 gene.
The base sequence of the negative strand of region j is as follows:
CTCCAGGAGAAGTGCGCCGAGGAGCCGGAGCCACTGAGTGAGGCCCCGCGGGGCCCGGGGGGCGGGCCCGAGTCATTTCCGGTGGG。
the nucleotides shown in SEQ ID Nos. 28-30 allow the methylation of cytosine at positions Chr9:129620089, chr9:129620086, chr9:129620078, chr9:129620057, chr9:129620055, chr9:129620035 and Chr9:129620024 on the negative strand of the region.
TABLE 1
Example 11
This example provides a method for diagnosis of colorectal or adenomatous cancer using any one of the kits of examples 1-10, comprising the steps of:
1. extraction of DNA template:
the sample used was a blood sample and was subjected to plasma cfDNA extraction using the magnetic bead serum/plasma free DNA extraction kit (DP 709) from the company sienna biochemistry technology (beijing), limited, see kit instructions for specific operation.
2. Conversion of sulfite
The nucleic acid transformation Kit is EZ DNA Methylation-Gold (TM) Kit of ZYMO RESEARCH, and specific experimental operation is described in the specification of the Kit.
3. PCR reaction
The PCR reaction system using beta-actin as an internal reference gene is shown in Table 2. Beta-actin is used as an internal reference gene, wherein the upstream primer of the beta-actin is as follows: taggttagacgggggatatgtag (SEQ ID NO. 31); the beta-actin downstream primer is: cacaataaatctaaacaaactcccc (SEQ ID NO. 32); the beta-actin probe is as follows: gtgtgctggggtcttggga (SEQ ID NO. 33).
The reporter group at the 5 'end of the probe of the detection target area is FAM, the quenching group at the 3' end is MGB, the reporter group at the 5 'end of the beta-actin probe is VIC, and the quenching group at the 3' end is BHQ1.
TABLE 2
Component (A) Specification of specification Volume (mu L)
Buffer solution 5× 5
dNTPs 2.5mM each 2
Upstream primer 10μM 1
Downstream primer 10μM 1
Probe with a probe tip 10μM 1
Beta-actin upstream primer 10μM 1
Beta-actin downstream primer 10μM 1
Beta-actin probe 10μM 1
DNAzymes 5U/μL 0.5
DNA of sample to be tested / 5
Purified water / Supplement to 25
The PCR reaction conditions are shown in Table 7 below.
TABLE 3 Table 3
Ct value reading: after the PCR is completed, a baseline is adjusted, and a threshold value is set in an exponential growth phase of an amplification curve to obtain Ct values of all genes of a sample.
And (3) quality control: synchronous detection is carried out on a negative control and a positive control during each detection, wherein the negative control is purified water, the positive control is an artificial synthetic plasmid containing beta-actin gene and target gene sequence, and the concentration is 10 3 Copy/microliter, negative control should have no significant exponential growth phase, positive control should have significant exponential growth phase, and Ct value of positive control should be between 26-30. Negative control, yangAfter both the sex control and the reference gene meet the requirements, the experiment is effective, and the next sample result can be judged. Otherwise, when the experiment is invalid, the detection is needed again.
Result analysis and interpretation method:
ROC analysis was performed using SPSS software to evaluate diagnostic efficacy of colorectal cancer and normal and colorectal adenoma samples and normal samples for each detection region, the state variable for normal samples was recorded as "0" and the state variable for cancer/adenoma samples was recorded as "1" during the analysis, the Ct value at maximum about log index was taken as cut-off, and the corresponding sensitivity, specificity and average AUC values were recorded.
For samples with unknown pathological states, after PCR is completed, the detection Ct value of each sample is read, and the samples are interpreted according to the comparison of the Ct value and a threshold value, and the reference method is as follows:
negative indicates that the sample subject has little or no colorectal adenoma/colorectal carcinoma, or both, and positive indicates that the sample subject has little or no colorectal adenoma/colorectal carcinoma, or both.
Experimental example 1
50 healthy human plasma samples, 94 colorectal adenoma patient plasma samples, 94 colorectal carcinoma patient plasma sample samples, 238 samples were tested by the method of example 11, the specificity of these markers was calculated from the results of the healthy human plasma samples (negative samples), and the detection sensitivity of these markers for colorectal adenoma and colorectal carcinoma was calculated from the detection results of colorectal adenoma and colorectal carcinoma samples (positive samples). ROC analysis was performed using SPSS software to evaluate the diagnostic efficacy of colorectal cancer and normal specimens and colorectal adenoma and normal specimens for each test area, taking the Ct value at maximum about the log index as the cut-off value, and recording the corresponding sensitivity, specificity, and average AUC values. The results are as follows.
(1) The detection sensitivity and specificity of the C9orf50 plus strand at region a, region b, region C, region d, region e and region f are shown in Table 4, and FIGS. 1 and 3.
TABLE 4 Table 4
From the above results, it can be seen that the AUC values of the C9orf50 gene in the positive strand, for region b, region C and region e, were significantly higher for both adenoma and normal samples than for region a, region d and region f. The sensitivity of the C9orf50 gene in the region b, the region C and the region e is more than 80 percent, the specificity is more than 90 percent, the detection sensitivity and the specificity of the colorectal cancer are more than 85 percent, the detection sensitivity of the C9orf50 gene in the region a, the region d and the region f for adenoma is less than 70 percent, and the detection specificity of the C9orf50 gene in the region a and the region f is only less than 80 percent; the AUC values for the C9orf50 gene positive strand, for region b, region C and region e, were significantly higher for both the cancer and normal samples than for region a, region d and region f. The detection sensitivity of the region d and the region to the cancer is only 70%, and the detection specificity of the region a and the region f to the cancer is not more than 80%. Overall, the detection effect of the region b, the region C and the region e on the positive strand of the C9orf50 gene is better than that of the region a, the region d and the region f.
(2) The detection sensitivity and specificity of region g, region h, region i and region j on the negative strand of C9orf50 are shown in Table 5, as well as FIGS. 2 and 4.
TABLE 5
From the above results, it can be seen that the AUC values of region h, region i on the negative strand of the C9orf50 gene, which distinguish adenoma from normal samples, are significantly higher than those of regions g and j. The sensitivity of the region h and the region i of the C9orf50 gene to colorectal carcinoma adenoma is over 75%, the specificity is over 90%, the adenoma detection specificity of the region g is only 77%, and the detection sensitivity and the specificity of the region j to adenoma are not high (the sensitivity is less than 70%, and the specificity is less than 90%); the AUC values of the region h and the region i on the negative strand of the C9orf50 gene for distinguishing cancer from normal samples are obviously higher than those of the region g and the region j, the detection sensitivity of the region h and the region i on the cancer is more than 80%, the specificity is more than 90%, the sensitivity of the region g and the region j is more than 80%, but the specificity is not more than 80%, and the detection effect of the region h and the region i on the negative strand of the C9orf50 gene is better than that of the region g and the region j as a whole.
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Wuhan Ai Misen life technologies Co., ltd
<120> diagnostic kit for colorectal cancer or adenoma
<160> 33
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> artificial sequence
<400> 1
tagttatgtg gtttcggggt g 21
<210> 2
<211> 19
<212> DNA
<213> artificial sequence
<400> 2
cgaaaaacga acccgaatc 19
<210> 3
<211> 20
<212> DNA
<213> artificial sequence
<400> 3
tttaaggacg ggttgcgagg 20
<210> 4
<211> 21
<212> DNA
<213> artificial sequence
<400> 4
cgtttaagaa gtcggggttt t 21
<210> 5
<211> 19
<212> DNA
<213> artificial sequence
<400> 5
gccgcgtaat aaccgaaaa 19
<210> 6
<211> 19
<212> DNA
<213> artificial sequence
<400> 6
ttggttacgc gttttcggg 19
<210> 7
<211> 24
<212> DNA
<213> artificial sequence
<400> 7
tagtagggat cgtagtagtt ttcg 24
<210> 8
<211> 22
<212> DNA
<213> artificial sequence
<400> 8
ctccgaaaac taaaaaatcc cg 22
<210> 9
<211> 22
<212> DNA
<213> artificial sequence
<400> 9
ttcgacgttt atttcgggtt tg 22
<210> 10
<211> 19
<212> DNA
<213> artificial sequence
<400> 10
ttagtttggg tagtcgcgg 19
<210> 11
<211> 21
<212> DNA
<213> artificial sequence
<400> 11
aacctaacgc ccaaaaaact c 21
<210> 12
<211> 21
<212> DNA
<213> artificial sequence
<400> 12
ttgcgtcgga agttttcgtc g 21
<210> 13
<211> 19
<212> DNA
<213> artificial sequence
<400> 13
tgggcgaagt cgacgttag 19
<210> 14
<211> 19
<212> DNA
<213> artificial sequence
<400> 14
tatccgccga accgataac 19
<210> 15
<211> 25
<212> DNA
<213> artificial sequence
<400> 15
tatcgtattt ttagcgcgcg tgggt 25
<210> 16
<211> 22
<212> DNA
<213> artificial sequence
<400> 16
ggttttaggc gagagttttt ag 22
<210> 17
<211> 24
<212> DNA
<213> artificial sequence
<400> 17
ccaacgtacc taacactata ccga 24
<210> 18
<211> 25
<212> DNA
<213> artificial sequence
<400> 18
taattttggg ggttgttgtg acgtt 25
<210> 19
<211> 22
<212> DNA
<213> artificial sequence
<400> 19
tgaagttatt cgttgttcgt cg 22
<210> 20
<211> 20
<212> DNA
<213> artificial sequence
<400> 20
ctaaacgaaa tcgacgccaa 20
<210> 21
<211> 24
<212> DNA
<213> artificial sequence
<400> 21
atttcgtatc gcgttgtttc gttc 24
<210> 22
<211> 23
<212> DNA
<213> artificial sequence
<400> 22
acggagattt tcgacgtagt agc 23
<210> 23
<211> 19
<212> DNA
<213> artificial sequence
<400> 23
aaacgaacaa acgcgacga 19
<210> 24
<211> 25
<212> DNA
<213> artificial sequence
<400> 24
ttcgcggttg tttaagttga tttcg 25
<210> 25
<211> 20
<212> DNA
<213> artificial sequence
<400> 25
ggttgttgcg gtttttgttg 20
<210> 26
<211> 21
<212> DNA
<213> artificial sequence
<400> 26
tcgaaatcct ccctaaccac g 21
<210> 27
<211> 25
<212> DNA
<213> artificial sequence
<400> 27
ttaggtagtt agggtttgga gagcg 25
<210> 28
<211> 21
<212> DNA
<213> artificial sequence
<400> 28
ttttaggaga agtgcgtcga g 21
<210> 29
<211> 20
<212> DNA
<213> artificial sequence
<400> 29
cccaccgaaa ataactcgaa 20
<210> 30
<211> 25
<212> DNA
<213> artificial sequence
<400> 30
tcggagttat tgagtgaggt ttcgc 25
<210> 31
<211> 23
<212> DNA
<213> artificial sequence
<400> 31
taggttagac gggggatatg tag 23
<210> 32
<211> 25
<212> DNA
<213> artificial sequence
<400> 32
cacaataaat ctaaacaaac tcccc 25
<210> 33
<211> 19
<212> DNA
<213> artificial sequence
<400> 33
gtgtgctggg gtcttggga 19

Claims (7)

1. A kit for the diagnosis or assisted diagnosis of colorectal cancer or colorectal adenoma, characterized in that it contains a reagent for detecting methylation of a target gene of a target region, said target gene being the C9orf50 gene;
taking GRCh38.p13 as a reference genome, wherein the target region is the negative strand of the region of Ch9: 129620328-129620513 or the negative strand of the region of Ch9: 129620018-129620103;
the target region is the sites of Chr9:129620512, chr9:129620502, chr9:129620499, chr9:129620491, chr9:129620486, chr9:129620484, chr9:129620465, chr9:129620345, chr9:129620342, chr9:129620340 and Chr9:129620332 on the negative strand of the Chr9:129620328-129620513 region;
the target region is the sites of Chr9:129620089, chr9:129620086, chr9:129620078, chr9:129620057, chr9:129620055, chr9:129620035 and Chr9:129620024 on the negative chain of the Chr9:129620018-129620103 region;
the reagent comprises one or a combination of several of the following nucleic acid combinations:
nucleic acid combinations of the nucleotides shown in SEQ ID No. 22-24;
nucleic acid combinations of the nucleotides shown in SEQ ID No. 28-30.
2. The kit of claim 1, wherein the reagent enables detection of methylation of the target gene by one or more of the following methods:
methylation-specific PCR, quantitative methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.
3. The kit of claim 2, wherein the reagents detect methylation of the target gene by methylation-specific PCR.
4. Use of a reagent for detecting methylation of a target gene for the preparation of a kit for diagnosis or assisted diagnosis of colorectal cancer or colorectal adenoma, characterized in that the target gene is the C9orf50 gene;
taking GRCh38.p13 as a reference genome, wherein the target region of the target gene is the negative strand of the region of Ch9: 129620328-129620513 or the negative strand of the region of Ch9: 129620018-129620103;
the target region is the sites of Chr9:129620512, chr9:129620502, chr9:129620499, chr9:129620491, chr9:129620486, chr9:129620484, chr9:129620465, chr9:129620345, chr9:129620342, chr9:129620340 and Chr9:129620332 on the negative strand of the Chr9:129620328-129620513 region;
the target region is the sites of Chr9:129620089, chr9:129620086, chr9:129620078, chr9:129620057, chr9:129620055, chr9:129620035 and Chr9:129620024 on the negative chain of the Chr9:129620018-129620103 region.
5. The use according to claim 4, wherein the detection of methylation of the target gene is achieved by one or more of the following methods:
methylation-specific PCR, quantitative methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.
6. The use according to claim 5, wherein the reagent detects methylation of the target gene by methylation-specific PCR.
7. The use of claim 6, wherein the agent comprises one or a combination of several of the following nucleic acid combinations:
nucleic acid combinations of the nucleotides shown in SEQ ID No. 22-24;
nucleic acid combinations of the nucleotides shown in SEQ ID No. 28-30.
CN202110107656.3A 2021-01-27 2021-01-27 Diagnostic kit for colorectal cancer or adenoma Active CN114807362B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202110107656.3A CN114807362B (en) 2021-01-27 2021-01-27 Diagnostic kit for colorectal cancer or adenoma
PCT/CN2021/120581 WO2022160750A1 (en) 2021-01-27 2021-09-26 Diagnostic kit for colorectal cancer or adenoma

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110107656.3A CN114807362B (en) 2021-01-27 2021-01-27 Diagnostic kit for colorectal cancer or adenoma

Publications (2)

Publication Number Publication Date
CN114807362A CN114807362A (en) 2022-07-29
CN114807362B true CN114807362B (en) 2023-11-10

Family

ID=82524422

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110107656.3A Active CN114807362B (en) 2021-01-27 2021-01-27 Diagnostic kit for colorectal cancer or adenoma

Country Status (2)

Country Link
CN (1) CN114807362B (en)
WO (1) WO2022160750A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014062218A1 (en) * 2012-10-16 2014-04-24 University Of Southern California Colorectal cancer dna methylation markers
RU2630669C1 (en) * 2016-07-21 2017-09-11 Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") Method for determination of methylation of colorectal cancer tumor marker genes regulatory regions pucgpy sites by glad-pcr analysis, and set of oligonucleotide primers and fluorescence-labelled probes for implementation of this method

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014062218A1 (en) * 2012-10-16 2014-04-24 University Of Southern California Colorectal cancer dna methylation markers
RU2630669C1 (en) * 2016-07-21 2017-09-11 Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") Method for determination of methylation of colorectal cancer tumor marker genes regulatory regions pucgpy sites by glad-pcr analysis, and set of oligonucleotide primers and fluorescence-labelled probes for implementation of this method

Also Published As

Publication number Publication date
WO2022160750A1 (en) 2022-08-04
CN114807362A (en) 2022-07-29

Similar Documents

Publication Publication Date Title
US11220714B2 (en) Method of diagnosing bladder cancer
EP3800273A1 (en) Use of detection reagent for detecting methylation of genes associated with colorectal cancer, and kit
US20080145852A1 (en) Methods and compositions for detecting adenoma
CN104812899A (en) Method for detecting gastric polyp and gastric cancer using marker gene of gastric polyp and gastric cancer-specific methylation
WO2010113529A1 (en) Method for detection of colorectal tumor
US10214778B2 (en) Methods and nucleotide fragments of predicting occurrence, metastasis of cancers and patients&#39; postoperative survival in vitro
CN113355415B (en) Detection reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer
WO2022002423A1 (en) Detection of colorectal neoplasms
CN109593847B (en) Primer pair, kit and method for detecting stability of NR24 locus of microsatellite
CN113789388B (en) Esophageal cancer gene methylation level detection reagent and application thereof
CN106755293B (en) Lung cancer auxiliary diagnosis related lncRNA marker and application thereof
CN111363811B (en) Lung cancer diagnostic agent and kit based on FOXD3 gene
EP4144859A1 (en) Tumor detection reagent and kit
CN115433778B (en) Detection reagent and kit for detecting colorectal cancer or colorectal adenoma related gene methylation and application of detection reagent and kit
CN112375824A (en) Application of MSC as cervical cancer diagnosis, prognosis and/or treatment marker
CN114807362B (en) Diagnostic kit for colorectal cancer or adenoma
CN113430272B (en) Reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer or precancerous lesion and application of reagent and kit
CN107326092B (en) Application of colorectal cancer-related miRNA as biomarker and colorectal cancer detection kit
CN116121387A (en) Combined marker for colorectal cancer detection and application thereof
CN115537464B (en) Diagnostic or auxiliary diagnostic reagent, nucleic acid combination, kit and application of colorectal cancer or precancerous lesions
EP2978861B1 (en) Unbiased dna methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer
CN102732516B (en) Multiplex nested methylation specific PCR (polymerase chain reaction) amplification primer and use method and application thereof
CN114941028B (en) Reagent and kit for detecting and diagnosing colorectal cancer
CN111363814B (en) Lung cancer diagnosis reagent and reagent kit based on DMRTA2 and FOXD3 genes
Bose et al. Factors Affecting Performance of DNA Methylation as a Potential Biomarker in Ascites for Peritonitis and Peritoneal Carcinomatosis.

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant