CN114457026A

CN114457026A - Pluripotent stem cell expressing 4-1BB activated antibody, derivative and application thereof

Info

Publication number: CN114457026A
Application number: CN202011186008.3A
Authority: CN
Inventors: 王淋立; 陈月花; 杨建国; 莫健
Original assignee: Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Current assignee: Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Priority date: 2020-10-30
Filing date: 2020-10-30
Publication date: 2022-05-10

Abstract

The invention discloses a pluripotent stem cell expressing a 4-1BB activated antibody, a derivative thereof and application thereof, wherein an expression sequence of the 4-1BB activated antibody is introduced into the genome of the pluripotent stem cell or the derivative thereof. The pluripotent stem cell expressing the 4-1BB activated antibody or the derivative thereof can be used for inducing iPSCs (induced pluripotent stem cells) or differentiating the iPSCs into MSCs (mesenchymal stem cells) which are low in immunogenicity to be applied, can continuously express the 4-1BB activated antibody in vivo so as to effectively activate 4-1BB, and is used for treating 4-1BB low-expression related tumors and related diseases.

Description

Pluripotent stem cell expressing 4-1BB activated antibody, derivative and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a pluripotent stem cell expressing a 4-1BB activated antibody, a derivative thereof and application thereof.

Background

4-1BB (also known as CD137), which belongs to a member of the tumor necrosis factor receptor superfamily (TNFRSF9), is a type I transmembrane glycoprotein, is expressed on the surface of activated T cells in a monomer or dimer form, is mainly expressed on the activated T cells, is a T cell costimulatory molecule, and has a ligand of 4-1 BBL. 4-1BBL (CD137L) is a type II transmembrane glycoprotein molecule, a member of the TNF superfamily, expressed on the surface of a variety of activated Antigen Presenting Cells (APC), such as IFN- γ activated macrophages, CD40 ligand activated B cells, monocytes, Dendritic Cells (DCs), T cells, and the like. When 4-1BB binds to 4-1BBL or an antibody agonist, the co-stimulatory signal can promote the proliferation and activation of T cells and inhibit activation-induced apoptosis, thereby enhancing the immune killing function of the T cells. At the same time, the activation of monocytes and the like is induced, the secretion of cytokines is promoted, and the monocytes, dendritic cells and the like play a role in immune regulation.

Human 4-1BB is located on chromosome 1p36, full length 255aa, and comprises the 17aa signal peptide, the extracellular region of 169aa, the transmembrane region of 27aa (p.187-213), and the intracellular region of 42 aa. Mouse 4-1BB is located on mouse chromosome 4 at the 75.5cM position, and has about 60% sequence similarity to human 4-1 BB.

4-1BB is an inducible costimulatory receptor expressed on activated CD4+ and CD8+ T cells, NKT, NK cells, DCs, macrophages, eosinophils, neutrophils and mast cells, and Tregs. In most cases, cell activation induces surface expression of 4-1BB, except for constitutive expression of 4-1BB on APC and Foxp3+ Tregs. Multiple studies using 4-1 BB-/-knockout mice found that 4-1BB plays an important role in maintaining immune homeostasis, and is critical for anti-tumor immunological memory.

On the other hand, in the field of cell therapy, the problem of immunological compatibility of allogens remains a big problem. In recent years, a plurality of reports have been provided that the deletion expression of genes on the cell surfaces of HLA-I and HLA-II or the genes thereof is realized by knocking out genes such as B2M, CIITA and the like, so that the cells have immune tolerance or escape T/B cell specific immune response, and universal PSCs with immune compatibility are generated, thereby laying an important foundation for the application of wider universal PSCs source cells, tissues and organs. Also, cells have been reported to overexpress CTLA4-Ig, PD-L1 and thereby inhibit allogeneic immune rejection. However, these approaches are either not fully immune compatible, and still allow for immunological rejection of the allogens by other routes; or completely eliminate the allogeneic immune rejection response, but simultaneously make the cells of the donor-derived transplant lose the antigen presenting capability, which brings great risk of diseases such as tumorigenicity and virus infection to the recipient.

Therefore, it is also reported that, when the B2M is not directly knocked out, the HLA-A, HLA-B is knocked out or the CIITA is knocked out together, the HLA-C is kept, 12 HLA-C immune matching antigens covering more than 90% of people are constructed, so that the transplanted cells still have a certain degree of antigen presenting function, and the inherent immune response of NK cells can be inhibited through the HLA-C. However, in the cells, the antigen type presented by HLA-I antigen is reduced by more than two thirds, the integrity of the presented antigen is reduced irreversibly, the presenting of various tumor, virus and other disease antigens has great bias, the risk of diseases such as tumor and virus infection is still kept to a certain extent, and the pathogenic risk is higher under the condition that CIITA is knocked out simultaneously; secondly, 12 high-frequency immune match HLA-C antigen species are very different, and the part of the area can only account for 70 percent by verification and calculation, while the HLA data of large sample size which is not authoritative currently in China, Indian and other big countries is displayed, so that the prepared general PSCs are still subjected to huge match vacancy tests; thirdly, the method can go through repeated gene editing for a plurality of times, at least two rounds of single cell isolation culture meters are needed according to each gene editing, the whole process needs at least more than six rounds of single cell isolation culture, and the processes are inevitable and cause various unpredictable mutations of cells due to multiple times of gene editing off-target or unstable chromatin or due to passage proliferation of a large number of single cells, thereby further inducing various problems of carcinogenesis, metabolic diseases and the like. It follows that such immuno-compatible schemes are also a matter of convenience in the "transition period", and many problems remain that are not better solved.

In addition, inducing killing of the suicide gene after donor tissue and cell disease has been induced, which results in serious tissue necrosis, cytokine storm and other unpredictable disease risk problems, and it is a big problem that proper donor cells, tissues and organs do not exist after the cell death of the design.

Disclosure of Invention

The present invention aims to provide a pluripotent stem cell or a derivative thereof;

it is another object of the present invention to provide another pluripotent stem cell or a derivative thereof;

the invention also aims to provide the application of the two pluripotent stem cells or the derivatives thereof in preparing 4-1BB low-expression tumor treatment medicines;

it is another object of the present invention to provide a formulation.

The technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, there is provided:

a pluripotent stem cell or a derivative thereof, wherein an expression sequence of a 4-1 BB-activating antibody is introduced into the genome of the pluripotent stem cell or the derivative thereof.

The inventors have found that 4-1 BB-activating antibodies targeting 4-1BB secreted from pluripotent stem cells or derivatives thereof can effectively stimulate 4-1BB production and can effectively eliminate tumor cells when the expression sequences of the 4-1 BB-activating antibodies are introduced into the pluripotent stem cells or derivatives thereof.

Furthermore, the heavy chain sequence of the 4-1BB activation type antibody is shown as SEQ ID NO.1, and the light chain sequence is shown as SEQ ID NO. 2.

Furthermore, the genome of the pluripotent stem cell or the derivative thereof is further introduced with an expression sequence of at least one immune compatible molecule for regulating the expression of a gene associated with an immune response in the pluripotent stem cell or the derivative thereof.

Further, the above-mentioned genes related to immune response include:

a major histocompatibility complex gene comprising: at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB 1;

major histocompatibility complex-associated genes comprising: at least one of B2M and CIITA.

Still further, the above-mentioned immune-compatible molecule comprises at least one of:

(1) an immune tolerance-related gene including at least one of CD47 and HLA-G;

(2) HLA-C molecules, including HLA-C multiple alleles of which the proportion in the population is over 90 percent in total, or fusion protein genes consisting of the HLA-C multiple alleles of which the proportion is over 90 percent and B2M;

(3) shRNA and/or shRNA-miR targeting major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB 1;

(4) shRNA and/or shRNA-miR targeting major histocompatibility complex-associated genes including at least one of B2M and CIITA.

Furthermore, the target sequence of the shRNA and/or shRNA-miR of the major histocompatibility complex gene is at least one of SEQ ID NO. 16-SEQ ID NO. 103; the target sequence of shRNA and/or shRNA-miR of the major histocompatibility complex related gene is at least one of SEQ ID NO. 3-SEQ ID NO. 15.

Furthermore, shRNA and/or miRNA processing complex related genes and/or anti-interferon effector molecules are also introduced into the genome of the pluripotent stem cell or the derivative thereof.

Wherein the shRNA and/or miRNA processing complex related gene comprises at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA) and DGCR 8; the anti-interferon effector molecule is at least one of shRNA and/or shRNA-miR of targeted PKR, 2-5As, IRF-3 or IRF-7.

The primary miRNA (pri-miRNA) in the nucleus is microprocessed through the complex Drosha-DGCR8, which cleaves the pri-miRNA into a precursor miRNA (pre-miRNA), which then forms a hairpin. Then, the pre-miRNA is transported out of the nucleus via the Exportin-5-Ran-GTP complex. The RNase Dicer enzyme, which binds to the double-stranded RNA-binding protein TRBP (TARBP2) in the cytoplasm, breaks down the pre-miRNA into mature lengths, at which point the miRNA is still in a double-stranded state. Finally, it is transported into AGO2 to form RISC (RNA-induced silencing complex). Finally, one strand of the miRNA double strand is retained in the RISC complex, and the other strand is eliminated and rapidly degraded. While DGCR8, the main binding protein of Drosha, can bind to pri-miRNA through two double-stranded RNA binding regions at its C-terminal end, recruit and guide Drosha to cut at the right position of pri-miRNA to produce pre-miRNA, which is further cut by Dicer and TRBP/PACT processing to form mature miRNA. Deletion or abnormal expression of DGCR8 affects the cleavage activity of Drosha, which in turn affects the activity of miRNA, leading to disease. TRBP is capable of recruiting Dicer complex mirnas to form RISC Ago 2.

Furthermore, the target sequence of the shRNA and/or shRNA-miR targeting PKR, 2-5As, IRF-3 or IRF-7 is shown in SEQ ID NO. 104-SEQ ID NO. 163.

Furthermore, the expression frameworks of the major histocompatibility complex gene, the major histocompatibility complex related gene, the shRNA and/or shRNA-miR targeting PKR or 2-5As or IRF-3 or IRF-7 are As follows:

(1) shRNA expression framework: the kit sequentially comprises an shRNA target sequence, a stem-loop sequence, a reverse complementary sequence of the shRNA target sequence and Poly T from 5 'to 3', wherein the shRNA target sequence is as described above;

(2) shRNA-miR expression framework: and (3) replacing the shRNA target sequence in the step (1) with the shRNA-miR target sequence.

Furthermore, the length of the stem-loop sequence is 3-9 bases; the Poly T is 5 to 6 bases in length.

Furthermore, an inducible gene expression system is also introduced into the genome of the pluripotent stem cell or the derivative thereof and is used for regulating and controlling the expression of the immune compatible molecules and/or shRNA and/or miRNA processing complex related genes and/or anti-interferon effector molecules.

Further, the inducible gene expression system includes at least one of a Tet-Off system and a dimer inducible expression system.

The invention knocks a tet-Off system and a sequence of one or more immune compatible molecules into a genome safety site of the pluripotent stem cell, and accurately turns on or Off the expression of the immune compatible molecules through the addition of tetracycline, so that the expression of major histocompatibility complex related genes in the pluripotent stem cell or a derivative thereof can be reversibly regulated.

The dimer-switched-off expression system specifically refers to: dimerized inducers or dimers are used to recombine active transcription factors on inactive fusion proteins. The most commonly used system is rapamycin (rapamydn), a natural product, or an analog that is biologically inactive, as the drug for dimerization. The rapamycin (or analog) sibling protein FKBP12 (the protein to which FKBP binds to FK 506) and a large serine-threonine protein kinase, known as FRAP (FRBP-rapamycin associated protein, mTOR (mammalian target of rapamycin)), have high affinity and function to bind to both proteins, thus bringing them together as a heterologous dimer. To regulate transcription of a target gene, a DNA binding domain is fused to one or more FKBP domains and a transcription repressing domain is fused to amino acid position 93 of FRAP, designated FRB, which is sufficient to bind the FKBP-rapamycin complex. Dimerization of these two fusion proteins can only occur in the presence of rapamycin. Thus inhibiting transcription of genes having sites that bind to the DNA binding region.

Furthermore, the expression sequence of the 4-1BB activation type antibody, the expression sequence of the immune compatible molecule, the gene related to shRNA and/or miRNA processing complex, the anti-interferon effector molecule and the inducible gene expression system are introduced by a method of viral vector interference, non-viral vector transfection or gene editing, and the method of gene editing comprises gene knock-in.

Furthermore, the introduction site of the expression sequence of the 4-1BB activation type antibody, the expression sequence of an immune compatible molecule, the shRNA and/or miRNA processing complex related gene, the anti-interferon effector molecule and the inducible gene expression system is a genome safety site of the pluripotent stem cell or the derivative thereof.

Further, the genome safety site comprises one or more of an AAVS1 safety site, an eGSH safety site and an H11 safety site.

Further, the pluripotent stem cells include embryonic stem cells, embryonic germ cells, embryonic carcinoma cells, or induced pluripotent stem cells; the pluripotent stem cell derivative includes an adult stem cell, each germ layer cell or tissue into which the pluripotent stem cell is differentiated; the adult stem cells include mesenchymal stem cells or neural stem cells.

In a second aspect of the present invention, there is provided:

a pluripotent stem cell or a derivative thereof, wherein a 4-1 BB-activating antibody expression sequence is introduced into the genome of the pluripotent stem cell or the derivative thereof, and the B2M gene and/or CIITA gene is deleted from the genome of the pluripotent stem cell or the derivative thereof.

The inventors found that 4-1 BB-activating antibodies targeting 4-1BB secreted from pluripotent stem cells or derivatives thereof can efficiently stimulate 4-1BB production and efficiently eliminate tumor cells when the expression sequences of the 4-1 BB-activating antibodies are introduced into the pluripotent stem cells or derivatives thereof.

Moreover, when the B2M and CIITA genes are knocked out, the influence of HLA-I and HLA-II molecules is completely eliminated, and therefore, the tumor treatment effect is optimal.

In a third aspect of the present invention, there is provided:

the two kinds of pluripotent stem cells or derivatives thereof are applied to the preparation of 4-1BB low-expression tumor treatment medicines.

In a fourth aspect of the present invention, there is provided:

a preparation comprising the pluripotent stem cells or derivatives thereof and a pharmaceutically acceptable carrier, diluent or excipient.

The invention has the beneficial effects that:

1. the pluripotent stem cells or derivatives thereof expressing the 4-1BB activated antibody can be used for inducing iPSCs (induced pluripotent stem cells) or differentiating the iPSCs into MSCs (mesenchymal stem cells) which are low in immunogenicity for application, can continuously express the 4-1BB activated antibody in vivo, and can be used for treating 4-1BB low-expression tumors and related diseases.

2. The B2M and CIITA genes in the pluripotent stem cells or the derivatives thereof are knocked out, or an immune compatible molecule expression sequence is introduced into the genome of the pluripotent stem cells or the derivatives thereof, so that the pluripotent stem cells or the derivatives thereof have low immunogenicity, and when the pluripotent stem cells or the derivatives thereof are transplanted into a receptor, the problem of allogeneic immune rejection between donor cells and the receptor can be overcome, so that the donor cells can continuously express the 4-1BB activated antibody in the receptor for a long time.

3. The genome of the immune-compatible reversible pluripotent stem cell or the derivative thereof expressing the 4-1BB activation type antibody of the present invention is introduced with an inducible gene expression system and an immune-compatible molecule expression sequence. The inducible gene expression system is controlled by an exogenous inducer, and the opening and closing of the inducible gene expression system are controlled by adjusting the addition amount, the continuous action time and the type of the exogenous inducer, so that the expression quantity of the epidemic compatible molecular expression sequence is controlled. While the immune-compatible molecule may regulate the expression of genes associated with an immune response in the pluripotent stem cell or derivative thereof. When the immune compatible molecule is normally expressed, the expression of genes related to immune response in the pluripotent stem cell or the derivative thereof is suppressed or overexpressed, and the allogeneic immune rejection response between the donor cell and the recipient can be eliminated or reduced, so that the donor cell can continuously express the 4-1BB activated antibody in the recipient for a long time. When donor cells are diseased, the expression of immune compatible molecules can be closed through induction of an exogenous inducer, so that HLA class I molecules are reversibly re-expressed on the surfaces of the donor cells, the antigen presenting capability of the donor cells is recovered, and the diseased cells can be eliminated by a receptor, so that the clinical safety of the general pluripotent stem cells or the derivatives thereof is improved, and the value of the general pluripotent stem cells or the derivatives thereof in clinical application is greatly expanded.

Drawings

FIG. 1 is a plasmid map of AAVS1 KI Vector (shRNA, Puro, constitutive);

FIG. 2 is a plasmid map of AAVS1 KI Vector (shRNA, inducible);

FIG. 3 is a plasmid map of AAVS1 KI Vector (shRNA-miR, constitutive);

FIG. 4 is a plasmid map of AAVS1 KI Vector (shRNA-miR, inducible);

FIG. 5 is a sgRNA clone B2M-1 plasmid map;

FIG. 6 is a sgRNA clone B2M-2 plasmid map;

FIG. 7 is a sgRNA clone CIITA-1 plasmid map;

FIG. 8 is a sgRNA clone CIITA-2 plasmid map;

FIG. 9 is a Cas9(D10A) plasmid map;

FIG. 10 is a sgRNA Clone AAVS1-1 plasmid map;

FIG. 11 is a sgRNA Clone AAVS1-2 plasmid map.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.

1.4-1 selection of BB-activating antibodies

The Heavy Chain (HC) sequence of the 4-1BB activated antibody is shown in SEQ ID NO.1, and the Light Chain (LC) sequence is shown in SEQ ID NO. 2.

The Heavy Chain (HC) sequence of the 4-1 BB-activating antibody is:

5’-GAGGTGCAGCTGGTGCAGAGCGGCGCCGAGGTGAAGAAGCCCGGCGAGAGCCTGAGGATCAGCTGCAAGGGCAGCGGCTACAGCTTCAGCACCTACTGGATCAGCTGGGTGAGGCAGATGCCCGGCAAGGGCCTGGAGTGGATGGGCAAGATCTACCCCGGCGACAGCTACACCAACTACAGCCCCAGCTTCCAGGGCCAGGTGACCATCAGCGCCGACAAGAGCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCAGCGACACCGCCATGTACTACTGCGCCAGGGGCTACGGCATCTTCGACTACTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGCCAGCACCAAGGGCCCCAGCGTGTTCCCCCTGGCCCCCTGCAGCAGGAGCACCAGCGAGAGCACCGCCGCCCTGGGCTGCCTGGTGAAGGACTACTTCCCCGAGCCCGTGACCGTGAGCTGGAACAGCGGCGCCCTGACCAGCGGCGTGCACACCTTCCCCGCCGTGCTGCAGAGCAGCGGCCTGTACAGCCTGAGCAGCGTGGTGACCGTGCCCAGCAGCAACTTCGGCACCCAGACCTACACCTGCAACGTGGACCACAAGCCCAGCAACACCAAGGTGGACAAGACCGTGGAGAGGAAGTGCTGCGTGGAGTGCCCCCCCTGCCCCGCCCCCCCCGTGGCCGGCCCCAGCGTGTTCCTGTTCCCCCCCAAGCCCAAGGACACCCTGATGATCAGCAGGACCCCCGAGGTGACCTGCGTGGTGGTGGACGTGAGCCACGAGGACCCCGAGGTGCAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCACAACGCCAAGACCAAGCCCAGGGAGGAGCAGTTCAACAGCACCTTCAGGGTGGTGAGCGTGCTGACCGTGGTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTGAGCAACAAGGGCCTGCCCGCCCCCATCGAGAAGACCATCAGCAAGACCAAGGGCCAGCCCAGGGAGCCCCAGGTGTACACCCTGCCCCCCAGCAGGGAGGAGATGACCAAGAACCAGGTGAGCCTGACCTGCCTGGTGAAGGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCCATGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAAGCTGACCGTGGACAAGAGCAGGTGGCAGCAGGGCAACGTGTTCAGCTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGAGCCTGAGCCTGAGCCCCGGCAAG-3’(SEQ ID NO.1)。

light Chain (LC) sequence of 4-1 BB-activating antibody:

5’-AGCTACGAGCTGACCCAGCCCCCCAGCGTGAGCGTGAGCCCCGGCCAGACCGCCAGCATCACCTGCAGCGGCGACAACATCGGCGACCAGTACGCCCACTGGTACCAGCAGAAGCCCGGCCAGAGCCCCGTGCTGGTGATCTACCAGGACAAGAACAGGCCCAGCGGCATCCCCGAGAGGTTCAGCGGCAGCAACAGCGGCAACACCGCCACCCTGACCATCAGCGGCACCCAGGCCATGGACGAGGCCGACTACTACTGCGCCACCTACACCGGCGAGGGCAGCCTGGCCGTGTTCGGCGGCGGCACCAAGCTGACCGTGCTGGGCCAGCCCAAGGCCGCCCCCAGCGTGACCCTGTTCCCCCCCAGCAGCGAGGAGCTGCAGGCCAACAAGGCCACCCTGGTGTGCCTGATCAGCGACTTCTACCCCGGCGCCGTGACCGTGGCCTGGAAGGCCGACAGCAGCCCCGTGAAGGCCGGCGTGGAGACCACCACCCCCAGCAAGCAGAGCAACAACAAGTACGCCGCCAGCAGCTACCTGAGCCTGACCCCCGAGCAGTGGAAGAGCCACAGGAGCTACAGCTGCCAGGTGACCCACGAGGGCAGCACCGTGGAGAAGACCGTGGCCCCCACCGAGTGCAGC-3’(SEQ ID NO.2)。

2. selection of immune compatible molecules

The types and sequences of the immune-compatible molecules used in the examples of the present invention are shown in tables 1 and 2.

TABLE 1 types and roles of immune-compatible molecules

TABLE 2 target sequences for immune-compatible molecules

Selection of shRNA/miRNA processing Complex genes and anti-Interferon Effector molecules

(1) selection of shRNA/miRNA processing Complex genes

shRNA/miRNA processing complex genes used in the present invention include shRNA and/or miRNA processing machinery that can induce off-expression. The processor capable of inducing and closing the shRNA and/or miRNA to express specifically comprises: drosha (Access number: NM-001100412), Ago1(Access number: NM-012199), Ago2(Access number: NM-001164623), Dicer1(Access number: NM-001195573), export-5 (Access number: NM-020750), TRBP (Access number: NM-134323), PACT (Access number: NM-003690) and DGCR8(Access number: NM-022720).

The specific functions of the shRNA and/or miRNA processing machine capable of inducing and closing expression in the cells are as follows:

the primary miRNA (pri-miRNA) in the nucleus is microprocessed through the complex Drosha-DGCR8, which cleaves the pri-miRNA into a precursor miRNA (pre-miRNA), which then forms a hairpin. Then, the pre-miRNA is transported out of the nucleus via the Exportin-5-Ran-GTP complex. The RNase Dicer enzyme, which binds to the double-stranded RNA-binding protein TRBP (TARBP2) in the cytoplasm, breaks down the pre-miRNA into mature lengths, at which point the miRNA is still in a double-stranded state. Finally, it is transported into AGO2 to form RISC (RNA-induced silencing complex). Finally, one strand of the miRNA double strand is retained in the RISC complex, and the other strand is eliminated and rapidly degraded. While DGCR8, the main binding protein of Drosha, can bind to pri-miRNA through two double-stranded RNA binding regions at its C-terminal end, recruit and guide Drosha to cut at the right position of pri-miRNA to produce pre-miRNA, which is further cut by Dicer and TRBP/PACT processing to form mature miRNA. Deletion or abnormal expression of DGCR8 affects the cleavage activity of Drosha, which in turn affects the activity of miRNA, leading to disease. TRBP is able to recruit Dicer complex mirnas to form RISC Ago 2.

(2) Selection of anti-Interferon Effector molecules

The anti-interferon effector molecules used in the invention comprise shRNA and/or shRNA-miR expression sequences which can induce closed expression and aim at inhibiting PKR, 2-5As, IRF-3 and IRF-7 genes so As to reduce the interferon reaction induced by dsRNA and avoid generating cytotoxicity.

Wherein the target sequences of the anti-interferon effector molecules are shown in Table 3.

TABLE 3 target sequences for anti-interferon effector molecules

The specific functions of the interferon effector molecules PKR, 2-5As, IRF-3 and IRF-7 in the cell are As follows:

protein Kinase (PKR) and 2 ', 5' Oligoadenylate Synthetase (2,5-Oligoadenylate synthase, 2-5As) are key factors of cell signal transduction pathway in IFN-induced process, and these two enzymes are closely related to dsRNA-induced IFN. PKR can inhibit protein synthesis by phosphorylating eukaryotic cell transcription factors, arrest cells in G0/G1 and G2/M phases and induce apoptosis, while dsRNA can promote synthesis of 2-5As, which results in nonspecific activation of RNase, RNaseL, degradation of all mRNA in cells and cell death. The specificity of induction of type I interferons is achieved by members of the IRF transcription factor family, which are not inducible to be secreted in many viral infections in the absence of IRF-3 and IRF-7 expression in cells.

4. Construction of plasmid vectors

Plasmid vectors used in embodiments of the invention include:

(1) cas9(D10A) plasmid: a plasmid expressing the Cas9(D10A) protein, specifically single-stranded cleaving genomic DNA under the direction of sgrnas.

(2) sgRNA plasmid: a plasmid for expressing sgRNA, sgRNA (small guide RNA), is a guide RNA (guide RNA, gRNA) responsible for directing targeted cleavage of the expressed Cas9(D10A) protein at gene editing.

(3) Donor fragment: the two ends contain recombination arms which are respectively positioned at the left side and the right side of the breaking position of the genome DNA, and the middle part contains genes, fragments or expression elements needing to be inserted. In the presence of the Donor fragment, the cells undergo a Homologous Recombination (HR) reaction at the site of the genomic break. If the Donor fragment is not added, Non-homologous End Joining-NHEJ reaction occurs at the site of the genomic break in the cell. The fragment is obtained by recovering after the digestion of KI Vector plasmid.

The genes in the plasmids are edited by a CRISPR-Cas9 gene editing system, the used Cas9 protein is Cas9(D10A), Cas9(D10A) is combined with sgRNA which is responsible for specifically recognizing a target sequence (genome DNA of a cell vector), and then Cas9(D10A) performs single-strand cleavage on the target sequence. Double Strand breaks in genomic DNA (DSB) must occur, and two Cas 9(D10A)/sgRNA groups must cleave both strands of genomic DNA of the cell vector separately, and not too far apart. The Cas 9(D10A)/sgRNA scheme has the advantage of higher specificity and lower probability of off-target compared to the Cas 9/sgRNA scheme.

Wherein, the specific sequence of the sgRNA is as follows:

sgRNA-B2M-1：5’-CGCGAGCACAGCTAAGGCCACGG-3’(SEQ ID NO.164)；

sgRNA-B2M-2：5’-ACTCTCTCTTTCTGGCCTGGAGG-3’(SEQ ID NO.165)。

sgRNA-CIITA-1：5’-ACCCAGCAGGGCGTGGAGCCAGG-3’(SEQ ID NO.166)；

sgRNA-CIITA-2：5’-GTCAGAGCCCCAAGGTAAAAAGG-3’(SEQ ID NO.167)。

the specific method for constructing the plasmid vector comprises the following steps:

(1) cas9(D10A) plasmid: obtained directly from an Addgene (plasma 41816, Addgene) subscription.

(2) sgRNA plasmid: the Plasmid was constructed by putting different target sequences into original blank plasmids (Plasmid 41824, Addgene).

Wherein the target sequence put into the sgRNA plasmid comprises the sequence of the immune compatible molecule, the sequence of shRNA/miRNA processing complex gene and the sequence of anti-interferon effector molecule.

(3) Donor fragment (KI plasmid):

a) designing a PCR primer, and amplifying by using a pUC18 plasmid (Takara, Code No.3218) as a template and a high fidelity enzyme (Nanjing Nozan organism, P505-d1) through a PCR method to obtain an Amp (R) -pUC origin fragment;

b) extracting genome DNA of human cells and designing corresponding primers, and then amplifying by using the human genome DNA as a template and a PCR method by using high-fidelity enzyme to obtain an AAVS1 or eGSH recombinant arm;

c) designing PCR amplification primers of KI (Knock-in) plasmid elements, and then carrying out high-fidelity enzyme amplification by using plasmids containing the KI plasmid elements as templates to obtain KI plasmid elements (subclones);

d) the amplified Amp (R) -pUC origin fragment, AAVS1 or eGSH recombination arm and KI plasmid element are connected by using multi-fragment recombinase (Nanjing Novozam organism, C113-02) or overlap PCR to form a complete circular plasmid.

The plasmids prepared by the embodiment of the invention can be divided into constitutive plasmids and inducible plasmids according to the expression frame type in the plasmids.

The expression frame in the constitutive plasmid comprises shRNA constitutive expression frame and shRNAMiR constitutive expression frame. The expression function of the Donor fragment obtained by enzyme digestion of the constitutive plasmid cannot be regulated after knocking in the stem cell vector genome DNA.

The expression frames in the inducible plasmid comprise shRNA inducible expression frames and shRNAMIR inducible expression frames. After the Donor fragment obtained from the inducible plasmid is digested by enzyme and the stem cell vector genome DNA is knocked in, the expression function of the fragment can be regulated and controlled by adding an inducer, which is equivalent to adding a switch for turning on or off the expression function.

The specific sequence requirements and structural composition of the expression frameworks are shown below.

(1) The sequence composition of the shRNA constitutive expression framework is:

5’-GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACgctagcgccacc(SEQ ID NO.168)N₁...N₂₁TTCAAGAGA(SEQ ID NO.169)N₂₂...N₄₂TTTTTT(SEQ ID NO.170)-3’；

wherein the content of the first and second substances,

a)N₁...N₂₁shRNA target sequence, N, of the above target sequence₂₂...N₄₂The reverse complementary sequence of the shRNA target sequence of the target sequence;

b) when plasmids constructed by using the shRNA constitutive expression frame need to express shRNAs of a plurality of genes, each gene respectively corresponds to one shRNA expression frame and then is connected seamlessly;

c) when the shRNA constitutive expression frame needs to carry different resistance genes, only the resistance gene sequences in the shRNA constitutive expression frame are different, and other sequences are the same;

d) n represents A or T or G or C base.

(2) The sequence composition of the shRNAmiR constitutive expression framework is as follows:

5’-GAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCG(SEQ ID NO.171)M₁N₁...N₂₁TAGTGAAGCCACAGATGTA(SEQ ID NO.172)N₂₂...N₄₂M₂TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAAT(SEQ ID NO.173)-3’；

wherein the content of the first and second substances,

a)N₁...N₂₁shRNAMIR target sequence, N, being the above target sequence₂₂...N₄₂The reverse complement of the shRNAmiR target sequence to the target sequence;

b) when a plasmid constructed by using the shRNAMIR constitutive expression framework needs to express shRNAMIR of a plurality of genes, each gene corresponds to one shRNAMIR expression framework respectively and then is connected seamlessly;

c) when the shRNAMIR constitutive expression framework needs to carry different resistance genes, only the resistance gene sequences in the shRNAMIR constitutive expression framework are different, and other sequences are the same;

d) n represents A or T or G or C base, M base represents A or C base;

e) if N1 is a G base, then M₁Is A base; otherwise M₁Is a C base;

f)M₁base and M₂And (3) base complementation.

(3) The sequence composition of the shRNA inducible expression framework is:

5’-GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagctcggtacccgggtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctgctagcgccacc(SEQ ID NO.174)N₁...N₂₁TTCAAGAGAN₂₂...N₄₂TTTTTT-3’；

wherein the content of the first and second substances,

a)N₁...N₂₁shRNA target sequence which is the above-mentioned target sequence, N₂₂...N₄₂The reverse complementary sequence of the shRNA target sequence of the target sequence;

b) when plasmids constructed by using the shRNA constitutive expression frame need to express shRNAs of a plurality of genes, each gene corresponds to a shRNA expression frame respectively and then is connected seamlessly;

d) n represents A or T or G or C base.

(4) The sequence composition of the shRNAmiR inducible expression framework is shown in the sequence composition of the shRNAmiR constitutive expression framework.

The constructed plasmid frameworks are shown in FIGS. 1-11.

5. Construction of Stem cell vectors

(1) Selection of Stem cell vectors

The stem cell carrier in the invention is a pluripotent stem cell, and the pluripotent stem cell can be selected from Embryonic Stem Cells (ESCs), Induced Pluripotent Stem Cells (iPSCs) and other forms of pluripotent stem cells, such as hPSCs-MSCs, NSCs and EBs cells.

Wherein the preparation method of the pluripotent stem cells comprises the following steps:

ESCs: HN4 cells were selected and purchased from Shanghai department of sciences.

And (3) iPSCs: using an episomal-iPSCs induction system (6F/BM1-4C), pE3.1-OG- -KS and pE3.1-L-Myc- -hmiR302 cluster were electrotransferred into somatic cells, RM1 medium was cultured for 2 days, 2 days with 2uM Parnate-containing BioCISO-BM1 medium, 2 days with 2uM Parnate, 0.25mM sodium butyrate, 3uM CHIR99021 and 0.5uM PD 03254901-containing BioCISO-BM1 medium, and then cultured continuously with BioCISO medium without other substances for about 17 days, iPSCs clonal cells were picked, and the picked iPSCs clonal cells were purified, digested, and passaged to obtain stable iPSCs. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.

hPSCs-MSCs: iPSCs were cultured for 25 days in BioCISO medium containing 10uM TGF β inhibitor SB431542 until 80-90 cell confluence (2mg/mL Dispase), 1:3 passaging was performed on Matrigel-coated plates, followed by ESC-MSC medium (knockout DMEM medium containing 10% KSR, NEAA, diabody, glutamine, β -mercaptoethanol, 10ng/mL bFGF and SB-431542), fluid was changed every day, and culture was continued for 20 days until 80-90 cell confluence (1:3 passaging), and specific construction methods were as follows: proc Natl Acad Sci U S A.2015; 112(2):530-535.

NSCs: iPSCs are cultured for 14 days in an induction medium (knockout DMEM medium containing 10% KSR and TGF-beta inhibitor and BMP4 inhibitor), and rose annular nerve cells are picked and cultured in a low-adhesion culture plate. The medium in the low adhesion plates included DMEM/F12 (with 1% N2, Invitrogen) and Neurobasal medium (with 2% B27, Invitrogen) in a ratio of 1:1, along with 20ng/ml bFGF and 20ng/ml EGF. Digestion passages were performed using Accutase. The specific construction method is as follows: FASEB J.2014; 28(11):4642-4656.

EBs cells: the iPSCs with cell confluency of 95% were digested with BioC-PDE1 for 6min, and the cells were scraped into clumps by mechanical scraping, and the clumps were settled. The settled cell pellet was transferred to a low adhesion plate and incubated with BioCISO-EB1 for 7 days with fluid changes every other day. After 7 days, the cells were transferred to a Matrigel-coated plate and subjected to adherent culture using a BioCISO medium for 7 days, thereby obtaining Embryoid Bodies (EBs) having an inner, middle and outer mesoderm structure. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.

The pluripotent stem cell derivative also includes adult stem cells, each germ layer cell or tissue, organ into which the pluripotent stem cells are differentiated; the adult stem cells include mesenchymal stem cells or neural stem cells.

(2) Knock-in of safe site in genome of constructed stem cell vector

In the technical scheme of the invention, the safety sites knocked in the genome of the constructed stem cell vector comprise an AAVS1 safety site, an eGSH safety site and an H11 safety site.

The AAVS1 safe site (PPP1R2C site) is located on chromosome 19 of the human genome and is a verified "safe harbor" site which can ensure the expected function of transferred DNA fragments. The site is an open chromosome structure, can ensure that the transgene can be normally transcribed, and has no known side effect on cells when the exogenous target segment is inserted into the site.

The eGSH safe site is located on chromosome 1 of the human genome and is another "safe harbor" site that ensures the intended function of the transferred DNA fragment.

The H11 safe site (Hipp11), located on human chromosome 22, is a site between the two genes Eif4enif1 and Drg 1. Because the H11 locus is positioned between two genes, the risk of influencing endogenous gene expression after the exogenous gene is inserted is small.

The single-cell cloning operation of the knock-in of the AAVS1 gene comprises the following steps:

a) electric transfer program:

donor cell preparation: human pluripotent stem cells

The kit comprises: human Stem Cell

Kit 1

The instrument comprises the following steps: electric rotating instrument

Culture medium: BioCISO

Induction of plasmid: cas9D10A, sgRNA clone AAVS1-1, sgRNA clone AAVS1-2, AAVS1 neo-Vector I, AAVS1 neo-Vector II

Wherein, if the eGSH knock-in is used, the induction plasmids used are: cas9D10A, sgRNA clone eGSH-1, sgRNA clone eGSH-2, eGSH-neo/eGSH-puro (donor). Among them, when using the eGSH gene knock-in, the donor plasmid differs only in the right and left recombination arms, and the other plasmid elements are the same, compared to the AAVS1 gene knock-in. Since the gene editing process of eGSH is the same as that of AAVS1, the following description will not be repeated.

b) The transformed human pluripotent stem cells are screened in a double antibiotic medium containing G418 and puro.

c) And (4) carrying out single cell clone screening and culture to obtain a single cell clone strain.

d) The obtained single-cell clone was cultured.

Wherein, the culture reagent of the single cell clone strain comprises:

the culture medium is as follows: BioCISO medium, 300. mu.g/ml G418 and 0.5. mu.g/ml puro. The culture medium needs to be placed at room temperature in advance, placed for 30-60 minutes in a dark condition until the room temperature is recovered, but not placed at 37 ℃ for preheating, so that the activity of the biological molecules is prevented from being reduced.

Matrix glue: hESC grade Matrigel. Before passage or cell recovery, adding the Matrigel working solution into a cell culture bottle dish and shaking up to ensure that the Matrigel completely submerges the bottom of the culture bottle dish and any Matrigel cannot be dried off before use. To ensure that cells adhere better and survive, Matrigel was placed in a 37 ℃ incubator for a period of time: 1:100 Xmatrigel can not be less than 0.5 hour; the 1:200 Xmatrigel cannot be less than 2 hours.

Digestion solution: EDTA was dissolved using DPBS to a final concentration of 0.5mM, pH 7.4. The EDTA cannot be diluted with water, otherwise the cells die due to reduced osmotic pressure.

Freezing and storing liquid: 60% BioCISO, 30% ESCS grade FBS, and 10% DMSO.

The culture step of the single-cell clone adopts the conventional subculture maintaining process in the field.

Wherein, the optimal passage time is that the overall confluency of the cells reaches 80 to 90 percent.

The optimal ratio of passage is 1: 4-1: 7, and the optimal confluency of the next day after passage is maintained at 20-30%.

The specific passage operation steps in the invention are as follows:

a) discarding the Matrigel from the coated cell culture flask, adding appropriate amount of the above culture medium, and adding 5% CO at 37 deg.C₂Incubation in an incubator;

b) when the cells meet the passage requirements, removing culture medium supernatant, and adding a proper amount of 0.5mM EDTA digestive juice into a cell bottle dish;

c) the cells were incubated at 37 ℃ with 5% CO₂Incubating in an incubator for 5-10 minutes (digesting until most cells are observed to shrink and become round under a microscope but not float), blowing the cells to separate the cells from the wall, sucking the cell suspension into a centrifugal tube, and centrifuging for 5 minutes at 200 g;

d) centrifuging, discarding supernatant, suspending the cells with culture medium, repeatedly blowing the cells until uniformly mixing, transferring the cells to a petrigel-coated bottle dish, shaking, observing under a mirror without abnormality, shaking, and standing at 37 deg.C and 5% CO₂Culturing in an incubator;

e) observing the adherent survival state of the cells the next day, sucking off the culture medium, and changing the culture medium on time every day.

The single cell clone obtained by passage can be directly used for experiment or selection freezing storage treatment.

The cell freezing method comprises the following specific steps:

a) digesting the cells by using 0.5mM EDTA until most cells shrink and become round but do not float, blowing the cells, collecting cell suspension, centrifuging for 5 minutes at 200g, abandoning supernatant, adding a proper amount of freezing solution to resuspend the cells, and transferring the cells to a freezing tube (one six-hole plate is recommended to be frozen with 80% confluence, and the volume of the freezing solution is 0.5 ml/piece);

b) placing the freezing tube in a programmed cooling box, and immediately placing the freezing tube at-80 ℃ overnight (ensuring that the temperature of the freezing tube is reduced by 1 ℃ per minute);

c) the next day the cells were immediately transferred into liquid nitrogen.

The cell recovery method of the cryopreserved cells comprises the following specific steps of:

a) preparing a Matrigel-coated cell flask dish (before resuscitating the cells, the Matrigel is discarded), adding an appropriate amount of BioCISO medium, and placing at 37 ℃ in 5% CO₂Incubating in an incubator;

b) taking out the cryopreservation tube from liquid nitrogen quickly, immediately putting the tube into a 37 ℃ water bath kettle for quick shaking to quickly melt the cells, observing that the shaking is stopped when the ice crystals completely disappear, and transferring the cells to a biological safety cabinet;

c) preparing 10mL of DMEM/F12 (volume ratio of 1:1) basal medium, balancing to room temperature, sucking 1mL of DMEM/F12 (volume ratio of 1:1) basal medium, slowly adding the DMEM/F12 (volume ratio of 1:1) basal medium into a freezing tube, uniformly mixing, transferring the mixture into a prepared 15mL centrifuge tube containing 9mL of DMEM/F12 (volume ratio of 1:1) basal medium, and centrifuging for 5 minutes at 200 g;

d) discarding supernatant, adding appropriate amount of BioCISO culture medium, mixing cells, transferring to cell bottle dish, shaking for observation without abnormality, shaking, and placing at 37 deg.C and 5% CO₂Culturing in an incubator;

e) the adherent survival state of the cells is observed the next day, and the liquid is normally changed on time every day. If the adherence is good, the BioCISO medium is replaced with the above medium mixed with BioCISO, 300. mu.g/ml G418 and 0.5. mu.g/ml puro.

(3) Detection of AAVS1 Gene knock-in cell vectors

The detection principle is as follows:

the cells treated by knock-in were tested for homozygote by PCR. Since the two Donor fragments have only difference in the sequences of the resistance genes, it is necessary to determine whether the cell is homozygous (the two chromosomes knock in the Donor fragments of different resistance genes), and it is only possible that the double-knocked-in cell is the correct homozygous by determining whether the genome of the cell contains the Donor fragments of the two resistance genes.

The detection method comprises the following steps:

one primer was designed inside (non-recombinant arm portion) the Donor plasmid (KI plasmid), and then the other primer was designed in the genome of the cell (non-recombinant arm portion). If the Donor fragment is inserted correctly in the genome, the target band will appear, otherwise no target band will appear.

The specific sequences of the primers and amplification conditions are shown in the following table.

TABLE 4 specific sequences of primers and amplification conditions

The detection method of the eGSH gene knock-in situation is the same as the AAVS1 gene knock-in detection principle and method.

(4) Knock-in of the selected plasmid into the stem cell vector genome using techniques conventional in the art

According to the grouping in the following tables 5 and 6, the sequence of the 4-1BB activation type antibody, the sequence of the immune compatible molecule, the sequence of the shRNA/miRNA processing complex gene and the sequence of the anti-interferon effector molecule are knocked into the safe site of the stem cell expression vector (stem cell vector) by adopting the conventional technology in the field, so that different types of constitutive stem cell expression vectors and inducible stem cell expression vectors are obtained to detect the expression feasibility of the constitutive stem cell expression vectors and the inducible stem cell expression vectors.

TABLE 5 constitutive knock-in expression experiment grouping

Wherein a "+" symbol indicates a knock-in of a gene or nucleic acid sequence and a "-" symbol indicates a knock-out of a gene.

The plasmids selected and the specific knock-in positions were as follows:

general principle: the sequence of the 4-1BB activated antibody is placed into MCS2 (constitutive expression) of the corresponding plasmid, other molecules are placed into shRNA or shRNA-miR expression frameworks of the corresponding plasmid according to shRNA and shRNA-miR, and other genes are placed into MCS1 of the corresponding plasmid.

Wherein, signal peptides are added in front of an LC light chain and an HC heavy chain of the 4-1BB activated antibody, and are connected by EMCV IRESWT in the middle, and the specific structure is as follows: the LC light chain (containing a stop codon which is TGA) of the signal peptide-4-1 BB activated antibody, the HC heavy chain (containing a stop codon which is TGA) of the EMCV IRESSwt-signal peptide-4-1 BB activated antibody.

The sequence of EMCV IRESWT is shown as SEQ ID NO. 183;

the sequence of the signal peptide is: 5'-ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGAATTCG-3' (SEQ ID NO. 184).

Wherein the sgRNA clone B2M plasmid comprises sgRNA clone B2M-1 and sgRNA clone B2M-2 plasmids.

The sgRNA clone CIITA plasmid comprises sgRNA clone CIITA-1 and sgRNA clone CIITA-2 plasmids.

(1) A1 grouping:

MCS2 of AAVS1 KI Vector (shRNA, constitutive) plasmid incorporates 4-1BB activating antibody sequences.

(2) A2 grouping:

the MCS2 of AAVS1 KI Vector (shRNA, constitutive) plasmid is put into 4-1BB activation type antibody sequence, the shRNA expression frame is put into shRNA target sequence of other molecules (if a plurality of shRNAs exist, the shRNA target sequences are connected in a seamless mode), and the MCS1 is put into other gene sequences.

(3) A3 grouping:

4-1BB activation type antibody sequences are placed in MCS2 of AAVS1 KI Vector (shRNA, constitutive type) plasmid, shRNA-miR target sequences of other molecules are placed in shRNA-miR expression frameworks (if a plurality of shRNAs exist, the shRNA-miR target sequences are connected in a seamless mode), and other gene sequences are placed in MCS 1.

(4) A4 grouping:

MCS2 of AAVS1 KI Vector (shRNA, constitutive) plasmid was placed in 4-1BB activating antibody sequence, B2M and CIITA were knocked out, and MCS1 was placed in other gene sequences.

(5) A5 grouping:

(6) A6 grouping:

When immune compatibility transformation is carried out, transformation can be carried out on hPSCs, and the derivative which is transformed into the pluripotent stem cells is used after the transformation is finished; the immune compatibility can also be modified after differentiation of hPSCs into derivatives of pluripotent stem cells.

TABLE 6 inducible knock-in expression experiment grouping

(1) B1 grouping:

4-1BB activation type antibody sequences are placed in MCS2 of AAVS1 KI Vector (shRNA, inducible) plasmid, shRNA target sequences of other molecules are placed in shRNA expression frameworks (if a plurality of shRNAs exist, the shRNA target sequences are connected in a seamless mode), other gene sequences are placed in MCS1, and the Tet-Off system is inserted.

(2) B2 grouping:

4-1BB activation type antibody sequences are placed in MCS2 of AAVS1 KI Vector (shRNA, inducible) plasmid, shRNA-miR target sequences of other molecules are placed in shRNA-miR expression frameworks (if a plurality of shRNAs exist, the shRNA-miR target sequences are connected seamlessly), other gene sequences are placed in MCS1, and the gene sequences are inserted into a Tet-Off system.

(3) B3 grouping:

the MCS2 of AAVS1 KI Vector (shRNA, inducible) plasmid is placed into a 4-1BB activation type antibody sequence, the shRNA expression frame is placed into shRNA target sequences of other molecules (if a plurality of shRNAs exist, the shRNA target sequences are connected in a seamless mode), and the MCS1 is placed into a gene sequence and inserted into a Tet-Off system.

(4) B4 grouping:

4-1BB activation type antibody sequences are placed in MCS2 of AAVS1 KI Vector (shRNA, inducible) plasmid, shRNA-miR target sequences of other molecules are placed in shRNA-miR expression framework (if a plurality of shRNA exist, the shRNA-miR target sequences are connected seamlessly), MCS1 gene sequences are placed in (if a plurality of genes exist, the genes are connected through EMCV IRESWT), and the gene sequences are inserted into a Tet-Off system.

The Tet-Off system in the invention specifically comprises the following steps:

in the absence of tetracycline, the tTA protein continues to act on the tet promoter, resulting in sustained gene expression. This system is very useful in situations where it is desirable to maintain the transgene in a sustained expression state. When tetracycline is added, the tetracycline can change the structure of the tTA protein, so that the tTA protein cannot be combined with a promoter, and the expression level of a gene driven by the tTA protein is reduced. To keep the system in an "off" state, the tetracycline must be added continuously.

The sequence of the Tet-Off system and one or more immune compatible molecules is knocked into a genome safety site of the pluripotent stem cell, and the expression of the immune compatible molecules is accurately turned on or Off through the addition of tetracycline, so that the expression of major histocompatibility complex related genes in the pluripotent stem cell or the derivative thereof can be reversibly regulated and controlled.

(5) Detection of Effect of expression of 4-1 BB-activating antibody on pluripotent Stem cells expressing 4-1 BB-activating antibody or derivatives thereof

The experimental group protocols in tables 5 and 6 were knocked into the genome safety sites of iPSCs, MSCs, NSCs and EBs cells at 37 ℃ with 0.5% CO₂Culturing in an incubator, collecting the culture supernatant, and treating the 4-1BB antibody expressed by the pluripotent stem cells by ELISA (competitive assay)And (5) detecting the body. The method comprises the following specific steps: mixing the collected culture medium supernatant with an enzyme-labeled anti-4-1 BB antibody (1:1), loading the mixture onto an enzyme-labeled plate coated with a 4-1BB antigen, adding a culture supernatant of the pluripotent stem cells which do not express the 4-1BB antibody into a control group, and gently mixing the culture supernatants. After sealing the plate, the plate was incubated at 37 ℃ for 30min, washed 5 times, then developed for 15min by adding a developing solution, 50. mu.L of a stop solution was added, and the absorbance was measured at a reading of 450nm (the expression level of 4-1BB antibody is inversely related to the shade of color).

The results of the tests of the respective experimental groups are shown in Table 7.

TABLE 7 expression results of 4-1 BB-activating antibody expressed by pluripotent stem cells or derivatives thereof

As can be seen from the above table, the 4-1 BB-activating antibody expressed by the pluripotent stem cell or the derivative thereof of the present invention can effectively bind to 4-1 BB. And the expression level is relatively constant in each group, so that the 4-1BB antibody expressed by the pluripotent stem cell derivative is not influenced by the cell differentiation form and other exogenous genes (immune compatibility modification).

(6) Detection of antitumor Effect of pluripotent Stem cells expressing 4-1 BB-activating antibody or derivatives thereof

The experimental group protocols in tables 6 and 7 are knocked into genome safety sites of iPSCs, MSCs, NSCs and EBs cells to obtain the cells expressing 4-1BB activated antibody. The antitumor effect was examined using the CFSE (5, 6-carboxyfluoroscein diacetate, succinimidyl ester, hydroxyfluorescein diacetate succinimidyl ester) test.

The method comprises the following specific steps:

1) preparation of effector cells:

t cell isolation: human Peripheral Blood Mononuclear Cells (PBMC) were isolated using Ficoll density gradient centrifugation (Ficoll-hypaque density gradient centrifugation) followed by Dynabeads^TM CD3(Invitrogen^TMAnd the cargo number: 11151D) T cells were isolated by the kit. Resuspend the cells at 10%FBS in RPMI1640 medium, cells were counted by trypan blue staining and concentrated to 1X 10⁷cells/mL.

2) Preparation of target cells:

the target cells were selected as tumor cells (NIC lung cancer), digested and resuspended, and cells were counted by trypan blue staining to prepare 1 × 10⁷cells/mL of cell suspension.

3) CFSE working solution (final concentration of 5. mu. mol/L CFSE) was added to the target cells at 37 ℃ with 5% CO₂Incubate for 10min and wash 2 times. After trypan blue staining counting, the cell is resuspended by a culture medium to be 1 multiplied by 10⁶cells/mL are ready for use.

4) Target and effector cells were added to 5mL flow tubes, 100. mu.L of target cells (1X 10) per tube⁵ml^-1) And effector cells (E/T ═ 1:2, 1:5, 1:10, E/T is the ratio of target cells to effector T cells), with target cells alone as control. Effector cells and target cells were gently mixed in a flow tube. Adding PI, standing at 37 deg.C, and 5% CO₂The culture was incubated for 4 h. Flow cytometry detection of CFSE⁺PI⁺Percentage of cells (dead target cells).

Target cell death (%) -target cell death (%) plus T cell stimulation (%) -target cell natural death (%)

The results are shown in Table 9.

TABLE 9 Effect of 4-1 BB-activating antibodies expressed in each experimental group on T cell killing of tumor cells

Through the experiment, the stem cell expressing the 4-1BB activated antibody or the derivative thereof prepared by the invention can be proved to be capable of effectively activating T cells to play an anti-tumor role.

(7) Application of pluripotent stem cells expressing 4-1BB activated antibody in treatment of various tumors

Immune compatible cells (hPSCs, MSCs, NSCs, EBs) from both B2M and the CIITA gene knockout panel (a4) were selected for testing.

In the humanized NSG mouse tumor model, experimental cells (hPSCs and hPSCs-derived derivatives (hPSCs-MSCs, hPSCs-NSCs, hPSCs-EBs) capable of expressing 4-1 BB-activating antibodies) were injected into each group of experimental cells, and the effect of the experimental cells on the treatment of RCC renal carcinoma, MM myeloma, and NIC lung cancer was observed. To avoid the problem of immune compatibility, the immune cells used were derived from the same person as hPSCs and hPSCs derived derivatives, and an immune compatibility protocol of B2M and CIITA gene knock-out was used.

The method comprises the following specific steps:

in humanized NSG mice (The Jackson Laboratory (JAX)), The right axilla was injected subcutaneously with 5X 10⁶Tumor (RCC renal carcinoma, MM myeloma, NIC lung carcinoma) cells until the tumor grows to 60MM³At size, tail vein injection of 200uL PBS (containing human immune cells and 10 mg)⁶The expressed 4-1BB activating type antibody) for tumor treatment, wherein only the group containing human immune cells was injected as a control group. Mice were sacrificed after 20 days and tumor sizes were compared between groups and statistical analysis of differences was performed.

The N (control) group refers to the NSG mouse tumor model without injection of experimental cells.

The results are shown in Table 9.

TABLE 9 antitumor Effect of pluripotent Stem cells or derivatives thereof in Each test group

Through the experiments, the stem cell expressing the 4-1BB activation type antibody or the derivative thereof prepared by the invention can be proved to be capable of effectively activating 4-1BB to play an anti-tumor role.

(8) Immune compatibility test of pluripotent stem cells expressing 4-1 BB-activating antibody

By utilizing the characteristic of low immunogenicity of the MSCs, the hPSCs source immune compatible MSCs capable of expressing 4-1BB activation antibodies are injected into a humanized NSG mouse tumor model, and the effect of treating tumors (NIC lung cancer) is observed. Wherein the immunocyte and the MSCs derived from hPSCs are derived from non-identical persons.

The control group is an NSG mouse tumor model without MSCs cell injection;

the Dox addition group is: the addition of 0.5mg/mL of Dox to the mouse diet was continued from the injection of 4-1 BB-activating antibody-expressing cells until the end of the experiment.

The results of the reversible expression test for the immune-compatible molecule-inducible expression panel are shown below.

TABLE 10 reversible expression test results for immune-compatible molecule-inducible expression sets

The above experiments show that: MSCs expressing only 4-1 BB-activated antibodies (group 2), which have low immunogenicity and can exist in foreign body for a certain period of time, can exert a certain tumor treatment effect, whereas those that are immuno-compatibly engineered (groups 3-11, including constitutive and reversible inducible immuno-compatibility), have a better immuno-compatibility effect, and have a longer in vivo residence time (or can achieve long-term co-existence) than MSCs that have not been immuno-compatibly engineered, and exert a better tumor treatment effect, whereas group 5 is a B2M and CIITA gene knock-out group, which completely eliminates the effect of HLA-I and HLA-II molecules, and thus has a best tumor treatment effect. However, there are group 8-15 protocols set up due to their constitutive immune compatible modifications (knock-in/knock-out) which cannot be cleared when the graft becomes mutated or otherwise unwanted. In groups 12-15, the mice injected with cells expressing 4-1 BB-activated antibody were administered with Dox-inducing agent (always administered) simultaneously with the injection of cells expressing 4-1 BB-activated antibody into the mice, and the immune compatibility of the mice injected with cells expressing 4-1 BB-activated antibody was abolished, and the cells existed in vivo for a period of time equivalent to that of the MSCs without immune compatibility modification, and the tumor therapy effect of the cells was also equivalent to that of the MSCs without immune compatibility modification.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> future Chile regenerative medicine institute (Guangzhou) Co., Ltd

Wang Linli

<120> pluripotent stem cell expressing 4-1BB activated antibody, and derivative and application thereof

<130>

<160> 184

<170> PatentIn version 3.5

<210> 1

<211> 1326

<212> DNA

<213> Artificial sequence

<400> 1

gaggtgcagc tggtgcagag cggcgccgag gtgaagaagc ccggcgagag cctgaggatc 60

agctgcaagg gcagcggcta cagcttcagc acctactgga tcagctgggt gaggcagatg 120

cccggcaagg gcctggagtg gatgggcaag atctaccccg gcgacagcta caccaactac 180

agccccagct tccagggcca ggtgaccatc agcgccgaca agagcatcag caccgcctac 240

ctgcagtgga gcagcctgaa ggccagcgac accgccatgt actactgcgc caggggctac 300

ggcatcttcg actactgggg ccagggcacc ctggtgaccg tgagcagcgc cagcaccaag 360

ggccccagcg tgttccccct ggccccctgc agcaggagca ccagcgagag caccgccgcc 420

ctgggctgcc tggtgaagga ctacttcccc gagcccgtga ccgtgagctg gaacagcggc 480

gccctgacca gcggcgtgca caccttcccc gccgtgctgc agagcagcgg cctgtacagc 540

ctgagcagcg tggtgaccgt gcccagcagc aacttcggca cccagaccta cacctgcaac 600

gtggaccaca agcccagcaa caccaaggtg gacaagaccg tggagaggaa gtgctgcgtg 660

gagtgccccc cctgccccgc cccccccgtg gccggcccca gcgtgttcct gttccccccc 720

aagcccaagg acaccctgat gatcagcagg acccccgagg tgacctgcgt ggtggtggac 780

gtgagccacg aggaccccga ggtgcagttc aactggtacg tggacggcgt ggaggtgcac 840

aacgccaaga ccaagcccag ggaggagcag ttcaacagca ccttcagggt ggtgagcgtg 900

ctgaccgtgg tgcaccagga ctggctgaac ggcaaggagt acaagtgcaa ggtgagcaac 960

aagggcctgc ccgcccccat cgagaagacc atcagcaaga ccaagggcca gcccagggag 1020

ccccaggtgt acaccctgcc ccccagcagg gaggagatga ccaagaacca ggtgagcctg 1080

acctgcctgg tgaagggctt ctaccccagc gacatcgccg tggagtggga gagcaacggc 1140

cagcccgaga acaactacaa gaccaccccc cccatgctgg acagcgacgg cagcttcttc 1200

ctgtacagca agctgaccgt ggacaagagc aggtggcagc agggcaacgt gttcagctgc 1260

agcgtgatgc acgaggccct gcacaaccac tacacccaga agagcctgag cctgagcccc 1320

ggcaag 1326

<210> 2

<211> 642

<212> DNA

<213> Artificial sequence

<400> 2

agctacgagc tgacccagcc ccccagcgtg agcgtgagcc ccggccagac cgccagcatc 60

acctgcagcg gcgacaacat cggcgaccag tacgcccact ggtaccagca gaagcccggc 120

cagagccccg tgctggtgat ctaccaggac aagaacaggc ccagcggcat ccccgagagg 180

ttcagcggca gcaacagcgg caacaccgcc accctgacca tcagcggcac ccaggccatg 240

gacgaggccg actactactg cgccacctac accggcgagg gcagcctggc cgtgttcggc 300

ggcggcacca agctgaccgt gctgggccag cccaaggccg cccccagcgt gaccctgttc 360

ccccccagca gcgaggagct gcaggccaac aaggccaccc tggtgtgcct gatcagcgac 420

ttctaccccg gcgccgtgac cgtggcctgg aaggccgaca gcagccccgt gaaggccggc 480

gtggagacca ccacccccag caagcagagc aacaacaagt acgccgccag cagctacctg 540

agcctgaccc ccgagcagtg gaagagccac aggagctaca gctgccaggt gacccacgag 600

ggcagcaccg tggagaagac cgtggccccc accgagtgca gc 642

<210> 3

<211> 21

<212> DNA

<213> human

<400> 3

gggagcagag aattctctta t 21

<210> 4

<211> 21

<212> DNA

<213> human

<400> 4

ggagcagaga attctcttat c 21

<210> 5

<211> 21

<212> DNA

<213> human

<400> 5

gagcagagaa ttctcttatc c 21

<210> 6

<211> 21

<212> DNA

<213> human

<400> 6

gctacctgga gcttcttaac a 21

<210> 7

<211> 21

<212> DNA

<213> human

<400> 7

ggagcttctt aacagcgatg c 21

<210> 8

<211> 21

<212> DNA

<213> human

<400> 8

gggtctccag tatattcatc t 21

<210> 9

<211> 21

<212> DNA

<213> human

<400> 9

gcctcctgat gcacatgtac t 21

<210> 10

<211> 21

<212> DNA

<213> human

<400> 10

ggaagacctg ggaaagcttg t 21

<210> 11

<211> 21

<212> DNA

<213> human

<400> 11

ggctaagctt gtacaataac t 21

<210> 12

<211> 21

<212> DNA

<213> human

<400> 12

gcggaatgaa ccacatcttg c 21

<210> 13

<211> 21

<212> DNA

<213> human

<400> 13

ggccttctct gaaggacatt g 21

<210> 14

<211> 21

<212> DNA

<213> human

<400> 14

ggactcaatg cactgacatt g 21

<210> 15

<211> 21

<212> DNA

<213> human

<400> 15

ggtacccact gctctggtta t 21

<210> 16

<211> 21

<212> DNA

<213> human

<400> 16

gctcccactc catgaggtat t 21

<210> 17

<211> 21

<212> DNA

<213> human

<400> 17

ggtatttctt cacatccgtg t 21

<210> 18

<211> 21

<212> DNA

<213> human

<400> 18

aggagacacg gaatgtgaag g 21

<210> 19

<211> 21

<212> DNA

<213> human

<400> 19

gctcccactc catgaggtat t 21

<210> 20

<211> 21

<212> DNA

<213> human

<400> 20

ggtatttcta cacctccgtg t 21

<210> 21

<211> 21

<212> DNA

<213> human

<400> 21

ggaccggaac acacagatct a 21

<210> 22

<211> 21

<212> DNA

<213> human

<400> 22

accggaacac acagatctac a 21

<210> 23

<211> 21

<212> DNA

<213> human

<400> 23

ggaacacaca gatctacaag g 21

<210> 24

<211> 21

<212> DNA

<213> human

<400> 24

gaacacacag atctacaagg c 21

<210> 25

<211> 21

<212> DNA

<213> human

<400> 25

ttcttacttc cctaatgaag t 21

<210> 26

<211> 21

<212> DNA

<213> human

<400> 26

aagttaagaa cctgaatata a 21

<210> 27

<211> 21

<212> DNA

<213> human

<400> 27

aacctgaata taaatttgtg t 21

<210> 28

<211> 21

<212> DNA

<213> human

<400> 28

acctgaatat aaatttgtgt t 21

<210> 29

<211> 21

<212> DNA

<213> human

<400> 29

aagcgttgat ggattaatta a 21

<210> 30

<211> 21

<212> DNA

<213> human

<400> 30

agcgttgatg gattaattaa a 21

<210> 31

<211> 21

<212> DNA

<213> human

<400> 31

gggtctggtg ggcatcatta t 21

<210> 32

<211> 21

<212> DNA

<213> human

<400> 32

ggtctggtgg gcatcattat t 21

<210> 33

<211> 21

<212> DNA

<213> human

<400> 33

gcatcattat tgggaccatc t 21

<210> 34

<211> 21

<212> DNA

<213> human

<400> 34

gcacatggag gtgatggtgt t 21

<210> 35

<211> 21

<212> DNA

<213> human

<400> 35

ggaggtgatg gtgtttctta g 21

<210> 36

<211> 21

<212> DNA

<213> human

<400> 36

gagaagatca ctgaagaaac t 21

<210> 37

<211> 21

<212> DNA

<213> human

<400> 37

gctttaatgg ctttacaaag c 21

<210> 38

<211> 21

<212> DNA

<213> human

<400> 38

ggctttacaa agctggcaat a 21

<210> 39

<211> 21

<212> DNA

<213> human

<400> 39

gctttacaaa gctggcaata t 21

<210> 40

<211> 21

<212> DNA

<213> human

<400> 40

gctccgtact ctaacatcta g 21

<210> 41

<211> 21

<212> DNA

<213> human

<400> 41

gatgaccaca ttcaaggaag a 21

<210> 42

<211> 21

<212> DNA

<213> human

<400> 42

gaccacattc aaggaagaac t 21

<210> 43

<211> 21

<212> DNA

<213> human

<400> 43

gctttcctgc ttggcagtta t 21

<210> 44

<211> 21

<212> DNA

<213> human

<400> 44

ggcagttatt cttccacaag a 21

<210> 45

<211> 21

<212> DNA

<213> human

<400> 45

gcagttattc ttccacaaga g 21

<210> 46

<211> 21

<212> DNA

<213> human

<400> 46

gcgtaagtct gagtgtcatt t 21

<210> 47

<211> 21

<212> DNA

<213> human

<400> 47

gacaatttaa ggaagaatct t 21

<210> 48

<211> 21

<212> DNA

<213> human

<400> 48

ggccatagtt ctccctgatt g 21

<210> 49

<211> 21

<212> DNA

<213> human

<400> 49

gccatagttc tccctgattg a 21

<210> 50

<211> 21

<212> DNA

<213> human

<400> 50

gcagatgacc acattcaagg a 21

<210> 51

<211> 21

<212> DNA

<213> human

<400> 51

gatgaccaca ttcaaggaag a 21

<210> 52

<211> 21

<212> DNA

<213> human

<400> 52

gaccacattc aaggaagaac c 21

<210> 53

<211> 21

<212> DNA

<213> human

<400> 53

gctttgtcag gaccaggttg t 21

<210> 54

<211> 21

<212> DNA

<213> human

<400> 54

gaccaggttg ttactggttc a 21

<210> 55

<211> 21

<212> DNA

<213> human

<400> 55

gaagcctcac agctttgatg g 21

<210> 56

<211> 21

<212> DNA

<213> human

<400> 56

gatggcagtg cctcatcttc a 21

<210> 57

<211> 21

<212> DNA

<213> human

<400> 57

ggcagtgcct catcttcaac t 21

<210> 58

<211> 21

<212> DNA

<213> human

<400> 58

gcagcaggat aagtatgagt g 21

<210> 59

<211> 21

<212> DNA

<213> human

<400> 59

gcaggataag tatgagtgtc a 21

<210> 60

<211> 21

<212> DNA

<213> human

<400> 60

ggttcctgca cagagacatc t 21

<210> 61

<211> 21

<212> DNA

<213> human

<400> 61

gcacagagac atctataacc a 21

<210> 62

<211> 21

<212> DNA

<213> human

<400> 62

gagacatcta taaccaagag g 21

<210> 63

<211> 21

<212> DNA

<213> human

<400> 63

gagtactgga acagccagaa g 21

<210> 64

<211> 21

<212> DNA

<213> human

<400> 64

gctttcctgc ttggctctta t 21

<210> 65

<211> 21

<212> DNA

<213> human

<400> 65

ggctcttatt cttccacaag a 21

<210> 66

<211> 21

<212> DNA

<213> human

<400> 66

gctcttattc ttccacaaga g 21

<210> 67

<211> 21

<212> DNA

<213> human

<400> 67

ggatgtggaa cccacagata c 21

<210> 68

<211> 21

<212> DNA

<213> human

<400> 68

gatgtggaac ccacagatac a 21

<210> 69

<211> 21

<212> DNA

<213> human

<400> 69

gtggaaccca cagatacaga g 21

<210> 70

<211> 21

<212> DNA

<213> human

<400> 70

ggaacccaca gatacagaga g 21

<210> 71

<211> 21

<212> DNA

<213> human

<400> 71

gagccaactg tattgcctat t 21

<210> 72

<211> 21

<212> DNA

<213> human

<400> 72

agccaactgt attgcctatt t 21

<210> 73

<211> 21

<212> DNA

<213> human

<400> 73

gccaactgta ttgcctattt g 21

<210> 74

<211> 21

<212> DNA

<213> human

<400> 74

gggtagcaac tgtcaccttg a 21

<210> 75

<211> 21

<212> DNA

<213> human

<400> 75

ggatttcgtg ttccagttta a 21

<210> 76

<211> 21

<212> DNA

<213> human

<400> 76

gcatgtgcta cttcaccaac g 21

<210> 77

<211> 21

<212> DNA

<213> human

<400> 77

gcgtcttgtg accagataca t 21

<210> 78

<211> 21

<212> DNA

<213> human

<400> 78

gcttatgcct gcccagaatt c 21

<210> 79

<211> 21

<212> DNA

<213> human

<400> 79

gcaggaaatc actgcagaat g 21

<210> 80

<211> 21

<212> DNA

<213> human

<400> 80

gctcagtgca ttggccttag a 21

<210> 81

<211> 21

<212> DNA

<213> human

<400> 81

ggtgagtgct gtgtaaataa g 21

<210> 82

<211> 21

<212> DNA

<213> human

<400> 82

gacatatata gtgatccttg g 21

<210> 83

<211> 21

<212> DNA

<213> human

<400> 83

ggaaagtcac atcgatcaag a 21

<210> 84

<211> 21

<212> DNA

<213> human

<400> 84

gctcacagtc atcaattata g 21

<210> 85

<211> 21

<212> DNA

<213> human

<400> 85

gccctgaaga cagaatgttc c 21

<210> 86

<211> 21

<212> DNA

<213> human

<400> 86

gcggaccatg tgtcaactta t 21

<210> 87

<211> 21

<212> DNA

<213> human

<400> 87

ggaccatgtg tcaacttatg c 21

<210> 88

<211> 21

<212> DNA

<213> human

<400> 88

gcgtttgtac agacgcatag a 21

<210> 89

<211> 21

<212> DNA

<213> human

<400> 89

ggctggctaa cattgctata t 21

<210> 90

<211> 21

<212> DNA

<213> human

<400> 90

gctggctaac attgctatat t 21

<210> 91

<211> 21

<212> DNA

<213> human

<400> 91

ggaccaggtc acatgtgaat a 21

<210> 92

<211> 21

<212> DNA

<213> human

<400> 92

ggaaaggtct gaggatattg a 21

<210> 93

<211> 21

<212> DNA

<213> human

<400> 93

ggcagattag gattccattc a 21

<210> 94

<211> 21

<212> DNA

<213> human

<400> 94

gcctgatagg acccatattc c 21

<210> 95

<211> 21

<212> DNA

<213> human

<400> 95

gcatccaata gacgtcattt g 21

<210> 96

<211> 21

<212> DNA

<213> human

<400> 96

gcgtcactgg cacagatata a 21

<210> 97

<211> 21

<212> DNA

<213> human

<400> 97

gctgtcacat aataagctaa g 21

<210> 98

<211> 21

<212> DNA

<213> human

<400> 98

gctaaggaag acagtatata g 21

<210> 99

<211> 21

<212> DNA

<213> human

<400> 99

gggatttcta aggaaggatg c 21

<210> 100

<211> 21

<212> DNA

<213> human

<400> 100

ggagttgaag agcagagatt c 21

<210> 101

<211> 21

<212> DNA

<213> human

<400> 101

gccagtgaac acttaccata g 21

<210> 102

<211> 21

<212> DNA

<213> human

<400> 102

gcttctctga agtctcattg a 21

<210> 103

<211> 21

<212> DNA

<213> human

<400> 103

ggctgcaact aacttcaaat a 21

<210> 104

<211> 21

<212> DNA

<213> human

<400> 104

ggatggattt gattatgatc c 21

<210> 105

<211> 21

<212> DNA

<213> human

<400> 105

ggaccttgga acaatggatt g 21

<210> 106

<211> 21

<212> DNA

<213> human

<400> 106

gctaattctt gctgaacttc t 21

<210> 107

<211> 21

<212> DNA

<213> human

<400> 107

gctgaacttc ttcatgtatg t 21

<210> 108

<211> 21

<212> DNA

<213> human

<400> 108

gcctcatctc tttgttctaa a 21

<210> 109

<211> 21

<212> DNA

<213> human

<400> 109

gctctggaga agatatattt g 21

<210> 110

<211> 21

<212> DNA

<213> human

<400> 110

gctcttgagg gaactaatag a 21

<210> 111

<211> 21

<212> DNA

<213> human

<400> 111

gggacggcat taatgtattc a 21

<210> 112

<211> 21

<212> DNA

<213> human

<400> 112

ggacaaacat gcaaactata g 21

<210> 113

<211> 21

<212> DNA

<213> human

<400> 113

gcagcaacca gctaccattc t 21

<210> 114

<211> 21

<212> DNA

<213> human

<400> 114

gcagttctgt tgccactctc t 21

<210> 115

<211> 21

<212> DNA

<213> human

<400> 115

gggagagttc atccaggaaa t 21

<210> 116

<211> 21

<212> DNA

<213> human

<400> 116

ggagagttca tccaggaaat t 21

<210> 117

<211> 21

<212> DNA

<213> human

<400> 117

gagagttcat ccaggaaatt a 21

<210> 118

<211> 21

<212> DNA

<213> human

<400> 118

gcctgtcaaa gagagagagc a 21

<210> 119

<211> 21

<212> DNA

<213> human

<400> 119

gctcagcttc gtactgagtt c 21

<210> 120

<211> 21

<212> DNA

<213> human

<400> 120

gcttcacaga actacagaga g 21

<210> 121

<211> 21

<212> DNA

<213> human

<400> 121

gcatctactg gacaaagtat t 21

<210> 122

<211> 21

<212> DNA

<213> human

<400> 122

ggctgaatta cccatgcttt a 21

<210> 123

<211> 21

<212> DNA

<213> human

<400> 123

gctgaattac ccatgcttta a 21

<210> 124

<211> 21

<212> DNA

<213> human

<400> 124

gggttggttt atccaggaat a 21

<210> 125

<211> 21

<212> DNA

<213> human

<400> 125

ggatcagaag agaagccaac g 21

<210> 126

<211> 21

<212> DNA

<213> human

<400> 126

ggttcaccat ccaggtgttc a 21

<210> 127

<211> 21

<212> DNA

<213> human

<400> 127

gctctcttct ctggaactaa c 21

<210> 128

<211> 21

<212> DNA

<213> human

<400> 128

gctagagtga ctccatctta a 21

<210> 129

<211> 21

<212> DNA

<213> human

<400> 129

gctgaccacc aattataatt g 21

<210> 130

<211> 21

<212> DNA

<213> human

<400> 130

gcagaatatt taaggccata c 21

<210> 131

<211> 21

<212> DNA

<213> human

<400> 131

gcccacttaa aggcagcatt a 21

<210> 132

<211> 21

<212> DNA

<213> human

<400> 132

ggtcatcaat accactgtta a 21

<210> 133

<211> 21

<212> DNA

<213> human

<400> 133

gcattcctcc ttctcctttc t 21

<210> 134

<211> 21

<212> DNA

<213> human

<400> 134

ggaggaactt tgtgaacatt c 21

<210> 135

<211> 21

<212> DNA

<213> human

<400> 135

gctgtaagaa ggatgctttc a 21

<210> 136

<211> 21

<212> DNA

<213> human

<400> 136

gctgcaggca ggattgtttc a 21

<210> 137

<211> 21

<212> DNA

<213> human

<400> 137

gcagttcgag gtcaagtttg a 21

<210> 138

<211> 21

<212> DNA

<213> human

<400> 138

gccaattagc tgagaagaat t 21

<210> 139

<211> 21

<212> DNA

<213> human

<400> 139

gcaggtttac agtgtatatg t 21

<210> 140

<211> 21

<212> DNA

<213> human

<400> 140

gcctacagag actagagtag g 21

<210> 141

<211> 21

<212> DNA

<213> human

<400> 141

gcagttgggt accttccatt c 21

<210> 142

<211> 21

<212> DNA

<213> human

<400> 142

gcaactcagg tgcatgatac a 21

<210> 143

<211> 21

<212> DNA

<213> human

<400> 143

gcatggcgct ggtacgtaaa t 21

<210> 144

<211> 19

<212> DNA

<213> human

<400> 144

gcctcgagtt tgagagcta 19

<210> 145

<211> 19

<212> DNA

<213> human

<400> 145

agacattctg gatgagtta 19

<210> 146

<211> 19

<212> DNA

<213> human

<400> 146

gggtctgtta cccaaagaa 19

<210> 147

<211> 19

<212> DNA

<213> human

<400> 147

ggtctgttac ccaaagaat 19

<210> 148

<211> 19

<212> DNA

<213> human

<400> 148

ggaaggaagc ggacgctca 19

<210> 149

<211> 19

<212> DNA

<213> human

<400> 149

ggaggcagta cttctgata 19

<210> 150

<211> 19

<212> DNA

<213> human

<400> 150

cgctctagag ctcagctga 19

<210> 151

<211> 19

<212> DNA

<213> human

<400> 151

ccaccacctc aaccaataa 19

<210> 152

<211> 19

<212> DNA

<213> human

<400> 152

atttcaagaa gtcgatcaa 19

<210> 153

<211> 19

<212> DNA

<213> human

<400> 153

gaagatctga ttaccttca 19

<210> 154

<211> 21

<212> DNA

<213> human

<400> 154

ggacactggt tcaacacctg t 21

<210> 155

<211> 21

<212> DNA

<213> human

<400> 155

ggttcaacac ctgtgacttc a 21

<210> 156

<211> 21

<212> DNA

<213> human

<400> 156

acctgtgact tcatgtgtgc g 21

<210> 157

<211> 21

<212> DNA

<213> human

<400> 157

gctggacgtg accatcatgt a 21

<210> 158

<211> 21

<212> DNA

<213> human

<400> 158

ggacgtgacc atcatgtaca a 21

<210> 159

<211> 21

<212> DNA

<213> human

<400> 159

gacgtgacca tcatgtacaa g 21

<210> 160

<211> 21

<212> DNA

<213> human

<400> 160

acgtgaccat catgtacaag g 21

<210> 161

<211> 21

<212> DNA

<213> human

<400> 161

acgctatacc atctacctgg g 21

<210> 162

<211> 21

<212> DNA

<213> human

<400> 162

gcctctatga cgacatcgag t 21

<210> 163

<211> 21

<212> DNA

<213> human

<400> 163

gacatcgagt gcttccttat g 21

<210> 164

<211> 23

<212> DNA

<213> human

<400> 164

cgcgagcaca gctaaggcca cgg 23

<210> 165

<211> 23

<212> DNA

<213> human

<400> 165

actctctctt tctggcctgg agg 23

<210> 166

<211> 23

<212> DNA

<213> human

<400> 166

acccagcagg gcgtggagcc agg 23

<210> 167

<211> 23

<212> DNA

<213> human

<400> 167

gtcagagccc caaggtaaaa agg 23

<210> 168

<211> 253

<212> DNA

<213> Artificial sequence

<400> 168

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgctagcgcc acc 253

<210> 169

<211> 9

<212> DNA

<213> Artificial sequence

<400> 169

ttcaagaga 9

<210> 170

<211> 6

<212> DNA

<213> Artificial sequence

<400> 170

tttttt 6

<210> 171

<211> 119

<212> DNA

<213> Artificial sequence

<400> 171

gaggcttcag tactttacag aatcgttgcc tgcacatctt ggaaacactt gctgggatta 60

cttcttcagg ttaacccaac agaaggctaa agaaggtata ttgctgttga cagtgagcg 119

<210> 172

<211> 19

<212> DNA

<213> Artificial sequence

<400> 172

tagtgaagcc acagatgta 19

<210> 173

<211> 119

<212> DNA

<213> Artificial sequence

<400> 173

tgcctactgc ctcggacttc aaggggctac tttaggagca attatcttgt ttactaaaac 60

tgaatacctt gctatctctt tgatacattt ttacaaagct gaattaaaat ggtataaat 119

<210> 174

<211> 686

<212> DNA

<213> Artificial sequence

<400> 174

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

ctttaccact ccctatcagt gatagagaaa agtgaaagtc gagtttacca ctccctatca 300

gtgatagaga aaagtgaaag tcgagtttac cactccctat cagtgataga gaaaagtgaa 360

agtcgagttt accactccct atcagtgata gagaaaagtg aaagtcgagt ttaccactcc 420

ctatcagtga tagagaaaag tgaaagtcga gtttaccact ccctatcagt gatagagaaa 480

agtgaaagtc gagtttacca ctccctatca gtgatagaga aaagtgaaag tcgagctcgg 540

tacccgggtc gaggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg 600

aaccgtcaga tcgcctggag acgccatcca cgctgttttg acctccatag aagacaccgg 660

gaccgatcca gcctgctagc gccacc 686

<210> 175

<211> 22

<212> DNA

<213> Artificial sequence

<400> 175

ccatagctca gtctggtcta tc 22

<210> 176

<211> 22

<212> DNA

<213> Artificial sequence

<400> 176

tcaggatgat ctggacgaag ag 22

<210> 177

<211> 20

<212> DNA

<213> Artificial sequence

<400> 177

ccggtcctgg actttgtctc 20

<210> 178

<211> 20

<212> DNA

<213> Artificial sequence

<400> 178

ctcgacatcg gcaaggtgtg 20

<210> 179

<211> 20

<212> DNA

<213> Artificial sequence

<400> 179

cgcattggag tcgctttaac 20

<210> 180

<211> 24

<212> DNA

<213> Artificial sequence

<400> 180

cgagctgcaa gaactcttcc tcac 24

<210> 181

<211> 23

<212> DNA

<213> Artificial sequence

<400> 181

cacggcactt acctgtgttc tgg 23

<210> 182

<211> 23

<212> DNA

<213> Artificial sequence

<400> 182

cagtacaggc atccctgtga aag 23

<210> 183

<211> 590

<212> DNA

<213> Artificial sequence

<400> 183

cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat aaggccggtg 60

tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg tgagggcccg 120

gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc tcgccaaagg 180

aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt cttgaagaca 240

aacaacgtct gtagcgaccc tttgcaggca gcggaacccc ccacctggcg acaggtgcct 300

ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac cccagtgcca 360

cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg tattcaacaa 420

ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg ggcctcggtg 480

cacatgcttt acatgtgttt agtcgaggtt aaaaaaacgt ctaggccccc cgaaccacgg 540

ggacgtggtt ttcctttgaa aaacacgatg ataatatggc cacaaccatg 590

<210> 184

<211> 60

<212> DNA

<213> Artificial sequence

<400> 184

atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacgaattcg 60

Claims

1. A pluripotent stem cell or a derivative thereof, wherein an expression sequence of a 4-1BB activating antibody is introduced into the genome of the pluripotent stem cell or the derivative thereof.

2. The pluripotent stem cell or the derivative thereof according to claim 1, wherein the sequence of the heavy chain of the 4-1 BB-activatable antibody is shown as SEQ ID No.1, and the sequence of the light chain is shown as SEQ ID No. 2.

3. The pluripotent stem cells or the derivatives thereof according to claim 2, wherein the genome of the pluripotent stem cells or the derivatives thereof further comprises an expression sequence of at least one immune compatible molecule for regulating the expression of genes associated with an immune response in the pluripotent stem cells or the derivatives thereof.

4. The pluripotent stem cell or the derivative thereof according to claim 3, wherein the gene associated with the immune response comprises:

5. The pluripotent stem cell or the derivative thereof of claim 3, wherein the immune-compatible molecule comprises at least one of:

(1) an immune tolerance-related gene including at least one of CD47 and HLA-G;

(4) shRNA and/or shRNA-miR targeting a major histocompatibility complex-associated gene that includes at least one of B2M and CIITA.

6. The pluripotent stem cell or the derivative thereof according to claim 5, wherein the target sequence of the shRNA and/or shRNA-miR of the major histocompatibility complex gene is at least one of SEQ ID No. 16-SEQ ID No. 103; the target sequence of shRNA and/or shRNA-miR of the major histocompatibility complex related gene is at least one of SEQ ID NO. 3-SEQ ID NO. 15.

7. The pluripotent stem cell or the derivative thereof according to claim 3, wherein a shRNA and/or miRNA processing complex-associated gene and/or anti-interferon effector molecule is further introduced into the genome of the pluripotent stem cell or the derivative thereof, wherein: the shRNA and/or miRNA processing complex related gene comprises at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA) and DGCR 8; the anti-interferon effector molecule is at least one of shRNA and/or shRNA-miR of a target PKR, 2-5As, IRF-3 or IRF-7.

8. The pluripotent stem cell or the derivative thereof according to claim 7, wherein the target sequence of the shRNA and/or shRNA-miR targeting PKR, 2-5As, IRF-3 or IRF-7 is shown in SEQ ID No.104 to SEQ ID No. 163.

9. The pluripotent stem cell or the derivative thereof according to claim 6 or 8, wherein the expression framework of the major histocompatibility complex gene, the major histocompatibility complex-related gene, the shRNA and/or shRNA-miR targeting PKR or 2-5As or IRF-3 or IRF-7 is As follows:

(1) shRNA expression framework: the shRNA target sequence, the stem-loop sequence, the reverse complementary sequence of the shRNA target sequence and the Poly T are sequentially included from 5 'to 3', and the shRNA target sequence is defined in claim 6 or 8;

(2) shRNA-miR expression framework: replacing the shRNA target sequence in (1) with the shRNA-miR target sequence of claim 6 or 8.

10. The pluripotent stem cell or the derivative thereof according to claim 9, wherein the stem-loop sequence is 3 to 9 bases in length; the length of the Poly T is 5-6 bases.

11. The pluripotent stem cell or the derivative thereof according to claim 3 or 7, wherein an inducible gene expression system is further introduced into the genome of the pluripotent stem cell or the derivative thereof, and is used for regulating the expression of an immune-compatible molecule and/or shRNA and/or miRNA processing complex-associated gene and/or anti-interferon effector molecule.

12. The pluripotent stem cells or derivatives thereof according to claim 11, wherein the inducible gene expression system comprises at least one of a Tet-Off system, a dimer inducible expression system.

13. The pluripotent stem cell or the derivative thereof according to claim 12, wherein the expression sequence of the 4-1 BB-activated antibody, the expression sequence of an immune-compatible molecule, the shRNA and/or miRNA processing complex-associated gene, the anti-interferon effector molecule, or the inducible gene expression system is introduced by a method of viral vector interference, non-viral vector transfection, or gene editing, wherein the method of gene editing comprises gene knock-in.

14. The pluripotent stem cell or the derivative thereof according to claim 13, wherein the introduction site of the expression sequence of the 4-1BB activating antibody, the expression sequence of an immune-compatible molecule, the shRNA and/or miRNA processing complex-associated gene, the anti-interferon effector molecule, or the inducible gene expression system is a genome-safe site of the pluripotent stem cell or the derivative thereof.

15. The pluripotent stem cell or derivative thereof of claim 14, wherein: the genome safe site comprises one or more of AAVS1 safe site, eGSH safe site and H11 safe site.

16. The pluripotent stem cells or derivatives thereof according to claim 15, wherein the pluripotent stem cells comprise embryonic stem cells, embryonic germ cells, embryonic carcinoma cells, or induced pluripotent stem cells; the pluripotent stem cell derivative includes an adult stem cell, each germ layer cell or tissue into which the pluripotent stem cell is differentiated; the adult stem cells include mesenchymal stem cells or neural stem cells.

17. A pluripotent stem cell or a derivative thereof, wherein a 4-1 BB-activating antibody expression sequence is introduced into the genome of the pluripotent stem cell or the derivative thereof, and the B2M gene and/or the CIITA gene is deleted from the genome of the pluripotent stem cell or the derivative thereof.

18. The pluripotent stem cell or the derivative thereof according to claim 17, wherein the sequence of the heavy chain of the 4-1 BB-activated antibody is represented by SEQ ID No.1, and the sequence of the light chain is represented by SEQ ID No. 2.

19. Use of the pluripotent stem cell or derivative thereof according to any one of claims 1 to 16 and/or the pluripotent stem cell or derivative thereof according to any one of claims 17 to 18 for the manufacture of a medicament for the treatment of a 4-1BB low expression tumor.

20. A formulation comprising a pluripotent stem cell or derivative thereof according to any of claims 1 to 16 and/or a pluripotent stem cell or derivative thereof according to any of claims 17 to 18 and a pharmaceutically acceptable carrier, diluent or excipient.