CN114380823B

CN114380823B - Imidazole-2-methylamine derivative and medical application thereof

Info

Publication number: CN114380823B
Application number: CN202210091081.5A
Authority: CN
Inventors: 温小安; 邬国庆; 孙宏斌; 陈俊雅
Original assignee: China Pharmaceutical University
Current assignee: China Pharmaceutical University
Priority date: 2022-01-26
Filing date: 2022-01-26
Publication date: 2023-06-23
Anticipated expiration: 2042-01-26
Also published as: CN114380823A

Abstract

The invention discloses an imidazole-2-methylamine derivative and medical application thereof, and provides an imidazole-2-methylamine derivative shown in formula IThe imidazole-2-methylamine derivatives are novel ALK5 inhibitors, have remarkable enzyme inhibition activity on ALK5, and can be used for treating or preventing various ALK5 mediated diseases.

Description

Imidazole-2-methylamine derivative and medical application thereof

Technical Field

The invention belongs to the field of biological medicine, and in particular relates to an imidazole-2-methylamine derivative and medical application thereof.

Background

Transforming growth factor beta (transforming growth factor beta, TGF-beta) is a multifunctional cytokine involved in the regulation of cell proliferation, differentiation and apoptosis by way of complex receptor signaling pathways on the cell surface in an autocrine, paracrine and endocrine fashion. In addition to TGF-beta, a variety of related proteins, such as activin (activins), inhibin (inhibins), bone morphogenic proteins (bonemorphogenetic proteins), and spurious inhibitory substances (Mullerian-inhibiting substance), belong to the transforming growth factor beta superfamily (TGF-beta superfamilies).

There are 3 major cellular receptors for TGF- β: type I (TGF-. Beta. R I, also known as ALK5, i.e., activin-like kinase 5), type II (TGF-. Beta.RII) and type III receptors (TGF-. Beta.RIII). Type I and type II receptors are transmembrane serine/threonine kinases, both of which directly signal, whereas type III receptors do not, and function primarily to present TGF- β to type II receptors, indirectly affecting signaling by providing ligand for receptor II. TGF-beta mainly mediates TGF-beta-Smad signaling pathway, smad protein family is intracellular signal transduction protein discovered in recent years, 8 Smad protein molecules are known in human body. Upon activation of the inactive TGF-beta in the form of a protein complex, it binds to the type II receptor and the type I receptor at the cell surface and forms a double dimeric receptor complex, which in turn phosphorylates the activated type I receptor, which in turn phosphorylates the linked Smad2/3, causing Smad2/3 to release into the cytosol and form a complex with Smad4 protein to transfer into the nucleus, thereby binding to different transcription factors and transcriptional co-activators or co-inhibitors, modulating the transcription of TGF-beta target genes, producing a biological effect.

The TGF- β -Smad signaling pathway has important regulatory effects on proliferation, differentiation, apoptosis, adhesion, migration, extracellular matrix synthesis, wound repair, immune function, and the like of cells (Nature 2003,425,577). Studies have shown that aberrant TGF- β signaling is associated with a variety of diseases such as cancer, renal fibrosis, liver fibrosis, pulmonary fibrosis, viral infection, chronic nephritis, acute nephritis, diabetic nephropathy, osteoporosis, arthritis, wound healing, ulcers, corneal trauma, heart valve stenosis, congestive heart necrosis, impaired nerve function, alzheimer's syndrome, peritoneal or subcutaneous adhesions, atherosclerosis and tumor metastasis growth, and the like. ALK5 is a potential target for the treatment of these diseases as an important node in the TGF- β signaling pathway. By inhibiting phosphorylation of ALK5 on its downstream protein Smad2 or Smad3, it is possible to block or partially block transmission of TGF-beta signals into cells, thereby correcting abnormal TGF-beta signals, and is expected to treat and prevent various ALK5 mediated diseases (Nat. Rev. Drug discovery.2012, 11,790-811; pharmacol. Theranut.2015, 147, 22-31). Prior art documents, for example: w02012002680, W02009022171, W02009133070, W02004048383, W02004013135, W02002094833, etc., have disclosed compounds as ALK5 inhibitors. Existing inhibitors have certain ALK5 inhibitory activity, but few patents or clinical research drugs for treating fibrotic diseases through ALK5 as a target point are available. Meanwhile, the existing compounds cannot reach an IC50 comparable to that of EW7197 and lack good bioavailability.

Disclosure of Invention

The invention aims to: in order to solve the problem that a PPAR alpha/delta dual agonist with strong efficacy and good pharmacokinetic property is lacking clinically at present, the invention provides a novel ALK5 inhibitor imidazole-2-methylamine derivative which has very good inhibitory activity on ALK5, and meanwhile, the in vitro activity shows that the compound of the invention has good prospect for treating fibrotic diseases.

The present invention provides a novel class of ALK5 inhibitors and their use in the treatment or prevention of a variety of diseases mediated by ALK 5.

The technical scheme is as follows: in order to achieve the above object, the present invention provides an imidazole-2-methylamine derivative, a pharmaceutically acceptable salt, ester, solvate, deuterate or prodrug thereof, as shown in formula I:

R ¹ selected from substituted or unsubstituted aryl, alkyl, cycloalkyl;

R ² selected from substituted or unsubstituted aryl;

R ³ selected from CN, CONH ₂ 、CONHNH ₂ C (NH) NHOH, substituted or unsubstituted amido, N-substituted carbamoyl, alkoxycarbonyl, substituted or unsubstituted alkyl;

w is CH or N.

Preferably, R in the imidazole-2-methylamine derivative, pharmaceutically acceptable salt, ester, solvate, deuteride or prodrug thereof ¹ Selected from the group consisting of substituted or unsubstituted phenyl, naphthyl, cyclopentyl, cyclohexyl, tetrahydropyran methyl; r is R ² Selected from substituted or unsubstituted phenyl, pyridinyl; r is R ³ Selected from CN, CONH ₂ 、CONHNH ₂ C (NH) NHOH, substituted or unsubstituted amido, N-substituted carbamoyl, alkoxycarbonyl, substituted or unsubstituted aminomethyl, heteroaryl; w is CH or N.

Preferably, the imidazole-2-methylamine derivative, pharmaceutically acceptable salt, ester, solvate, deuteride or prodrug thereof is selected from any one of the following compounds:

/>

/>

wherein the salt of the imidazole-2-methylamine derivative comprises a salt of the derivative with a metal ion or a pharmaceutically acceptable amine or ammonium ion. The compounds of formula I of the present invention may form pharmaceutically acceptable salts with acids including, but not limited to, galactose diacid, D-glucuronic acid, glycerophosphate, hippuric acid, isethionic acid, lactobionic acid, maleic acid, 1, 5-naphthalene disulfonic acid, naphthalene-2-sulfonic acid, pivalic acid, terephthalic acid, thiocyanic acid, cholic acid, n-dodecylsulfuric acid, benzenesulfonic acid, citric acid, D-glucose, glycolic acid, lactic acid, malic acid, malonic acid, mandelic acid, phosphoric acid, propionic acid, hydrochloric acid, sulfuric acid, tartaric acid, succinic acid, formic acid, hydroiodic acid, hydrobromic acid, methanesulfonic acid, nicotinic acid, nitric acid, orotic acid, oxalic acid, picric acid, L-pyroglutamic acid, saccharin acid, salicylic acid, gentisic acid, p-toluenesulfonic acid, valeric acid, palmitic acid, sebacic acid, stearic acid, lauric acid, acetic acid, adipic acid, carbonic acid, benzenesulfonic acid, ethanedisulfonic acid, ethylsuccinic acid, fumaric acid, 3-hydroxynaphthalene-2-carboxylic acid, 1-hydroxynaphthalene-2-carboxylic acid, oleic acid, undecylenic acid, ascorbic acid, camphoric acid, ethanesulfonic acid; the compounds of formula I may also form pharmaceutically acceptable salts of metals (including but not limited to sodium, potassium, calcium) or ammonium ions with inorganic bases, or pharmaceutically acceptable salts with organic bases (including but not limited to ethylenediamine, tromethamine, choline).

The invention relates to an application of imidazole-2-methylamine derivative, pharmaceutically acceptable salt, ester, solvate, deuteride or prodrug thereof in preparing ALK5 inhibitor.

The invention relates to an application of imidazole-2-methylamine derivative, pharmaceutically acceptable salt, ester, solvate, deuteride or prodrug thereof in preparing a medicament for preventing or treating ALK5 mediated diseases.

Wherein the ALK5 mediated condition includes, but is not limited to, one or more of cancer, organ fibrosis, viral infection, chronic nephritis, acute nephritis, diabetic nephropathy, osteoporosis, arthritis, wound healing, ulcers, corneal trauma, heart valve stenosis, congestive heart necrosis, impaired neurological function, alzheimer's syndrome, peritoneal or subcutaneous adhesions, atherosclerosis and tumor metastasis growth, preferably cancer or organ fibrosis. Such cancers include, but are not limited to, colon, pancreas, breast, prostate, lung, brain, ovary, cervix, testes, kidney, head or neck, bone, skin, rectum, liver, colon, esophagus, stomach, pancreas, thyroid, bladder, lymphoma, leukemia, and melanoma. Such organ fibrosis includes, but is not limited to, kidney fibrosis, liver fibrosis and lung fibrosis.

The invention relates to a pharmaceutical composition for preventing or treating ALK5 mediated diseases, wherein imidazole-2-methylamine derivatives, pharmaceutically acceptable salts, esters, solvates, deuterated substances or prodrugs thereof are used as active ingredients and pharmaceutically acceptable auxiliary materials.

Wherein the pharmaceutical composition is in the form of capsule, powder, tablet, granule, pill, injection, syrup, oral liquid, inhalant, ointment, suppository or patch.

The imidazole-2-methylamine derivatives are novel compounds which are not reported, have strong ALK5 inhibition activity, represent a new structural type ALK5 inhibitor, and can be used for preparing medicines for treating or preventing ALK5 mediated diseases.

The invention discovers that the compound has good interaction on ALK5 protein through specific drug design. The compound of the invention is butted by using Discover studio and Schrodinger software, and the key parts such as His283, lys232, tyr249, lys337 and the like are found to have hydrogen bond function. Meanwhile, the in vitro activity test also proves that the compound has good inhibition activity. The presence of cyano and primary amide groups in the present compounds can improve water solubility and good metabolic stability compared to EW 7197.

The beneficial effects are that: compared with the prior art, the invention has the following advantages:

(1) The invention provides imidazole-2-methylamine compound derivatives, which show remarkable enzyme inhibition activity on ALK5 in enzyme activity tests;

(2) The inhibition activity of the compound on a TGF-beta/smad signal channel in human liver cancer HepG2 cells is excellent, and the activity of part of the compound is obviously better than that of Vactoservib (EW-7197);

(3) Has remarkable effect on the inhibition of Col1a1 gene expression in LX-2 cells, and the activity of part of the compounds is remarkably superior to Vactoservib (EW-7197).

(4) The imidazole-2-methylamine compound derivative has the ALK5 inhibition activity equivalent to that of EW7197, shows good activity superior to that of EW7197 on LX-2 cell activity, has good prospect for treating pulmonary fibrosis, can make up for the market blank, and has very good patent medicine potential.

(5) The imidazole-2-methylamine compound derivative has the advantages of ingenious design, simple structure, cheap and easily available raw materials, safe and environment-friendly synthesis process and easy mass production.

Drawings

FIG. 1 is the effect of compounds on Col1a1 gene expression in LX-2 cells under TGF- β induction.

Detailed Description

The following examples illustrate the invention in detail. In the present invention, the following examples are given for better illustration of the present invention and are not intended to limit the scope of the present invention. Various changes and modifications can be made to the present invention without departing from the spirit and scope of the invention.

Example 1

6- (2- ((2-fluorophenyl) amino) methyl) -5- (6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (compound 1)

2-amino-5-bromopyridine (10 g,57.8 mmol) and N, N-dimethylformamide dimethyl acetal (8.26 g,63.96 mmol) were dissolved in isopropanol (30 mL), warmed to 80℃and stirred for 3h, after TLC indicated the end of the reaction, the solvent was distilled off under reduced pressure, N-hexane (20 mL) was added to slurry overnight, and crude white solid of intermediate 1-1 (10.11 g, crude yield 76%) was obtained by suction filtration.

Crude intermediate 1-1 (2 g,8.77 mmol), bromoacetonitrile (1.58 g,13.15 mmol), sodium bicarbonate (1.47 g,17.54 mmol) and potassium iodide (145 mg,0.877 mmol) were taken in DMF (20 mL), warmed to 50℃and stirred overnight. After the TLC detection reaction was completed, water (20 mL) was added to the reaction solution, stirred overnight, the solid was collected by suction filtration and dried under infrared to give a crude light brown solid (1.45 g, crude yield 75%) of intermediate 1-2.

Crude intermediate 1-2 (3.2 g,14.41 mmol), trimethylethynyl silicon (1.7 g,17.29 mmol), cuprous iodide (274 mg,1.441 mmol) and bis triphenylphosphine palladium dichloride (500 mg, 0.433 mmol) were taken in anhydrous tetrahydrofuran (20 mL). Diisopropylamine (2.19 g,21.6 mmol) was slowly added over 15 minutes. After completion of the reaction, the reaction mixture was stirred overnight at room temperature, filtered through celite, and the cake was washed three times with ethyl acetate (10 mL. Times.3), and the filtrate was collected and washed three times with saturated brine (15 mL. Times.3). The organic phase was separated, dried over anhydrous sodium sulfate, concentrated, and chromatographed (petroleum ether/ethyl acetate=10:1) to give intermediate 1-3 as a tan solid (2 g, yield 62%).

Intermediate 1-3 (100 mg,0.418 mmol) was dissolved in tetrahydrofuran (5 mL), tetrabutylammonium fluoride (120 mg,0.46 mmol) was slowly added and stirred at room temperature for 30 min. After completion of TLC detection, the reaction mixture was diluted with water, extracted three times with ethyl acetate (15 mL. Times.3), and the organic phase was separated, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to give crude light brown solid (85 mg, crude yield 100%) of intermediate 1-4.

Crude intermediate 1-4 (1.04 g,6.23 mmol), 2-bromo-6-methylpyridine (2.14 g,12.45 mmol), cuprous iodide (119 mg, 0.627 mmol) and bis triphenylphosphine palladium dichloride (216 mg,0.187 mmol) were taken in anhydrous tetrahydrofuran (20 mL) and diisopropylamine (1.26 g,12.46 mmol) was slowly added over 15 minutes. Heating to 65 deg.c and stirring for 2 hr. After completion of the TLC detection reaction, the reaction solution was suction-filtered through celite, the cake was washed three times with ethyl acetate (10 ml×3), the mother liquor was collected, washed three times with saturated brine (15 ml×3), the organic phase was separated, dried over anhydrous sodium sulfate, concentrated, and column-chromatographed (petroleum ether/ethyl acetate=5:1) to give intermediate 1-5 as a pale yellow solid (610 mg, 40% yield).

Intermediate 1-5 (50 mg,0.194 mmol) was dissolved in anhydrous DMSO (10 mL), palladium dichloride (4 mg,0.0194 mmol) was added, and the temperature was raised to 140℃and stirred under reflux under Ar atmosphere overnight. After completion of the TLC detection reaction, the reaction solution was diluted with water (15 mL) and extracted three times with ethyl acetate (15 mL. Times.3). The organic phases were combined, washed three times with saturated brine (15 ml×3), dried over anhydrous sodium sulfate, concentrated, and column chromatographed (petroleum ether/ethyl acetate=5:1) to give intermediate 1-6 as a pale yellow solid (30 mg, 53%).

Intermediate 1-6 (120 mg,0.413 mmol), ammonium acetate (96 mg,0.620 mmol) and glyoxal-1, 1-dimethyl acetal (65 mg,0.620 mmol) were dissolved in a mixed solution of tetrahydrofuran (5 mL) and methanol (5 mL) and stirred at room temperature for 3 hours. After completion of the TLC detection, the reaction solution was diluted with ethyl acetate (20 mL), and washed three times with saturated brine (15 mL. Times.3). The organic phase was separated, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure, followed by purification by column chromatography (petroleum ether/ethyl acetate=1:1) to give intermediate 1-7 as a pale yellow solid (120 mg, yield 77%).

Intermediate 1-7 (120 mg,0.317 mmol) was taken in 1N aqueous HCl (5 mL), warmed to 70 ℃, stirred for 30 min, after TLC detection reaction was completed, pH was adjusted to weak base with saturated sodium bicarbonate (5 mL), extracted three times with ethyl acetate (15 ml×3), the organic phases were combined, dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and purified by column chromatography (dichloromethane/methanol=15:1) to give intermediate 1-8 as a white solid (100 mg, yield 90%).

Intermediate 1-8 (50 mg,0.152 mmol) and o-fluoroaniline (34 mg,0.305 mmol) were dissolved in 1, 2-dichloroethane, 20uL of glacial acetic acid was added, the temperature was raised to 70℃and the mixture was refluxed for 8 hours, and after completion of the TLC detection the solvent was distilled off under reduced pressure. The residue was dissolved in ethyl acetate (10 mL), washed three times with saturated aqueous sodium bicarbonate (5 mL. Times.3), dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to give crude light brown solid (52 mg) of intermediate 1-9.

Crude intermediate 1-9 (52 mg,0.122 mmol) was dissolved in a mixed solution of tetrahydrofuran (3 mL) and methanol (3 mL), sodium borohydride (20 mg, 0.88 mmol) was added in portions under ice-bath conditions, stirred for 2 hours, ethyl acetate (15 mL) was added to dilute the reaction after TLC detection, the organic phase was washed three times with saturated brine (10 ml×3), dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and purified by column chromatography (dichloromethane/methanol=15:1) to give compound 1 as a white solid (33 mg, two-step yield 65%). ¹ H NMR(300MHz,MeOH-d ₄ )δ8.99(s,1H),8.28(s,1H),7.73(dt,J＝10.8,9.2Hz,3H),7.40(s,1H),7.21(d,J＝7.8Hz,1H),6.98(dd,J＝13.6,7.1Hz,2H),6.84(t,J＝7.7Hz,1H),6.65(dd,J＝12.6,6.4Hz,1H),4.57(s,2H),2.54(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₈ FN ₇ [M+H] ⁺ 424.1608,found424.1684。

Example 2

6- (2- ((3-fluorophenyl) amino) methyl) -5- (6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (compound 2)

Referring to the synthesis of compound 1, compound 2 was prepared by replacing o-fluoroaniline with m-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.00(s,1H),8.28(s,1H),7.74(dd,J＝21.6,10.2Hz,3H),7.41(s,1H),7.22(d,J＝7.7Hz,1H),7.10(dd,J＝15.0,7.9Hz,1H),6.53(d,J＝8.1Hz,1H),6.46(d,J＝11.8Hz,1H),6.36(t,J＝8.3Hz,1H),4.50(s,2H),2.55(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₈ FN ₇ [M+H] ⁺ 424.1608,found 424.1684。

Example 3

6- (2- ((4-chlorophenyl) amino) methyl) -5- (6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 3)

Referring to the synthesis of compound 1, compound 3 was prepared by replacing o-fluoroaniline with p-chloroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.00(s,1H),8.28(s,1H),7.96–7.63(m,3H),7.42(s,1H),7.22(d,J＝7.4Hz,1H),7.10(d,J＝8.3Hz,2H),6.71(d,J＝8.2Hz,2H),4.49(s,2H),2.54(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₈ ClN ₇ [M+H] ⁺ 440.1312,found 440.1388。

Example 4

6- (2- ((3-chlorophenyl) amino) methyl) -5- (6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 4)

Referring to the synthesis of compound 1, o-fluoroaniline was replaced with p-chloroaniline to prepare compound 4. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.00(s,1H),8.28(s,1H),7.79(s,1H),7.76–7.59(m,2H),7.41(s,1H),7.21(d,J＝7.7Hz,1H),7.09(t,J＝8.0Hz,1H),6.75(s,1H),6.65(t,J＝5.2Hz,2H),4.49(s,2H),2.54(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₈ ClN ₇ [M+H] ⁺ 440.1312,found 440.1389。

Example 5

6- (2- ((3-cyanophenyl) amino) methyl) -5- (6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (Compound 5)

Referring to the synthesis of compound 1, the o-fluoroaniline was replaced with m-aminobenzonitrile to produce compound 5. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.79(s,1H),9.28(s,1H),8.47(s,1H),7.97(s,1H),7.86(d,J＝11.9Hz,1H),7.78(d,J＝14.0Hz,1H),7.43(d,J＝7.6Hz,1H),7.30(d,J＝7.8Hz,1H),7.27–7.17(m,1H),7.09(s,1H),7.05(d,J＝8.3Hz,1H),6.97(d,J＝7.2Hz,1H),6.74(s,1H),4.42(s,2H),2.57(s,3H)。HRMS(ESI)m/z calcd.for C ₂₅ H ₁₈ N ₈ [M+H] ⁺ 431.1654,found 431.1734。

Example 6

6- (2- ((2-fluorophenyl) amino) methyl) -5- (6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 6)

Compound 5 (30 mg,0.071 mmol) was dissolved in DMSO (5 mL), potassium carbonate (5 mg,0.036 mmol) was added, 30% hydrogen peroxide (8 uL,0.078 mmol) was added under ice-bath conditions, and the mixture was slowly warmed to room temperature and stirred overnight. TLC detection of the end of the reaction, addSaturated brine (5 mL) and yellow solid precipitated. Suction filtration afforded crude compound 18, which was further purified by column chromatography (dichloromethane/methanol=15:1) to afford compound 6 (15 mg, pale yellow solid). ¹ H NMR(300MHz,DMSO-d ₆ )δ12.57(s,1H),9.87(s,1H),8.34(s,1H),7.95(s,1H),7.76–7.55(m,3H),7.27(d,J＝7.9Hz,1H),7.14(d,J＝7.5Hz,1H),7.06(d,J＝8.7Hz,1H),6.99(d,J＝9.5Hz,1H),6.95–6.82(m,1H),6.60(s,1H),5.94(s,1H),4.45(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₂₀ FN ₇ O[M+H] ⁺ 442.1713,found 442.1789。

Example 7

6- (2- ((3-fluorophenyl) amino) methyl) -5- (6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 7)

Referring to the synthesis of compound 6, compound 7 was prepared by replacing o-fluoroaniline with m-fluoroaniline. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.66(s,1H),9.88(s,1H),8.33(s,1H),7.93(s,1H),7.79–7.55(m,3H),7.52–7.23(m,1H),7.12(dd,J＝15.9,7.8Hz,2H),6.52(dd,J＝11.6Hz,3H),6.33(s,1H),4.36(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₂₀ FN ₇ O[M+H] ⁺ 442.1713,found 442.1792。

Example 8

6- (2- ((4-chlorophenyl) amino) methyl) -5- (6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 8)

Referring to the synthesis of compound 6, compound 8 was prepared by substituting o-fluoroaniline with p-chloroaniline. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.73(s,1H),9.89(s,1H),8.36(s,1H),7.97(s,1H),7.83–7.51(m,2H),7.35(dd,1H),7.21–6.97(m,2H),6.77(d,2H),6.40(s,1H),4.36(s,2H)。HRMS m/z(ESI)calcd.for C ₂₄ H ₂₀ ClN ₇ O[M+H] ⁺ 458.1418,found 458.1496。

Example 9

6- (2- ((3-chlorophenyl) amino) methyl) -5- (6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carboxamide (Compound 9)

Referring to the synthesis of compound 6, the o-fluoroaniline was replaced with m-chloroaniline to produce compound 9. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.88(s,1H),9.91(s,1H),8.40(s,1H),8.00(s,1H),7.65(t,J＝7.8Hz,3H),7.39(d,J＝7.9Hz,2H),7.10(dd,J＝17.9,8.0Hz,2H),6.78(s,1H),6.75–6.50(m,3H),4.38(s,2H)。HRMS m/z(ESI)calcd.for C ₂₄ H ₂₀ ClN ₇ O[M+H] ⁺ 458.1418,found 458.1498。

Example 10

6- (2- (((1R, 2S) -2-hydroxy-2, 3-dihydro-1H-inden-1-yl) amino) methyl) -5- (6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 10)

Referring to the synthesis of compound 1, o-fluoroaniline was replaced with (1 r,2 s) -1-amino-2-indenol to produce compound 10. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.71(s,1H),9.31(s,1H),8.47(d,1H),7.98(d,1H),7.87(dd,1H),7.76(d,1H),7.58–7.36(m,1H),7.30–7.02(m,3H),5.11(s,1H),4.43(s,1H),4.05(s,2H),3.12–2.72(m,2H)。HRMS(ESI)m/z calcd.for C ₂₇ H ₂₃ N ₇ O[M+H] ⁺ 462.1964,found 462.2032。

Example 11

6- (2- ((3-fluorophenyl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (Compound 11)

2-amino-5-bromopyridine (10 g,57.8 mmol) and N, N-dimethylformamide dimethyl acetal (8.26 g,63.96 mmol) were dissolved in isopropanol (30 mL), and the temperature was raised to 80 ℃. After stirring for 3 hours, TLC indicated that the reaction was complete, the solvent was distilled off under reduced pressure, and n-hexane (20 mL) was added to the solution to pulp overnight, followed by suction filtration to give crude white solid of intermediate 11-1 (10.11 g, crude yield 76%).

Crude intermediate 11-1 (2 g,8.77 mmol), bromoacetonitrile (1.58 g,13.15 mmol), sodium bicarbonate (1.47 g,17.54 mmol) and potassium iodide (145 mg,0.877 mmol) were taken in DMF (20 mL), warmed to 50℃and stirred overnight. After completion of the TLC detection reaction, water (20 mL) was added to the reaction mixture and stirred overnight. And (5) filtering to obtain a solid. Oven-drying under infrared conditions to obtain crude product of intermediate 11-2 (1.45 g, crude product yield 75%).

Intermediate 11-2 (3.2 g,14.41 mmol), trimethylethynyl silicon (1.7 g,17.29 mmol), cuprous iodide (274 mg,1.44 mmol) and bis triphenylphosphine palladium dichloride (500 mg,0.43 mmol) were taken in anhydrous tetrahydrofuran (20 mL). Diisopropylamine (2.19 g,21.60 mmol) was added slowly over 15 minutes. After completion of the reaction, the reaction mixture was stirred overnight at room temperature, filtered through celite, and the cake was washed three times with ethyl acetate (10 mL. Times.3), and the filtrate was collected and washed three times with saturated brine (15 mL. Times.3). The organic phase was separated, dried over anhydrous sodium sulfate, concentrated, and chromatographed (petroleum ether/ethyl acetate=10:1) to give intermediate 11-3 as a tan solid (2 g, yield 62%).

Intermediate 11-3 (100 mg,0.42 mmol) was dissolved in tetrahydrofuran (5 mL), tetrabutylammonium fluoride (120 mg,0.46 mmol) was slowly added, and stirred at room temperature for 30 minutes. After completion of TLC detection, the reaction mixture was diluted with water, extracted three times with ethyl acetate (15 mL. Times.3), and the organic phase was separated, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to give a light brown crude product (85 mg, crude product yield 100%) of intermediate 11-4.

Crude intermediate 11-4 (3.22 g,19.28 mmol), 2-bromo-6-trifluoromethylpyridine (6.54 g,28.92 mmol), copper iodide (367.2 mg,1.928 mmol), bis triphenylphosphine palladium dichloride (407 mg,0.58 mmol) were taken in dry tetrahydrofuran (30 mL), diisopropylamine (3.9 g,38.56 mmol) was added slowly over 30 min. The mixture was heated to reflux under argon for 4 hours. After completion of the TLC detection reaction, the reaction solution was cooled to room temperature, suction-filtered through celite, the cake was washed three times with ethyl acetate (15 ml×3), the mother liquor was collected, washed three times with saturated brine (20 ml×3), the organic phase was separated, dried over anhydrous sodium sulfate, concentrated, and column-chromatographed (petroleum ether/ethyl acetate=10:1) to give intermediate 11-5 as a pale yellow solid (2.66 g, yield 44%).

Intermediate 11-5 (50 mg,0.194 mmol) was dissolved in anhydrous DMSO (10 mL), palladium dichloride (4 mg,0.0194 mmol) was added, and the mixture was warmed to 140℃and stirred under reflux under Ar atmosphere overnight. After completion of the TLC detection reaction, the reaction solution was diluted with water (15 mL) and extracted three times with ethyl acetate (15 mL. Times.3). The organic phases were combined, washed three times with saturated brine (15 ml×3), dried over anhydrous sodium sulfate, concentrated, and chromatographed (petroleum ether/ethyl acetate=5:1) to give intermediate 11-6 as a pale yellow solid (30 mg, yield 53%).

A mixed solution of intermediate 11-6 (120 mg,0.413 mmol), ammonium acetate (96 mg,0.620 mmol) and glyoxal-1, 1-dimethyl acetal (65 mg,0.620 mmol) in tetrahydrofuran (5 mL) and methanol (5 mL) was taken and stirred at room temperature for 3 hours. After completion of the TLC detection, the reaction solution was diluted with ethyl acetate (20 mL), and washed three times with saturated brine (15 mL. Times.3). The organic phase was separated, dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and purified by column chromatography (petroleum ether/ethyl acetate=1:1) to give intermediate 11-7 as a pale yellow solid (120 mg, yield 77%).

Intermediate 11-7 (120 mg,0.28 mmol) was taken and placed in 1N aqueous HCl (5 mL), warmed to 70 ℃, stirred for 30 min, after TLC detection reaction was completed, pH was adjusted to weak base with saturated sodium bicarbonate (5 mL), extracted three times with ethyl acetate (15 ml×3), the organic phases were combined, dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and purified by column chromatography (dichloromethane/methanol=15:1) to afford intermediate 11-8 as a white solid (100 mg, yield 90%).

Intermediate 11-8 (100 mg,0.262 mmol) and m-fluoroaniline (58 mg, 0.323 mmol) were dissolved in dichloroethane (5 mL), acetic acid (20 uL) was added dropwise, the temperature was raised to 70℃and the mixture was stirred under reflux for 8 hours, and after completion of the TLC detection, the solvent was distilled off under reduced pressure. The residue was diluted with ethyl acetate (10 mL), washed three times with saturated aqueous sodium bicarbonate (5 mL. Times.3), dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to give a light brown crude product (110 mg) of intermediate 11-8.

Intermediate 11-9 (110 mg,0.23 mmol) was dissolved in a mixed solution of tetrahydrofuran (3 mL) and methanol (3 mL), and sodium borohydride (40 mg,1.048 mmol) was added portionwise under ice-bath conditions. After stirring for 2 hours and completion of the TLC detection reaction, the reaction mixture was diluted with ethyl acetate (10 mL), the organic phase was washed three times with saturated brine (10 ml×3), dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=100:1) to give compound 11 as a white solid (97 mg, two-step yield 65%). ¹ H NMR(300MHz,MeOH-d ₄ )δ8.85(s,1H),8.31(s,1H),8.03(dd,2H),7.79(dd,J＝23.4,9.3Hz,2H),7.66(d,J＝4.5Hz,1H),7.11(dd,J＝15.0,7.9Hz,1H),6.54(d,J＝8.5Hz,1H),6.47(dd,J＝11.9Hz,1H),6.37(t,J＝8.3Hz,1H),4.52(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₅ F ₄ N ₇ [M+H] ⁺ 478.1325,found 478.1393。

Example 12

6- (2- ((3-fluorophenyl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 12)

Compound 11 (75 mg,0.16 mmol) and potassium carbonate (11 mg,0.08 mmol) were taken in DMSO (5 mL) and 30% aqueous hydrogen peroxide (20 uL,0.19 mmol) was slowly added under ice-bath conditions. Stirring overnight at normal temperature, diluting (10 mL) reaction solution with water after TLC detection reaction, extracting with ethyl acetate (10 mL×3) three times, mixing organic phases, washing with saturated saline (10 mL×3) three times, drying with anhydrous sodium sulfate, evaporating solvent under reduced pressure, and purifying the product by column chromatography (dichloromethane/methanol=10:1) to obtainCompound 12 was a pale yellow solid (50 mg, yield 63%). ¹ H NMR(300MHz,MeOH-d ₄ )δ9.72(s,1H),8.30(s,1H),7.95(d,J＝6.0Hz,2H),7.70(q,J＝9.3Hz,2H),7.59(d,J＝8.3Hz,1H),7.11(dd,J＝15.0,8.0Hz,1H),6.53(dd,J＝8.2Hz,1H),6.47(dd,J＝11.8Hz,1H),6.36(t,J＝8.4Hz,1H),4.50(s,2H).HRMS(ESI)m/z calcd.for C ₂₄ H ₁₇ F ₄ N ₇ O[M+H] ⁺ 496.1431,found 496.1503。

Example 13

6- (2- ((2-fluorophenyl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (Compound 13)

Referring to example 11, compound 13 was prepared by substituting m-fluoroaniline with o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.85(s,1H),8.31(s,1H),8.03(dd,2H),7.79(dd,J＝23.4,9.3Hz,2H),7.66(d,J＝4.5Hz,1H),7.11(dd,J＝15.0,7.9Hz,1H),6.54(d,J＝8.5Hz,1H),6.47(dd,J＝11.9Hz,1H),6.37(t,J＝8.3Hz,1H),4.52(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₅ F ₄ N ₇ [M+H] ⁺ 478.1325,found 478.1393。

Example 14

6- (2- ((3-cyanophenyl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (Compound 14)

Referring to example 11, compound 14 was prepared by substituting meta-fluoroaniline with meta-aminobenzonitrile. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.84(s,1H),8.30(s,1H),8.02(dd,2H),7.83(d,J＝9.3Hz,1H),7.75(d,J＝9.4Hz,1H),7.66(t,1H),7.29(t,J＝8.1Hz,1H),7.04(s,2H),7.02–6.92(m,1H),4.55(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₅ F ₄ N ₇ [M+H] ⁺ 485.1372,found 485.1444。

Example 15

6- (2- ((2-fluorophenyl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 15)

Referring to example 12, compound 15 was prepared by substituting m-fluoroaniline with o-fluoroaniline. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.80(s,1H),9.70(s,1H),8.34(s,1H),8.05(t,J＝7.3Hz,2H),7.96–7.80(m,1H),7.63(q,J＝9.4Hz,3H),7.35(s,1H),7.15–6.93(m,2H),6.87(t,J＝8.5Hz,1H),6.59(q,J＝5.4Hz,1H),5.99(t,1H),4.47(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₇ F ₄ N ₇ O[M+H] ⁺ 496.1431,found 496.1501。

Example 16

6- (2- ((3-chlorophenyl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (Compound 16)

Referring to example 11, compound 16 was prepared by substituting meta-fluoroaniline for meta-chloroaniline. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.96(s,1H),8.84(s,1H),8.48(d,J＝12.4Hz,1H),8.26(d,J＝7.3Hz,1H),8.18–8.03(m,1H),7.97–7.60(m,3H),7.11(t,1H),6.79(d,1H),6.69(d,1H),6.62–6.39(m,2H),4.41(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₅ ClF ₃ N ₇ [M+H] ⁺ 494.1030,found 494.1097。

Example 17

6- (2- ((4-chlorophenyl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (Compound 17)

Referring to example 11, compound 17 was prepared by substituting p-chloroaniline for compound m-fluoroaniline. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.94(s,1H),8.86(s,1H),8.48(s,1H),8.23(s,1H),8.11(t,J＝7.5Hz,1H),7.82(s,2H),7.74(s,1H),7.13(d,J＝8.7Hz,2H),6.73(d,J＝8.7Hz,2H),6.41(d,1H),4.39(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₅ ClF ₃ N ₇ [M+H] ⁺ 494.1030,found 494.1101。

Example 18

6- (2- (((1S, 2R) -2-hydroxy-2, 3-dihydro-1H-inden-1-yl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (Compound 18)

Referring to example 11, compound 18 was prepared by substituting compound metafluoroaniline with (1 s,2 r) - (-) -1-amino-2-indenol. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.87(s,1H),8.89(s,1H),8.49(s,1H),8.23(s,1H),8.11(t,1H),7.94–7.81(m,2H),7.73(t,1H),7.45(d,1H),7.33–7.10(m,3H),5.08(s,1H),4.45(s,1H),4.07(s,2H),3.08–2.74(m,2H)。HRMS(ESI)m/z calcd.for C ₂₇ H ₂₀ F ₃ N ₇ O[M+H] ⁺ 516.1681,found 516.1756。

Example 19

6- (2- ((2-chlorophenyl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 19)

Referring to example 12, compound 19 was prepared by substituting m-fluoroaniline with o-chloroaniline. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.88(s,1H),9.71(s,1H),8.34(s,1H),8.06(t,2H),7.89(s,1H),7.73–7.54(m,1H),7.36(s,1H),7.10(t,1H),6.77(s,1H),6.69(s,1H),6.61–6.44(m,1H),4.39(s,1H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₇ ClF ₃ N ₇ O[M+H] ⁺ 512.1135,found 512.1209。

Example 20

6- (2- ((4-chlorophenyl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 20)

Referring to example 12, compound 20 was prepared by substituting m-fluoroaniline with o-chloroaniline. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.88(s,1H),9.71(s,1H),8.34(s,1H),8.02(dd,J＝24.4,16.8Hz,3H),7.63(q,J＝9.5Hz,3H),7.35(s,1H),7.12(d,J＝8.6Hz,2H),6.74(d,J＝8.7Hz,2H),6.39(t,1H),4.37(d,J＝5.3Hz,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₇ ClF ₃ N ₇ O[M+H] ⁺ 512.1135,found 512.1210。

Example 21

6- (2- (((tetrahydro-2H-pyran-4-yl) methyl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 21)

Referring to example 11, compound 21 was prepared by substituting meta-fluoroaniline with 4-aminomethyltetrahydropyran. ¹ H NMR(300MHz,DMSO-d ₆ )δ8.86(s,1H),8.49(s,1H),8.11(t,J＝6.8Hz,2H),7.84(s,2H),7.73(d,J＝7.8Hz,1H),3.83(t,J＝9.9Hz,4H),3.27(t,J＝11.0Hz,4H),1.65(d,J＝12.1Hz,3H),1.27–1.02(m,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₂₂ F ₃ N ₇ O[M+H] ⁺ 482.1838,found 482.1915。

Example 22

6- (2- ((cyclohexylamino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (Compound 22)

Referring to example 11, compound 22 was prepared by substituting m-fluoroaniline with cyclohexylamine. ¹ H NMR(300MHz,DMSO-d ₆ )δ8.88(s,1H),8.49(s,1H),8.12(t,2H),7.85(d,2H),7.75(d,J＝7.4Hz,1H),4.06(s,2H),2.86–2.59(m,4H),1.95(q,J＝24.6Hz,3H),1.72(t,2H),1.58(d,J＝8.7Hz,1H),1.34–1.06(m,4H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₂₂ F ₃ N ₇ [M+H] ⁺ 466.1889,found 466.1964。

Example 23

6- (2- ((naphthalen-1-ylmethyl) amino) methyl) -5- (6- (trifluoromethyl) pyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (Compound 23)

Referring to example 11, compound 23 was prepared by substituting m-fluoroaniline with 1-naphthylmethylamine. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.81(s,1H),8.89(s,1H),8.49(s,1H),8.24(d,J＝7.7Hz,2H),8.10(d,J＝7.7Hz,1H),7.93(d,J＝7.6Hz,2H),7.84(d,J＝7.6Hz,3H),7.74(d,1H),7.53(dt,J＝15.3,7.2Hz,4H),4.27(s,2H),3.97(s,2H)。HRMS(ESI)m/z calcd.for C ₂₉ H ₂₀ F ₃ N ₇ [M+H] ⁺ 524.1732,found 524.1812。

Example 24

6- (2- ((2-fluorophenyl) amino) methyl) -5- (6-methoxypyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (compound 24)

2-amino-5-bromopyridine (10 g,57.80 mmol) and N, N-dimethylformamide dimethyl acetal (8.26 g,63.96 mmol) were dissolved in isopropanol (30 mL) and warmed to 80 ℃. After stirring for 3 hours, TLC indicated that the reaction was complete, the solvent was distilled off under reduced pressure, and n-hexane (20 mL) was added to the solution to pulp overnight, followed by suction filtration to give crude white solid of intermediate 24-1 (10.11 g, crude yield 76%).

Intermediate 24-1 (2 g,8.77 mmol), bromoacetonitrile (1.58 g,13.15 mmol), sodium bicarbonate (1.47 g,17.54 mmol) and potassium iodide (145 mg,0.877 mmol) were taken in DMF (20 mL), warmed to 50℃and stirred overnight. After completion of TLC detection, water (20 mL) was added to the reaction mixture, stirred overnight, the solid was collected by suction filtration and dried under infrared to give intermediate 24-2 as a crude light brown solid (1.45 g, 75% yield of crude).

Crude intermediate 24-2 (3.2 g,14.41 mmol), trimethylethynyl silicon (1.7 g,17.29 mmol), cuprous iodide (274 mg,1.441 mmol) and bis triphenylphosphine palladium dichloride (500 mg, 0.433 mmol) were taken in anhydrous tetrahydrofuran (20 mL). Diisopropylamine (2.19 g,21.6 mmol) was slowly added over 15 minutes. After completion of the reaction, the reaction mixture was stirred overnight at room temperature, filtered through celite, and the cake was washed three times with ethyl acetate (10 mL. Times.3), and the filtrate was collected and washed three times with saturated brine (15 mL. Times.3). The organic phase was separated, dried over anhydrous sodium sulfate, concentrated, and chromatographed (petroleum ether/ethyl acetate=10:1) to give intermediate 24-3 as a tan solid (2 g, yield 62%).

Intermediate 24-3 (100 mg,0.418 mmol) was dissolved in tetrahydrofuran (5 mL), tetrabutylammonium fluoride (120 mg,0.46 mmol) was slowly added and stirred at room temperature for 30 min. After completion of TLC detection, the reaction mixture was diluted with water, extracted three times with ethyl acetate (15 mL. Times.3), and the organic phase was separated, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to give crude light brown solid (85 mg, crude yield 100%) of intermediate 24-4.

Intermediate 24-4 (1 g,5.99 mmol), 2-methoxy-6 bromopyridine (2.03 g,10.77 mmol), cuprous iodide (115 mg,0.6 mmol) and bis triphenylphosphine palladium dichloride (126 mg,0.18 mmol) were taken in anhydrous tetrahydrofuran (20 mL) and diisopropylamine (1.22 g,1.7 mL) was slowly added over 15 minutes. Slowly heating to 65 ℃, and stirring for 4 hours. After the TLC detection reaction was completed, the reaction solution was suction-filtered through celite, the filter cake was washed three times with ethyl acetate (15 ml×3), the organic phases were combined, washed with saturated sodium chloride water (10 ml×3) times, dried over anhydrous sodium sulfate, concentrated, and the product was purified by column chromatography (petroleum ether/ethyl acetate=15:1) to give an off-white solid of intermediate 24-5 (720 mg, yield 43%).

Intermediate 24-5 (140 mg,0.51 mmol) and palladium dichloride (14 mg,0.051 mmol) were dissolved in anhydrous DMSO (10 mL), slowly warmed to 140℃and stirred under reflux under Ar atmosphere overnight. After the completion of the TLC detection reaction, the reaction solution was suction-filtered through celite, and the cake was washed three times with ethyl acetate (10 mL. Times.3), and the mother liquor was collected. The mother liquor was washed three times with saturated brine (15 ml×3), dried over anhydrous sodium sulfate, concentrated, and the product purified by column chromatography (petroleum ether/ethyl acetate=5:1) to give intermediate 24-6 as an off-white solid (132 mg, yield 84%).

Intermediate 24-6 (640 mg,2.188 mmol), glyoxal-1, 1-dimethyl acetal (341.6 mg, 3.281mmol) and ammonium acetate (506 mg,6.564 mmol) were taken and placed in a mixed solution of methanol (10 mL) and tetrahydrofuran (10 mL) and stirred at room temperature for 4 hours. After completion of the TLC detection, ethyl acetate (20 mL) was added to dilute the reaction solution, followed by washing with saturated brine (15 mL. Times.3) three times. The organic phase was separated, dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=100:1) to give intermediate 24-7 as an off-white solid (710 mg, yield 84%).

Intermediate 24-7 (650 mg,1.66 mmol) was taken and placed in 1N aqueous HCl (15 mL), warmed to 70℃and stirred for 30 min after completion of the TLC detection reaction. The reaction was cooled to room temperature and saturated sodium bicarbonate (15 mL) was adjusted to pH slightly alkaline. White solid is separated out, suction filtration is carried out, and the filter cake is washed three times. Oven drying under infrared conditions gave intermediate 24-8 as a white solid (640 mg, 90% yield).

Intermediate 24-8 (100 mg,0.29 mmol) and o-fluoroaniline (65 mg,0.581 mmol) were taken in dichloroethane (5 mL), 20uL of glacial acetic acid was added, the temperature was slowly raised to 70 ℃, the mixture was refluxed for 8 hours, and after completion of the TLC detection, the solvent was distilled off under reduced pressure. The residue was diluted with ethyl acetate (15 mL), the organic phase was washed three times with saturated aqueous sodium bicarbonate (15 mL. Times.3), dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to give intermediate 24-9 as a brown solid (110 mg).

A mixed solution of crude intermediate 24-9 (110 mg,0.32 mmol) in tetrahydrofuran (5 mL) and methanol (5 mL) was taken and sodium borohydride (44 mg,1.16 mmol) was added in portions under ice-bath conditions and stirred for 2 hours. After the completion of the TLC detection, the reaction mixture was diluted with ethyl acetate (20 mL), the organic phase was washed with saturated brine (10 ml×3) three times, dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=100:1) to give compound 24 as a white solid (90 mg, two-step yield 71%). ¹ H NMR(300MHz,MeOH-d ₄ )δ8.77(s,1H),8.29(s,1H),7.77(q,J＝9.4Hz,2H),7.65(t,J＝7.9Hz,1H),7.23(s,1H),6.98(t,J＝9.0Hz,2H),6.85(t,J＝8.1Hz,1H),6.67(q,J＝7.4Hz,2H),4.57(s,2H),3.66(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₈ FN ₇ O[M+H] ⁺ 440.1557,found 440.1628。

Example 25

6- (2- ((2-fluorophenyl) amino) methyl) -5- (6-methoxypyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 25)

Compound 24 (50 mg,0.114 mmol) and potassium carbonate (6 mg,0.170 mmol) were taken in DMSO (5 mL) and 30% aqueous hydrogen peroxide (20 uL,0.170 mmol) was slowly added under ice-bath conditions and stirred overnight at room temperature. After TLC detection of the end of the reaction, the reaction mixture was diluted with water (10 mL), the aqueous phase was extracted with ethyl acetate (15 mL. Times.3), the organic phases were combined, and the organic phase was taken over The product was purified by column chromatography (dichloromethane/methanol=20:1) by washing with saturated brine (10 ml×3) three times, drying over anhydrous sodium sulfate, and evaporating the solvent under reduced pressure to give compound 25 as a white solid (40 mg, yield 76%). ¹ H NMR(300MHz,MeOH-d ₄ )δ9.74(s,1H),8.30(s,1H),7.97–7.48(m,3H),7.22(s,1H),6.98(dd,J＝13.4,5.6Hz,2H),6.86(t,J＝8.6Hz,1H),6.65(dd,J＝18.2,7.8Hz,2H),4.56(s,2H),3.47(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₂₀ FN ₇ O ₂ [M+H] ⁺ 458.1663,found 458.1738。

Example 26

6- (2- ((3-fluorophenyl) amino) methyl) -5- (6-methoxypyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (compound 26)

/>

Referring to example 24, compound 26 was prepared by substituting m-fluoroaniline for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.79(s,1H),8.30(s,1H),7.78(q,J＝9.0Hz,2H),7.66(s,1H),7.11(dd,J＝15.2,7.8Hz,2H),6.69(d,J＝7.8Hz,1H),6.50(dd,J＝21.6,9.9Hz,2H),6.37(t,J＝8.4Hz,1H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₈ FN ₇ O[M+H] ⁺ 440.1557,found 440.1630。

Example 27

6- (2- ((4-chlorophenyl) amino) methyl) -5- (6-methoxypyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (compound 27)

Referring to example 24, the substitution of o-fluoroaniline for m-chloroaniline produced compound 27. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.78(s,1H),8.29(s,1H),7.78(q,J＝9.1Hz,2H),7.66(t,J＝7.8Hz,1H),7.24(s,1H),7.11(d,J＝8.7Hz,2H),6.70(t,J＝8.4Hz,3H),4.49(s,2H),3.66(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₈ ClN ₇ O[M+H] ⁺ 456.1261,found 456.1337。

Example 28

6- (2- ((4-chlorophenyl) amino) methyl) -5- (6-methoxypyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 28)

Referring to example 25, compound 28 was prepared by substituting p-chloroaniline for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.74(s,1H),8.30(s,1H),7.91–7.55(m,3H),7.23(s,1H),7.11(d,J＝8.8Hz,2H),6.71(d,J＝8.8Hz,2H),6.61(d,J＝8.2Hz,1H),4.47(s,2H),3.57(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₂₀ ClN ₇ O ₂ [M+H] ⁺ 474.1367,found 474.1446。

Example 29

6- (2- ((3-chlorophenyl) amino) methyl) -5- (6-methoxypyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 29)

Referring to example 24, the substitution of o-fluoroaniline for m-chloroaniline produced compound 29. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.74(s,1H),8.30(s,1H),7.91–7.55(m,3H),7.23(s,1H),7.11(d,J＝8.8Hz,2H),6.71(d,J＝8.8Hz,2H),6.61(d,J＝8.2Hz,1H),4.47(s,2H),3.57(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₂₀ ClN ₇ O ₂ [M+H] ⁺ 474.1367,found 474.1446。

Example 30

6- (2- ((3-chlorophenyl) amino) methyl) -5- (6-methoxypyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 30)

Referring to example 25, compound 30 was prepared by substituting m-chloroaniline for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.74(s,1H),8.30(s,1H),7.91–7.55(m,3H),7.23(s,1H),7.11(d,J＝8.8Hz,2H),6.71(d,J＝8.8Hz,2H),6.61(d,J＝8.2Hz,1H),4.47(s,2H),3.57(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₂₀ ClN ₇ O ₂ [M+H] ⁺ 474.1367,found 474.1446。

Example 31

6- (2- ((3-cyanophenyl) amino) methyl) -5- (6-methoxypyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 31)

Referring to example 24, compound 31 was prepared by substituting m-aminobenzonitrile for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.80(s,1H),8.31(s,1H),7.80(d,2H),7.68(s,1H),7.31(t,2H),7.05(q,3H),6.72(d,1H),4.55(s,2H),3.76(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₂₀ ClN ₇ O ₂ [M+H] ⁺ 474.1367,found 447.1681。

Example 32

6- (5- (6-methoxypyridin-2-yl) -2- ((naphthalen-1-ylmethyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 32)

Referring to example 32, compound 32 was prepared by substituting o-fluoroaniline with 1-naphthylmethylamine. ¹ H NMR(300MHz,DMSO-d ₆ )δ12.65(s,1H),8.82(s,1H),8.47(s,1H),8.24(s,1H),7.87(m,5H),7.57(d,J＝30.6Hz,4H),7.17(s,1H),6.64(s,1H),4.33(s,2H),4.02(s,2H),3.67(s,3H)。HRMS(ESI)m/z calcd.for C ₂₉ H ₂₃ N ₇ O[M+H] ⁺ 489.1964,found 486.2041。

Example 33

6- (5- (5-fluoro-6-methylpyridin-2-yl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (compound 33)

2-amino-5-bromopyridine (10 g,57.8 mmol) and N, N-dimethylformamide dimethyl acetal (8.26 g,63.96 mmol) were dissolved in isopropanol (30 mL) and warmed to 80 ℃. After stirring for 3 hours, TLC indicated that the reaction was complete, the solvent was distilled off under reduced pressure, and n-hexane (20 mL) was added to the solution to pulp overnight, followed by suction filtration to give crude white solid of intermediate 33-1 (10.11 g, crude yield 76%).

Crude intermediate 33-1 (2 g,8.77 mmol), bromoacetonitrile (1.58 g,13.15 mmol), sodium bicarbonate (1.47 g,17.54 mmol) and potassium iodide (145 mg,0.877 mmol) were taken in DMF (20 mL), warmed to 50℃and stirred overnight. After completion of TLC detection, water (20 mL) was added to the reaction mixture, stirred overnight, the solid was collected by suction filtration and dried under infrared to give crude light brown solid (1.45 g, crude yield 75%) of intermediate 33-2. Crude intermediate 33-2 (3.2 g,14.41 mmol), trimethylethynyl silicon (1.7 g,17.29 mmol), cuprous iodide (274 mg,1.441 mmol) and bis triphenylphosphine palladium dichloride (500 mg, 0.433 mmol) were taken in anhydrous tetrahydrofuran (20 mL). Diisopropylamine (2.19 g,21.6 mmol) was slowly added over 15 minutes. After completion of the reaction, the reaction mixture was stirred overnight at room temperature, filtered through celite, and the cake was washed three times with ethyl acetate (10 mL. Times.3), and the filtrate was collected and washed three times with saturated brine (15 mL. Times.3). The organic phase was separated, dried over anhydrous sodium sulfate, concentrated, and chromatographed (petroleum ether/ethyl acetate=10:1) to give intermediate 33-3 as a tan solid (2 g, yield 62%).

Intermediate 33-3 (100 mg,0.418 mmol) was dissolved in tetrahydrofuran (5 mL), tetrabutylammonium fluoride (120 mg,0.46 mmol) was slowly added and stirred at room temperature for 30 min. After completion of TLC detection, the reaction mixture was diluted with water, extracted three times with ethyl acetate (15 mL. Times.3), and the organic phase was separated, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to give a crude light brown solid (85 mg, crude yield 100%) of intermediate 33-4.

Intermediate 33-4 (1.37 g,8.2 mmol), 2-bromo-5-fluoro-6-methylpyridine (1.87 g,9.84 mmol), cuprous iodide (156.2 mg,0.82 mmol) and bis triphenylphosphine palladium dichloride (173 mg,0.25 mmol) were taken in anhydrous tetrahydrofuran (25 mL) and diisopropylamine (1.25 g,12.3 mmol) was added slowly over 20 min. Reflux is carried out for 4 hours under Ar atmosphere. After the completion of the TLC detection reaction. The reaction solution was filtered through celite, the filter cake was washed three times with ethyl acetate (15 ml×3), the mother liquor was collected, the filtrate was washed three times with saturated brine (20 ml×3), the organic phase was separated, dried over anhydrous sodium sulfate, and concentrated. Purification by column chromatography (petroleum ether/ethyl acetate=30:1) afforded intermediate 33-5 as a tan solid (1.4 g, 62% yield).

Intermediate 33-5 (50 mg,0.181 mmol) and palladium dichloride (4 mg,0.0181 mmol) were taken in anhydrous DMSO (10 mL), warmed to 140℃and heated under reflux under argon for 10 hours. After completion of the TLC detection reaction, the reaction solution was diluted with water (15 mL) and extracted three times with ethyl acetate (15 mL. Times.3). The organic phases were combined, washed three times with saturated brine (15 ml×3), dried over anhydrous sodium sulfate, concentrated, and chromatographed (petroleum ether/ethyl acetate=5:1) to give intermediate 33-6 as an off-white solid 33-6 (20 mg, yield 35%).

A mixed solution of 33-6 (560 mg,1.82 mmol), glyoxal-1, 1-dimethyl acetal (284 mg,2.72 mmol) and ammonium acetate (280 mg,6.564 mmol) was taken and placed in methanol (10 mL) and tetrahydrofuran (10 mL), and stirred at room temperature for 4 hours. After the completion of the TLC detection reaction, ethyl acetate (20 mL) was added to dilute the reaction solution, and the mixture was washed three times with saturated brine (15 ml×3), dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure, followed by purification by column chromatography (dichloromethane/methanol=100:1). Intermediate 33-7 was obtained as an off-white solid (615 mg, 86% yield).

Intermediate 33-7 (600 mg,1.54 mmol) was taken and placed in 1N HCl (15 mL) in water, warmed to 70℃and stirred for 30 min. After TLC indicated the end of the reaction, the reaction was cooled to room temperature and the pH was adjusted to weak base with saturated sodium bicarbonate (10 mL). White solid is precipitated, suction filtered, and the filter cake is washed with water (10 mL. Times.3) three times and dried under infrared conditions. Intermediate 33-8 was obtained as a white solid. (460 mg, yield 76%).

Intermediate 33-8 (100 mg,0.288 mmol) and o-fluoroaniline (65 mg,0.577 mmol) were dissolved in 1, 2-dichloroethane (10 mL) and acetic acid 20uL was added. Heating to 70 ℃, and refluxing for 8 hours. After completion of the TLC detection, the solvent was distilled off under reduced pressure, the residue was diluted with ethyl acetate (15 mL), and the organic phase was washed three times with saturated brine (15 mL. Times.3), dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to give an intermediate 33-9 as a pale brown solid (110 mg).

A mixed solution of crude intermediate 33-9 (110 mg,0.25 mmol) in tetrahydrofuran (5 mL) and methanol (5 mL) was taken, and sodium borohydride (44 mg,1.16 mmol) was added in portions under ice-bath conditions and stirred for 2 hours. After the completion of the TLC detection reaction, ethyl acetate was added to dilute (20 mL) the reaction solution, and the organic phase was washed three times with saturated brine (10 mL. Times.3), dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=10:1). Compound 33 was obtained as an off-white solid (95 mg, 75% in two steps). ¹ H NMR(300MHz,MeOH-d ₄ )δ9.02(s,1H),8.29(s,1H),7.77(dd,J＝18.7,9.3Hz,2H),7.50(d,2H),6.98(q,J＝13.1,7.3Hz,2H),6.83(t,J＝7.9Hz,1H),6.65(dd,J＝12.5,6.5Hz,1H),4.56(s,2H),2.50(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₇ F ₂ N ₇ [M+H] ⁺ 442.1513,found 442.1587。

Example 34

6- (5- (5-fluoro-6-methylpyridin-2-yl) -2- (((1S, 2R) -2-hydroxy-2, 3-dihydro-1H-inden-1-yl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 34)

Method for reference to Compound 33, substitution of o-fluoroaniline with (1S, 2R) - (-) -1-amino-2-indeneAlcohol to produce compound 34. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.08(s,1H),8.30(s,1H),7.82(dd,J＝17.7Hz,2H),7.51(q,3H),7.25(dd,3H),4.59(s,1H),4.41–4.06(m,3H),3.06(dd,J＝19.5Hz,2H),2.48(s,3H)。HRMS(ESI)m/z calcd.for C ₂₇ H ₂₂ FN ₇ O.[M+H] ⁺ 480.1870,found 480.1943。

Example 35

6- (5- (5-fluoro-6-methylpyridin-2-yl) -2- ((3-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (compound 35)

Referring to the procedure of example 33, the substitution of o-fluoroaniline for m-fluoroaniline produced compound 35. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.03(s,1H),8.29(s,1H),7.78(dd,J＝19.5,9.0Hz,2H),7.51(d,J＝5.8Hz,2H),7.10(dd,J＝7.3Hz,1H),6.70–6.16(m,3H),4.49(s,3H),2.51(s,4H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₇ F ₂ N ₇ [M+H] ⁺ 442.1513,found 442.1591。

Example 36

6- (5- (5-fluoro-6-methylpyridin-2-yl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 36)

Compound 33 (50 mg,0.113 mmol) and potassium carbonate (10 mg,0.06 mmol) were taken in DMSO (5 mL) and aqueous hydrogen peroxide (0.136 mmol,20 uL) was slowly added under ice-bath conditions. Stirring overnight, after completion of TLC detection, stirring overnight at room temperature. After the TLC detection reaction was completed, the reaction solution was diluted (10 mL) with water, the aqueous phase was extracted with ethyl acetate (15 ml×3), the organic phases were combined, washed three times with saturated brine (10 ml×3), dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=20:1),compound 36 was obtained as a white solid (30 mg, yield 56%). ¹ H NMR(300MHz,MeOH-d ₄ )δ9.79(s,1H),8.29(s,1H),7.68(s,2H),7.43(d,2H),7.07–6.92(m,2H),6.84(t,J＝8.1Hz,1H),6.71–6.57(m,1H),4.55(s,2H),2.57(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₉ F ₂ N ₇ O[M+H] ⁺ 460.1619,found 460.1695。

Example 37

6- (2- ((3-cyanophenyl) amino) methyl) -5- (5-fluoro-6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 37)

Referring to the method of compound 33, o-fluoroaniline is replaced by m-aminobenzonitrile. Compound 37 was obtained. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.01(s,1H),8.20(s,1H),7.95–7.68(m,2H),7.60(s,1H),7.30(dt,2H),6.98(d,2H),4.50(s,2H),2.53(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₉ F ₂ N ₇ O[M+H] ⁺ 449.1650,found 460.1639。

Example 38

6- (5- (5-fluoro-6-methylpyridin-2-yl) -2- ((3-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 38)

Referring to the method of compound 36, o-fluoroaniline is replaced with m-fluoroaniline. Compound 38 was obtained. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.03(s,1H),8.29(s,1H),7.76(t,J＝10.4Hz,2H),7.50(t,J＝8.8Hz,2H),7.10(dd,J＝15.0,8.1Hz,1H),6.53(dd,J＝8.2,1.5Hz,1H),6.45(dt,J＝11.8,2.2Hz,1H),6.36(qd,1H),4.54(s,2H),2.59(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₉ F ₂ N ₇ O[M+H] ⁺ 460.1619,found 460.1639。

Example 39

6- (2- ((2-chlorophenyl) amino) methyl) -5- (5-fluoro-6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (compound 39)

/>

Referring to the method of compound 33, o-fluoroaniline was replaced with o-chloroaniline. Compound 39 was obtained. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.02(s,1H),8.29(s,1H),7.77(q,J＝9.3Hz,2H),7.50(d,J＝6.8Hz,1H),7.26(d,J＝7.8Hz,1H),7.13(t,J＝7.1Hz,1H),6.83(d,J＝7.7Hz,1H),6.66(t,J＝7.1Hz,1H),4.60(s,2H),2.51(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₉ F ₂ N ₇ O.[M+H] ⁺ 458.1218,found 458.1287。

Example 40

6- (2- ((3-chlorophenyl) amino) methyl) -5- (5-fluoro-6-methylpyridin-2-yl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (compound 40)

Referring to the method of compound 33, o-fluoroaniline was replaced with m-chloroaniline. Compound 40 was obtained. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.03(s,1H),8.29(s,1H),7.78(dd,J＝20.2,9.4Hz,2H),7.51(d,J＝6.9Hz,2H),7.08(t,J＝8.0Hz,1H),6.74(s,1H),6.64(d,J＝8.0Hz,2H),4.49(s,2H),2.51(s,3H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₇ ClFN ₇ [M+H] ⁺ 458.1218,found 458.1282。

Example 41

6- (5- (5-fluoro-6-methylpyridin-2-yl) -2- ((naphthalen-1-ylmethyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 41)

Referring to the method of compound 33, o-fluoroaniline was replaced with 1-naphthylmethylamine. Compound 41 was obtained. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.01(s,1H),8.24(dd,J＝32.1Hz,2H),8.02–7.69(m,4H),7.63–7.18(m,6H),4.42(s,2H),4.12(s,2H),2.52(s,3H)。HRMS(ESI)m/z calcd.for C ₂₉ H ₂₂ FN ₇ [M+H] ⁺ 488.1921,found 488.1994。

Example 42

6- (5- (4-fluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 42)

2-amino-5-bromopyridine (10 g,57.8 mmol) and N, N-dimethylformamide dimethyl acetal (8.26 g,63.96 mmol) were dissolved in isopropanol (30 mL) and warmed to 80 ℃. After stirring for 3 hours, TLC indicated that the reaction was complete, the solvent was distilled off under reduced pressure, and n-hexane (20 mL) was added to the solution to pulp overnight, followed by suction filtration to give crude white solid of intermediate 42-1 (10.11 g, crude yield 76%).

Crude intermediate 42-1 (2 g,8.77 mmol), bromoacetonitrile (1.58 g,13.15 mmol), sodium bicarbonate (1.47 g,17.54 mmol) and potassium iodide (145 mg,0.877 mmol) were taken in DMF (20 mL), warmed to 65℃and stirred overnight. After the completion of TLC detection, water (20 mL) was added to the reaction mixture, stirred overnight, the solid was collected by suction filtration and dried under infrared to give crude light brown solid (1.45 g, crude yield 75%) of intermediate 42-2.

Intermediate 42-2 (4 g,17.97 mmol), 4-fluorophenylacetylene (2.81 g,23.36 mmol), cuprous iodide (342.24 mg,1.797 mmol) and bis triphenylphosphine palladium dichloride (378 mg,0.54 mmol) were taken in anhydrous acetonitrile (20 mL). Diisopropylamine (2.75 g,26.96 mmol) was added slowly over 15 minutes. After stirring overnight at room temperature and completion of the reaction by TLC, the reaction mixture was filtered through celite, and the cake was washed three times with ethyl acetate (10 mL. Times.3). The mother liquor was collected and washed three times with saturated brine (15 mL. Times.3). The organic phase was dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and column chromatography (petroleum ether/ethyl acetate=10:1) gave intermediate 42-3 as a yellow solid (4.2 g, yield 87%).

Intermediate 42-3 (60 mg,0.23 mmol) and palladium dichloride (5 mg,0.0232 mmol) were taken in anhydrous DMSO (10 mL), warmed to 140℃and heated under argon atmosphere for 10 hours. After completion of the TLC detection, the reaction mixture was suction-filtered through celite, the filter cake was washed three times with ethyl acetate (15 mL. Times.3), and the mother liquor was washed three times with saturated brine (15 mL. Times.3), and the organic phase was dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, and the product was purified by column chromatography to give intermediate 42-4 as an off-white solid (50 mg, yield 89%).

A mixed solution of intermediate 42-4 (3.5 g,11.935 mmol), glyoxal-1, 1-dimethyl acetal (2.48 g,23.87 mmol), ammonium acetate (3.68 g,47.74 mmol) in tetrahydrofuran (10 mL) and methanol (10 mL) was taken and stirred at ambient temperature for 4 hours. After the completion of the TLC detection reaction, the reaction mixture was stirred at room temperature for 4 hours, after the completion of the TLC detection reaction, ethyl acetate (30 mL) was added to dilute the reaction mixture, and the mixture was washed three times with saturated brine (25 mL. Times.3), dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure, followed by purification by column chromatography (dichloromethane/methanol=100:1). 42-5 was obtained as an off-white solid (3.17 g, yield 70%).

Compound 42-5 (3.17 g,8.4 mmol) was dissolved in 1N HCl (25 mL) and warmed to 70℃under reflux for 30 min, after TLC indicated the end of the reaction, the reaction was cooled to room temperature and saturated sodium bicarbonate (20 mL) was adjusted to weak base pH. The white solid precipitated, was suction filtered, and the filter cake was washed with water (20 mL. Times.3) three times and dried under infrared conditions to give intermediate 42-6 as a pale brown solid (3 g, 99%).

Intermediate 42-6 (120 mg,0.362 mmol) and o-fluoroaniline (81 mg,0.724 mmol) were dissolved in dichloroethane (10 mL) and acetic acid 20uL was added. After the completion of the reaction, the solvent was distilled off under reduced pressure, diluted with ethyl acetate (15 mL), and the organic phase was washed three times with saturated brine (15 mL. Times.3), dried over anhydrous sodium sulfate, and distilled off under reduced pressure to give intermediate 42-7 as a brown solid (110 mg).

A mixed solution of intermediate 42-7 (110 mg,0.25 mmol) in tetrahydrofuran (5 mL) and methanol (5 mL) was taken and sodium borohydride (44 mg,1.16 mmol) was added portionwise under ice-bath conditionsStirring for 30 minutes. After the TLC detection reaction was completed, the reaction solution was diluted with ethyl acetate (20 mL), the organic phase was washed with water (10 ml×3) three times, dried over anhydrous sodium sulfate, and the product was purified by column chromatography (dichloromethane/methanol=10:1). Compound 42 was obtained as an off-white solid (115 mg, 74% in two steps). ¹ H NMR(300MHz,MeOH-d ₄ )δ9.50(s,1H),8.76(s,1H),8.15(s,1H),7.63(d,J＝9.2Hz,1H),7.53(d,1H),7.39(d,2H),7.21–6.97(m,3H),6.77(t,J＝7.7Hz,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₆ F ₂ N ₆ [M+H] ⁺ 427.1405,found 427.1477。

Example 43

6- (5- (4-fluorophenyl) -2- ((3-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 43)

Referring to the procedure of example 42, compound 43 was prepared by substituting m-fluoroaniline for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.50(s,1H),8.64(s,1H),8.25(s,1H),7.67(d,J＝9.4Hz,1H),7.57(d,J＝9.3Hz,1H),7.49(dd,J＝8.6,5.4Hz,2H),7.13(dt,J＝15.0,8.4Hz,3H),6.52(d,J＝8.3Hz,1H),6.44(d,J＝11.8Hz,1H),6.36(t,J＝8.4Hz,1H),4.48(s,2H)。HRMS(ESI)m/zcalcd.for C ₂₄ H ₁₆ F ₂ N ₆ [M+H] ⁺ 427.1405,found 427.1478。

Example 44

6- (5- (4-fluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carboxamide (Compound 44)

Compound 42 (60 mg,0.140 mmol) and potassium carbonate (10 mg,00.07 mmol) were taken in DMSO (5 mL) and 30% aqueous hydrogen peroxide (0.155 mmol,16 uL) was slowly added under ice-bath conditions. Stirring at room temperature overnight, and diluting with water after TLC detection(10 mL) the reaction solution, ethyl acetate (15 ml×3) extracted the aqueous phase, the organic phases were combined, and the organic phase was washed three times with saturated brine (10 ml×3), dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=20:1) to give compound 44 as a white solid (40 mg, yield 64%). ¹ H NMR(300MHz,MeOH-d ₄ )δ9.50(s,1H),8.64(s,1H),8.25(s,1H),7.67(d,J＝9.4Hz,1H),7.57(d,J＝9.3Hz,1H),7.49(dd,J＝8.6,5.4Hz,2H),7.13(dt,J＝15.0,8.4Hz,3H),6.52(d,J＝8.3Hz,1H),6.44(d,J＝11.8Hz,1H),6.36(t,J＝8.4Hz,1H),4.48(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₈ F ₂ N ₆ O.[M+H] ⁺ 445.1510,found 445.1587。

Example 45

6- (2- ((3-chlorophenyl) amino) methyl) -5- (4-fluorophenyl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (Compound 45)

Referring to the procedure of example 42, compound 45 was prepared by substituting m-chloroaniline for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.64(s,1H),8.25(s,1H),7.67(d,J＝9.2Hz,1H),7.57(d,J＝9.5Hz,1H),7.53–7.41(m,2H),7.13(dt,J＝15.9,8.3Hz,3H),6.74(s,1H),6.64(d,J＝7.9Hz,2H),4.44(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₆ ClFN ₆ [M+H] ⁺ 443.1109,found443.1181。

Example 46

6- (2- ((3-cyanophenyl) amino) methyl) -5- (4-fluorophenyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 46)

Referring to the procedure of example 42, compound 46 was prepared by substituting m-aminobenzonitrile for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.64(s,1H),8.25(s,1H),7.68(d,J＝9.3Hz,1H),7.60(d,1H),7.49(t,2H),7.29(t,J＝8.2Hz,1H),7.17(t,J＝8.1Hz,2H),6.99(t,J＝12.4Hz,3H),4.51(s,2H)。HRMS(ESI)calcd.for C ₂₅ H ₁₆ FN ₇ .[M+H] ⁺ 434.1109,found 434.1524。

Example 47

6- (2- ((3-chlorophenyl) amino) methyl) -5- (4-fluorophenyl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 47)

Referring to the procedure of example 42, compound 47 was prepared by substituting m-chloroaniline for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.65(s,1H),8.27(s,1H),7.63(d,J＝9.5Hz,1H),7.48(dd,J＝17.1,9.0Hz,3H),7.23–6.99(m,3H),6.75(s,1H),6.65(d,J＝7.7Hz,2H),4.46(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₈ ClFN ₆ O.[M+H] ⁺ 461.1215,found 4461.1286。

Example 48

6- (2- ((2-chlorophenyl) amino) methyl) -5- (4-fluorophenyl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (compound 48)

Referring to the procedure of example 42, compound 48 was prepared by substituting o-fluoroaniline for o-chloroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.65(s,1H),8.27(s,1H),7.63(d,J＝9.5Hz,1H),7.48(dd,J＝17.1,9.0Hz,3H),7.23–6.99(m,3H),6.75(s,1H),6.65(d,J＝7.7Hz,2H),4.46(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₆ ClFN ₆ [M+H] ⁺ 461.1215,found 461.1286。

Example 49

6- (2- ((2-chlorophenyl) amino) methyl) -5- (4-fluorophenyl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 49)

Referring to the procedure of example 44, compound 49 was prepared by substituting m-chloroaniline for o-chloroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.65(s,1H),8.27(s,1H),7.63(d,J＝9.5Hz,1H),7.48(dd,J＝17.1,9.0Hz,3H),7.23–6.99(m,3H),6.75(s,1H),6.65(d,J＝7.7Hz,2H),4.46(s,2H)。HRMS(ESI)m/z calcd.for C ₂₄ H ₁₆ ClFN ₆ [M+H] ⁺ 461.1215,found 461.1286。

Example 50

6- (5- (4-fluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-b ] pyridazine-3-carbonitrile (Compound 50)

3-amino-6-chloropyridazine (5 g,38.59 mmol) was dissolved in N, N-dimethylformamide dimethyl acetal (30 mL), heated to 80℃and stirred under reflux for 3 hours, after TLC indicated the completion of the reaction, the solvent N, N-dimethylformamide dimethyl acetal was distilled off under reduced pressure, and then N-hexane (20 mL) was added to slurry overnight, and the cake was washed three times with N-hexane (15 mL. Times.3), and a white solid (7 g, yield 98%) of intermediate 50-1 was obtained by suction filtration.

Intermediate 50-1 (6 g,32.497 mmol), bromoacetonitrile (7.8 g,48.74 mmol), sodium bicarbonate (5.46 g,65 mmol) and potassium iodide (500 mg,3.25 mmol) were taken in isopropanol (20 mL) and warmed to 50 ℃. After completion of the reaction by TLC, the solvent was distilled off under reduced pressure, diluted with ethyl acetate (30 mL), and the reaction mixture was washed with water (20 mL. Times.3) three times and dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure and the product was purified by column chromatography (petroleum ether/ethyl acetate=15:1). The product was dried under infrared conditions to give intermediate 50-2 as a pale yellow solid (6.2 g, 100% yield).

Intermediate 50-2 (100 mg,0.56 mmol), 4-fluorophenylacetylene (100.9 mg,0.84 mmol) and cuprous iodide (11 mg,0.056 mmol) were taken and ditriphenylphosphine palladium dichloride (12 mg,0.0168 mmol) was placed in anhydrous acetonitrile (10 mL). Diisopropylamine (100.72 mg,1.008 mmol) was added slowly over 15 minutes. After the reaction was completed by TLC, the mixture was filtered through celite, and the cake was washed three times with ethyl acetate (10 mL. Times.3). The mother liquor was collected and washed three times with saturated brine (15 mL. Times.3). The organic phase was collected, dried over anhydrous sodium sulfate, concentrated, and chromatographed (petroleum ether/ethyl acetate=1:1) to give intermediate 50-3 as a tan solid (100 mg, 65% yield).

Intermediate 50-3 (200 mg,0.763 mmol) and palladium dichloride (13 mg,0.0763 mmol) were dissolved in anhydrous DMSO (10 mL), heated to 140℃and heated under reflux under argon atmosphere for 10 hours. After completion of the TLC detection, the reaction mixture was suction-filtered through celite, the filter cake was washed three times with ethyl acetate (15 mL. Times.3), and the mother liquor was washed three times with saturated brine (15 mL. Times.3), and the organic phase was dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, and the product was purified by column chromatography to give 50-4 (150 mg, yield 67%) as a yellow solid of the compound.

A mixed solution of intermediate 50-4 (460 mg,1.57 mmol), glyoxal-1, 1-dimethyl acetal (325.5 mg,3.13 mmol) and ammonium acetate (241.3 mg,3.13 mmol) in tetrahydrofuran (10 mL) and methanol (10 mL) was stirred at room temperature for 4 hours. After the completion of the TLC detection reaction, ethyl acetate (30 mL) was added to dilute the reaction solution, and the mixture was washed three times with saturated brine (25 ml×3), dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure, followed by purification by column chromatography (dichloromethane/methanol=50:1). An off-white solid (500 mg, 84% yield) of compound 50-5 was obtained.

Compound 50-5 (500 mg,8.4 mmol) was dissolved in 1N HCl (25 mL) in water, warmed to 70℃and stirred for 30 min, after TLC indicated the end of the reaction, the reaction was cooled to room temperature and saturated sodium bicarbonate (20 mL) was pH adjusted to weak base. The white solid precipitated, was suction filtered, and the filter cake was washed with water (20 mL. Times.3) three times and dried under infrared conditions to give intermediate 50-6 as a yellow solid (400 mg, 76% yield).

Compound 50-6 (150 mg,0.45 mmol) and o-fluoroaniline (106.65 mg,0.90 mmol) were dissolved in dichloroethane (10 mL) and 20uL of acetic acid was added. After the completion of the TLC detection at 70℃and the temperature was raised, the solvent was distilled off under reduced pressure, the residue was diluted with ethyl acetate (15 mL), and the organic phase was washed three times with saturated brine (15 mL. Times.3), dried over anhydrous sodium sulfate and distilled off under reduced pressure to give intermediate 50-7 as a brown solid (150 mg).

Crude intermediate 50-7 (150 mg,0.35 mmol) was taken and dissolved in a mixture of tetrahydrofuran (5 mL) and methanol (5 mL), sodium borohydride (68 mg,1.8 mmol) was added in portions under ice-bath conditions, after TLC detection, the reaction was diluted with ethyl acetate (20 mL) and the organic phase was washed three times with water (10 mL x 3), dried over anhydrous sodium sulfate and the product purified by column chromatography (dichloromethane/methanol=30:1). Compound 50 was obtained as a white solid (90 mg, 46% in two steps). ¹ H NMR(300MHz,MeOH-d ₄ )δ8.29(s,1H),8.10(t,2H),7.76(t,2H),7.19(t,J＝8.8Hz,2H),6.97(dd,J＝7.6Hz,2H),6.84(t,J＝8.0Hz,1H),6.67(q,1H),4.57(s,2H)。

Example 51

6- (5- (4-fluorophenyl) -2- ((3-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-b ] pyridazine-3-carbonitrile (Compound 51)

Referring to the procedure of example 50, compound 51 was prepared by substituting m-fluoroaniline for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.29(s,1H),8.12(d,2H),7.79(t,2H),7.31–7.01(m,3H),6.61–6.30(m,3H),4.47(s,2H)。

Example 52

6- (5- (4-fluorophenyl) -2- (((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-b ] pyridazine-3-carboxamide (Compound 52)

Compound 50 (60 mg,0.140 mmol) and potassium carbonate (10 mg,0.07 mmol) were dissolved in DMSO (5 mL) and 30% aqueous hydrogen peroxide (0.17 mmol,20 uL) was added under ice-bath. Stirring overnight, after TLC detection reaction is finished, stirring overnight at room temperature, TLC detectionAfter completion of the reaction, the reaction mixture was diluted with water (10 mL), the aqueous phase was extracted with ethyl acetate (15 ml×3), the organic phases were combined, washed three times with saturated brine (10 ml×3), dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=20:1) to give compound 52 as a white solid (40 mg, yield 64%). ¹ H NMR(300MHz,MeOH-d ₄ )δ8.27(s,1H),8.15(d,J＝8.1Hz,1H),7.95(s,1H),7.53(t,2H),7.21(t,J＝8.7Hz,2H),6.99(dd,J＝12.9,7.2Hz,2H),6.82(t,J＝7.7Hz,1H),6.76–6.58(m,1H),4.57(s,2H)。

Example 53

6- (5- (4-fluorophenyl) -2- ((3-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-b ] pyridazine-3-carboxamide (Compound 53)

Referring to the procedure of example 52, compound 53 was prepared by substituting m-fluoroaniline for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.27(s,1H),8.16(t,1H),7.95(s,1H),7.66–7.42(m,2H),7.16(dd,J＝30.2Hz,3H),6.76–6.08(m,3H),4.49(s,2H).

Example 54

6- (5- (4-fluorophenyl) -2- (((3-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-b ] pyridazine-3-carboxylic acid ethyl ester (Compound 54)

3-amino-6-chloropyridazine (5 g,38.59 mmol) was dissolved in N, N-dimethylformamide dimethyl acetal (30 mL), warmed to 80 ℃, heated under reflux and stirred for 3 hours, after TLC indicated that the reaction was complete, the solvent was distilled off under reduced pressure, N-hexane (20 mL) was added to slurry overnight, and a white solid (7 g, yield 98%) of intermediate 54-1 was filtered off with suction.

Intermediate 54-1 (3 g,16.25 mmol), ethyl bromoacetate (4.07 g,24.37 mmol), sodium bicarbonate (2.73 g,32.5 mmol), potassium iodide (264 mg,1.625 mmol) were taken in DMF (20 mL) and warmed to 65 ℃. After stirring for 3h and completion of the TLC detection, the solvent was distilled off under reduced pressure, ethyl acetate was diluted (30 mL), the reaction solution was washed with water (20 mL. Times.3) three times, dried over anhydrous sodium sulfate, filtered, the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (petroleum ether/ethyl acetate=15:1). The product was dried under infrared conditions to give intermediate 54-2 as a pale yellow solid (2.79 g, 80% yield).

Intermediate 54-2 (1.38 g,6.12 mmol), 4-fluorophenylacetylene (882 mg,7.33 mmol) and cuprous iodide (117 mg,0.612 mmol) and bis triphenylphosphine palladium dichloride (130 mg,0.184 mmol) were taken in anhydrous DMF (20 mL). Diisopropylamine (1.25 g,12.24 mmol) was added slowly over 15 minutes. After the reaction was completed by TLC, the mixture was filtered through celite, and the cake was washed three times with ethyl acetate (10 mL. Times.3). The mother liquor was collected and washed three times with saturated brine (15 mL. Times.3). The organic phase was dried over anhydrous sodium sulfate and concentrated by column chromatography (petroleum ether/ethyl acetate=5:1) to give intermediate 54-3 as a tan solid (1.12 g, 86% yield).

Intermediate 54-3 (1.12 g,3.62 mmol) and palladium dichloride (64 mg,0.362 mmol) were taken in anhydrous DMSO (20 mL), warmed to 140℃and heated under reflux under argon atmosphere for 10 hours. After completion of the TLC detection reaction, the reaction solution was suction-filtered through celite, the filter cake was washed three times with ethyl acetate (15 mL. Times.3), the mother liquor was collected, the mother liquor was washed three times with saturated brine (15 mL. Times.3), and the organic phase was dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, and the product was purified by column chromatography (petroleum ether/ethyl acetate=1:1) to give intermediate 54-4 as a pale brown solid (650 mg, yield 52%).

A mixed solution of intermediate 54-4 (650 mg,1.9 mmol), glyoxal-1, 1-dimethyl acetal (297.4 mg,2.86 mmol) and ammonium acetate (293 mg,3.8 mmol) in tetrahydrofuran (10 mL) and methanol (10 mL) was taken and stirred at room temperature for 4 hours. After completion of the TLC detection, ethyl acetate (30 mL) was added to dilute the reaction solution, which was washed three times with saturated brine (25 ml×3), dried over anhydrous sodium sulfate, filtered, and the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=100:1). Intermediate 54-5 was obtained as an off-white solid (530 mg, 72% yield).

Intermediate 54-5 (530 mg,1.24 mmol) was dissolved in 1N HCl (25 mL) in water, warmed to 70 ℃, heated under reflux, stirred for 30 min, after TLC indicated the reaction was complete, the reaction was cooled to room temperature and saturated sodium bicarbonate (20 mL) was adjusted to weak base pH. The white solid precipitated, was suction filtered, and the filter cake was washed with water (20 mL. Times.3) three times and dried under infrared conditions to give intermediate 54-6 as a yellow solid (385 mg, 82% yield).

Compound 54-6 (100 mg,0.264 mmol) and o-fluoroaniline (62.29 mg,0.53 mmol) were dissolved in dichloroethane (10 mL) and 20uL of acetic acid was added. After the completion of the TLC detection reaction, the solvent was distilled off under reduced pressure, diluted with ethyl acetate (15 mL), and the organic phase was washed three times with saturated brine (15 mL. Times.3), dried over anhydrous sodium sulfate, and distilled off under reduced pressure to give a brown solid (110 mg) of intermediate 54-7.

Crude intermediate 54-7 (110 mg,0.23 mmol) was taken and dissolved in a mixture of tetrahydrofuran (5 mL) and methanol (5 mL), sodium borohydride (40 mg,1.056 mmol) was added in portions under ice-bath, after the TLC detection reaction was completed, the reaction was diluted with ethyl acetate (20 mL), the organic phase was washed with water (10 ml×3) three times, dried over anhydrous sodium sulfate, and the product was purified by column chromatography (dichloromethane/methanol=30:1) to give compound 54 as a white solid (78 mg, 79% in two steps). ¹ H NMR(300MHz,MeOH-d ₄ )δ8.33(s,1H),8.13–7.63(m,2H),7.22(d,J＝28.8Hz,1H),7.04–6.87(m,1H),6.83(t,1H),6.66(q,J＝5.2Hz,1H),4.34(q,2H),1.36(t,3H)。

Example 55

6- (5- (4-fluorophenyl) -2- (((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-b ] pyridazine-3-carboxamide (Compound 55)

/>

Compound 54 (104 mg,0.227 mmol) and hydrazine hydrate (45 mg,0.227 mmol) were dissolved in ethanol, and heated to 80℃and refluxed for 4 hours. After the TLC detection reaction is finished, the solvent is distilled off under reduced pressure, anhydrous diethyl ether (5 mL) is pulped, suction filtration is carried out, and a filter cake is dried by infrared. Compound 55 was obtained as a white solid (100 mg, yield 95%). ¹ H NMR(300MHz,MeOH-d ₄ )δ8.37–8.07(m,2H),7.88(d,J＝9.3Hz,1H),7.66(t,2H),7.26(dd,J＝19.0,10.2Hz,2H),7.14–6.95(m,2H),6.87(t,J＝8.9Hz,1H),6.61(s,1H),4.44(s,2H)。

Example 56

6- (2- (((3-chlorophenyl) amino) methyl) -5- (4-fluorophenyl) -1H-imidazol-4-yl) imidazo [1,2-b ] pyridazine-3-carboxylic acid ethyl ester (Compound 56)

Referring to the procedure of example 54, compound 56 was prepared by substituting m-chloroaniline for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.45–8.18(m,2H),8.08(d,2H),7.95(d,J＝9.3Hz,1H),7.24(q,2H),7.10(q,1H),6.77(s,1H),6.65(q,1H),4.37(s,2H),4.30(q,J＝6.3Hz,2H),1.26(t,3H)。

Example 57

6- (2- (((4-chlorophenyl) amino) methyl) -5- (4-fluorophenyl) -1H-imidazol-4-yl) imidazo [1,2-b ] pyridazine-3-carboxylic acid ethyl ester (Compound 57)

Referring to the procedure of example 54, compound 57 was prepared by substituting p-chloroaniline for o-fluoroaniline. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.40–8.19(m,2H),8.09(q,2H),7.93(d,1H),7.23(t,J＝8.8Hz,2H),7.12(d,J＝8.3Hz,2H),6.73(d,J＝8.5Hz,2H),4.35(s,2H),4.29(q,2H),1.27(t,J＝13.8,6.9Hz,3H)。

Example 58

6- (5- (4-fluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) -N-hydroxyimidazo [1,2-a ] pyridine-3-carboxamide (Compound 58)

Compound 42 (80 mg,0.18 mmol) and hydroxylamine hydrochloride (14.34 mg,0.206 mmol) were dissolved in ethanol (10 mL), followed by dropwise addition of N, N-diisopropylamine (50 uL,0.282 mmol). Stirring at normal temperature for 4 hours, and adding water to dilute the reaction solution after TLC detection reaction is finished. Ethyl acetate (15 ml×3) and methanol (5 ml×3) were extracted three times, the organic phase was separated, dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the product was purified by post column chromatography (dichloromethane/methanol=30:1) to give compound 58 as a white solid (75 mg, yield 91%). ¹ H NMR(300MHz,MeOH-d ₄ )δ9.50(s,1H),8.01(s,1H),7.57(d,J＝9.3Hz,1H),7.45(dd,J＝8.7,5.3Hz,2H),7.36(d,J＝9.3Hz,1H),7.11(t,J＝8.8Hz,2H),7.04–6.93(m,2H),6.81(t,J＝7.8Hz,1H),6.66(dd,J＝11.9,7.0Hz,1H),4.55(s,2H)。

Example 59

6- (5- (-fluorophenyl) -2- ((3-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) -N-hydroxyimidazo [1,2-a ] pyridine-3-carboxamide (compound 59)

Referring to the procedure of example 58, the substitution of o-fluoroaniline for m-fluoroaniline produced compound 59. ¹ H NMR(300MHz,MeOH-d ₄ )δ9.50(s,1H),8.00(s,1H),7.57(d,J＝9.3Hz,1H),7.46(dd,J＝8.7,5.4Hz,2H),7.19–7.03(m,3H),6.52(d,J＝8.1Hz,1H),6.44(d,J＝11.8Hz,1H),6.37(t,J＝8.6Hz,1H),4.47(s,2H)。

Example 60

N- ((6- (4- (4-fluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-5-yl) imidazo [1,2-a ] pyridin-3-yl) methyl) acetamide (Compound 60)

Intermediate 42-5 (30 mg,0.079 mmol) and butyric anhydride (16 mg,0.158 mmol) were taken and dissolved in methanol (4 mL). Sodium borohydride (9 mg,0.237 mmol) was added in portions and nickel chloride (20 mg,0.079 mmol) was added in portions under ice-bath conditions. The solution was gradually changed from black to pale yellow, stirred for 30 minutes, and after completion of the reaction by TLC, 15mL of water was added to dilute the reaction solution. The organic phase was extracted three times with ethyl acetate (15 ml×3) and methanol (5 ml×3), separated, the organic phase was collected, dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=30:1) to give intermediate 60-1 as a white solid (20 mg, yield 64%).

Intermediate 60-1 (105 mg,0.25 mmol) was dissolved in 1N aqueous HCl and heated to 70℃and refluxed for 30 minutes. After completion of TLC detection, a saturated sodium carbonate solution (5 mL) was added to adjust the pH to 8, the mixture was extracted three times with ethyl acetate (15 mL. Times.3) and methanol (5 mL. Times.3), the liquid was separated, the organic phase was collected, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to give crude intermediate 60-2 as a white solid (100 mg, yield 100%).

Intermediate 60-2 (50 mg,0.132 mmol), o-fluoroaniline (29.4 mmol,0.265 mmol) was dissolved in dichloroethane (10 mL) and acetic acid 20uL was added. After the completion of the TLC detection, the temperature was slowly raised to 70℃and the solvent was distilled off under reduced pressure, diluted with ethyl acetate (15 mL), and the organic phase was washed three times with saturated brine (15 mL. Times.3), dried over anhydrous sodium sulfate and distilled off under reduced pressure to give intermediate 60-3 as a brown solid (75 mg).

A crude intermediate 60-3 (75 mg,0.123 mmol) was dissolved in a mixture of tetrahydrofuran (5 mL) and methanol (5 mL), sodium borohydride (20 mg,0.528 mmol) was added in portions under ice-bath conditions, after completion of TLC detection, the reaction solution was diluted with ethyl acetate (20 mL), the organic phase was washed with water (10 mL. Times.3) three times, dried over anhydrous sodium sulfate, and the product was purified by column chromatography (dichloromethane/methanol=30:1). Compound 60 (40 mg, 64% yield in two steps) was obtained. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.50(s,1H),7.64–7.41(m,5H),7.33(d,J＝9.4Hz,1H),7.10(t,J＝8.5Hz,2H),6.97(t,J＝8.2Hz,2H),6.83(t,J＝7.9Hz,1H),6.66(q,J＝5.2Hz,1H),4.66(s,2H),4.54(s,2H),1.93(s,3H)。

Example 61

N- ((6- (2- ((3-cyanophenyl) amino) methyl) -4- (4-fluorophenyl) -1H-imidazol-5-yl) imidazo [1,2-a ] pyridin-3-yl) methyl) acetamide (Compound 61)

Referring to the procedure of example 60, the substitution of o-fluoroaniline with m-aminobenzonitrile produced compound 61. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.49(s,1H),7.77–7.40(m,5H),7.31(t,2H),7.21–6.77(m,5H),4.67(s,2H),4.50(s,2H),1.89(s,3H)。

Example 62

N- ((4- (3- (1, 2, 4-oxadiazol-3-yl) imidazo [1,2-a ] pyridin-6-yl) -5- (4-fluorophenyl) -1H-imidazol-2-yl) methyl) -2-fluoroaniline (Compound 62)

Compound 59 (90 mg,0.196 mmol) was taken and dissolved in triethyl orthoformate (5 mL), 20uL of trifluoroacetic acid was added, the temperature was raised to 80 ℃, stirring was carried out for 3.5 hours, after the completion of TLC detection reaction, the reaction solution was diluted with ethyl acetate (20 mL), the reaction solution was washed with water (10 ml×3) three times, the organic phase was collected, dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (dichloromethane/methanol=30:1). Compound 62 was obtained as a white solid (80 mg, yield 87%). ¹ H NMR(300MHz,DMSO-d ₆ )δ9.75(s,1H),9.23(s,1H),8.42(dd,J＝41.4,33.7Hz,2H),7.95–7.60(m,2H),7.46(d,J＝8.7Hz,3H),7.40(d,J＝6.6Hz,1H),7.34–7.18(m,3H),7.10(t,J＝8.5Hz,1H),5.00(s,2H)。

Example 63

N- ((6- (5- (4-fluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridin-3-yl) methyl) isobutyramide (Compound 63)

Intermediate 42-5 (150 mg,0.40 mmol) and isobutyric anhydride (125 mg,0.795 mmol) were taken in methanol (4 mL). Sodium borohydride (45.4 mg,1.2 mmol) was added and nickel chloride (104 mg,0.8 mmol) was added in portions under ice-bath conditions. The solution gradually changed from black to light yellow. After stirring for 30 minutes and completion of the TLC detection, the reaction mixture was diluted with water. The organic phase was extracted three times with ethyl acetate (15 ml×3) and methanol (5 ml×3), separated, the organic phase was collected, dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=30:1) to give intermediate 63-1 as a white solid (100 mg, yield 55%).

Intermediate 63-1 (100 mg,0.22 mmol) was dissolved in 1N aqueous HCl and heated to 70℃under reflux for 30 min. After completion of TLC detection, a saturated sodium carbonate solution (5 mL) was added to adjust the pH to 8, the organic phase was extracted three times with ethyl acetate (15 mL. Times.3) and methanol (5 mL. Times.3), the organic phase was separated, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to give a crude intermediate 63-2 as a white solid (80 mg, yield 100%).

Crude intermediate 63-2 (80 mg, 0.197mmol) was taken, o-fluoroaniline (43 mg, 0.390 mmol) was dissolved in dichloroethane (10 mL) and 20uL of acetic acid was added. After the completion of the TLC detection, the temperature was raised to 70℃and the solvent was distilled off under reduced pressure, diluted with ethyl acetate (15 mL), and the organic phase was washed three times with saturated brine (15 mL. Times.3), dried over anhydrous sodium sulfate and distilled off under reduced pressure to give intermediate 63-3 as a brown solid (75 mg).

Crude intermediate 63-3 (75 mg,0.150 mmol) was taken and dissolved in a mixture of tetrahydrofuran (5 mL) and methanol (5 mL), sodium borohydride (17 mg,0.450 mmol) was added in portions under ice-bath conditions, after TLC detection, the reaction was diluted with ethyl acetate (20 mL) and the organic phase was washed with water (10 ml×3) three times, dried over anhydrous sodium sulfate and the product purified by column chromatography (dichloromethane/methanol=30:1). Compound 63 was obtained as a white solid (40 mg, 41% yield in two steps). ¹ H NMR(300MHz,MeOH-d ₄ )δ8.48(s,1H),7.62–7.39(m,4H),7.30(d,J＝9.3Hz,1H),7.10(t,J＝8.8Hz,2H),6.99(dd,J＝13.3,5.6Hz,2H),6.82(t,J＝8.1Hz,1H),6.67(t,1H),4.67(s,2H),4.54(s,2H),2.40(dt,J＝13.9,7.8Hz,1H),1.01(s,J＝17.9Hz,6H)。

Example 64

N- ((6- (5- (4-fluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridin-3-yl) methyl) pivalamide (Compound 64)

Referring to the procedure of example 63, the replacement of isobutyric anhydride with pivalic anhydride produced compound 64. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.53(s,1H),7.59–7.37(m,4H),7.28(d,J＝9.3Hz,1H),7.09(t,J＝8.7Hz,2H),7.04–6.92(m,2H),6.82(t,J＝8.2Hz,1H),6.66(q,1H),4.66(s,2H),4.54(s,2H),1.11(s,9H)。

Example 65

Methyl ((6- (5- (4-fluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridin-3-yl) methyl carbamate (compound 65)

Referring to the procedure of example 63, the replacement of isobutyric anhydride with dimethyl pyrocarbonate produced compound 65. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.49(s,1H),7.62–7.42(m,4H),7.31(d,J＝9.5Hz,1H),7.10(t,J＝8.7Hz,2H),6.99(t,J＝9.1Hz,2H),6.82(t,J＝8.0Hz,1H),6.66(d,J＝5.4Hz,1H),4.59(s,2H),4.54(s,2H),3.61(s,3H)。

Example 66

N- ((6- (5- (4-fluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridin-3-yl) methyl) propanamide (Compound 66)

Referring to the procedure of example 63, the replacement of isobutyric anhydride with propionic anhydride produced compound 66. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.46(s,1H),7.67–7.39(m,4H),7.30(d,J＝8.4Hz,1H),7.09(t,J＝8.5Hz,2H),6.98(t,J＝8.1Hz,2H),6.82(t,J＝8.2Hz,1H),6.66(q,1H),4.66(s,2H),4.53(s,2H),2.13(dd,J＝15.0,7.4Hz,2H),1.06(t,J＝7.5Hz,3H)。

Example 67

6- (2- ((2-fluorophenyl) amino) methyl) -5-phenyl-1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 67)

Referring to the procedure of example 42, the substitution of p-fluorophenylacetylene for phenylacetylene produced compound 67. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.65(s,1H),8.25(s,1H),7.63(dd,J＝20.4,9.5Hz,2H),7.53–7.33(m,4H),7.00(dd,J＝13.4,5.6Hz,2H),6.83(t,J＝8.1Hz,1H),6.71–6.60(m,1H),4.56(s,2H)。

Example 68

6- (2- ((2-fluorophenyl) amino) methyl) -5-phenyl-1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carboxylic acid (compound 68)

Compound 67 (130 mg,0.318 mmol) and potassium carbonate (22 mg, 0.1599 mmol) were taken in DMSO (5 mL) and 30% aqueous hydrogen peroxide (0.382 mmol,39 uL) was slowly added under ice-bath. After completion of the reaction by TLC detection, the reaction mixture was stirred overnight at room temperature, diluted with water (10 mL), the aqueous phase was extracted with ethyl acetate (15 ml×3), the organic phases were combined, washed three times with saturated brine (10 ml×3), dried over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=20:1) to give an off-white solid of compound 68 (120 mg, yield 88%). ¹ H NMR(300MHz,MeOH-d ₄ )δ9.68(s,1H),8.27(s,1H),7.60(d,J＝9.3Hz,1H),7.46(dd,J＝15.9,8.4Hz,2H),7.35(dd,J＝14.7,7.0Hz,3H),6.99(t,J＝8.2Hz,2H),6.83(t,J＝8.4Hz,1H),6.66(t,1H),4.54(s,2H)。

Example 69

6- (5- (3-chloro-4-fluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carbonitrile (compound 69)

Referring to the synthesis of compound 1, 2-bromo-6-methylpyridine was replaced with 2-chloro-1-fluoro-4-iodobenzene to afford compound 69. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.74–8.59(m,1H),8.28(s,1H),7.66(dd,J＝19.7,8.2Hz,2H),7.54(d,J＝9.2Hz,1H),7.39(dd,J＝7.6,5.5Hz,1H),7.27(t,J＝8.8Hz,1H),7.05–6.92(m,2H),6.80(t,J＝8.5Hz,1H),6.72–6.58(m,1H),4.56(s,2H)。

Example 70

6- (5- (3-chloro-4-fluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazole [1,2-a ] pyridine-3-carboxamide (Compound 70)

Compound 69 (100 mg,0.217 mmol) and potassium carbonate (15 mg,0.108 mmol) were placed in DMSO (5 mL) and 30% aqueous hydrogen peroxide (0.238 mmol,27 uL) was slowly added under ice-bath conditions. After completion of the TLC detection reaction, the reaction mixture was diluted with water (10 mL), the aqueous phase was extracted with ethyl acetate (15 ml×3), the organic phases were combined, washed three times with saturated brine (10 ml×3), dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure, and the product was purified by column chromatography (dichloromethane/methanol=20:1) to give an off-white solid of compound 70 (79.8 mg, yield 77%). ¹ H NMR(300MHz,MeOH-d ₄ )δ9.66(s,1H),8.29(s,1H),7.70–7.41(m,3H),7.39–7.28(m,1H),7.21(t,J＝8.9Hz,1H),7.04–6.89(m,2H),6.80(t,J＝8.2Hz,1H),6.65(t,J＝4.3Hz,1H),4.54(s,2H)。

Example 71

6- (5- (3, 4-difluorophenyl) -2- ((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carbonitrile (compound 71)

Referring to the synthesis of compound 42, compound 71 was prepared by replacing 4-fluorophenylacetylene with 3, 4-difluorophenylacetylene. ¹ H NMR(300MHz,MeOH-d ₄ )δ8.65(s,1H),8.26(s,1H),7.70(d,J＝9.3Hz,1H),7.54(d,1H),7.47–7.36(m,1H),7.28(d,J＝17.1Hz,2H),7.07–6.91(m,2H),6.81(t,J＝8.2Hz,1H),6.66(d,J＝4.7Hz,1H),4.56(s,2H)。

Example 72

6- (5- (3, 4-difluorophenyl) -2- (((2-fluorophenyl) amino) methyl) -1H-imidazol-4-yl) imidazo [1,2-a ] pyridine-3-carboxamide (compound 72)

Synthesis of reference Compound 68 yields Compound 72. ¹ HNMR(300MHz,MeOH-d ₄ )δ9.65(s,1H),8.29(s,1H),7.66(d,J＝9.3Hz,1H),7.52(d,J＝9.3Hz,1H),7.44–7.32(m,1H),7.31–7.16(m,2H),6.99(dd,J＝13.3,5.6Hz,2H),6.81(t,J＝8.4Hz,1H),6.65(dd,J＝12.5,7.3Hz,1H),4.54(s,2H)。

Example 73

Inhibitory Activity of Compounds on ALK5 kinase

The purpose of the experiment is as follows: test compounds for ALK5 kinase inhibitory Activity and calculate IC using ADP-Glo method ₅₀ Values, vactoservib (EW-7197) was used as a positive control compound (see J. Med. Chem.2014,57,4213-4238 for synthetic procedure reference).

The experimental method comprises the following steps: 1) Preparing a storage solution: the compound was dissolved in 100% dmso to prepare a 10mM stock solution, which was stored in the dark. 2) 1 XKinase buffer was prepared. 3) Preparing a compound concentration gradient: the test compounds were tested at an initial concentration of 1. Mu.M, 3-fold dilution, 10 concentrations, single well test. 100% DMSO solutions were diluted to 100-fold final concentration in 384 well plates. Transfer compound wells of 50nL to 384 well plates using a dispenser Echo 550; 50nL of DMSO was added to each of the negative control wells and the positive control wells. A2-fold final concentration of Kinase solution was prepared using a 1 XKinase buffer. 2.5. Mu.L of kinase solution with a final concentration of 2 times was added to each of the compound wells and the positive control wells; 2.5. Mu.L of 1 XKinase buffer was added to the negative control wells. Centrifuge at 1000rpm for 30 seconds, mix well with shaking and incubate at room temperature for 10 minutes. A2-fold final concentration of ATP solution was prepared using a 1 XKinase buffer. 2.5. Mu.L of ATP solution at a final concentration of 2-fold was added to initiate the reaction. The 384-well plate was centrifuged at 1000rpm for 30 seconds, and incubated at room temperature for 120 minutes after shaking and mixing. Add 5. Mu.LADP-Glo Reagent, centrifuge at 1000rpm for 30 seconds, mix well with shaking and incubate at room temperature for 120 minutes. 10 mu LKinase Detection Reagent was added, centrifuged at 1000rpm for 30 seconds, and incubated at room temperature for 30 minutes after shaking and mixing. Read with Envision.

Experimental results: the log value of the concentration is taken as an X axis, the percent inhibition rate is taken as a Y axis, and a log (inhibitor) vs. response-Variable slope fit quantitative effect curve of analysis software GraphPad Prism 5 is adopted, so that the IC of each compound on the enzyme activity is obtained ₅₀ Values, partial results are shown in table 1.

Table 1 inhibitory Activity of Compounds against ALK5 kinase

/>

/>

/>

/>

The experimental result shows that the compound synthesized by the invention has obvious inhibition effect on ALK 5. Meanwhile, the activity is equivalent to that of EW7197, which shows that the compound has potential therapeutic effect on diseases caused by over-expression of ALK5 and has good development potential and market prospect.

Example 74

Effect of Compounds on Col1a1 Gene expression in LX-2 cells under TGF-beta Induction

The purpose of the experiment is as follows: the effect of the compound on Col1a1 gene expression in LX-2 cells under TGF-beta induction was examined by RT-qPCR using Vactoservib (EW-7197) as a positive control compound.

The experimental method comprises the following steps: LX-2 cells were placed in DMEM complete medium (containing 10% fetal bovine serum and 1% streptomycin/penicillin) in the presence of 5% CO ₂ Is cultured in an incubator at 37 ℃.

Primer sequence Col1a1: F: GTGCGATGACGTGATCTGTGA; r is CGGTGGTTTCTTGGTCGGT. GAPDH, F, GGAGCGAGATCCCTCCAAAT; r is GGCTGTTGTCATACTTCTCATGG.

In a 12-well plate, cells with a proportion of viable cells of 90% or more were taken for the experiment. LX-2 cells were plated at 20 ten thousand wells and placed in 5% CO ₂ Is cultured in an incubator at 37 ℃. After 18-24 hours, the original medium was discarded, the cells were washed 1 time with 1mL of sterile PBS, and complete medium containing the appropriate concentration of the compound and 10ng/mL of TGF-beta was added, with the final concentration of the test compound set to 1, 0.1. Mu.M, and the administration time was 12 hours. RNA was then extracted, reverse transcribed into cDNA, and RT-qPCR was performed to detect changes in Col1a1 gene expression. The experimental results are shown in FIG. 1.

The experimental results (FIG. 1) show that compounds 3, 4, 5, 6, 7, 8 and 9 can reduce the relative expression of Col1a1 genes, and the inhibition effect of the compounds on the relative expression of the Col1a1 genes at 0.1 mu M is superior to that of a positive control compound EW7197. In addition, the compound has obvious inhibition effect on Col1a1 gene expression in LX-2 cells under the induction of TGF-beta, and the gene is a remarkable marker of fibroblast over-expression in pulmonary fibrosis diseases, which indicates that the compound can have prevention and treatment effect on the fibrosis diseases to a certain extent, especially the pulmonary fibrosis diseases.

Example 75

Inhibitory Activity of Compounds against TGF-beta downstream Smad Signal pathway

The purpose of the experiment is as follows: detection of Compound inhibition Activity on TGF-beta stimulated HepG2 cells Using luciferase method, calculation of IC thereof ₅₀ Values, vactoservib (EW-7197) was used as positive control compound.

The experimental method comprises the following steps: human liver cancer HepG2 cells were collected and cell density was adjusted to 7.5X10 with MEM medium containing 10% FBS ⁵ 1 mL/mL was added to a 60mm cell culture dish. After overnight incubation, the reagent Lipo was transfected according to plasmid SBE-Luc (Beyotidme, product number: C0526-1.5 ml) ^M 6000 as 1 (5. Mu.g) and 2 (10. Mu.L) were added to Opti-MEM reduced serum medium, left at room temperature for 5 min, and then 500. Mu.L of the transfection mixture was added to the cell culture dish, mixed well and placed in a medium containing 5% CO ₂ Is cultured in an incubator at 37 ℃. After 4 hours, cells were digested with the appropriate volume of pancreatin, centrifuged and resuspended to adjust the cell concentration to 1X 10 ⁵ Per mL, 100. Mu.L/well was added to a 96-well plate and placed in a solution containing 5% CO ₂ Is cultured in an incubator at 37 ℃ for 18-24 hours.

Compounds were formulated in 10mM stock with DMSO and were subjected to secondary dilutions with complete medium containing 10ng/mL TGF-beta as required for initial concentration prior to detection of the compounds. mu.L of the compound was added to 594. Mu.L of complete medium containing 10ng/mL of TGF-beta, and the mixture was stirred and mixed well, and the compound was diluted 3-fold with medium containing 10ng/mL of TGF-beta. 100 μl of the formulated compound was added to 96-well cell culture plates according to a concentration gradient. Placed in a mixture containing 5% CO ₂ Is cultured in an incubator at 37℃for 24 hours. After 24 hours, luciferase activity was determined using a luciferase reporter assay kit, and the resulting data was curve fitted using GraphPad Prism and IC was calculated ₅₀ 。

Experimental results: the partial results of the inhibitory activity of the compounds listed in the examples on the TGF- β downstream Smad signaling pathway are shown in table 2.

TABLE 2 inhibitory Activity of Compounds against TGF-beta downstream Smad Signal pathway

/>

The experimental results (table 2) show that the compounds of the present invention have significant inhibitory activity on TGF- β downstream Smad signaling pathway, especially the activity of a portion of compounds such as compound 4 is significantly better than the positive control compound EW7197.

Example 76

Tablet formulation

The compound 41 produced in example 41 or the compound (50 g) of other examples, hydroxypropylmethyl cellulose E (150 g), starch (200 g), a proper amount of povidone K30 and magnesium stearate (1 g) were mixed, granulated and tableted.

In addition, the compounds prepared in examples 1 to 72 may be formulated into capsules, powders, granules, pills, injections, syrups, oral liquids, inhalants, ointments, suppositories or patches, etc. by imparting various pharmaceutical excipients according to the conventional formulation method of pharmacopoeia 2015.

Claims

1. An imidazole-2-methylamine derivative represented by formula I or a pharmaceutically acceptable salt thereof:

R ¹ Selected from the group consisting of substituted or unsubstituted phenyl, 2-hydroxy-2, 3-dihydro-1H-inden-1-yl, tetrahydropyran methyl, cyclohexyl, benzyl, naphthyl; the substituted phenyl is F, cl or CN substituted phenyl;

R ² selected from substituted or unsubstituted phenyl, substituted or unsubstituted pyridyl; the substituted phenyl is 4-fluorophenyl, and the substituted pyridyl is 6-methylpyridyl, 6-trifluoromethyl pyridyl, 6-methylpyridyl or 5-fluoro-6 methylpyridyl;

R ³ selected from CN, CONH ₂ 、COOCH ₂ CH ₃ 、CONHNH ₂ 、C(NH)NHOH、CH ₂ NHCOCH ₃ 、NHCOCH ₃ 1,2, 4-oxadiazolyl, CH ₂ NHCOCH(CH ₃ ) ₂ 、CH ₂ NHCOOCH ₃ 、CH ₂ NHCOC ₂ H ₅ Phenyl, 3-chloro-4-fluorophenyl or 3, 4-difluorophenyl;

w is CH or N.

2. An imidazole-2-methylamine derivative or a pharmaceutically acceptable salt thereof, wherein the imidazole-2-methylamine derivative is selected from any one of the following compounds:

3. the imidazole-2-methylamine derivative or a pharmaceutically acceptable salt thereof as claimed in any one of claims 1 to 2, wherein the salt of the imidazole-2-methylamine derivative comprises a salt of the derivative with a metal ion or a pharmaceutically acceptable amine or ammonium ion.

4. Use of an imidazole-2-methylamine derivative as claimed in any one of claims 1 to 2, or a pharmaceutically acceptable salt thereof, in the preparation of an ALK5 inhibitor.

5. Use of an imidazole-2-methylamine derivative as claimed in any one of claims 1 to 2, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the prophylaxis or treatment of ALK5 mediated disorders.

6. The use of claim 5, wherein the ALK 5-mediated condition comprises cancer, renal fibrosis, liver fibrosis, pulmonary fibrosis, viral infection, chronic nephritis, acute nephritis, diabetic nephropathy, osteoporosis, arthritis, wound healing, ulcers, corneal trauma, heart valve stenosis, congestive heart necrosis, impaired nerve function, alzheimer's syndrome, peritoneal or subcutaneous adhesions, atherosclerosis, or metastatic growth of tumors.

7. A pharmaceutical composition for preventing or treating ALK 5-mediated diseases, which comprises the imidazole-2-methylamine derivative or a pharmaceutically acceptable salt thereof as claimed in any one of claims 1 to 3 as an active ingredient and pharmaceutically acceptable excipients.

8. The pharmaceutical composition of claim 7, wherein the pharmaceutical composition is in the form of a capsule, powder, tablet, granule, pill, injection, syrup, oral liquid, inhalant, ointment, suppository or patch.