CN114317676A - Method for detecting activity of T4RNA ligase - Google Patents
Method for detecting activity of T4RNA ligase Download PDFInfo
- Publication number
- CN114317676A CN114317676A CN202011080485.1A CN202011080485A CN114317676A CN 114317676 A CN114317676 A CN 114317676A CN 202011080485 A CN202011080485 A CN 202011080485A CN 114317676 A CN114317676 A CN 114317676A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- primer
- stranded
- template
- strand
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 102000003960 Ligases Human genes 0.000 title claims abstract description 58
- 108090000364 Ligases Proteins 0.000 title claims abstract description 58
- 230000000694 effects Effects 0.000 title claims abstract description 46
- 238000000034 method Methods 0.000 title claims abstract description 29
- 150000007523 nucleic acids Chemical class 0.000 claims abstract description 111
- 102000039446 nucleic acids Human genes 0.000 claims abstract description 108
- 108020004707 nucleic acids Proteins 0.000 claims abstract description 108
- 238000006243 chemical reaction Methods 0.000 claims abstract description 56
- 102000004190 Enzymes Human genes 0.000 claims abstract description 42
- 108090000790 Enzymes Proteins 0.000 claims abstract description 42
- 238000003753 real-time PCR Methods 0.000 claims abstract description 25
- 102100034343 Integrase Human genes 0.000 claims abstract description 10
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 claims abstract description 8
- 230000009471 action Effects 0.000 claims abstract description 8
- 108020004414 DNA Proteins 0.000 claims description 42
- 239000012634 fragment Substances 0.000 claims description 38
- 238000010839 reverse transcription Methods 0.000 claims description 27
- 230000000295 complement effect Effects 0.000 claims description 25
- 102000053602 DNA Human genes 0.000 claims description 17
- 239000002773 nucleotide Substances 0.000 claims description 16
- 125000003729 nucleotide group Chemical group 0.000 claims description 16
- 239000007850 fluorescent dye Substances 0.000 claims description 11
- 230000000903 blocking effect Effects 0.000 claims description 9
- 108020004682 Single-Stranded DNA Proteins 0.000 claims description 5
- 230000004048 modification Effects 0.000 claims description 5
- 238000012986 modification Methods 0.000 claims description 5
- 230000026731 phosphorylation Effects 0.000 claims description 5
- 238000006366 phosphorylation reaction Methods 0.000 claims description 5
- 238000012360 testing method Methods 0.000 claims description 4
- 125000003277 amino group Chemical group 0.000 claims description 3
- 239000007795 chemical reaction product Substances 0.000 claims description 3
- 230000029087 digestion Effects 0.000 claims 1
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 67
- 238000001514 detection method Methods 0.000 description 18
- 239000000047 product Substances 0.000 description 15
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 13
- 230000003321 amplification Effects 0.000 description 7
- 238000003199 nucleic acid amplification method Methods 0.000 description 7
- 239000000523 sample Substances 0.000 description 7
- 230000000052 comparative effect Effects 0.000 description 6
- 108091028043 Nucleic acid sequence Proteins 0.000 description 5
- 238000010790 dilution Methods 0.000 description 5
- 239000012895 dilution Substances 0.000 description 5
- 125000002887 hydroxy group Chemical group [H]O* 0.000 description 5
- 238000003904 radioactive pollution Methods 0.000 description 4
- 229910019142 PO4 Inorganic materials 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 230000000875 corresponding effect Effects 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- NBIIXXVUZAFLBC-UHFFFAOYSA-K phosphate Chemical compound [O-]P([O-])([O-])=O NBIIXXVUZAFLBC-UHFFFAOYSA-K 0.000 description 3
- 239000010452 phosphate Substances 0.000 description 3
- 125000002467 phosphate group Chemical group [H]OP(=O)(O[H])O[*] 0.000 description 3
- 230000035945 sensitivity Effects 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- 101710203526 Integrase Proteins 0.000 description 2
- 108020002230 Pancreatic Ribonuclease Proteins 0.000 description 2
- 102000005891 Pancreatic ribonuclease Human genes 0.000 description 2
- 101710086015 RNA ligase Proteins 0.000 description 2
- 102000006382 Ribonucleases Human genes 0.000 description 2
- 108010083644 Ribonucleases Proteins 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 238000010276 construction Methods 0.000 description 2
- 230000007547 defect Effects 0.000 description 2
- 238000012423 maintenance Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000005259 measurement Methods 0.000 description 2
- 238000002360 preparation method Methods 0.000 description 2
- 125000002924 primary amino group Chemical group [H]N([H])* 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 238000011002 quantification Methods 0.000 description 2
- 238000007363 ring formation reaction Methods 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 239000000758 substrate Substances 0.000 description 2
- 229920002594 Polyethylene Glycol 8000 Polymers 0.000 description 1
- 230000026279 RNA modification Effects 0.000 description 1
- 230000004075 alteration Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 238000006555 catalytic reaction Methods 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 230000007423 decrease Effects 0.000 description 1
- 230000001419 dependent effect Effects 0.000 description 1
- XPPKVPWEQAFLFU-UHFFFAOYSA-N diphosphoric acid Chemical compound OP(O)(=O)OP(O)(O)=O XPPKVPWEQAFLFU-UHFFFAOYSA-N 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000002795 fluorescence method Methods 0.000 description 1
- 239000013067 intermediate product Substances 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 238000000691 measurement method Methods 0.000 description 1
- 229940005657 pyrophosphoric acid Drugs 0.000 description 1
- 238000010791 quenching Methods 0.000 description 1
- 230000000171 quenching effect Effects 0.000 description 1
- 230000002285 radioactive effect Effects 0.000 description 1
- 150000003384 small molecules Chemical class 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting the activity of T4RNA ligase. The method comprises the following steps: performing ligation reaction on the first RNA single strand and the second nucleic acid single strand under the action of T4RNA ligase to be detected so as to obtain a first single-strand template; extending the third single-stranded nucleic acid in the 5 'to 3' direction by the action of reverse transcriptase using the first single-stranded template as a template to obtain a second single-stranded template; performing fluorescent quantitative PCR reaction by using the second single-chain template as a template so as to obtain a CT value of the fluorescent reaction; and determining the activity of the T4RNA ligase to be tested based on the preset corresponding relation between the enzyme concentration and the CT value.
Description
Technical Field
The invention relates to the field of biotechnology, in particular to a method for detecting the activity of T4RNA ligase.
Background
T4RNA Ligase, T4RNA Ligase, is an ATP-dependent enzyme that catalyzes the formation of phosphodiester bonds between single-stranded RNA, single-stranded DNA, or single nucleotide molecules or between the 5'-P and 3' -OH termini intramolecularly. T4RNA Ligase has the highest efficiency for ligation between RNAs, the second highest efficiency for DNA-to-RNA ligation, and the lowest efficiency for DNA ligation, and is therefore also considered to be a ssRNA Ligase.
T4RNA Ligase is mainly used for the connection between RNA and RNA, and the connection requires the existence of 5 'phosphate group and 3' hydroxyl group. T4RNA Ligase can be used not only for ligation between RNA molecules but also for circularization of RNA molecules (shortest 8 bases).
T4RNA Ligase can also be used for ligation between RNA and mononucleotides, which must be in both 5' and 3' phosphorylated form, and which are commonly used for 3' end labeling of RNA. T4RNA Ligase can also be used for ligation between DNA and RNA. When the DNA provides a 5 'phosphate group and the RNA provides a 3' hydroxyl group, the connection efficiency is higher; when the DNA provides a 3 'hydroxyl group and the RNA provides a 5' phosphate group, ligation efficiency is very low.
T4RNA Ligase can also be used for ligation between DNA and DNA, but the ligation efficiency is very low. Mainly used for circularization of DNA, such as cDNA circularization in 5' RACE. The ligation between DNA and DNA, although possible, is difficult.
The T4RNA Ligase catalyzed ligation reaction proceeds as follows. Firstly, T4RNA Ligase reacts with ATP to generate an intermediate product T4RNA Ligase-AMP, and releases pyrophosphoric acid; subsequently, AMP is transferred from the intermediate T4RNA Ligase-AMP to the 5' phosphate end of the nucleic acid, forming an adenylylated nucleic acid intermediate; finally, under the catalysis of T4RNA Ligase, the 3 'hydroxyl group of another nucleic acid attacks the 5' phosphate end of the adenylated nucleic acid intermediate, forming a 3 '-5' phosphodiester bond, and releasing AMP.
T4RNA Ligase is mainly used for RNA connection, RNA modification and other RNA related applications, and is also applied to T4RNA Ligase in the related library construction technology of small molecule RNA library construction in the NGS field.
The conventional enzyme activity detection method is to use radioactive isotope to carry out enzyme activity calibration, and the enzyme quantity required by detecting 1nmol of 5' - [32P ] rA16 converted into phosphate insoluble substance is defined as 1 enzyme activity unit. However, the conventional standard T4RNA Ligase activity measurement method is limited by the quality of a marker, radioactive pollution is easy to generate in the operation process, the steps are multiple, the period is long, and high-throughput and automation are difficult to realize.
Therefore, the detection method of T4RNA ligase activity still needs to be further developed and improved.
Disclosure of Invention
The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. Therefore, the invention provides a method for detecting the activity of T4RNA ligase, which has the advantages of no radioactive pollution, low requirement on environment, simple and quick operation steps, low reagent cost and high sensitivity.
The invention provides a method for detecting the activity of T4RNA ligase. According to an embodiment of the invention, the method comprises: performing a ligation reaction on a first RNA single strand and a second nucleic acid single strand under the action of T4RNA ligase to be detected so as to obtain a first single strand template, wherein the 5 'end of the second nucleic acid single strand has phosphorylation modification, and the 3' end of the second nucleic acid single strand has a blocking group; extending a third single-stranded nucleic acid in a 5 'to 3' direction by reverse transcriptase using the first single-stranded template as a template to obtain a second single-stranded template, the third single-stranded nucleic acid being a single-stranded DNA, at least a portion of the third single-stranded nucleic acid being completely complementary to the second single-stranded nucleic acid; performing fluorescent quantitative PCR reaction by using the second single-chain template as a template so as to obtain a CT value of the fluorescent reaction; and determining the activity of the T4RNA ligase to be tested based on the preset corresponding relation between the enzyme concentration and the CT value. As described above, compared with the prior art, the detection method provided by the embodiment of the invention has the advantages of no radioactive pollution, low requirement on environment, simple and rapid operation steps, low reagent cost and higher sensitivity, and the method establishes a quantitative relation between the activity of the T4RNA Ligase and the CT value, reflects the activity of the T4RNA Ligase by measuring the CT value, overcomes the defect that the traditional method cannot accurately quantify, and has more accurate measurement result.
According to an embodiment of the present invention, the method may further include at least one of the following additional technical features:
according to an embodiment of the present invention, the third single-stranded nucleic acid comprises a 5 'end fragment and a 3' end fragment, the 3 'end fragment of the third single-stranded nucleic acid is completely complementary to the second single-stranded nucleic acid, and the length of the 5' end fragment of the third single-stranded nucleic acid is at least 1 bp. The inventors found that when the 3 'end fragment of the third single-stranded nucleic acid is completely complementary to the second single-stranded nucleic acid and the 5' end fragment of the third single-stranded nucleic acid is at least 1bp in length, that is, when the 3 'end of the third single-stranded nucleic acid is completely complementary to the second single-stranded nucleic acid but a non-complementary overhang segment is present at the 5' end, designing a primer on the overhang segment can further improve the detection accuracy.
According to an embodiment of the present invention, the length of the 5' -end fragment of the third single-stranded nucleic acid is 50 to 100 bp. The inventor finds that the length of the 5' end fragment of the third nucleic acid single strand is 50-100 bp, and the detection accuracy can be further improved.
According to an embodiment of the present invention, the second single nucleic acid strand is a single strand of RNA or DNA. According to the detection method provided by the embodiment of the invention, the activity of the T4RNA Ligase to be detected can be indirectly reflected by the connection efficiency of RNA and RNA or the connection efficiency of RNA and DNA single strands.
According to an embodiment of the invention, the blocking group is an amino group or a dideoxy group. Further blocking the 3' end of the second nucleic acid single strand to avoid cyclization after ligation.
According to an embodiment of the present invention, after the reverse transcription reaction, the method further comprises digesting the reverse transcription reaction product with an rnase (e.g., at least one of RnaseH, RnaseA, etc.) to obtain the second single-stranded template. And then the first single-chain template is digested to obtain a second single-chain template, so that subsequent fluorescent quantitative forward primers can be conveniently combined, and the accuracy of enzyme activity determination is further improved. The RNase treatment may be performed before or during the fluorescent quantitative PCR reaction.
According to the embodiment of the invention, in the fluorescent quantitative PCR reaction, a first primer and a second primer are arranged; the first primer is complementary to the segment of the second single-stranded template near the 3 'end, and the second primer is identical to the segment of the second single-stranded template near the 5' end. Preferably, the first primer is not complementary to the third nucleic acid single strand. In the fluorescent quantitative PCR reaction, if the first RNA single strand and the second nucleic acid single strand are successfully connected in the initial connection reaction, the first RNA single strand and the second nucleic acid single strand can be reversely transcribed to form a second single strand template, the first primer can be complementarily paired with the 3' end of the second single strand template, a complementary strand extends out, and a double-stranded DNA product is amplified; if the first RNA single strand and the second nucleic acid single strand are not successfully ligated in the initial ligation reaction, the third nucleic acid single strand cannot be reverse-transcribed to form the second single-stranded template, the first primer cannot be complementary-paired with the second single-stranded template, and the first primer cannot be complementary-paired with the third nucleic acid single strand, so that a double-stranded DNA product cannot be amplified.
According to the embodiment of the present invention, the second primer is the same as the fragment of the third single-stranded nucleic acid near the 5' -end, and the primer is designed on the protruding segment of the third single-stranded nucleic acid, thereby further improving the detection accuracy. Fragments referred to above as being near the 5 'or 3' end refer to nucleic acid fragments positioned near both ends in the sequence, but it is not required that the fragments must start or end at the 5 'or 3' end of the sequence.
According to the embodiment of the invention, a fluorescent probe is also arranged in the fluorescent quantitative PCR reaction.
According to an embodiment of the invention, the first RNA single strand has the sequence of SEQ ID NO: 1.
rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC(SEQ ID NO:1)。
According to an embodiment of the present invention, the second single nucleic acid strand has a nucleotide sequence shown in SEQ ID NO. 2.
AGATGTACAGATAAGCGTCTG(SEQ ID NO:2)。
According to an embodiment of the present invention, the third single nucleic acid strand has a nucleotide sequence shown in SEQ ID NO. 3.
GCTCTCACATTATACGAACACGTCAACTACGTCGAGCTGCTCGTACTCTAGTGTAGAATGTACGCAGACGCTTATCTGTACATCT(SEQ ID NO:3)。
According to the embodiment of the invention, in the fluorescent quantitative PCR reaction, the first primer has the nucleotide sequence shown in SEQ ID NO. 4, and the second primer has the nucleotide sequence shown in SEQ ID NO. 5.
GTTCAGAGTTCTACAGTCCGACGATC(SEQ ID NO:4)。
GCTCTCACATTATACGAACACGTC(SEQ ID NO:5)。
According to the embodiment of the invention, in the fluorescent quantitative PCR reaction, the fluorescent probe has a nucleotide sequence shown as SEQ ID NO. 6.
CGTCGAGCTGCTCGTACTCTAGTGTAGA(SEQ ID NO:6)。
In a second aspect of the invention, the invention provides a kit for detecting the activity of T4RNA ligase. According to an embodiment of the present invention, the kit comprises the first RNA single strand, the second nucleic acid single strand, and the third nucleic acid single strand described in the above embodiment.
According to an embodiment of the invention, a first primer, a second primer and optionally a fluorescent probe as described in the above embodiments are also included.
Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.
Drawings
The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:
FIG. 1 is a schematic diagram of a ligation reaction in a detection method according to an embodiment of the present invention;
FIG. 2 is a schematic diagram of a reverse transcription reaction in the detection method according to the embodiment of the present invention;
FIG. 3 is a schematic diagram of a fluorescent quantitative PCR reaction in the detection method according to the embodiment of the present invention;
FIG. 4 is a graph showing the correlation between the enzyme amount and CT value of different T4RNA ligases in example 1 according to the present invention; and
FIG. 5 is a graph showing the correlation between the enzyme amount and CT value of different T4RNA ligases according to comparative example 1 of the present invention.
Detailed Description
Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.
Furthermore, the terms "first", "second" and "first" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In the description of the present invention, "a plurality" means at least two, e.g., two, three, etc., unless specifically limited otherwise.
The invention provides a method for detecting the activity of T4RNA ligase. According to an embodiment of the invention, the method comprises: performing a ligation reaction on a first RNA single strand and a second nucleic acid single strand under the action of T4RNA ligase to be detected so as to obtain a first single strand template, wherein the 5 'end of the second nucleic acid single strand has phosphorylation modification, and the 3' end of the second nucleic acid single strand has a blocking group; extending a third single-stranded nucleic acid in a 5 'to 3' direction by reverse transcriptase using the first single-stranded template as a template to obtain a second single-stranded template, the third single-stranded nucleic acid being a single-stranded DNA, at least a portion of the third single-stranded nucleic acid being completely complementary to the second single-stranded nucleic acid; performing fluorescent quantitative PCR reaction by using the second single-chain template as a template so as to obtain a CT value of the fluorescent reaction; and determining the activity of the T4RNA ligase to be tested based on the preset corresponding relation between the enzyme concentration and the CT value.
In the ligation reaction according to the above-described detection method according to the embodiment of the present invention, referring to fig. 1, the artificially synthesized second nucleic acid single strand (DNA-1 #, for example, single-stranded DNA) and the first RNA single strand (RNA #, for example) are used as substrates, the 5 'end of the second nucleic acid single strand is phosphorylated and modified, the 3' end is aminated, ATP and T4RNA Ligase diluted in a gradient are added to the reaction system, and the 5 'end of the reacted DNA-1# is ligated to the 3' end hydroxyl group of RNA to form a hybrid template, i.e., a first single-stranded template, which is used as a template for the next reverse transcription. Referring to FIG. 2, in the reverse transcription system, the DNA sequence in the ligated RNA + DNA-1# template (i.e., the first single-stranded template) is completely complementary-paired with the 3' -end fragment of the third nucleic acid single strand (labeled as DNA-2#) to generate a DNA sequence complementary to the RNA under the action of the reverse transcriptase, and finally a complete DNA template that can be used for fluorescence quantitative PCR (i.e., the second single-stranded template) is generated. Referring to fig. 3, in the fluorescent quantitative PCR reaction, RnaseH, for example, can be used to degrade RNA in the hybrid strand, and amplify a DNA double-stranded product for a second single-stranded template obtained in the reverse transcription process, and the activity of the enzyme is calibrated, in the figure, the upstream primer is the first primer, and the downstream primer is the second primer.
Compared with the prior art, the detection method provided by the embodiment of the invention has the advantages of no radioactive pollution, low requirement on environment, simple and rapid operation steps, low reagent cost and higher sensitivity, and the method establishes a quantitative relation between the activity of the T4RNA Ligase and the CT value, reflects the activity of the T4RNA Ligase by measuring the CT value, overcomes the defect that the traditional method cannot accurately quantify, and has more accurate measurement result.
According to an embodiment of the present invention, referring to fig. 2, the third single-stranded nucleic acid comprises a 5' end fragment and a 3' end fragment, the 3' end fragment of the third single-stranded nucleic acid is completely complementary to the ' second single-stranded nucleic acid, and the length of the 5' end fragment of the third single-stranded nucleic acid is at least 1 bp. The 3 '-end fragment of the third single-stranded nucleic acid described herein refers to a nucleic acid sequence segment near the 3' -end of the third single-stranded nucleic acid, the 5 '-end fragment of the third single-stranded nucleic acid described herein refers to a nucleic acid sequence segment near the 5' -end of the third single-stranded nucleic acid, and the 5 '-end fragment and the 3' -end fragment of the third single-stranded nucleic acid in this order from the 5 '-end to the 3' -end constitute the third single-stranded nucleic acid. The inventors have found that when the 3 '-end fragment of the third single-stranded nucleic acid is completely complementary to the' second single-stranded nucleic acid and the 5 '-end fragment of the third single-stranded nucleic acid is at least 1bp in length, that is, when a protruding segment that is not complementary to the' second single-stranded nucleic acid exists in the third single-stranded nucleic acid, designing a primer on the protruding segment (refer to fig. 2, in which the complementary segment can be regarded as the 3 '-end fragment of the third single-stranded nucleic acid and the protruding segment can be regarded as the 5' -end fragment of the third single-stranded nucleic acid) can further improve the detection accuracy. Meanwhile, the inventor also unexpectedly finds that the highlighted fragment is also beneficial to reducing the background signal of a fluorescent quantitative PCR system, is beneficial to obtaining a better amplification curve, and has better discrimination on T4RNA Ligase with different enzyme activity units.
According to an embodiment of the present invention, the length of the 5' -end fragment of the third single-stranded nucleic acid is 50 to 100 bp. The inventor finds that the length of the 5' end fragment of the third nucleic acid single strand is 50-100 bp, and the detection accuracy can be further improved.
According to an embodiment of the present invention, the second single nucleic acid strand is a single strand of RNA or DNA. According to the detection method provided by the embodiment of the invention, the activity of the T4RNA Ligase to be detected can be indirectly reflected by the connection efficiency of RNA and RNA or the connection efficiency of RNA and DNA single strands.
According to an embodiment of the invention, the blocking group is an amino group or a dideoxy group. Further blocking the 3' end of the second nucleic acid single strand to avoid cyclization after ligation.
According to an embodiment of the present invention, after the reverse transcription reaction, the method further comprises digesting the reverse transcription reaction product with an rnase (e.g., at least one of RnaseH, RnaseA, etc.) to obtain the second single-stranded template. And then the first single-stranded template is digested to obtain a second single-stranded template, so that subsequent fluorescent quantitative forward primers can be conveniently combined, the accuracy of enzyme activity determination is further improved, and the RNase treatment can be carried out before the fluorescent quantitative PCR reaction or in the reaction.
According to the embodiment of the invention, in the fluorescent quantitative PCR reaction, a first primer and a second primer are arranged; the first primer is complementary to a segment of the second single-stranded template near the 3 'end, and the second primer is identical to a segment of the second single-stranded template near the 5' end. Preferably, the first primer is not complementary to the third nucleic acid single strand. The first primer and the second primer are DNA sequences. In the fluorescent quantitative PCR reaction, if the first RNA single strand and the second nucleic acid single strand are successfully connected in the initial connection reaction, the first RNA single strand and the second nucleic acid single strand can be reversely transcribed to form a second single strand template, the first primer can be complementarily paired with the 3' end of the second single strand template, a complementary strand extends out, and a double-stranded DNA product is amplified; if the first RNA single strand and the second nucleic acid single strand are not successfully ligated in the initial ligation reaction, the third nucleic acid single strand cannot be reverse-transcribed to form the second single-stranded template, the first primer cannot be complementary-paired with the third nucleic acid single strand, and the double-stranded DNA product cannot be amplified. Therefore, the efficiency of the initial ligation reaction can be reflected by the amount of the finally amplified double-stranded DNA product, the relationship between the amount of the double-stranded DNA product and the enzyme activity of the T4RNA ligase is established, the amount of the double-stranded DNA product can be reflected by the CT value of the fluorescent PCR reaction, and the enzyme activity of the T4RNA ligase can be directly reflected by the CT value in the fluorescent PCR reaction. Further preferably, the second primer is the same as the fragment of the third single-stranded nucleic acid near the 5' -end, and the primer is designed on the protruding segment of the third single-stranded nucleic acid, thereby further improving the detection accuracy.
The "first RNA single strand", "second nucleic acid single strand", and "third nucleic acid single strand" described in the present application are not limited to specific sequences.
According to a specific embodiment of the invention, the first RNA single strand has the sequence of SEQ ID NO: 1.
rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC(SEQ ID NO:1)。
According to a specific embodiment of the present invention, the second single nucleic acid strand has the nucleotide sequence shown in SEQ ID NO. 2.
AGATGTACAGATAAGCGTCTG(SEQ ID NO:2)。
According to a specific embodiment of the present invention, the third single nucleic acid strand has the nucleotide sequence shown in SEQ ID NO. 3.
GCTCTCACATTATACGAACACGTCAACTACGTCGAGCTGCTCGTACTCTAGTGTAGAATGTACGCAGACGCTTATCTGTACATCT(SEQ ID NO:3)。
According to the specific embodiment of the present invention, in the fluorescent quantitative PCR reaction, the first primer has the nucleotide sequence shown in SEQ ID NO. 4, and the second primer has the nucleotide sequence shown in SEQ ID NO. 5. GTTCAGAGTTCTACAGTCCGACGATC (SEQ ID NO: 4).
GCTCTCACATTATACGAACACGTC(SEQ ID NO:5)。
According to the embodiment of the invention, in the fluorescent quantitative PCR reaction, the fluorescent probe has a nucleotide sequence shown as SEQ ID NO. 6.
CGTCGAGCTGCTCGTACTCTAGTGTAGA(SEQ ID NO:6)。
According to the embodiment of the invention, a first primer, a second primer and a probe are added into a fluorescent quantitative PCR system, an amplification curve is formed through fluorescent quantitative PCR, a positive correlation relationship is formed between a CT value and an enzyme quantity, a contrast enzyme (a contrast enzyme with known enzyme activity is used during detection and is subjected to gradient dilution to different enzyme concentrations, different enzyme activities can be represented by different enzyme concentrations) is used for comparing the amplification curve of different enzyme activities with the CT value of the enzyme to be detected, the preset corresponding relationship between the enzyme activity and the CT value is realized, and when the enzyme to be detected is diluted to correspond to the CT value of the contrast enzyme, the enzyme sample to be detected and the contrast enzyme are judged to have the same enzyme activity unit, so that the Ligase activity of unknown T4RNA Ligase is calibrated.
According to an embodiment of the present invention, in the fluorescent quantitative PCR system, the relative amount of the product dsDNA is measured by fluorescence using a fluorescent probe (5 'end containing a fluorescent dye modification and 3' end containing a fluorescence quenching group), and the relative amount of dsDNA is expressed as fluorescence intensity.
The invention also provides a kit for detecting the activity of the T4RNA ligase, which comprises the first RNA single strand, the second nucleic acid single strand and the third nucleic acid single strand.
According to an embodiment of the invention, a first primer, a second primer and optionally a fluorescent probe as described in the above embodiments are also included.
The invention will now be described with reference to specific examples, which are intended to be illustrative only and not to be limiting in any way.
Example 1 establishment of method for measuring T4RNA Ligase Activity by fluorescence method
In the method for detecting T4RNA ligase activity of this embodiment, a segment of RNA and a segment of DNA are used as substrates, under the condition of T4RNA ligase with different enzyme activity units, the RNA and the DNA are connected into RNA + DNA products with different amounts, and finally, under the action of the other DNA strand, complementary pairing is performed with the DNA region of the RNA + DNA product, and under the action of reverse transcriptase, the RNA region is reverse transcribed into DNA, and finally, the full-length DNA strand after reverse transcription is detected, and the enzyme activity unit of T4RNA ligase is determined by CT value.
1.1 preparation of RNA + DNA-1# template
ssRNA and ssDNA-1# are synthesized by Takara Bio Inc., wherein the sequences of ssRNA and ssDNA-1# are shown as SEQ ID NO:1 and SEQ ID NO:2, wherein the 5 'end of the ssDNA-1# template has phosphorylation, and the 3' end is connected with amino for blocking.
ssRNA：
5′-rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC-3′-OH(SEQ ID NO:1)。
ssDNA-1#：
P-5’-AGATGTACAGATAAGCGTCTG-3’-NH2(SEQ ID NO:2)。
The ssRNA and ssDNA-1# were ligated in the reaction system shown in the following table under conditions of 25 ℃ for 1h, 65 ℃ for 15min, and 12 ℃ to allow the 3 'end of the ssRNA to be ligated to the 5' end of the ssDNA-1# to obtain the RNA + DNA-1# template.
The DNA and RNA ligation reaction system is shown in Table 1.
Table 1:
| components | Concentration of | Volume (ul) | |
| T4 |
10× | 1 | |
| | 10mM | 1 | |
| | 1μM | 1 | |
| ssDNA-1 | 1μM | 1 | |
| RNasin | 40U/μl | 0.25 | |
| PEG-8000 | 50％ | 2 | |
| T4 RNA Ligase | 10U/ |
2 | |
| DEPC water | — | ||
| Final volume | 10μl |
1.2 reverse transcription ssDNA-2# synthesized by Takara Bio:
5’-GCTCTCACATTATACGAACACGTCAACTACGTCGAGCTGCTCGTACTCTAGTGTAGAATGTACGCAGACGCTTATCTGTACATCT-3’(SEQ ID NO:3)。
ssDNA-2# is added into the system (containing RNA + DNA-1# template) after the ligation reaction for reverse transcription reaction, the reverse transcription system is shown in the following table, and the conditions of reverse transcription reaction are 50 ℃ for 20min, 70 ℃ for 15min and 12 ℃ for maintenance.
The reverse transcription system is shown in Table 2.
Table 2:
| components | Concentration of | Volume (μ l) | |
| |
5× | 10 | |
| dNTP | 25mM | 0.2 | |
| ssDNA-2 | 1μM | 1 | |
| reverse transcriptase | 200U/μl | 0.4 | |
| RNasin | 40U/μl | 0.25 | |
| Post ligation system | — | 10 | |
| DEPC water | — | ||
| Final volume | 50μl |
1.3 fluorescent quantitative reaction:
taking the reverse transcription product to carry out fluorescence quantitative reaction.
The part of the double-stranded DNA is RNA + DNA heterozygotic chain after reverse transcription, and the subsequent amplification only needs the full-length ssDNA-2# after extension, so that the products after reverse transcription need to be digested by RNase H and RNase A.
The following sequences were synthesized by Takara Bio Inc:
the forward primer (first primer) was: 5'-GTTCAGAGTTCTACAGTCCGACGATC-3', respectively;
the reverse primer was (second primer): 5'-GCTCTCACATTATACGAACACGTC-3', respectively;
the probe is as follows: FAM-5'-CGTCGAGCTGCTCGTACTCTAGTGTAGA-3' -BHQ1
The fluorescence quantification system is shown in Table 3.
Table 3:
| components | Concentration of | Volume (μ l) | |
| |
5× | 10 | |
| dNTP | 25mM | 0.4 | |
| | 10μM | 1 | |
| | 10μM | 1 | |
| Probe needle | 20μM | 0.2 | |
| Hotstart Taq | 5U/μl | 0.5 | |
| RNase H | 5U/μl | 0.5 | |
| RNase A | 100ng/μl | 0.5 | |
| Solution I | 10× | 5 | |
| Reverse transcription product | — | 5 | |
| ddH2O | — | ||
| Final volume | 50μl |
The fluorescent PCR conditions are shown in Table 4.
Table 4:
comparative example 1
Comparison of the Effect of the presence or absence of a protruding fragment at the 5' -end of the third single-stranded nucleic acid, which is not complementary to the second single-stranded nucleic acid, on the detection of T4RNA Ligase.
1.1 preparation of RNA + DNA-3# template
The inventors biosynthesize ssRNA and ssDNA-3#, wherein the sequences of the ssRNA and the ssDNA-3# are shown as SEQ ID NO:1 and SEQ ID NO:7, wherein the 5 'end of the ssDNA-3# template has phosphorylation, and the 3' end is connected with amino.
ssRNA：
5′-rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC-3′-OH(SEQ ID NO:1)。
ssDNA-3#：
P-5’-AGATGTACAGATAAGCGTCTGCGTACATTCTACACTAGAGTACGAGCAGCTCGACGTAGTTGACGTGTTCGTATAATGTGAGAGC-3’-NH2(SEQ ID NO:7)。
The ssRNA and ssDNA-3# were ligated in the reaction system shown in the following table under conditions of 25 ℃ for 1h, 65 ℃ for 15min, and 12 ℃ to allow the 3 'end of the ssRNA to ligate to the 5' end of the ssDNA-3# to obtain the RNA + DNA-3# template.
The DNA and RNA ligation reaction system is shown in Table 5.
Table 5:
1.2 reverse transcription
ssDNA-2# was synthesized by Takara Bio:
5-GCTCTCACATTATACGAACACGTCAACTACGTCGAGCTGCTCGTACTCTAGTGTAGAATGTACGCAGACGCTTATCTGTACATCT-3’(SEQ ID NO:3)。
and adding the system (containing RNA + DNA-3# template) after the ligation reaction into ssDNA-2# for reverse transcription reaction, wherein the reverse transcription system is shown in the table, and the reverse transcription reaction conditions are 50 ℃ for 20min, 70 ℃ for 15min and 12 ℃ for maintenance.
The reverse transcription system is shown in Table 6.
Table 6:
| components | Concentration of | Volume (μ l) | |
| |
5× | 10 | |
| dNTP | 25mM | 0.2 | |
| ssDNA-2 | 1μM | 1 | |
| reverse transcriptase | 200U/μl | 0.4 | |
| RNasin | 40U/μl | 0.25 | |
| Post ligation system | — | 10 | |
| DEPC water | — | ||
| Final volume | 50μl |
1.3 fluorescent quantitation
Taking the reverse transcription product to carry out fluorescence quantitative reaction.
The following sequences were synthesized by Takara Bio Inc:
the forward primer (first primer) was: 5'-GTTCAGAGTTCTACAGTCCGACGATC-3', respectively;
reverse primer (second primer): 5'-GCTCTCACATTATACGAACACGTC-3', respectively;
the probe is as follows: FAM-5'-CGTCGAGCTGCTCGTACTCTAGTGTAGA-3' -BHQ1
The fluorescence quantification system is shown in Table 7.
Table 7:
the fluorescent PCR conditions are shown in Table 8.
Table 8:
test example, T4RNA Ligase sample gradient enzyme activity amplification Curve
Sample treatment:
5. mu.l of control T4RNA Ligase was added with 45. mu.l of ddH2In O, carrying out continuous 3 10-time gradient dilution to form 3 standard substance gradients;
ligation, reverse transcription and fluorescent quantitative PCR were performed according to example 1 or comparative example 1, respectively.
2 duplicate wells were set for each dilution.
The results of the test of example 1 are shown in fig. 4, and the results of the test of comparative example 1 are shown in fig. 5.
The CT value results are shown in Table 9.
Table 9:
the enzyme amount (enzyme dilution factor, here, enzyme activity is reflected by enzyme concentration-dilution factor) of T4RNA Ligase is correlated with the CT value, and the CT value exhibits enzyme concentration dependency, and becomes larger as the enzyme amount concentration decreases. When ssDNA-3# is used as a perfectly complementary match to ssDNA-2#, i.e., no protruding fragment at the 5' end of the third single-stranded nucleic acid that is not complementary to the second single-stranded nucleic acid, the difference in Δ CT values of the quantitative amplification curve of T4RNA Ligase fluorescence values of different enzyme activity units is less significant than that of the fragment containing a protruding segment, and the baseline of the amplification curve of comparative example 1 without a protruding fragment is significantly "up-shifted", which is more advantageous to obtain a "S" type curve and better discrimination than that of comparative example 1 in example 1.
In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.
Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.
Claims (10)
1. A method for detecting the activity of T4RNA ligase, which comprises the following steps:
performing a ligation reaction on a first RNA single strand and a second nucleic acid single strand under the action of T4RNA ligase to be detected so as to obtain a first single strand template, wherein the 5 'end of the second nucleic acid single strand has phosphorylation modification, and the 3' end of the second nucleic acid single strand has a blocking group;
extending a third single-stranded nucleic acid in a 5 'to 3' direction by reverse transcriptase using the first single-stranded template as a template to obtain a second single-stranded template, the third single-stranded nucleic acid being a single-stranded DNA, at least a portion of the third single-stranded nucleic acid being completely complementary to the second single-stranded nucleic acid;
performing fluorescent quantitative PCR reaction by using the second single-chain template as a template so as to obtain a CT value of the fluorescent reaction;
and determining the activity of the T4RNA ligase to be tested based on the preset corresponding relation between the enzyme concentration and the CT value.
2. The method according to claim 1, wherein the third single-stranded nucleic acid comprises a 5 'end fragment and a 3' end fragment, the 3 'end fragment of the third single-stranded nucleic acid is completely complementary to the second single-stranded nucleic acid, and the 5' end fragment of the third single-stranded nucleic acid has a length of at least 1 bp;
preferably, the length of the 5' end fragment of the third single-stranded nucleic acid is 50-100 bp.
3. The method of claim 1, wherein the second single nucleic acid strand is a single strand of RNA or DNA.
4. The method of claim 1, wherein the blocking group is an amino group or a dideoxy group.
5. The method according to claim 1, wherein a first primer and a second primer are provided in the fluorescent quantitative PCR reaction; the first primer is complementary to the segment of the second single-stranded template near the 3 'end, and the second primer is the same as the segment of the second single-stranded template near the 5' end;
preferably, the first primer is not complementary to the third nucleic acid single strand;
preferably, the second primer is the same as the fragment of the third nucleic acid single strand near the 5' end;
optionally, a fluorescent probe is further provided.
6. The method of claim 1, wherein the reverse transcription reaction is followed by digestion of the reverse transcription reaction product with an rnase to obtain the second single-stranded template.
7. The method of any one of claims 1-6, wherein the first single RNA strand has the sequence of SEQ ID NO: 1;
optionally, the second single-stranded nucleic acid has a nucleotide sequence shown in SEQ ID NO. 2;
preferably, the third single-stranded nucleic acid has the nucleotide sequence shown in SEQ ID NO. 3.
8. The method of claim 7, wherein in the fluorescent quantitative PCR reaction, the first primer has the nucleotide sequence shown in SEQ ID NO. 4, the second primer has the nucleotide sequence shown in SEQ ID NO. 5,
optionally, the fluorescent probe has a nucleotide sequence shown in SEQ ID NO. 6.
9. A kit for detecting T4RNA ligase activity, comprising a first RNA single strand, a second nucleic acid single strand, and a third nucleic acid single strand, wherein the first RNA single strand, the second nucleic acid single strand, and the third nucleic acid single strand are as defined in any one of claims 1 to 8.
10. The test kit according to claim 9, characterized in that it further comprises a first primer, a second primer and optionally a fluorescent probe, said first primer, second primer and optionally a fluorescent probe being as defined in any one of claims 1 to 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011080485.1A CN114317676A (en) | 2020-10-10 | 2020-10-10 | Method for detecting activity of T4RNA ligase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011080485.1A CN114317676A (en) | 2020-10-10 | 2020-10-10 | Method for detecting activity of T4RNA ligase |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114317676A true CN114317676A (en) | 2022-04-12 |
Family
ID=81032016
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011080485.1A Pending CN114317676A (en) | 2020-10-10 | 2020-10-10 | Method for detecting activity of T4RNA ligase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114317676A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080044813A1 (en) * | 2003-03-20 | 2008-02-21 | Kristian Jansson | Amp Ligation Assay (Ala) |
| CN104278090A (en) * | 2014-09-28 | 2015-01-14 | 南京诺唯赞生物科技有限公司 | Method for determining activity of DNA ligase |
| CN105121655A (en) * | 2012-12-21 | 2015-12-02 | 新英格兰生物实验室公司 | A novel ligase activity |
| US20190062827A1 (en) * | 2016-03-14 | 2019-02-28 | RGENE, Inc. | HYPER-THERMOSTABLE LYSINE-MUTANT ssDNA/RNA LIGASES |
| CN109468364A (en) * | 2018-03-15 | 2019-03-15 | 武汉康昕瑞基因健康科技有限公司 | The activity test method of T4DNA ligase |
| CN110964782A (en) * | 2019-12-09 | 2020-04-07 | 上海鹍远健康科技有限公司 | Method for detecting efficiency of single-stranded nucleic acid ligation |
-
2020
- 2020-10-10 CN CN202011080485.1A patent/CN114317676A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080044813A1 (en) * | 2003-03-20 | 2008-02-21 | Kristian Jansson | Amp Ligation Assay (Ala) |
| CN105121655A (en) * | 2012-12-21 | 2015-12-02 | 新英格兰生物实验室公司 | A novel ligase activity |
| CN104278090A (en) * | 2014-09-28 | 2015-01-14 | 南京诺唯赞生物科技有限公司 | Method for determining activity of DNA ligase |
| US20190062827A1 (en) * | 2016-03-14 | 2019-02-28 | RGENE, Inc. | HYPER-THERMOSTABLE LYSINE-MUTANT ssDNA/RNA LIGASES |
| CN109477127A (en) * | 2016-03-14 | 2019-03-15 | R基因股份有限公司 | Uht-stable lysine-saltant type ssDNA/RNA ligase |
| CN109468364A (en) * | 2018-03-15 | 2019-03-15 | 武汉康昕瑞基因健康科技有限公司 | The activity test method of T4DNA ligase |
| CN110964782A (en) * | 2019-12-09 | 2020-04-07 | 上海鹍远健康科技有限公司 | Method for detecting efficiency of single-stranded nucleic acid ligation |
Non-Patent Citations (1)
| Title |
|---|
| 谭慎操等: "固相T4-RNA连接酶", 《北京大学学报(自然科学版)》, no. 01, 20 January 1982 (1982-01-20), pages 64 - 70 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tian et al. | Homogeneous circle-to-circle amplification for real-time optomagnetic detection of SARS-CoV-2 RdRp coding sequence | |
| WO2012142924A1 (en) | METHOD AND PRIMERS FOR DETECTION OF miRNA, AND APPLICATION THEREOF | |
| Hong et al. | Direct detection of circulating microRNAs in serum of cancer patients by coupling protein-facilitated specific enrichment and rolling circle amplification | |
| Liu et al. | Research progress in molecular biology related quantitative methods of MicroRNA | |
| CN105463110B (en) | A method of MicroRNA is detected using two-step amplification method | |
| JP2022185060A (en) | Method for detecting small rna | |
| Song et al. | Palindromic hyperbranched rolling circle amplification enabling ultrasensitive microRNA detection | |
| CN107190091B (en) | Real-time quantitative PCR method suitable for gene expression quantification of FFPE sample | |
| US20230304081A1 (en) | Primer and probe design method, detection composition, and kit for mirna detection | |
| CN116356005B (en) | Composition for detecting CAR-T cell copy number and application thereof | |
| KR20210029727A (en) | Composition for determining false positives using a unique artificial nucleotide sequence and method for determining false positives using the same | |
| CN114317676A (en) | Method for detecting activity of T4RNA ligase | |
| CN115873928B (en) | Rolling circle amplification method based on double-chain-ring template and application thereof | |
| EP4083229A1 (en) | Methods and compositions for nucleic acid detection | |
| JP6698696B2 (en) | Detection of nucleic acid molecules | |
| US8389246B2 (en) | Method for nucleic acid quantitation | |
| EP3447145A1 (en) | Target nucleic acid sequence detection method using multiple amplification nested signal amplification | |
| CN109957611B (en) | Specific quantitative PCR reaction mixed solution, miRNA quantitative detection kit and detection method | |
| US20220119882A1 (en) | Single-stranded nucleic acid for real-time detection of genetic variation of single target gene and detection method using the same | |
| EP1978104A1 (en) | A method for the quantitative analysis of RNA molecules in a sample | |
| CN110603328B (en) | Quantitative PCR amplification primer pair and application thereof | |
| CN110612355B (en) | Composition for quantitative PCR amplification and application thereof | |
| Smith et al. | Rapid quantification of microRNA-375 through one-pot primer-generating rolling circle amplification | |
| CN113088560B (en) | MicroRNA high-throughput detection method and kit based on hybrid capture and enzyme protection | |
| WO2024046097A1 (en) | Method for measuring terminal transferase activity and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |