CN114317470B

CN114317470B - Compound oxalicine B biosynthesis gene cluster and C-15 hydroxylase OxaL and application

Info

Publication number: CN114317470B
Application number: CN202111627219.0A
Authority: CN
Inventors: 余利岩; 张涛; 张德武; 谷国威; 苏静
Original assignee: Institute of Medicinal Biotechnology of CAMS
Current assignee: Institute of Medicinal Biotechnology of CAMS
Priority date: 2021-12-28
Filing date: 2021-12-28
Publication date: 2024-04-30
Anticipated expiration: 2041-12-28
Also published as: CN114317470A

Abstract

The invention discloses a compound oxalicine B biosynthesis gene cluster and a C-15 hydroxylase OxaL and application thereof. The invention provides application of OxaL protein shown in sequence 3 or related biological materials thereof: use as hydroxylase; use of (a 2) for the preparation of hydroxylase. The invention also protects the 15-deoxyoxalicine B biosynthesis gene cluster shown in the sequence 1. The invention also protects the application of the 15-deoxyoxalicine B biosynthetic gene cluster in synthesizing a compound oxalicine B. All the gene and protein information provided by the invention can help people understand the biosynthesis mechanism of natural products of a-pyrone hetero-terpene family, and provide materials and knowledge for further genetic engineering. The gene and the protein thereof provided by the invention can also be used for searching and finding compounds or genes and proteins which can be used in medicine, industry or agriculture.

Description

Compound oxalicine B biosynthesis gene cluster and C-15 hydroxylase OxaL and application

Technical Field

The invention belongs to the fields of microbial gene resources, genetic engineering and biological enzyme development, and in particular relates to an anti-HIV (human immunodeficiency Virus) -1 compound oxalicine B biosynthesis gene cluster, a C-15 hydroxylase OxaL and application thereof.

Background

Oxalicine B has a unique chemical structure, is a novel structural compound of six-ring system skeleton formed by polymerizing pyridyl-alpha-pyrone units and diterpene units, and has a molecular formula of C ₃₀H₃₃NO₇ and a molecular weight of 519.

Oxalicine B belong to the family of alpha-pyrone-containing hetercerpenes (the schematic structure of the family of alpha-pyrone-containing hetercerpenes is shown in figure 1). With the discovery and identification of other compounds of this family, this unique chemical structure has attracted many organic chemists to conduct their chemical synthesis studies. Oxalicines is a secondary metabolite of fungi, mainly isolated from the genus penicillium, which was originally extracted from the mycelium of penicillium oxalicum (Penicillium oxalicum) by Ubillas in 1989. Up to now, researchers have successively isolated oxalicines molecules from Penicillium P.thiersii, P.decaturense and a strain of Aspergillus. oxalicines compounds mainly have insecticidal activity, and researches show that the compound oxalicine B has strong insecticidal activity on spodoptera frugiperda Spodoptera frugiperda and certain cytotoxic activity. Meanwhile, the prior laboratory researches find that oxalicine compounds have antiviral activity, oxalicine B has anti-HIV (HIV-1) activity, and oxalicine A has good anti-influenza A virus (H1N 1) activity.

In 2015, yaegashi, J, et al identified the 15-deoxyoxalicine B biosynthetic gene cluster from Penicillium P.canensens ATCC 10419 (olc) and described and resolved the 15-deoxyoxalicine B biosynthetic pathway using bioinformatics and gene knockout strategies. The biosynthetic pathway of the biosynthetic gene cluster of 15-deoxyoxalicine B is shown in FIG. 2. The source of the non-terpene moieties (a-pyrone and nicotinamide elements) in the biosynthesis of the hetereerpene molecules 15-deoxyoxalicine B is the same as pyripyropene A, but a significant difference occurs after the production of the intermediate compound molecule 4-hydroxy-6- (3-pyridinyl) -2H-pyran-2-one (HPPO). Geranyl pyrophosphate (GGPP) is used as a donor, and is connected with HPPO under the action of UbiA protein isopentenyl transferase OlcH, and GGPP is completed by diterpene synthase coded by olcC genes. In turn, flavin FAD-dependent monooxygenase OlcE works in combination with diterpene cyclase OlcD to form a key five-membered ring intermediate compound molecule predecaturin E, wherein OlcE participates in the oxidation of the long-chain diterpene terminal double bond to form a three-membered oxygen ring, and terpene cyclase OlcD cyclizes the long-chain diterpene. P450 oxidase OlcG participates in the right-hand spiro formation of 15-deoxyoxalicine B molecules, yielding decaturin E intermediate. Thereafter, a cascade of oxidoreductase enzymes is involved, which includes the action of P450 oxidase (OlcJ) and short-chain dehydrogenase/reductase (OlcF), to produce intermediate compound decaturin C having a hemiacetal structure. Finally, under the combined action of the Fe ²⁺ -KG dioxygenase (OlcK), the transmembrane protein drug-resistant pump (OlcL) and the P450 oxidase (OlcB), the target compound molecules 15-deoxyoxalicine B are generated.

Disclosure of Invention

The invention aims to provide a compound oxalicine B biosynthesis gene cluster and a C-15 hydroxylase OxaL and application.

The invention provides an application of OxaL protein or OxaL protein related biological material, which is (a 1) or (a 2):

(a1) Use of OxaL protein or OxaL protein-related biological material as hydroxylase;

(a2) Use of OxaL protein or OxaL protein-related biological material in the preparation of hydroxylase;

The OxaL protein is a protein shown in a sequence 3 in a sequence table;

The OxaL protein related biological material is a gene encoding the OxaL protein, an expression cassette expressing the OxaL protein, an expression vector expressing the OxaL protein or a recombinant microorganism expressing the OxaL protein.

Illustratively, the hydroxylase has the following functions: compound 3 was converted to compound 8.

Illustratively, the hydroxylase has the following functions: compound 2 was converted to compound 9.

Illustratively, the hydroxylase has the following functions: compound 4 was converted to compound oxalicine B.

The invention also protects a 15-deoxyoxalicine B biosynthetic gene cluster, which has 13 genes: oxaM gene, oxaE gene, oxaD gene, oxaC gene, oxaF gene, oxaG gene, oxaL gene, oxaH gene, oxaA gene, oxaI gene, oxaJ gene, oxaK gene and oxaB gene;

the oxaM gene (coding chain) is shown as 409-1287 th position in sequence 1 in a sequence table; the oxaE gene (template chain) has four exons, which correspond to 1819 to 1889, 1966 to 2227, 2280 to 2650 and 2717 to 3392 of sequence 1 in the sequence table in sequence; the oxaD gene (template chain) has two exons, which correspond to 3699-3900 and 3965-4476 of sequence 1 in sequence table in sequence; the oxaC gene (coding chain) has four exons, which correspond to 4847-4897, 4956-5110, 5165-5491 and 5551-6001 of the sequence 1 in the sequence table in sequence; the oxaF gene (template chain) has four exons, which correspond to the 6024 th to 6250 th, 6311 th to 6397 th, 6453 th to 6891 th and 6945 th to 6971 th of the sequence 1 in the sequence table in sequence; the oxaG gene (coding chain) has five exons, which correspond to 7344 to 7568, 7620 to 7736, 7800 to 7971, 8033 to 8647 and 8706 to 9145 of the sequence 1 in the sequence table in sequence; the oxaL gene (template chain) is provided with three exons, which correspond to 9903 th to 10063 th, 10112 th to 10563 th and 10625 th to 11535 th of the sequence 1 in the sequence table in sequence; the oxaH gene (coding chain) has two exons, which correspond to 11801-11912 bits and 11971-12911 bits of sequence 1 in sequence table in sequence; the oxaA gene (coding chain) is shown as 13529 th-20836 th position in sequence 1 in the sequence table; the oxaI gene (coding chain) has two exons, which correspond to 21517-21749 and 21798-23435 of sequence 1 in sequence table in sequence; the oxaJ gene (template chain) has two exons, which correspond to the 23483-24757 position and 24824-25174 position of the sequence 1 in sequence table in sequence; the oxaK gene (template chain) is shown as 25296-26171 in the sequence 1 in the sequence table; the oxaB gene (coding chain) has two exons, which correspond to 26443-27567 th and 27628-27975 th positions of sequence 1 in the sequence table in sequence.

The 15-deoxyoxalicine B biosynthesis gene cluster is specifically shown as a sequence 1 in a sequence table.

The invention also protects the application of the 15-deoxyoxalicine B biosynthetic gene cluster in synthesizing a compound oxalicine B.

In this application, the synthesis of compound oxalicine B is performed in penicillium.

In this application, the synthesis of compound oxalicine B is performed in penicillium oxalicum.

In this application, the synthesis of compound oxalicine B was performed in P.oxalicum 114-2.

The invention also protects OxaL protein, which is shown as a sequence 3 in a sequence table.

The invention also protects the gene encoding the OxaL protein.

The gene for encoding OxaL protein can be specifically shown as a sequence 2 in a sequence table.

The gene (template chain) for encoding OxaL protein has three exons, which correspond to 9903-10063, 10112-10563 and 10625-11535 of sequence 1 in sequence table.

The invention also protects recombinant microorganisms expressing the OxaL protein.

The recombinant microorganism is specifically a recombinant microorganism obtained by introducing a gene encoding the OxaL protein into a host microorganism.

The host microorganism may be a yeast, in particular Saccharomyces cerevisiae, more in particular S.cerevisiae RC01.

The gene encoding the OxaL protein may be introduced into the host microorganism, in particular, by an expression vector expressing the OxaL protein.

The expression vector for expressing the OxaL protein can be a oxaL gene overexpression vector.

The expression vector for expressing OxaL protein can be specifically: the small fragment between NdeI and PmeI enzyme cutting sites of the yeast expression plasmid pXW06 is replaced by a DNA molecule shown in a sequence 2 of a sequence table to obtain a recombinant plasmid pXW06-oxaL.

The invention also protects the application of OxaL protein in the synthesis of the compound oxalicine B.

The invention also protects the use of the recombinant microorganism as follows (b 1) or (b 2) or (b 3):

(b1) Use in converting compound 3 to compound 8;

(b2) Use in converting compound 2to compound 9;

(b3) Use in converting compound 4 to compound oxalicine B.

The invention also protects the total protein of the recombinant microorganism.

The total protein is in the form of microsomes.

The preparation method of the total protein sequentially comprises the following steps:

(1) Culturing the recombinant microorganism, centrifuging to collect thalli, and re-suspending with microsomal extract;

(2) Cell wall disruption is performed;

(3) Centrifuging and collecting supernatant containing total protein;

(4) And centrifuging and collecting the precipitate to obtain the total protein.

In step (1), a liquid YPD medium is used for culturing the recombinant microorganism.

In step (1), the conditions for culturing the recombinant microorganism are: the culture was carried out at 28℃and 200rpm for 2 days.

In step (2), cell wall disruption is performed by adding glass beads and vortexing.

In the step (3), the centrifugation conditions are as follows: centrifuge at 4000rpm at 4℃for 5min.

In the step (4), the centrifugation conditions are as follows: centrifuge at 17000rpm at 4℃for 50min.

Microsomal extract: TES buffer containing 10g/L bovine serum albumin, 2mM beta-mercaptoethanol, balance pH 7.5.

The invention also protects the use of the total protein as follows (b 1) or (b 2) or (b 3):

(b1) Use in converting compound 3 to compound 8;

(b2) Use in converting compound 2to compound 9;

(b3) Use in converting compound 4 to compound oxalicine B.

Compound 3 is shown in formula I. Compound 8 is shown in formula II.

Compound 2 is shown in formula iii. Compound 9 is shown in formula iv.

Compound 4 is shown in formula v. Compound oxalicine B is shown in formula vi.

The inventor of the invention takes oxalicine B compound from penicillium oxalicum as target molecule and combines genome excavation to locate oxalicine B biosynthesis gene cluster oxa. Comparison found that oxaL (encoding P450 oxidase) and oxaM (encoding NADPH dependent P450 oxidoreductase) in the oxa gene cluster were not present in the biosynthesis gene cluster olc of 15-deoxyoxalicine B. In connection with bioinformatic alignment analysis, oxaL is presumably responsible for the hydroxylation reaction at position C-15 in the oxalicine B compound molecule. Meanwhile, the biosynthesis of the natural product is studied by adopting a method combining molecular genetics, bioinformatics, biochemistry and natural product chemistry. By studying the biosynthesis of natural products of this family, studies from both genetic and enzymatic levels can help one understand how to synthesize such numerous structurally complex and similar compounds in nature. On the basis of elucidating the biosynthesis way in nature and understanding the natural combined biosynthesis mechanism of the natural alpha-pyrone hetero-terpene compounds, people can produce a plurality of structural analogues which do not exist in nature by utilizing a combined biosynthesis method, and provide molecules and activity diversity for the discovery and drug development of new active 'non-natural' products.

The contribution of the invention is as follows: a biosynthetic gene cluster for producing antibiotic-oxalicine B with anti-HIV-1 activity in penicillium oxalate P.oxacum 114-2 is provided, and the OxaL protein encoded therein is subjected to functional research and application. The invention reports oxalicine B biosynthesis gene cluster oxa for the first time, and the function of C-15 hydroxylation reaction enzyme-P450 oxidase OxaL in oxalicines class compound molecules and enzyme catalytic machine are clarified and analyzed for the first time. The information provided by the invention, which contains all genes and proteins related to oxalicine B biosynthesis, can help people understand the biosynthesis mechanism of natural products of a-pyrone hetero-terpene family, and provides materials and knowledge for further genetic engineering. The gene and the protein thereof provided by the invention can also be used for searching and finding compounds or genes and proteins which can be used in medicine, industry or agriculture.

Drawings

FIG. 1 is a schematic representation of the structure of a family of alpha-pyrone-containing hetercerpenes.

FIG. 2 is a schematic representation of the biosynthetic pathway of the biosynthetic gene cluster of FIGS. 15-deoxyoxalicine B.

FIG. 3 is a schematic representation of the elements of the 15-deoxyoxalicine B biosynthetic gene cluster and the oxalicine B biosynthetic gene cluster.

FIG. 4 is an electrophoretogram of PCR amplification products in example 2 and example 3.

Fig. 5 is an HPLC profile of example 4.

FIG. 6 is a structural formula of each compound prepared in example 5.

FIG. 7 is a graph showing the results of example 6.

FIG. 8 shows the possible 4 biosynthetic pathways from decaturin C to target compound oxalicine B in the late stage of oxalicine B biosynthesis, as predicted in example 7.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified. Yeast transformation kit (Frozen-EZ Yeast Transformation II Kit): ZYMO company; cat.no.t2001. Solutions I, II and III are all components of a yeast transformation kit. Unless otherwise indicated, the quantitative tests in the examples below were all performed in triplicate, and the results averaged.

Penicillium oxalate (Penicillium oxalicum) 114-2, also known as P.oxalicum 114-2, is described in the following document ：Production of a high-efficiency cellulase complex viaβ-glucosidase engineering in Penicillium oxalicum;Guangshan Yao,Ruimei Wu,Qinbiao Kan,Liwei Gao,Meng Liu,Piao Yang,Jian Du,Zhonghai Li,Yinbo Qu;Yao et al.Biotechnol Biofuels(2016)9:78.

Yeast expression plasmid pXW06 (Yeast expression plasmid pXW 06) is described in the following document ：Biosynthesis of Heptacyclic Duclauxins Requires Extensive Redox Modifications of the Phenalenone Aromatic Polyketide;Shu-Shan,Gao,Tao,Zhang,Marc,Garcia-Borràs,Yiu-Sun,Hung,John,M;10.1021/jacs.8b03705;2018.

Saccharomyces cerevisiae (Saccharomyces cerevisiae) RC01, also known as S.cerevisiae RC01, is described in ：Genome Mining and Assembly-Line Biosynthesis of the UCS1025A Pyrrolizidinone Family of Fungal Alkaloids;Li Li,Man-Cheng Tang,Shoubin Tang,Shushan Gao,Sameh Soliman,Leibniz Hang,Wei Xu,Tao Ye,Kenji Watanabe,Yi Tang.J.Am.Chem.Soc.2018,140,6,2067–2071.

MEPA medium (100 ml): malt extract 1.5g, soybean cake powder 0.2g, agar 2g and the balance of water. Dichloromethane-methanol: from 1 part by volume of methylene chloride and 1 part by volume of methanol.

Liquid Trp-auxotrophic media (100 mL): contains Difco ^TM yeast basic nitrogen source (BD, 239210) 0.67g,Yeast synthetic Drop-out Medium supplements (Sigma, Y2001) 0.14g, L-leucine 0.02g, uracil 0.02g, glucose 0.8g, balance water. Solid Trp-auxotrophic media differ from liquid Trp-auxotrophic media only by the addition of agar.

EXAMPLE 1, oxalicine B biosynthetic Gene Cluster was found from P.oxalicum114-2

A section of contig region is obtained by screening the genomic DNA of P.oxalicum 114-2 by using 15-deoxyoxalicine B biosynthesis key polyketide synthase (OlcA) coding gene. Genome and microbial secondary metabolite synthesis gene cluster prediction is utilized. Analysis was performed by ANTISMASH and Softberry (http:// www.softberry.com /) database online tool. Protein function annotation homology searches of amino acid sequences were performed in the GenBank protein database by means of the BLAST program (http:// www.ncbi.nlm.nih.gov/Blastp /). Amino acid sequence alignment was performed using the Clustalx program. Oxalicine B biosynthetic gene clusters were found in P.oxalicum 114-2. oxalicine B biosynthesis gene clusters have 13 genes, as shown in a sequence 1 in a sequence table (in the sequence 1, part of genes are coding chains and part of genes are template chains).

The elements of the 15-deoxyoxalicine B biosynthetic gene cluster and the oxalicine B biosynthetic gene cluster obtained according to the invention are schematically shown in FIG. 3.

The 13 genes in oxalicine B biosynthetic gene clusters are: oxaM gene, oxaE gene, oxaD gene, oxaC gene, oxaF gene, oxaG gene, oxaL gene, oxaH gene, oxaA gene, oxaI gene, oxaJ gene, oxaK gene, oxaB gene.

The proteins encoded by the individual genes are shown in Table 1.

Table 1oxalicine B Gene and functional annotation of biosynthetic Gene clusters

OxaM gene, as shown in 409-1287 th nucleotide (coding strand; without intron) in sequence 1 of the sequence table; the oxaM gene codes for NADPH-P450 oxidoreductase. oxaE gene, as shown in 1819-3392 (template strand; with intron; exon: 1819-1889, 1966-2227, 2280-2650, 2717-3392) in sequence 1 of the sequence table; the oxaE gene encodes a FAD-dependent monooxygenase. oxaD gene, as shown in 3699-4476 (template strand; with intron; exon: 3699-3900, 3965-4476) in sequence 1 of the sequence table; the oxaD gene encodes a terpene cyclase. oxaC gene, as shown in 4847-6001 nucleotide (coding strand; with intron; exon: 4847-4897, 4956-5110, 5165-5491, 5551-6001) in sequence 1 of the sequence table; the oxaC gene encodes a diterpene synthase. oxaF gene, as shown in nucleotide 6024-6971 (template strand; with intron; exon: 6024-6250, 6311-6397, 6453-6891, 6945-6971) in sequence 1 of the sequence table; oxaF gene codes for short-chain dehydrogenase/reductase. oxaG gene, as shown in 7344-9145 nucleotide (coding strand; with intron; exon: 7344-7568, 7620-7736, 7800-7971, 8033-8647, 8706-9145) in sequence 1 of the sequence table; oxaG gene codes for P450 oxidase. oxaL gene, as shown in 9903-11535 nucleotide (template strand; with intron; exon: 9903-10063, 10112-10563, 10625-11535) in sequence 1 of the sequence table; oxaL gene codes for P450 oxidase shown in sequence 3 of a sequence table. oxaH gene, as shown in 11801-12911 nucleotide in sequence 1 of the sequence table (coding strand; with intron; exon: 11801-11912, 11971-12911); the oxaH gene encodes an isopentenyl transferase. oxaA gene, as shown in 13529 th-20836 th nucleotide in sequence 1 of the sequence table (coding strand; without intron); oxaA gene codes for polyketide synthase. oxaI gene as shown in 21517-23435 nucleotide (coding strand; with intron; exon: 21517-21729, 21798-23435) in sequence 1 of the sequence table; the oxaI gene encodes a CoA ligase. oxaJ gene, as shown in 23483-25174 (template strand; with intron; exon: 23483-24757, 24824-25174) in sequence 1 of the sequence table; oxaJ gene codes for P450 oxidase. oxaK gene, as shown in 25296-26171 nucleotide in sequence 1 of the sequence table (template strand; without intron); oxaK gene codes for Fe (II)/a-KG-dependent dioxygenase. oxaB gene, as shown in 26443-27975 nucleotides (coding strand; with intron; exon: 26443-27567,27628-27975) in sequence 1 of the sequence table; oxaB gene codes for P450 oxidase.

The biosynthetic pathway of oxalicine B in oxalicum114-2 is as follows: ① Forming a-pyrone under the action of polyketide synthase coded by oxaA genes; ② The CoA ligase encoded by oxaI gene links the niacinamide to the a-pyrone, forming HPPO intermediate compounds; ③ The oxaC gene encoded diterpene synthase is responsible for synthesizing from the precursor substance mevalonate to long-chain diterpene; ④ The oxaH gene encodes an isopentenyl transferase responsible for transferring long chain diterpenes to HPPO biosynthetic intermediates; ⑤ The monooxygenase coded by oxaE genes and the terpene cyclase coded by oxaD genes are responsible for the oxidation of the terminal double bond of the long-chain diterpene of the intermediate to form a trioxycycle and the cyclization of the diterpene to form an intermediate predecaturin E; ⑥ The three oxidoreductases encoded by oxaG, oxaJ and oxaF are involved in the predecaturin E to decaturin C cascade reaction system, wherein the P450 oxidase (OxaG) is involved in the formation of the right-hand spiro ring of the oxalicine B molecule; ⑦ Thereafter, under the combined action of P450 oxidase (OxaL), fe ²⁺ -dependent a-KG dioxygenase (OxaK) and P450 oxidase (OxaB), the target compound molecule oxalicine B is produced, wherein OxaL is responsible for C-15 hydroxylation reaction, oxaK is responsible for C-23 hydroxyl group introduction, and OxaB participates in the formation of a left spiro ring of oxalicine B molecules. oxaM encoded NADPH-P450 oxidoreductase does not participate in specific backbone synthesis, ligation or modification reactions in the oxalicineB molecular biosynthetic pathway, as a chaperone for the P450 oxidase.

Example 2 preparation of oxaA Gene knockout Strain

1. Construction of knockout vectors

OxaA gene knockout vector: the recombinant plasmid pXW 06-Delta oxaA is obtained by replacing a small fragment between NdeI and PmeI enzyme cutting sites of a yeast expression plasmid pXW06 with a DNA molecule shown in a sequence 4 of a sequence table. In the DNA molecule shown in the sequence 4 of the sequence table, nucleotides 1 to 2200 are the upstream homology arm oxaA-UP of oxaA genes, nucleotides 2201 to 3802 are hygromycin resistance genes, and nucleotides 3803 to 5926 are the downstream homology arm oxaA-DN of oxaA genes.

2. Protoplast transformation

1. Spores of P.oxalicum 114-2 were taken, washed with Osmotic buffer, then suspended in 10mL of Trichoderma lyase solution, and cultured with shaking at 30℃and 120rpm for 4 hours.

Osmotic buffer (ph 5.8): contains 1.2M MgSO ₄ and 20mM sodium phosphate, the balance being water. 10mL of Trichoderma lyase solution: consists of 10mg of Trichoderma lyase and 10mL Osmotic buffer. Trichoderma lyase (1U/mg): sigma, L1412-5G.

2. After the step 1 is completed, collecting the supernatant containing the protoplasts, adding an equal volume of STC buffer, centrifuging at 3000rpm for 5min, and collecting the precipitate (the precipitate is the protoplasts).

STC buffer (pH 7.0): contains 1.0M sorbitol and 0.1M Tris-HCl, the balance being water.

3. Suspending the precipitate obtained in the step 2 in 200-500 mu L STC buffer solution, adding 50 mu L oxaA gene knockout carrier, standing on ice for 20min, adding 1.0mL 60% PEG ₆₀₀₀ buffer solution, coating on a screening culture medium plate, and performing forward culture at 28 ℃.

60% PEG ₆₀₀₀ buffer (pH 7.5): contains 5mM CaCl ₂, 50mM Tris-HCl and 60g/100mL PEG ₆₀₀₀, the balance being water.

Screening the culture medium: PDA medium containing 200. Mu.g/ml hygromycin B.

4. Clones which can grow normally in the step 3 are transferred to a new screening culture medium plate one by one, and are cultivated at 28 ℃.

After step 4, 130 hygromycin resistant transformants which can grow normally were selected.

3. Screening recombinant bacteria

10 Hygromycin resistant transformants obtained in step two, were randomly picked up and molecular identified using P.oxaceum 114-2 as a wild strain control (WT).

1. Extracting genome DNA.

2. PCR amplification was performed using genomic DNA as a template and primer pairs consisting of hph-for and hph-rev (target sequence located at hygromycin resistance gene), and then the amplified product was sequenced. All 10 transformants showed the expected size (515 bp) of amplified product, and the sequencing result showed the target amplified product.

hph-for：TCGTTATGTTTATCGGCACT；hph-rev：TGTTGGCGACCTCGTATT。

3. PCR amplification was performed using genomic DNA as a template and primer pairs consisting of Check ALs for and CHECK HPH REV. Check ALs for is derived from the left homology arm upstream region and CHECK HPH REV is derived from the hygromycin resistance gene region. The oxaA gene knockout strain can amplify PCR fragments (3065 bp), and the wild strain can not realize amplification.

Check ALs for：GCAGATTTGATGCGAAGG；Check hph rev：GAACCCGCTCGTCTGGCTAAG。

4. PCR amplification was performed using genomic DNA as a template and primer pairs consisting of Check hph for and CHECK ARS REV. Check hph for is derived from the hygromycin resistance gene region and CHECK ARS REV is derived from the right homology arm downstream region. The oxaA gene knockout strain can amplify PCR fragments (2524 bp), and the wild strain cannot be amplified.

Check hph for：TGGCTGTGTAGAAGTACTCGC；Check ARs rev：TTCCTATCACGGGTCAGC。

5. PCR amplification was performed using genomic DNA as a template and primer pairs consisting of Check ALs for and CHECK ALS REV. The wild strain can amplify PCR fragment (2467 bp), and oxaA gene knockout strain can not realize amplification.

Check ALs rev：CTGTGGACTGGCATTGATA。

The electrophoretogram of each amplification product is shown in FIG. 4A. In FIG. 4A, lanes 1 and 5 are each an amplification product obtained by PCR amplification using a primer set composed of Check ALs for and CHECK HPH REV, lanes 2 and 6 are each an amplification product obtained by PCR amplification using a primer set composed of Check hph for and CHECK ARS REV, and lanes 3 and 7 are each an amplification product obtained by PCR amplification using a primer set composed of Check ALs for and CHECK ALS REV.

Example 3 preparation of oxaL Gene knockout Strain

1. Construction of knockout vectors

OxaL gene knockout vector: the recombinant plasmid pXW 06-Delta oxaL is obtained by replacing a small fragment between NdeI and PmeI enzyme cutting sites of a yeast expression plasmid pXW06 with a DNA molecule shown in a sequence 5 of a sequence table. In the DNA molecule shown in the sequence 5 of the sequence table, nucleotide numbers 1-2090 are the homology arm oxaL-UP at the upstream of oxaL genes, nucleotide numbers 2091-3692 are hygromycin resistance genes, and nucleotide numbers 3693-5716 are the homology arm oxaL-DN at the downstream of oxaL genes.

2. Protoplast transformation

The oxaL gene knockout vector was used instead of the oxaA gene knockout vector, and the procedure II of example 2 was repeated.

After step 4 was completed, 120 hygromycin resistant transformants which could grow normally were selected.

3. Screening recombinant bacteria

1. Extracting genome DNA.

hph-for：TCGTTATGTTTATCGGCACT；hph-rev：TGTTGGCGACCTCGTATT。

3. PCR amplification was performed using genomic DNA as a template and primer pairs consisting of Check LLs for and CHECK HPH REV. Check LLs for is derived from the left homology arm upstream region and CHECK HPH REV is derived from the hygromycin resistance gene region. The oxaL gene knockout strain can amplify PCR fragments (2994 bp), and the wild strain can not realize amplification.

Check LLs for：TCACGCTATACGAAACGA；Check hph rev：GAACCCGCTCGTCTGGCTAAG。

4. PCR amplification was performed using genomic DNA as a template and primer pairs consisting of Check hph for and CHECK LRS REV. Check hph for is derived from the hygromycin resistance gene region and CHECK LRS REV is derived from the right homology arm downstream gene region. The oxaL gene knockout strain can amplify PCR fragments (2607 bp), and the wild strain can not realize amplification.

Check hph for：TGGCTGTGTAGAAGTACTCGC；Check LRs rev：TGGGCTGATGCTGAAGAAA。

5. PCR amplification was performed using genomic DNA as template and primer pairs consisting of Check LRs for and CHECK LRS REV. The wild strain can amplify PCR fragment (2532 bp), and oxaL gene knockout strain can not realize amplification.

Check LRs for：TGCGGTAGGATGACGACG。

The results are shown in FIG. 4B. In FIG. 4B, lanes 1 and 5 are each the amplification products of PCR amplification using a primer set of Check LLs for and CHECK HPH REV, lanes 2 and 6 are each the amplification products of PCR amplification using a primer set of Check hph for and CHECK LRS REV, and lanes 3 and 7 are each the amplification products of PCR amplification using a primer set of Check LRs for and CHECK LRS REV.

EXAMPLE 4 Metabolic Spectrometry HPLC analysis

Test strain: the p.oxalicum 114-2 (WT), oxaA gene knockout strain prepared in example 2 (Δ oxaA) or oxaL gene knockout strain prepared in example 3 (Δ oxaL), respectively.

The test strain was inoculated into MEPA medium plates (plate diameter: 3 cm) and cultured at 28℃for 6 days. All cultures (whole culture system with medium) were then collected in 15ml centrifuge tubes and extracted by ultrasound with 5ml ethyl acetate at room temperature for 30min (ultrasound frequency 25KHz, ultrasound power 800W). Then centrifuged at 5000rpm for 10min, the supernatant was collected, the solvent was evaporated to dryness with a solvent evaporation station (GeneVac EZ-2), then 500. Mu.L of acetonitrile (chromatographic purity) was added to dissolve the residue, and then centrifuged at 13000rpm for 10min, and the supernatant was collected.

The supernatant was applied to Agilent 1290 for HPLC detection analysis.

Chromatograph: high performance liquid chromatograph (Agilent 1290 tandem liquid evaporative light scattering detector ELSD);

Chromatographic column: agilent ZORBAX SB-C18,5 μm, 4.6X1250 mm; the flow rate was 1mL/min.

The elution process comprises the following steps: the elution time is 30min; the eluent consists of acetonitrile and water; at the initial time and the final time, the volume fraction of acetonitrile in the eluent is linearly increased from 5% to 99%.

The results are shown in FIG. 5. Oxalicum 114-2 may produce target compound molecule oxalicine B (corresponding peak labeled 1). The oxaA knockout strain was unable to produce oxalicine B, further confirming that the gene cluster found in example 1 of the present invention is the oxalicine B biosynthetic gene cluster. The oxaL knockout strain likewise failed to produce oxalicine B while accumulating intermediate compound molecules (corresponding peaks labeled 2,3, and 4;2 for compound 2,3 for example 5 and compound 3,4 for example 5 and compound 4 for example 5).

Example 5 isolation and purification and structural characterization of intermediate Compounds produced by oxaL Gene knockout Strain

1. Preparation and isolation and purification of the Compounds

1. The oxaL gene knockout strain (. DELTA. oxaL) prepared in example 3, spores were collected and suspended in sterile water to give a spore suspension having a spore concentration of (1-2). Times.10 ⁶/ml; 300-400. Mu.l of the spore suspension was inoculated into MEPA medium plates (15 cm diameter) and incubated at 28℃for 6 days. At least 150 replicates were set.

2. Mixing 150 plates to complete all cultures (the whole culture system including the culture medium) in the step 1, adding 5L of ethyl acetate, performing ultrasonic extraction at room temperature for 3 hours, and collecting an organic phase; adding 5L ethyl acetate into the residue, performing ultrasonic extraction for 3 hours at room temperature, and collecting an organic phase; adding 5L ethyl acetate into the residue, performing ultrasonic extraction for 3 hours at room temperature, and collecting an organic phase; the organic phases obtained by the three extractions are combined and concentrated to constant weight under reduced pressure at 40 ℃ to obtain 12g of extract. Ultrasonic parameters of ultrasonic extraction: the ultrasonic frequency is 25KHz, and the ultrasonic power is 800W.

3. Dissolving the extract obtained in the step 2 in dichloromethane-methanol, uniformly stirring with 20g of normal phase silica gel (60-100 meshes), concentrating to constant weight by adopting a rotary evaporator to obtain a solid sample, filling the solid sample into a sample column, connecting the sample column, and separating by using a chromatograph.

The chromatographic column is normal phase silica gel chromatographic column, and the packing medium is column chromatography silica gel (200-300 mesh, 330 g).

The chromatograph is a Combiflash Rf200 preparative chromatograph from TELEDYNE ISCO Co.

Mobile phase a: dichloromethane; mobile phase B: acetone. Mobile phase flow rate: 30mL/min. Detection wavelength: 230nm.

The elution process comprises the following steps: 0-5min, wherein the mobile phase is mobile phase A;5-80min, the volume fraction of the mobile phase B in the mobile phase is linearly increased from 0% to 100%, and the volume fraction of the mobile phase A in the mobile phase is linearly decreased from 100% to 0%;80-105min, and the mobile phase is mobile phase B.

The whole elution process continuously collects the eluent after passing through the column, 1 bottle is collected every 150mL, and 21 bottles are collected in total. The 1 st to 4 th bottles are combined to form a fraction Fr.1, the 5 th to 9 th bottles are combined to form a fraction Fr.2, the 10 th to 12 th bottles are combined to form a fraction Fr.3, the 13 th to 14 th bottles are combined to form a fraction Fr.4, the 15 th to 19 th bottles are combined to form a fraction Fr.5, and the 20 th to 21 th bottles are combined to form a fraction Fr.6.

The fractions were concentrated to constant weight using a rotary evaporator to give dry matter.

4. The dry matter of fraction fr.2 obtained in step 3 (79 mg) was dissolved in dichloromethane-methanol, then loaded and separated by gel column chromatography. The column size of the gel column chromatography was 30X 1700mm (diameter X length), and the packing medium was Sephadex LH-20 (80 g). The mobile phase is: dichloromethane-methanol. The elution after passing through the column was continuously collected throughout the elution process, 1 bottle was collected for 1-100mL (i.e., fraction Fr.2-1), followed by 10 bottles per 20mL of 1 bottle (fractions Fr.2-2 to Fr.2-11 in order).

5. The dry matter (16 mg) of fractions Fr.2-5 obtained in step 4 was dissolved in 0.5mL of methanol, and then separated and purified by chromatography.

Chromatograph: hanbang NP7000.

Chromatographic column: sunFire C18, 10mm 250mm, pore size 5 μm, waters company.

Mobile phase: consists of 45 parts by volume of acetonitrile and 55 parts by volume of water. Mobile phase flow rate: 6mL/min. Detection wavelength: 230nm.

Collecting the eluent after passing through the column with the retention time of 12.1min corresponding to the peak value, concentrating to constant weight by adopting a rotary evaporator to obtain 2.3mg of yellow solid product, namely the compound 3.

6. The dry matter of fraction fr.3 obtained in step 3 (117.8 mg) was dissolved in dichloromethane-methanol, then loaded and separated by gel column chromatography. The column size of the gel column chromatography was 30X 1700mm (diameter X length), and the packing medium was Sephadex LH-20 (80 g). The mobile phase is: dichloromethane-methanol. The elution after passing through the column was continuously collected for the whole elution process, 1 bottle was collected for 1-100mL (i.e., fraction Fr.3-1), followed by 11 bottles per 20mL of 1 bottle (fractions Fr.3-2 to Fr.3-12 in order).

7. The dry matter (20 mg) of fraction Fr.3-5 obtained in step 6 was dissolved in 0.5mL of methanol, and then separated and purified by chromatography.

Chromatograph: hanbang NP7000.

Collecting the eluent after passing through the column with retention time of 8.7min, concentrating to constant weight by rotary evaporator to obtain 8.7mg yellow solid product, namely compound 4.

8. The dry matter (115 mg) of fraction fr.5 obtained in step 3 was dissolved in dichloromethane-methanol, then loaded and separated by gel column chromatography. The column size of the gel column chromatography was 30X 1700mm (diameter X length), and the packing medium was Sephadex LH-20 (80 g). The mobile phase is: dichloromethane-methanol. The elution after passing through the column was continuously collected throughout the elution process, 1 bottle was collected for 1-100mL (i.e., fraction Fr.5-1), followed by a total of 14 bottles per 20mL of 1 bottle collected (fractions Fr.5-2 through Fr.5-15 in order).

9. The dry matter (26.5 mg) of fraction Fr.5-5 obtained in step 8 was dissolved in 0.7mL of methanol, and then separated and purified by chromatography.

Chromatograph: hanbang NP7000.

Mobile phase: consists of 40 parts by volume of acetonitrile and 60 parts by volume of water. Mobile phase flow rate: 6mL/min. Detection wavelength: 230nm.

Collecting the eluent after passing through the column with the retention time of 7.0min corresponding to the peak value, concentrating to constant weight by adopting a rotary evaporator to obtain 13.9mg yellow solid product, namely the compound 2.

10. The dry matter (185.8 mg) of fraction fr.6 obtained in step 3 was dissolved in dichloromethane-methanol, then loaded and separated by gel column chromatography. The column size of the gel column chromatography was 30X 1700mm (diameter X length), and the packing medium was Sephadex LH-20 (80 g). The mobile phase is: dichloromethane-methanol. The elution after passing through the column was continuously collected throughout the elution process, 1 bottle was collected for 1-100mL (i.e., fraction Fr.6-1), followed by 10 bottles per 20mL of 1 bottle (fractions Fr.6-2 to Fr.6-11 in order).

11. The dry matter (15 mg) of fraction Fr.6-6 obtained in step 10 was dissolved in 0.5mL of methanol, and then separated and purified by chromatography.

Chromatograph: agilent 1100.

Chromatographic column: YMC-C18, 10 mm. Times.250 mm, pore size 5 μm, japan YMC company.

Mobile phase: consists of 35 parts by volume of acetonitrile and 65 parts by volume of water. Mobile phase flow rate: 4mL/min. Detection wavelength: 230nm.

Collecting the eluent after passing through the column with the retention time of 17.4min corresponding to the peak value, concentrating to constant weight by adopting a rotary evaporator to obtain 1mg of pale yellow solid product, namely the compound 7.

12. The dry matter of fraction fr.1 obtained in step 3 (138.1 mg) was dissolved in dichloromethane-methanol, then loaded and separated by gel column chromatography. The column size of the gel column chromatography was 30X 1700mm (diameter X length), and the packing medium was Sephadex LH-20 (80 g). The mobile phase is: dichloromethane-methanol. The elution after passing through the column was continuously collected for the whole elution process, 1 bottle was collected for 1-100mL (i.e., fraction Fr.1-1), followed by 11 bottles per 20mL of 1 bottle (fractions Fr.1-2 to Fr.1-12 in order).

13. The dry matter (0.8 mg) of fractions Fr.1-3 obtained in step 12 was dissolved in 0.3mL of methanol, and the mixture was separated and purified by chromatography.

Chromatograph: hanbang NP7000.

Mobile phase: consists of 50 parts by volume of acetonitrile and 50 parts by volume of water. Mobile phase flow rate: 6mL/min. Detection wavelength: 230nm.

Collecting the eluent after passing through the column with the retention time of 22.5min corresponding to the peak value, concentrating to constant weight by adopting a rotary evaporator to obtain 0.4mg yellow solid product, namely the compound 6.

14. The dry matter (22.8 mg) of fractions Fr.1-5 obtained in step 12 was dissolved in 0.5mL of methanol, and the mixture was separated and purified by chromatography.

Chromatograph: hanbang NP7000.

Collecting the eluent after passing through the column with the retention time of 17.4min corresponding to the peak value, concentrating to constant weight by adopting a rotary evaporator to obtain 4.5mg of product, namely the product Fr.1-5-1.

15. All the products Fr.1-5-1 obtained in the step 14 were dissolved in 0.3mL of methanol, and the mixture was separated and purified by chromatography.

Chromatograph: agilent 1100.

Mobile phase a: water; mobile phase B: acetonitrile. Mobile phase flow rate: 4mL/min. Detection wavelength: 230nm.

Elution procedure: and 0-10min, the volume fraction of the mobile phase B in the mobile phase is linearly increased from 70% to 100%, and the volume fraction of the mobile phase A in the mobile phase is linearly decreased from 30% to 0%.

And collecting the column-passing solution of the elution peak with the retention time of 4.1min corresponding to the peak value, and concentrating to constant weight by adopting a rotary evaporator to obtain 0.9mg of yellow solid product, namely the compound 5.

2. Identification of Compounds

In the first step, 1 oxalicine kinds of compounds (compound 4) and 5 kinds of decaturin analogues (compound 2, compound 3, compound 7, compound 5 and compound 6) are separated. By nuclear magnetic resonance and mass spectrometry, 3 main compounds were identified as 15-deoxyoxalicine B (compound 4), decaturin C (compound 3) and decaturin A (compound 2), all of which are intermediates for the biosynthesis of compound oxalicine B. By nuclear magnetic resonance and mass spectrometry, 3 additional compounds, decaturin H (compound 5), decaturin I (compound 6) and decaturin F (compound 7), respectively, were identified. decaturin I (Compound 6) and decaturin F (Compound 7) are novel decaturin derivatives.

The identification data for each compound is as follows:

The HRESIMS ion peak of compound 5 is M/Z504.2369 [ M+H ] +, corresponding to formula C ₃₀H₃₃NO₆ with unsaturation of 15. The ¹H、¹³ C and HSQC NMR data of compound 5 showed that there was 4 methyl [δ_H 0.84(3H,s),δ_C17.1;δ_H1.04(3H,s),δ_C 26.1;δ_H 1.05(3H,s),δ_C 15.5;δ_H 1.64(3H,s),δ_C 18.0], -alkenylene [ delta _H5.72(1H,d,J＝5.4Hz),δ_C 128.4.4 ] and that the ¹ H and ¹³ C NMR spectra of the typical pyridine- α -pyrrolidinyl group [δ_H 7.27(1H,s),δ_C94.1;δ_H 7.56(1H,br s),δ_C 124.1;δ_H 8.23(1H,d,J＝7.8Hz),δ_C 133.1;δ_H 8.71(1H,br s),δ_C 151.4;δ_H 9.10(1H,br s),δ_C 146.7;δ_C 169.8,159.6,159.5,127.3,and 101.3]. of compound 5 were similar to decaturin C (compound 3), with the obvious difference that the carbonyl signal (delta _C 173.5) was present in compound 3, rather than one oxymethylene signal [ (delta _H 4.07(1H,dd,J＝9.0,3.0Hz),3.73(1H,d,J＝9.0Hz);δ_C 66.3.3 ]. The position of the carbonyl group was further confirmed by the correlation of C-29/H-19, H-23 and H-25 in HMBC. Complete assignment of compound 5 was established by detailed analysis of the DEPT, ¹H-¹ H COSY, HSQC, HMBC spectra. By analysis of ¹ H and ¹³ C NMR data, NOESY correlation and ECD spectra and the biological basis, the relative configuration and absolute configuration of compound 5 were the same as that of compound 3. In summary, compound 5 may not be a precursor of oxalicine B, but a product of obvious other pathways.

The HRESIMS ion peak of compound 6 is M/Z518.2528 [ M+H ] ⁺, consistent with the molecular formula of C ₃₁H₃₅NO₆, indicating that a methyl group may be introduced as compared to compound 5. The ¹ H and ¹³ C NMR data for compound 6 are similar to compound 5 except for the presence of a methoxy moiety (δ _H 3.30;δ_C 50.5.5). Correlation from H-34 to C-27 in the HMBC spectra confirm the position of the methoxy group. The stereochemistry of compound 6 was similar to that of compound 5 based on nuclear magnetic resonance data, NOESY experiments and ECD spectroscopy.

¹ H-NMR and ¹³ C-NMR data for Compound 5 and Compound 6 are shown in Table 3.

TABLE 3 ¹ H-NMR and ¹³ C-NMR data for Compound 5 and Compound 6

/>

Spectroscopic data for Compound 2 ：(+)ESI-MS m/z 506.5[M+H]⁺;¹H-NMR(600MHz,DMSO-d₆)δ:9.09(1H,d,J＝2.4Hz),8.38(1H,dd,J＝4.8,1.8Hz),8.24(1H,ddd,J＝8.4,1.8,1.8Hz),7.55(1H,dd,J＝8.4,4.8Hz),7.35(1H,s),5.67(1H,d,J＝5.4Hz),3.98(1H,dd,J＝9.0,3.0Hz),3.73(1H,d,J＝9.0Hz),3.05(1H,d,J＝16.2Hz),2.84(1H,d,J＝16.2Hz),2.17(1H,dd,J＝12.6,5.4Hz),1.99(1H,m),1.95(1H,m),1.93(1H,m),1.84(1H,m),1.80(1H,m),1.69(1H,m),1.61(3H,s),1.54(1H,m),1.48(1H,m),1.46(1H,m),1.19(1H,m),0.93(3H,s),0.83(3H,s),0.81(3H,s);¹³C-NMR(150MHz,DMSO-d₆)δ:170.1,159.6,159.5,151.4,146.7,133.0,131.0,128.2,127.2,124.0,101.2,99.7,97.5,94.1,72.9,66.4,46.3,40.0,38.9,37.7,29.1,28.5,27.7,24.7,24.5,22.6,21.1,20.0,18.4,15.3.

Spectroscopic data for Compound 3 ：(+)ESI-MS m/z 490.6[M+H]⁺;¹H-NMR(600MHz,DMSO-d₆)δ:9.09(1H,br s),8.70(1H,br s),8.25(1H,br d,J＝7.8Hz),7.56(1H,dd,J＝7.8,4.8Hz),7.30(1H,s),5.68(1H,br d,J＝5.4Hz),4.07(1H,dd,J＝9.0,2.4Hz),3.73(1H,d,J＝9.0Hz),3.04(1H,d,J＝16.2Hz),2.85(1H,d,J＝16.2Hz),2.10(1H,m),2.08(1H,m),1.99(1H,m),1.78(1H,m),1.67(1H,dd,J＝12.0,4.2Hz),1.64(1H,m),1.61(3H,s),1.55(1H,m),1.50(2H,m),1.25(1H,m),1.23(1H,m),1.12(1H,m),0.91(3H,s),0.88(3H,s),0.83(3H,s);¹³C-NMR(150MHz,DMSO-d₆)δ:169.9,159.5,159.5,151.2,146.5,133.3,131.1,128.1,127.3,124.1,101.3,99.5,96.9,94.2,66.2,49.5,41.8,40.1,40.1,34.4,34.1,29.8,29.5(C-26),27.6,27.2,22.7,18.6,18.5,17.9,15.8.

Spectroscopic data for Compound 4 ：(+)ESI-MS m/z 504.5[M+H]⁺;¹H-NMR(600MHz,DMSO-d₆)δ:9.10(1H,br s),8.69(1H,d,J＝4.8Hz),8.27(1H,ddd,J＝8.4,2.4,1.8Hz),7.57(1H,dd,J＝8.4,4.8Hz),7.36(1H,s),5.71(1H,br d,J＝5.4Hz),5.09(1H,s),4.88(1H,s),4.48(1H,d,J＝12.6Hz),4.43(1H,d,J＝12.6Hz),3.07(1H,d,J＝16.2Hz),2.87(1H,d,J＝16.2Hz),2.61(1H,dd,J＝12.0,4.8Hz),2.42(1H,dd,J＝16.0,6.0,6.0Hz),2.33(1H,m),2.27(2H,m),2.17(1H,m),2.10(1H,m),1.94(1H,m),1.79(3H,s),1.65(3H,s),1.45(1H,m),1.41(1H,m),1.22(1H,m),0.85(1H,m);¹³C-NMR(150MHz,DMSO-d₆)δ:173.5,170.1,159.5,159.4,151.1,150.5,146.4,133.3,130.7,127.8,127.3,124.1,114.3,101.2,99.9,94.2,75.0,66.9,43.6,41.6,40.1,29.6,27.9,27.6,25.7,24.8,23.5,21.6),18.1,15.2.

Spectroscopic data for Compound 7 ：(+)ESI-MS m/z 492.4[M+H]⁺;¹H-NMR(600MHz,DMSO-d₆)δ:9.08(1H,br s),8.68(1H,br s),8.24(1H,ddd,J＝8.4,1.8,1.8Hz),7.54(1H,dd,J＝8.4,4.8Hz),7.36(1H,s),5.65(1H,br s),3.79(1H,d,J＝12.0Hz),3.76(1H,d,J＝12.0Hz),3.04(1H,d,J＝16.2Hz),3.01(1H,dd,J＝11.4,4.8Hz),2.88(1H,d,J＝16.2Hz),2.65(1H,m),2.24(1H,ddd,J＝13.2,3.6,3.6Hz),2.05(1H,m),1.61(3H,s),1.60(1H,overlap),1.58(1H,m),1.55(1H,m),1.44(2H,m),1.42(1H,m),1.34(1H,m),1.02(3H,s),0.89(3H,s),0.78(1H,dd,J＝11.4,2.4Hz),0.71(3H,s),0.68(1H,dd,J＝13.2,3.6Hz);¹³C-NMR(150MHz,DMSO-d₆)δ:170.0,159.6,159.5,151.4,146.7,133.1,130.3,129.4,127.2,123.9,101.1,100.6,94.3,77.1,59.3,54.7,48.1,40.5,40.5),38.4,32.7,32.1,29.0,27.9,27.5,24.6,18.1,17.2,16.5,16.4.

The structural formula of each compound is shown in figure 6 according to the identification result.

Example 6 heterologous expression and functional identification of P450 oxidase OxaL

1. Construction of recombinant plasmids

OxaL gene overexpression vector: the recombinant plasmid pXW06-oxaL is obtained by replacing a small fragment between NdeI and PmeI enzyme cutting sites of a yeast expression plasmid pXW06 with a DNA molecule shown in a sequence 2 of a sequence table. The DNA molecule shown in the sequence 2 in the sequence table codes OxaL protein shown in the sequence 3 in the sequence table.

2. Heterologous expression and functional characterization of P450 oxidase OxaL (Agilent 1290 tandem liquid phase evaporative light scattering detector ELSD detection assay)

1. S.cerevisiae RC01 was washed with Solution I, then resuspended with Solution II, then oxaL gene overexpression vector was added, then Solution III was added and vortex-suspended, then incubated at 30℃for 1h (1-3 times during vortex-suspension), then coated on Trp-auxotrophic medium plates, and incubated overnight at 30 ℃.

2. Collecting normal growth clone (yeast gene engineering bacteria RC 01-oxaL) on the plate, inoculating to 100ml liquid Trp-auxotroph culture medium, and shake culturing at 30deg.C and 150rpm for 1 day to obtain seed solution.

3.2 ML of the seed solution obtained in step 2 was inoculated into 20mL of liquid YPD medium and cultured at 28℃under shaking at 200rpm for 36 hours.

4. After completion of step 3, 0.1mg of the test compound was added to the system, and the mixture was subjected to shaking culture at 28℃for 1 day at 200 rpm.

The test compounds were: compound 2, compound 3, compound 4 or compound 7 prepared in example 5.

Controls were set without test compound added.

5. After the step 4 is completed, all cultures (the whole culture system containing the culture medium) are collected, an equal volume of ethyl acetate is added for ultrasonic extraction at room temperature for 1 hour, and an organic phase is collected; adding an equal volume of ethyl acetate into the residue, performing ultrasonic extraction for 1 hour at room temperature, and collecting an organic phase; and combining organic phases obtained by the two extractions, and concentrating to constant weight by adopting a rotary evaporator to obtain an extract. Ultrasonic parameters of ultrasonic extraction: the ultrasonic frequency is 25KHz, and the ultrasonic power is 800W.

6. Taking the extract of the step 5, adding 500 mu L of acetonitrile (chromatographic purity) for dissolution, centrifuging at 13000rpm for 10min, and collecting supernatant; the supernatant was applied to Agilent 1290 for HPLC detection analysis.

The results are shown in FIG. 7A. In fig. 7 a: i OxaL +3 denotes the result of adding compound 3 in the above method, iv OxaL +4 denotes the result of adding compound 4 in the above method, v OxaL +2 denotes the result of adding compound 2 in the above method, vi OxaL +7 denotes the result of adding compound 7 in the above method, ii 8 denotes compound 8 (standard), iii denotes compound 3 (standard), vii OxaL denotes the result of a control in which no compound is added in the above method. The result shows that the compound 3 can completely generate the compound 8 through the biotransformation of the yeast genetic engineering bacteria RC 01-oxaL; comparison of compound 3, compound 8, hydroxylated at the C-15 position, indicated OxaL protein was the hydroxylase. From figure 7a, no significant conversion was seen for compound 2, compound 4 and compound 7.

3. Heterologous expression and functional characterization of P450 oxidase OxaL (UPLC-MS characterization analysis)

Steps 1 to 5 are identical to steps 1 to 5 of step two.

6. The product of step 5 was dissolved in 200. Mu.l acetonitrile and then analyzed by UPLC-MS identification.

Instrument: ultra-high performance liquid mass spectrometry detector (Waters ACQUITY UPLC-Class-MS tandem Xevo-G2-S Q-TOF).

Chromatographic column: waters ACQUITY UPLC-BEH-C18,1.7 μm, 2.1X100 mm;

mobile phase a: acetonitrile containing 0.02% (by volume) of formic acid; mobile phase B:0.02% (volume ratio) aqueous formic acid solution.

Mobile phase flow rate: 0.5mL/min.

Mobile phase: 0-5min, the volume fraction of the mobile phase A is linearly increased from 10% to 20%, and the volume fraction of the mobile phase B is linearly decreased from 90% to 80%;5-7min, wherein the mobile phase A accounts for 20% of the volume of the mobile phase, and the corresponding mobile phase B accounts for 80% of the volume of the mobile phase; and the volume fraction of the mobile phase A in the mobile phase is linearly increased from 20% to 100% after 7-25min, and the volume fraction of the mobile phase B in the mobile phase is linearly decreased from 80% to 0%.

ESI positive and negative ion detection mode.

The results are shown in FIG. 7B. In fig. 7B: i represents the result of adding compound 3 in the above method, v represents the result of adding compound 2 in the above method, and iv represents the result of adding compound 4 in the above method. The results show that: the compound 3 can be completely generated into a compound 8 (m/z 504.2380[ M-H ] ^-) through biological conversion of yeast genetic engineering bacteria RC01-oxaL, and meanwhile, the retention time and ultraviolet absorption spectrum (lambda max 205,235,335 nm) are compared, and a product generated by OxaL catalytic compound 3 is the same as a standard compound 8, so that OxaL is further proved to be hydroxylase; the compound 2 can be partially produced into a compound 9 (m/z 564.2224[ M+HCOOH-H ] ^-) through biological transformation of yeast genetic engineering bacteria RC 01-oxaL; the compound 4 can be partially produced into a compound 1 (compound 1 is oxalicine B) through biological transformation of yeast genetic engineering bacteria RC01-oxaL (m/z 566.2399[ M+HCOOH-H ] ^-); the yeast genetically engineered bacterium RC01-oxaL cannot carry out bioconversion on the compound 7.

Spectroscopic data for Compound 8 ：(+)ESI-MS m/z 506.6[M+H]⁺;¹H-NMR(600MHz,DMSO-d₆)δ:9.13(1H,br s),8.74(1H,br s),8.27(1H,d,J＝7.8Hz),7.59(1H,dd,J＝8.4,4.8Hz),7.32(1H,s),5.74(1H,d,J＝5.4Hz),5.17(1H,s),4.08(1H,d,J＝8.4Hz),3.73(1H,overlap),2.60(1H,m),2.08(1H,m),2.04(1H,m),1.99(1H,m),1.86(1H,m),1.66(1H,m),1.63(1H,m),1.50(1H,m),1.42(1H,m),1.46(3H,s),1.15(1H,m),1.11(3H,s),0.92(3H,s),0.85(3H,s);¹³C-NMR(150MHz,DMSO-d₆)δ:170.1,160.6,158.9,151.4,146.7,133.5,130.6,130.3,127.2,124.2,105.6,99.6,96.9,94.4,73.0,66.4,49.5,43.6,40.1,39.8,39.3,34.7,34.5,29.9,29.4,27.2,23.0,18.9,18.6,15.7.

Spectroscopic data for Compound 9 ：(+)ESI-MS m/z 522.4[M+H]⁺;¹H-NMR(600MHz,DMSO-d₆)δ:9.11(1H,d,J＝4.8Hz),8.70(1H,dd,J＝4.8,1.8Hz),8.27(1H,ddd,J＝8.4,2.4,1.8Hz),7.57(1H,dd,J＝8.4,4.8Hz),7.34(1H,s),5.72(1H,dd,J＝4.2,1.8Hz),5.16(1H,s),4.00(1H,dd,J＝9.0,2.4Hz),3.73(1H,d,J＝9.0Hz),2.25(1H,dt,J＝13.2,3.6Hz),2.14(1H,t,J＝9.0Hz),2.03(1H,m),1.98(1H,m),1.92(1H,m),1.91(1H,m),1.68(1H,m),1.53(1H,m),1.48(1H,m),1.47(3H,s),1.37(1H,dt,J＝14.4,3.6Hz),1.07(3H,s),0.93(3H,s),0.84(3H,s);¹³C-NMR(150MHz,DMSO-d₆)δ:170.3,160.6,158.9,151.5,146.8,133.3,130.4,130.4,127.2,124.1,105.5,99.9,97.5,94.3,73.0,72.5,66.5,46.0,40.0,39.8,39.3,29.2,28.6,24.8,24.1,22.9,21.1,20.1,19.0,15.6.

Spectroscopic data for Compound 1 (Compound 1, oxalicine B) ：(+)ESI-MS m/z 520.4[M+H]⁺;¹H-NMR(600MHz,CDCl₃)δ:9.03(1H,br s),8.71(1H,d,J＝4.8Hz),8.13(1H,ddd,J＝7.8,1.8,1.8Hz),7.42(1H,dd,J＝8.4,4.8Hz),6.70(1H,s),5.82(1H,br d,J＝5.4Hz),5.52(1H,s),5.20(1H,s),5.08(1H,s),4.51(1H,d,J＝12.6Hz),4.41(1H,d,J＝12.6Hz),2.65(1H,dd,J＝12.6,4.8Hz),2.53(1H,ddd,J＝14.4,14.4,4.8Hz),2.45(1H,m),2.43(1H,m),2.33(1H,m),2.33(1H,m),2.26(1H,ddd,J＝13.2,13.2,3.6Hz),2.16(1H,ddd,J＝18.0,5.4,5.4Hz),1.90(3H,s),1.61(1H,m),1.61(3H,s),1.45(1H,ddd,J＝14.4,3.6,3.6Hz),1.30(1H,m),1.20(1H,s);¹³C-NMR(150MHz,CDCl₃)δ:173.4,170.4,161.9,160.1,152.0,150.7,147.2,133.4,130.7,129.9,127.3,123.7,115.1,105.6,101.1,93.9,76.3,74.4,67.8,44.6,43.6,41.1,29.9,29.3,26.0,24.5,24.5,21.7,19.4,15.9.

4. UPLC-MS identification OxaL microsome in vitro biochemistry

3. 2ML of the seed solution obtained in step 2 was inoculated into 20mL of liquid YPD medium and cultured at 28℃for 2 days with shaking at 200 rpm.

4. After the completion of step 3, the cells were collected by centrifugation at 4℃and resuspended in 2mL of the microsomal extract.

5. 2ML Eppendorf centrifuge tubes were taken, 1mL of the resuspension of step 4 was added, and 2/3 height glass beads (Sigma, G9268, 425 μm-600 μm) were added, and vortexing (1 min/time, 6 times total, each shaking was done on ice) to break the cell walls.

6. After completion of step 5, 750. Mu.l of the suspension was centrifuged at 4000rpm for 5min at 4℃and the supernatant was collected.

7. Taking the supernatant obtained in the step 6, centrifuging at 17000rpm for 50min at 4 ℃, discarding the supernatant, and collecting the precipitate.

8. To the pellet obtained in step 7, an appropriate amount of TEG buffer was added, and the mixture was gently stirred and dispensed into a 1.5ml Eppendorf centrifuge tube, 100. Mu.l/tube.

TEG buffer (ph 7.5): contains 50mM Tris-HCl, 1mM EDTA, 30% glycerol, the balance being water.

9. The reaction system was prepared and reacted.

The reaction system: mu.l of the solution obtained in step 8, 1. Mu.l of the test compound mother liquor, 49. Mu.l of 50mM Tris-HCl buffer (pH 7.5).

Reaction conditions: the reaction mixture was allowed to stand at 30℃for 12 hours.

Test compounds were dissolved in DMSO to give a test compound mother liquor having a compound concentration of 50 mg/ml.

10. After completion of step 9, 50. Mu.l of methanol was added to the system, vortexed for 1min, and then centrifuged at 13000rpm for 10min, and 30. Mu.l of the supernatant was taken for UPLC-MS identification analysis.

The parameters of the UPLC-MS identification analysis are the same as those of the step three 6.

The results are shown in FIG. 7C. The result is consistent with the result of step three.

The results show that: compound 3 is catalyzed by oxaL to form compound 8 (m/z 504.2392[ M-H ] ^-); compound 2 undergoes oxaL catalytic energy to partially form compound 9 (m/z 564.2217[ m+hcooh-H ] ^-); compound 4 undergoes oxaL catalytic energy to partially form Compound 1 (m/z 520.2348[ M-H ] ^-). OxaL are unable to catalyze compound 7 to form other compounds.

Example 7 and Oxalicine B late biosynthetic pathway resolution

Isolation and identification of intermediate compounds such as the knockout strain Δ oxaL, the possible 4 biosynthetic pathways from decaturin C to the target compound oxalicine B in the late stage of oxalicine B biosynthesis were estimated by analysis of the enzyme functions of the P450 oxidase OxaL, the Fe ²⁺ -dependent a-KG dioxygenase OxaK and the P450 oxidase OxaB, but the 1 st pathway is mainly shown in FIG. 8. OxaL is responsible for the C-15 hydroxylation reaction, oxaK is responsible for the C-23 hydroxyl group introduction, and OxaB participates in the formation of the left spiro ring of oxalicine B molecules.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Sequence listing

<110> Institute of medical biotechnology of the national academy of medical science

<120> Compound oxalicine B biosynthesis Gene Cluster and C-15 hydroxylase OxaL and use

<130> GNCYX213577

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28137

<212> DNA

<213> Penicillium oxalicum

<400> 1

cagggagatc acgaggaaga cacaggaaaa caaaagttgc gtgaatagac ccacaagcat 60

gatattttgt ccgacgtccg ccatcgatgc ttgggttatc atgccgccac cgccggcttg 120

gagaaggatg gcaataacgt caccgcatac aaagacttta gtcactcgag ccgaaggaat 180

catgcttgtc ttaggcgtgc tgacgaagag cgcaatacat ccgtacatca tatcatagag 240

agttgcagcg taaaggtggg tggggggggg gggggggtgg gcaggacgac gagcagagat 300

tcaatgcatg atgtatgggc ctaggtcgaa aggtgacttg gcggaaaaga tctcgcaatg 360

taaccggtgg tcatccctac ctaagaacag ggattatgag ctgcatcgat gggggagatt 420

caagacggac tcctcctgca tatggagttc gacacgagat ccggaggtca gactatccaa 480

tatgaaagcg aggatcacct tgcgacatgg caaatcaacc caaacggtga agtcattctc 540

atcgcaagcc tgttcaagtg ggacaagaag accttgaagg caaacattga aatcagaccg 600

catggttctg cccttgacgg ctccgtcgca gtcttcggcg ttgcaccaac cacaagggaa 660

acactgctac attatcagct cgacatctgc ggaccagtca ctcctgaaat gctggagctg 720

cttgccgcct atagcccggg gccagcagcc aagaagtatc taaatcgcta ccgattcgaa 780

tgcctgagta cctcggacat ctccagaaat ctcctcaccc gtgggcagct gatgaagcag 840

gctgccagca aagcagtgtg gcccgaggaa gaattctcta ccttgatctc cattatgccg 900

agactccgcc tgtggtattt ctccatcgtc tcctcgcctc gtgtgaaccc atcttccatc 960

gccatcaccg ctggtgtcct cgaaacaaca attgcacaca ctgatcgagg attcattggc 1020

ttgacggcgg gctacctgca ttctttgcac ctgaaagaaa accaactcaa ctcaagcgat 1080

gaacctgagt cttccaacaa ccttgaagga ccacgatcta tcgtgaaaga ccacaagcta 1140

ttcgcccaca tccgcaaatc aaggttcagg cttccagaca gtgatgagac tccaattatc 1200

ttcatcgctg ccggaagtgg catcacacca ttcagagcct ttgttcagaa gcggaagctt 1260

ctttcaagta agggtatcag tgggtaagat ggttcttttc tatgagtctc gctccgagga 1320

ggattgtctg taaaaggacg tctagatgga agtggaggcg atagggatct tagacaccca 1380

cttcgtgtac tcgtctcgat tggtggatgg aaagaatttc tacgtgcagg acaaaatgta 1440

cacattttgc agagaccatg aatcaattga ttcagacgga ggatgcgtca atttatgtct 1500

gcggaggctc tagcatggcc aatgatgtga aagccatcac ggtcactcga gtccttggcg 1560

gcatcggggc tgtccagcaa ttgaagagat ctagacggct ataggaaggt gtttgggggt 1620

agcaagtgtt tcattcatgc tatttgtttc tccgcaatga caagatctac atattgaaca 1680

aaaacgtatg gaaagtgtga ccttcatgac tcacatgagt ctgcatgtca ggctagcaag 1740

tcaaggcccg aattttgaac gctagagatc ttctagatgc tcatcctctc cgtgtccaaa 1800

ttagccctag tacaaacatc aatcccagaa taacgcccca tatttctttt ccactccctg 1860

tagtattttc agtccatcca ttggcggccc tagttggaat tggaatgaag ttcaaccttg 1920

cagcgccttt aattgcttgt gatgctcccc tggcttgtat tttaccggca tatggtaata 1980

catatcgggc gaaaaagcgg aggaagaaag tgtcccgcgc ttgtaaacgg acaaccagcc 2040

gcgcaacttt gtgaatttta tgcattcgtg cttttcgctc agccgtatac cgccttagcc 2100

tattgtccaa ttgttccgtg cttggtttgc tgcttgggct ggcaatgagg aattcatgaa 2160

gcagattggc taggccggcg gcatcttcaa tagcacaatt ggcgccttgt ccggtgttgg 2220

gggcgatcta cctggagtta gcttctgctt tgatgtagga aaattaaggt ggtatgtacc 2280

ttatgtatac tgtccccaat gcaaactatg cgcttatgat gccagttctc aaatacattc 2340

tcttcgagaa ctgtcatgtt atgccttgtt ctccgagtcc agaggtcgcg aaacgccacc 2400

tcgccccaga taatatcgtt tgcgtatttt tcaaccacgg atgccacatc ggttgttgcg 2460

aaacgaggca tatcgccatc ggaatagagc cgatcaagtt tccagatcaa aaaccaaaat 2520

gtgcgatcat ggtttccagg aaaggttaag aatgaccgtt tgtcgttgag gctggcaacg 2580

tgctcgccgg gtgggaatcc cggcactgcg gaggatatgc cgaaaacgca gccatactcc 2640

gctgtgagac ctgttcactg ttagctgcct tctttgatgt atgaagtata ttcaacaagg 2700

gacaattggc acaaaccgtc tctcccaaca ggttccataa tttctccgtc ttcggcagag 2760

attctccaca tttcccggcg gacaatgcta tgcaccccat cacaacccac cactagatct 2820

cccttatagt cttctccatc cttcgttctt accaagactc cttctcgctt tcctcccgaa 2880

tcagcaatga gctcaacccg tgcaacttcc ttatcacaga gaacctggct gccttcaccc 2940

ccgtctttag tcactttccc acgttgccca agaccaagcc tatcagcaag aatacacaat 3000

agcgtcctcc gctctaaaaa tgcaaagggg aacccaaagc tctcgccgat tacccgagga 3060

gagtcattcg tcagcacaaa cctatttgtg tccgggaagc gaagatgagc ggtatgtagg 3120

ggagcaatct ccttctcaac gcactcgaag agccctagct ggtcgagaat ccgaccgcca 3180

tgggggagaa tcccgatgga ggcaccttct tgtggtgtaa gtgacgtgcg cttttcgagc 3240

accgtgaatc gaatttttgc tctgtgtgtt tgggtgttgt cttggagaag agaggtattg 3300

agggcagtca gagcgtgtgc gagcgttaga ccagcgatgg agcctccaat aatgataata 3360

tgcagctcgt ctgatgcaga cttctcggtc atcgcgaatc atggattccc ccgcggagaa 3420

tggcacttat gatggtagtg cggcgtagag agttcgtaga ggcagtgtgc tattgcaagt 3480

aggtaaaaaa gtaacgctcc ttgattgact acagggatag ccattgtacg ttaggtctag 3540

ccgagaggcg taatagtagg atgatgtaag tcgtgtatta ttgtaagcat aaatttgatt 3600

taatacatcg gctcatcagg cgagactgta gatcttatcg ttacctaact cataccttgc 3660

ttaatgatga atcaatagca aacatgctct gtgaaatctc actcagtctt tttgccagcc 3720

tttgcttcag cctgtttcac aaaggcaaaa aacaagccgt acgccccatc aaagattaca 3780

aatgctgcgg tggaccagta gaacaacggg ttcatcgtcc acgcccacag ctcaggccag 3840

tagtgtgcac gaaaaaacac acctgcaagg gcacttcctg tcccagtcac acgagacgac 3900

ctatctctca gtcagcaagg caaggaagtt cgttgtcgaa gtcaggggga cggaagaaac 3960

gtaccagatg agccaactag caccacgcga ttggctcgat cgcacgagct cacacagcgc 4020

ggtcacactg gtcatgatct ggcagcccag tccaccatag tagaacgctg taaggggtcc 4080

cacgaggttt gcgagggaga catgtcccgc agcccagata gcggtgacga tgacgaaggt 4140

aagatagaag taatagccgc ggagcatcga atcatccccc aatgctaggg gatggtattt 4200

gagagccgca tatattgaag caaggttcag cataaaccat gcggtgacta ttggaaggcg 4260

gggcggggga tagagagtcg cgtagacgag ctcccaggcg aggttacagg atactgggac 4320

gatggggacc cagcaggctt tgtcgcggca agcggtgcga atcgtggcgg cgtagcaagt 4380

cagccagccc gctgccatgg cgaagagcag tgtgtcggat atccatttaa ccgattgaaa 4440

ggattcgggc gctttggtga aatccagtga gtccatagtc actttgaagg gtgagcgtgt 4500

tggtggctgc aagagggaat ggggttgatc cttgaaatat tatcctgcac aacacagtcg 4560

aagtggaacc aaaggcgccc tccaggagga actcatattt atgagaatgc gtacactttc 4620

aagtcgcaca ccgtcctcgc aaggaaatat gcaggggtac cgttgtggag ccctccttgc 4680

atcgcgtgct ccaacttgat aagccatagg tccaagctgt cacacctgac gagatgaagg 4740

gttgctcaca acgaaaaacc tttcacatcg atttcgaaga cccgtggcga atcttgcctc 4800

taggttcacc gtcacgacga ccccgagcat cgcagcgcct ctagctatga ctggtcaagg 4860

tgtcacccag cagaaggcga ctctaagtcc cgagaaggta tcgaagcata tcacttcacc 4920

ttatgtcttc gaattttaat actcacaaac aatagatcat agcagccccg atagactacc 4980

tcttatccca accaggaaag gacctccgca gccgcctaat cactgctttc aacgagtggc 5040

tgaatgtccc agaggagaag ctcgatctca tcagaagagt gattgagctt ctgcacacgg 5100

cctcactcct gtaggcttct ttaatcgttc gcacaagttg aaaatgccta attcagcgtc 5160

ctagaattga tgacattcag gactcctcta agctgcgccg gggtcaacca gtcgcccaca 5220

gtctatttgg gattccacag actatcaact ctgcgaacaa tgcatatttc gaagcgcaaa 5280

atgaactgca caagctgaat gacccgcgag cagtccagat cttcacagag gagcttctcc 5340

ggctgcatcg cgggcaggga atggatttgt actggcgaga ctccatgatc tgcccgtccg 5400

aagaagaata cctcgatatg gtagctgata agacgggagg tctgtttcga ctcgcgatca 5460

agttgatgca gtgttcaagc tttagtacat agtaagctgg cacgtctgac tctgggcaaa 5520

cggtttgaat gagctgacta gagataatag cgactacgtt cccctggttg acttgatggg 5580

cgtcatcttc cagattcggg acgactacca gaatctccag agcggaacat atattcagaa 5640

caaaggtttt ggagaggatt tgactgaggg aaagttttca ttcccaatca tccatggact 5700

caatcatggg acgcagagcc tgcagctttt caatatcctg aagcagaaga cggaggatgt 5760

gtctgtcaaa cgatacgcgc taagcatcat ggaagcagct ggaagctttg catattgccg 5820

cgcaaggctc gcggaactgg ggacggaggc gaggttgatg cttcaggaaa ttgagcgtac 5880

cacagaggga gcatgcgccg gtgacacaaa aggcaaagct gtcgccgaat ttttggattt 5940

gctcgagatc aaacaggaca gctcatgttc caactgtgct aattgcacac aaggcttatg 6000

aatgttctag tgtgcgagtg ttattaaata gtagaccagc catcgtcaat aggaagaaca 6060

gctccattta tccgcgaagc ctgatctgag cacatgaaca caataataga cgctacttcg 6120

tccggcatca tcatcgcgta tccatctctc cggttggcat acacagcgga aagaacaggc 6180

ttgattgtcg aagtggcttc cggatcaaac cttgatggat caacactgtt taatataccg 6240

gtcgccactc ctactgatag tgagtgcctg taacaaaata tgggcttaat ggaagaacaa 6300

gacatcttac ctcctgggca cagcacgttg catcgtatgt tctccccttt gaatctccag 6360

gccacgttct tcgtcgctcc gataaggcca tgcttaccta cgactggtta gaggtatctt 6420

ttaatgagac tgaccaagaa agagaaacgt actcgccgta tacgccacgc ctgctgcagc 6480

accgctcatt ccagctcgac tcgccatgtt caagatcaca ccagacttct gcatcctcat 6540

ctccccgata acctctctca tcagtctcac cggtgccgta aggttcacag ccatacaacg 6600

attccagtct gcgtctgtga ctgtgtccac actggcattg tgatcgagga ctccagcgat 6660

attcatgaga atgtcaatcc ggttaccgaa ggctgaaaga caagctttga caattgtctt 6720

agggatatct aggtctgtga ggtcacattg catcgtctga cagttctcgt tggcttccag 6780

gacggctgga aatggcgata tgtcaacggc gaatacattg gccccagcct ctaaagcagc 6840

ctcagcagca gccagcccaa tgcctgagga ggcgccggtg atgattgcga cctgccctga 6900

gtgttactat gccatcgatt ggcgattatt cgggcaatac taacacgatt ttgaagacag 6960

cctgattcca tcgtgatagt cattctgcct ctctgtgcag aggacgtgag ttacacgtag 7020

ctcaattctc acccaggtac tgagcgcaga tcatttcaca aaatgactta aagcttttct 7080

agaagtgaca ttgaccgccc agatggggcc agttcccatt tagttggcag acaccctaag 7140

aggaagttct ccatcaggta tgtggtgtat ctgatgcgga ctggacccct tgcattagtg 7200

ttacacaggg gaactacacc gcttcactag tgcagcgact acatattgat atcacaaata 7260

ttttcaagga cagtacaatg ctctttccag gccgtatatt ctacgctttg caaaggttgt 7320

ctacgtcgga tagacaagca atcatgattg caagtatact tgaaaagtcc cgagatgctg 7380

accacttcac tattatcatc gccgcatctt ttctcttgag cgtcgcgatt tctcttgtct 7440

ttttacgttc aactacgcct cagctgcctt tgttaaatgg acccaagcgt tgggaattca 7500

cgttcacgaa tgcgaagaag cgctattact tgaatgcgaa tcaaattata caagatggat 7560

tcaagaaggt ctttcctcca tctgcgacag aatactagca agatctcact aagccacagt 7620

ctaaagatgg gttttatgct gtcaccgaga atggaatcga gctgattctc gcaccgaaat 7680

atgctcacgc tatacgaaac gacaagagac tcgactttca cacttacagg acgcatgtaa 7740

gtatagtagc tatacttatc tggtcttttt gccctttctc atttaaaaat cactcacaga 7800

ctatgctccc caatgtcgca ggcctgaaag tctttgagat ggatcaggtc ggaagggaga 7860

taatgagtta catcatccgc caaaaactaa cacatcattt ggtcgatctc atcagaccgc 7920

tgtctgagga ggccgatgat tgtttacacc ggagttggac agataattca ggtactccaa 7980

atctccatgt cgtagctcgt ccatgaggat ccattcactt attaatcctt agattggcac 8040

gaaatttctc tcaaatccac cctcctcgac atgatatccc agcaatcggc ccacgtcttc 8100

ctcggccgca gcttttccca taacgtgagt tggctagcgc tgtcgcgcag cataaccttg 8160

caggccttcg gcgccgtccg cgagcttcgc gtatacccat ccttcatacg cccgcttgtt 8220

ggctggtttc tccccgcatg taaatcactt cgcggagaga ttgccaaagc ccggaagctt 8280

gttgagcccc ttatactagc tcgaagactc gaaagagagc gatgcatcgc cagtggccgg 8340

gaaccacccg tctatcatga cactattgca tgggcagagg aatgtgcacg tggacgaaaa 8400

tacgatccag ctcttattca gctcacgctc gcgctttcgg ctatgcacaa cacctctgac 8460

tttctcacgc aagtaatata tgacatagcg gcgaggccga aactcgtgga ggagttgagg 8520

aaagagatca tcgatgttcg gacgtgtgga gatgcaacag agtcatggaa taagggggcg 8580

gttcacaagt tgaagttgat ggatagtgtc atgaaagaaa gtcagcgatt gaagcctacg 8640

ggattgggta agttttgctg ggatcaacgc ttattctcta caaggctaat atgctaatca 8700

tatagtaaac atgcggcgct atgcaactga ggacatccag ctctcttccg tcattcccga 8760

gcacaaggaa ggcagcatca caatccgaaa gggggatctg gtcatgatat cgcaacacag 8820

ccactgggac gaggatattt accaagacgc ggcgtctttc aacccatacc gattctgcag 8880

gatgcgcgaa caacccacgc aggagcacac agcacacttt gtcgccacaa gtgtcaacca 8940

tatcggcttc gggcatgggg tgcatggctg tcctggtcga ttctttgccg ccgctgagac 9000

gaagcttgca atgtgtcaca ttttgatgaa atacgacatt aagcttatcg atcagcctaa 9060

ggtcctcaat gtaggttcgc ttatggttgc aaatcccgtt gcgaaggttg cagtgagaag 9120

gaggaaggag gaggtttcat tgtgattgtg aacagtgagc tcgcccacat ctcactcagc 9180

ccaaggagta ccaaaggtag gtggagatgg accgtaacca cattactgct ttcggacaaa 9240

ctcaatttac tacatacctc gtggaatact caccttcgcg taaatgaaag tctcccaacc 9300

tttgtaatca cagtatatat tgggcttcca agcttccgtc tatgtctgtg aattctaaag 9360

cgttactatc gtcccttgaa cctctgtccc aaacttgaat gatatccttt ctcgtccatc 9420

atgttgtcaa tgatcgtaag gggaagaatg ataaaataaa ttgaagtatg gttattcagt 9480

tgaatctctg gcagactcaa attcacctat tcaatctgaa ttctaacttg tccaggttcc 9540

atgtccgggt ggtttgtgac cgttgatata cctatcgagc atacgtaatc ttccaaagtt 9600

taaggttgcg acccaccaat acctgaacca gggcgtagat cacacctaga tacgtgtaca 9660

acggctcata ttcgatcggt gtatcatata tgcctaggat aatggctaaa tgcagcctgc 9720

ctaagaagcg gtcgggagac ggtgctccac ctacctagta gtagtagtag gactaggtac 9780

tccctatgct acgtgtgtaa tgactcaaca ctttctcttg gctatgaccg cctctctgga 9840

tgcaggtgaa ttcacaatta ctaagtaagg tcaagaaagc ggacataatg caagagtgga 9900

cattatgctc ttcttcgcac tctcactacc acatccggag gcacagcatg ctctcccatg 9960

aaaaagttcg gaggccgtcc atcaatctct tcgatgtcgt aatgcaggac gatgtaagaa 10020

agcatcattt tcaatatgcg ggttgcaaac tgtcttccgg cgctacaaaa ccattagaat 10080

tacatagaaa atgagaggta tcagacctac caggccgagc gaccgtgtcc aaaggacaga 10140

aatgtgtcgc ttgtcgagac acaagactct gatttcccat cctgcacaaa acgaaaaggc 10200

ttgaattgtt ctgcattctc gtagaatctc ttatcgttat gaatgggaat tgaaggaaca 10260

gccagccagc tgcctttgtt aaggagttgt ccatttggca gcgccagccc atctcgggga 10320

acgacctcgc gcaacagagc catcgaggtg ggtggcgccc gccgcagact ctctcgaagg 10380

gtgctatcga tgtatcctaa acgatgaaca gtagctgggt cagcccattt agcaggacca 10440

tcaaacaccg actcagcctc gcttcgaaga atttggtaaa tctctgcctt ttcgctcgag 10500

ccgagtatgt cgagcaaggc atggtgcgcc gtcaatacgg tacttgtaaa tgcagctcca 10560

agctggcgga agttgtcaga tcatgataga atcttccaga tgaggtagag ttgataaccg 10620

taccagtaag ttaaaagcgt cagcgaacac cccctcagct ccttctgggc cgcgtgtctt 10680

gaggatggct tgacagagcc aagtgaccat gtcttccggg acctgtgaat cctcctgcaa 10740

tttgttcaat ctctctttta caattggcat caggtaagcc aggtaccggc gctggacata 10800

tccgatgggc ttctgcagca cccacccgat gacgcctcga aaaggggccg gcaaacattg 10860

ccctgttatc gtagaggccg ccccaaacca ctgtgagctc gatatgatcg cctctacaaa 10920

gcgctcattt ttggccaatt cgcgacccgc cagaacggga accaaggtat ggtaaacggc 10980

gtagcgcaac gcgtcgccaa gtgacacctt actgacacag tttgcggtgc caaaactgcg 11040

atcaatcgcc caactcagtt ggtcatacat agccggttgc aacctgtcaa acttcttgtt 11100

caggtggact ttgatcgcgg tgtgcagtat ctcacttgtg gctggtgtga agccaggcgc 11160

cacgtaccgc acgcccatcc gggagtatgc ggcgcggcgt gggcacagga ccgtgggcgg 11220

ttgatcgata atccattgta tgtgctcttg cggtaggatg acgacgggct caaaactaat 11280

caacggcata agaaaggctt tgccagtttt gttgaaggct ttgtagccgg cctcgaggat 11340

ggccggattg tactgccatt gagcaagaca ggcacggaac gcgctgagca agccctgctc 11400

gcgacctatc catgagatgt cctttggccg gcgttggaga ggaaaacagg ctcgggcgag 11460

atggtatagg ctgagtccca ggactaaggg agctatgagg atgagaatgg ttggggctga 11520

aagttggtac tgcatcttgg tcacggcggt catgggcacg ccacggagca aggaattacc 11580

actgtttagt atgagagact gaaaatatag atggtcgatc ccgattgccc tgattaaaga 11640

gcggtatgga tggtgtgacg tccttgcatc aagttttctt cgactttgca tgtaaggggt 11700

ccctagccac ggactcgcct gttctgagaa tgctgatata agaggcacag ctctctatca 11760

tggaattatt tacaggccac agttctatcc cttcgtcaca atgatccgca gtcccactgc 11820

cccaagcagg cccctaggcc agatctcgtg ggacctgatc cgcatctcgc gatttgacaa 11880

gtacaactca tttctagccc tctttgccgg aggttagtcc acccatccca aattcataca 11940

ctctaggcag tgggtgctaa caacacacag tatggtcaac ccttcttgcg gggagcgcac 12000

gacttcgcga agaccctgag cacgtctccg ttcaatatat ccttagtcgt gcttttctgt 12060

gctccatagc cgcatatata ttctctgggg caggcatggt gtggaatgac tgggttgacc 12120

gggacatcga tgctcgcgtg gcacgcacca aggatcgtcc tttagctgca ggcagactga 12180

gcacagaaga agcaatgctt tggatgctgc ttcaagctgg tgtagcaacg acatttttgt 12240

attggatgat ggacggacaa catgtgttcg tgagcccctg gaaaagtcat ctctctctct 12300

ctgctgtacc aaggtcgact aacgaagcgg ggctacctag cttgcattcc atgattcctc 12360

caacattagg aacattgata tatccatatt gcaagcgtcc tctcgctcgc cgacttggta 12420

tctaccctca atatgttctc ggtctgacag cttcctgccc tgtcctcttt ggccgtgctt 12480

cgatataccc tgatatagaa tccttctctc gactcgtatc gtctagcctc ccgctttgcc 12540

tagtggtgtt tacatggact ctctatttca ataccgcata cagctaccag gacatcgttg 12600

atgacaagaa attgggggtg aactcactat acaaccttgc gggaaagcac atacatggcg 12660

tgcttgtggc cctcgtgaca atcatggtga gcgcactgtg gtgggcactg taccccttgg 12720

gatcagcttg gttgtggatc tcttggatgg gagtctggat cgtgggatgt gtggaccaaa 12780

tgcgcagatt tgatgcgaag gatccttcaa gtggacagta cgtcttccgt agcaatgtcc 12840

ttatggggct ctggacgatg cttgcttgtc ttttggaggt tttttctaca gggaagagag 12900

tggctttgtg aacgaaatgg ggaagacata gcgacacaaa taaatattag ctgccagccc 12960

agcaagcgca gagcaagatc atgtgagact ggatgaagca cctgctagaa atatcatggc 13020

atttgatcag gttgaagtga gatcagtatc ccagtagagt agcggggtgt tcttttccaa 13080

aggaatgttc caccctggcc gaacgttctt ctcttccttg cccgtgaatc tttaatgttc 13140

tagcaaccac agacggagaa agactcagct gagaccagcg gctatacagg aacaccagct 13200

actatttaca cgtgttatgc tagattgatg gatatttgag tcatttgtct ttgacatctg 13260

cgctcaagac ttgacgaaga aagggcaaat tcaaaaaccc acagagaccg aacaacaggc 13320

tgaaagccct gatgggagtt cataggttgg taatgagcag taaaactggt actgggcagt 13380

catatgcaat tattcctgta ggagtaaggg gctcgcctag cccaattgcc ttgcaagata 13440

agctagtcac caaataaata tagatcaatt cggttggttt ggactctcat ctccatttct 13500

tgtcttcatc atcctgtaga tatcgccaat gtccctcgag cccatagcta ttgttggaac 13560

aggatgccgc tttccgggtt cctcttcctc accgaatcgt ctctggcact tgcttcaaaa 13620

tccgcaaaat gtcgcctcca aagtccccag tgagcgcttc aacgtggact cattctacca 13680

ccctaatagc cagcagcatg gctcgacaag cgtggccgag tcttattttc ttgaggaaga 13740

tataagagcc tttgacgcgc ctttcttcag catcagccca gcggaagcgg ctgccatgga 13800

tccacagcaa cgcttgcttc tggagacggt ttatcactcc ctcgaggccg gtggccatag 13860

acttgacgct ttgcagggct cggccacagg agtctactgt ggctttctcc ggactgatta 13920

cagccagata cagtttacag acccggactc gttgccaccg tacacggtta caggaaattc 13980

tcccgcaatc atggcaaacc gcatctcata ctttttcaac tggactgggc catcgttcgc 14040

ggtggatacc gggtgctctt cgagcttgct ggcagttcac ctggctgttg aatcgttgag 14100

gaaaagagac tgtgatttgg ctgtcgcggt ggggagtaat ctgcttctat cgcccaaccc 14160

ttatatcgcg gatgcaaaga cgggaatgtt gtcagctaca ggccgatcgc ggatgtggga 14220

tgcatccgcg gatggctacg cgcgcggaga aggggttgcg tcggtagtac tcaagcgatt 14280

gagcgacgcc gtcgctgcag gggacgagat tgagtgtgta attcgagcta cagggatgaa 14340

cagcgacggc cggacaatgg gtatcaccat gcccagtgga gaggcacagc ggaaactgat 14400

tgagtcgacc tatgccagta ttggacttga tcccaaaaat gctcaggaca gatgtcaata 14460

tttcgaggcg cacgggacgg gaacgcaggc gggagatcca caagaggcca gtgcgattca 14520

tgcggcattc tttgggaacg aagctgaaaa cgacagctct aacgtcctgc atgtcggttc 14580

aatcaagaca gtaatcggtc atacggaagc aactgctggc ctggctggct tgatcaaggc 14640

atctctgtgt ctacagcatg gggagatcac accgaacctt ctgttctcca cgcctaaccc 14700

tcgcataaca ccgcatctta ctcgactcca ggtgccgagt gagtctgtag catggcctac 14760

cctgccgccc ggggcaccac gtagggcttc ggtgaactcg tttggctttg gcggtgctaa 14820

tgttcatgcc atcctggaaa gctatgaacc cccttcttca tctcgccgag gctcagaaga 14880

tgcagaggcg gattgtttgc ttcttccctt tgtggtttca gcggcatcag aaccctcatt 14940

gaggacagca ctggagaggc ttttccaatt ccttgaggat cagccggtga caaacatgat 15000

cgactttgct cagaccctct tgacgcggcg ttcgtgccat aaacatcgta tagtatttat 15060

cgctagctca tcggacgagc tcagagacaa gattctgcat gaaatatcct acccatccag 15120

tggccagata tccgcgaaaa ttcatcgccc tgtccaggca aatcggagct ttggcatatt 15180

gggaatattc actggccagg gggcacagtg gccgcagatg agtctcgata ttatcaatgc 15240

cagtccacag gctcaaaggt ggatggctga tatgcagaaa gcccttgaca cgctccctca 15300

acaataccgg cctgattttg atctattggc agaacttgca gtcccaaagt ccgactctcg 15360

aattcatgaa gctagaatct cacaggttct acgcactgct gttcagatcg tgcaaaccaa 15420

cctccttcgt acccttgggg tcaactttga tactgtgatt ggccactcat cgggcgaaat 15480

cgccgccgct tttgctgctg ggattctcga cctctcagat accatccgga ttgcttacct 15540

acgagggtgg gcgatcaaac agtctcaaaa tcagcaacaa tgcccaggga gcatgattgc 15600

agtgatgctt gattggaacc aagcagaggc catttgctgc aaccttgccc agtacacagg 15660

gaagattcaa atagcagcct acaattccct cagaagtgtc acactatctg gcgaccgcaa 15720

catgatcgat gaactggcct ggctactttc aagtttgggt catgctgtgc accggctcca 15780

cgttgatact gcgtaccatt cccaccacat ggagcctgcc gccaagctgt atcggcaagc 15840

cttgaaagct tgcaacatcc aggcaaaaaa gcccagatcg acaatgcgct ggttttcatc 15900

cgttcatcct ggggtagacc tcaatgctac cgggatttct caaccgaggg agtactgggt 15960

agccaatatg ctggagtcag tttcattctc acaagctgtt tcgaccgcgc tcctgtcatc 16020

ttcagatacc cagtatagct gtgccattga gattggtccg caccctgtgc tcggtggacc 16080

agtcaagcag atccttgagg ggatggcgag accgatagac ctgccgtatt ttggcctagc 16140

gaggcgcgcc acatcaggaa tacaatcatt cgccttggcg attggacaac tctggactat 16200

ctttggtcct ggcgaactag atttccaggg ctatctccgc gcattcaata tcaatgcttc 16260

accttctctg ttgaaagacc tgccgagtta cccatttgac catagccaat catattgggc 16320

cgagtcacga ttatcacgag ctcgcttacg tgcacaaaat cctccaaatg cattgttagg 16380

ccgattgctt cccacctctg gccaaggaga acgacgctgg agaaattatt tgcgccccga 16440

ggagcttttg tggttggatg ggtacaaatt agaggggagg ccagttcttc cgccagcaac 16500

atacgtctcc atgatggttg aagcggccct tgagatttcc ggggtatctc cagtacaact 16560

actcgagctt cgtgatctag aattctatca agatgtcccg ctcccatcag atcaggctgg 16620

acttgaggta ttgttcgctg cggaggtaag ctcaaatgaa tctcatgcgt tgggcaggtt 16680

cagctgtcaa gcagctgttg atggtgagct ttgccgtgct gcttcaggcc aattcgaaat 16740

tacctatgat gtacctggct ttcaagctct ggctgcacga gccacacctc tgacgctcca 16800

gccaatggat gtgaacggat tttaccgcga tttatctgct ctaggtcatg acagatgtgg 16860

agatttcaaa ggcctttcta cacttgcttg caatcggaaa gtcgcttctg caaccatagt 16920

ccatccaggc agcaacagcc atcaaccctt gaattttcac cctgccacaa tcgaccacgc 16980

ttttcagact gtattagcaa cttcgatctc caaaacgagg gatcaggcca ccggctcgcg 17040

ctacacaatc tccagaatat cttatttggg catcaatccg accttgcgcc cggcagatag 17100

cgaagcactg aacattgacg gctcaatcgt tactaaagtc ccgggtttga tcaccggcgc 17160

tgcagaaatt ttccggtcaa atgacgagtg cctgctatct tgcgagggaa tacaaatctc 17220

tagaaccgcc aatgcctcca gcccacctca attgtttagc accattgact ggatacctct 17280

tcaacccagc gcaaccgcag gtggaaatgt actatgccga ccaggggccg tgaggacgct 17340

gatggctcgt gaacagctcg cactactgct cctgcgtgat atatgcagga aagatgcgcg 17400

gaagtcaagg gaaaccctcc cagaaggcaa ggctgcattc ctaaactggg ctgatcatgt 17460

cctggcccat gtcagagagg gcatgcatcc agtctgtcgc ccggagtggc tcgcgggtaa 17520

atctgacgag atctgcacac ctccacttga acctctgatg cgcattggtg aagattgggg 17580

aaaccttctc gcttctgagt gtgaggatgt tattcctgct gtggagcttc tggatcgata 17640

ctacgctaca aatatgcaag acttcaaccc gtggtattac cgcttcgtgt cgctagtcaa 17700

acagctgaca gcactctatc cagtgatgga tatcattgag gtgacagtca gtccgagtta 17760

tcgactgaca aaccgtgttt tgagcgagat cgggactgcc tataagacct atacacgcgc 17820

ggtggtcaac atgtccacgg cagcatcaag cacgaagcca gctgcacaac cacaaatcca 17880

cgagaagaac ttcgaggccg acgcgttcaa gcagaattcc gtcgatctaa ttatcgtcca 17940

tcaggcgctt tacagcacaa agtcgttaga cgatgccttc aaaagactgc gccgaatgat 18000

caagcctggc ggctacctcc tcattcttga agatacaaac cccaacctca ttcatcggaa 18060

actgctgctt ccattcagcg gctggaaaaa gacaagtaca gaacatctgt ccaatggccc 18120

tattcagaca cgtgacgcat ggaaatccct ccttttcaag catggtttca gcgggattga 18180

ttcaataacc tcaattcatg acgaggtgat agctggtctt tccatcatgg taagccgcgc 18240

ggtggaacct gcggcccaag agattcaaag tccatctcac gagtcaaaca agcccagcga 18300

tttggtgatc gtggcggcgc agaataagtg gatgaatcgt acatggattg ccgtctctga 18360

gcgctttcgc cgtatggaac tagtcgagaa tattcgcgag attaaatttg ggacaggaag 18420

aaatccgcct gtcgtccttg ttgtgacaga ctctttgcag ccaacagtct tttcagggcc 18480

ccatgaggag gagaaacagc taagacggtt gtttgctggg gccagcaaag ttctctgggt 18540

tgtttctcgc tctgatttca gaagccctgt ggctttgtcc aacgctgtta cagcgggaat 18600

tctttctagc ctctcagttg agtacccaga cacaatgttc cagcgcctcg agcttccctg 18660

cgatctgcct tctaaggaaa atgtcgatgc tgtggtcacc cttctgatgc gcctggtgtt 18720

cacatcttca aaagaaagtc tctcgctaga atcgcacatg cgactgtctg agaagggtgt 18780

ccttcatgtt ccgcgtcata catattccga ctctatgaat cagcgctgtc tagcagcgca 18840

cgtcgaagtt caaggtgaca ttttgttcaa tcggaatcaa aaatatactg tactgcaggt 18900

tgagcatgtg ggaacgaccg agaaacaagt cgctcgcctg catgcatatc catccatcgg 18960

actcatgtct ggtgtctcga gaacaaatat cgaggtcgaa gttgattatt ccacagcaca 19020

tagtatcaaa attgaagggg cgggatcttt ctacctttct ttaggtacag cctcccgtca 19080

tagcagcggt ctccaccctc gcacgggaaa aggccactcc agtcgcgtct tcgcactctc 19140

tgagcgcaat gcgtcacgcg tgcatacccc aatcttgtgg tgctgggatg tccctgccgc 19200

tgtttccgcg gcgcaggaag ctgggttcct agcgaatata gtggctgtct tgatcgcgaa 19260

agatatccta tccaagactg aacccgactc ttcaatattg cttttagaac ctgatgtgac 19320

catcctgaag atcctcgatt cactcgcgcc tttgcacaag acaaagatta tatcggtcac 19380

acacaaggca actgccaaag ccaacagaaa gagtctgatt tatatccccg agcgtacgcc 19440

ctctcatcgc atacggcaaa tgattccaca caaaaaagtt gtcagagccg ttgtttttga 19500

ttctaaccgc gtctgtaacg gacgaaatga tcgcatctgc aacctctttc cgaatgctcg 19560

acagcttgat atcgcgtcct tctatcaaac tgtgccgatg ccaaactcac cagaacatgg 19620

ttccatactg tgtattcctg cagcggttca gagtgtagcg gggtggcttc accccgaaga 19680

ttccactttt gcagtaacct cgatcacaaa acttatttca gaagaaatcg atctacgacc 19740

aacctctgtg atcaaatggt catctgagac tcagaacccg atcaaagcgc agatacgttc 19800

agcgacagat gcggtcaatt tgtcgcaaca aggcgcatat gttttgtggg agctgcccaa 19860

ggccttgaga aggaccgttg ccgattggct tgtctcccat ggagcgcagc atcttgtttt 19920

tgttcagaaa attcccgatg atacccagtg ggtgtccagc attacatgtg gtggtgcaga 19980

agttgttatt gtgcctcctc aggaagatct cgttcacacg gttcttgcgc tccgagacca 20040

ctcgtctgtg ccgcttgttc ggggtattgt atttactggg gcactcgata atgctgtggc 20100

tgctgagacg atccaacggg ctaaatgctt gtcccaacat tacgactctc ccaatctaga 20160

gatgttcttg agcattgact gctgcccagc gataccgaat ccgcagcagt gcgctgtgac 20220

cgaatttctc gcagcactag cacatcaacg agcaatgatc aatcttgcgg caagtgtcct 20280

ctgtcttgga cccgggtttg atctcgacaa tccacacgga gatgatattg cggagatact 20340

tgcagaggct gccttagccg gccatccctt tgccggtggc gatcgcgtgg ttacagctgg 20400

cctctgtccc ggtactggca gtccagagta caaggcgtgg gacactatcc actcgcggaa 20460

cccagcaatg tcgaacatcc ttgctttgtc aaggaaaggt gggcaagaag agactgctgg 20520

cgttgaggca gccacggagc atatcccttt gaaagtccaa ctcgagcgtg ctaaagaaac 20580

cacatcggca gccttggctg tgcgggctat tttgaatcag tactttacca gatacctccg 20640

gatgcggctc cagtccacgg ccgagatcaa tgagaatacc ttattcaacg aacttggtgt 20700

ggactcgatg gtcgcggcac agttggttgg gtggtttatg aaagaagttg gcgtggaggt 20760

ttcggttgtt ttcattctcg ctggcgcatc tgttggcgag gtcctccagg atgtcacgga 20820

gaagcttatc ccttgaggtc gagatttttc tgtgtgaata aatatagctc tcctgacgcg 20880

accttagaaa accacatgcg taccagatgc aaatttttag gtcattcaat attaacatct 20940

acatgcagaa gcaattactt ccttcattat cagtctcatt tataatctgt gcactagact 21000

gtaatagagg ctgtgcagca tgactcaaaa actaggaaaa ggtcacttca acaggctagg 21060

tacgtttatc accaacaaaa gatggaatct gatccactca gctcatttga tgtagacatg 21120

gataaatatt ggcaccgaag gcatatttac actactgccg gcgagattga gccaaacata 21180

acaagctgcc cgaggtgcgg atttgcaatt gatccgtgac atttccttga aggacccaac 21240

cgcctcccat cacaacgccc cagctgaggc aaaacggcgc tcggagaaga cttgaacgta 21300

aattgaacga gagttcctaa ggaatttcac gcaatggaaa gcgccgcccg ctcagcccag 21360

acgtaggtgt ggtatacccg ctgacccgtg ataggaagct cagcgaccac ctatttctat 21420

aagcttttgc ccctcgcatg ggtaagtcct ataaaaaaga gccctcttcg gttcgatgca 21480

atcccttctg tgtttacttt caagtatcaa gtgatcatgt ctgactctaa ctgttacgac 21540

ctggtcagct ttgccttcaa cgggccgttc ctccacagcg aacagccacc gattttcatc 21600

gatgccaaaa gtccctctcg agcgttgagt gccgggccgt tcaagcgact tctttgctcg 21660

ctgattgccg gtctcactgc tcaccagatc cagccagggg actgcgtgct tgttcaaatg 21720

gataactatg taactgaacc tggacctagg cctcagtctg tggatgagac ctttactgac 21780

ggatgcgcga gcaccagatc cttcattccg ccgtctatct cgcaatcatc ggtgcaggag 21840

gtgtctacat gggctgtagc ccgacgactc ctcgccacga gctcgagcat tttgtgaagc 21900

tctctgatcc acgtatcatt ttgacagcag agagtgctct ccctctggtt cgagaagtct 21960

gcgcttcttc tccttcgccg cgccaaatct gcctcgtcac cgaaactgga attgatgagc 22020

ttattgcctt cgcgaacgaa cacgacccta gcaacggttc tctgtcctcg acggggaaca 22080

aaaatgacgg aagaaacaat gacccggagt tgcagcctga ataccccatc actgaactta 22140

caggccatgg ctcagccccc tggcgtcgta tacccacatt ggaacttgcc aaaacgacac 22200

cagcggccat gtttactact agtggcacta gcggactccc caaagcagcg atccgcacgc 22260

accacaccat catctcgcag cacctgagcg tctactacca gaccccctac agcatctcca 22320

ccgagatcac agaggaaggt gtcgaaattg acgcaagttc aaaaacccaa catggtcgaa 22380

tccgtcgcct tctcgccctt cccgcctacc attccttcgg tgacttctgg aataacctgt 22440

tcccgctccg ctatggcgag ccgctataca tcgtcccacg cttcgatctc gctgacttca 22500

tcgccgcggt cgagcgcttc cgcatcacgg agacctatct cgtccccgtc gcggtgcaga 22560

tgctcgcgca ggcgggccgg gcagccaatg gtgcgcgggt ccgcgagggt ctcgcctcgt 22620

tgcgatatat cggtgtgtcg ggggcgccgg tcgatgcggc ctctttgcaa agatgtgagg 22680

aggtcttgca tccagatgcg tgtgtgagtc agctgtgggg gatgaccgag gttggggtcg 22740

ttttccaaaa tcgctatggg gatcgcctgc atcctggaag tttgggaatg ctgcttgacc 22800

ggtacgaggt gcgattggtg gatcccgttg ggggtgaggg agttgatgga tcgcttggtg 22860

aacttgggtc agggcaacca gccacaggag agctgtatgt tcgtggaccg gggctcatgg 22920

ctgggtacaa aggacgaagt gaccccgttg tggatgcgga ggggtggttc ccgaccggag 22980

acatggtcta cgagaaagac ggacactggt ttattgtggg tcggaccaag gagctgatta 23040

aggtaagggg gtactcggtc gctccggcag agatcgaggc gcttctgctc gacaaggagg 23100

agggcatagc agacgtggct gttttaggag tcaaatcggg gaatggggac ggagaggaag 23160

tcccacgggc ctacgtggtc cgttcaaagg agcaaagtca aggcagtggt aagatagcaa 23220

cgtccggggt agtcaccgag gagcggattc gggcgatcat gcagcaacat ctggccagct 23280

acaaggcgtt ggaaggcggc gtggtctttg tcgacagcat tccacgcaca gacatcggga 23340

agccggctcg gtccaagctg gcgagattga atcagcagcg tgacgagctg gcagccttgc 23400

tccaggcgac ttgtacaagt gtcagagaga agtagaagat agaatggcac actctagcgg 23460

tggtttattc acttatatat gactacgttg atgagtttcg ccgcttcatc aagacttggg 23520

cctgcggatc cgccagaaga atctcatcga tcatcatatt cctcggtcgc tccttcccat 23580

caggcaagcg gaactcatac ccgaccaaca aatgggccag gatgatcttg atctcgttgg 23640

cagcaaagaa tctcccgggg caagcgtact tgccatggcc aaagtgaaga ctatttttgt 23700

cggttgtggc gaactgatgc cggtgtgctt ctgcgggatc gaccctacgc cgccgtgagt 23760

agcgatatcc gtcgaactcg gggtcataat ctgtgctatt ggtgatatct gcagcgggta 23820

ccgcgagatg tgtccccttg gggagaacgg tgccgtcaga tagggtaaga tcgcgcatga 23880

cgatgcgttg gaagctcact aaagcagggt tagatcggag ttggcccaaa gaactcggtg 23940

ggatgattaa agacttgggg ggtaacgaac gtagagcagg cgggttcaaa cgctgcactt 24000

ccttgatgaa gctgtcgaga tcccacatct tcgtcagagt cgtcttctta tattcgccgc 24060

catcttcgac gagggcctga agcacctctc gacgtaaggg ctcaatatag tcttggtgcg 24120

cgcagagatc gtatacagcc tgggttgccg aggcggtagt ggtgtggatt gctgccagac 24180

tgaggatgag ctgacgatgc gcgagttttt cgggctgact gtcatacgga ttcgccttgt 24240

ccatcatcca ctgcaggaga tcggctggct ttttcttctc cgcatcgcct gggctcgtgg 24300

attgctggga tcgtcgctca cgaaccaagg tgccgatgat tcgatttccc gtcgagagcc 24360

cgcggcggat cgccctgtat cgaggaataa gaggagcgat gagcgggcgc atccagcgtg 24420

gaaagcgacg caggatggcc agggtaagga aaacatcctc ggtaaaatgg atcgagagat 24480

tgagccattc ctcattacgg caggtaggga gcccgacaaa gacgcgtgcc gaaatgcgcg 24540

cgacgatgcg cagaatgacc tcgtagatac aaactggagt ccattcgtcg atagtgagat 24600

tgcttggccg gaactcctgc gcgaaagcaa agtctagctc ggatttgaca tcgtggatca 24660

gattgccgag tcgcggggtc aactcggttt gcaagacgtg tgtatgcagg gtcccctcat 24720

caaggatgtc gatggtcgaa tacctgccga gaagattctg cagagttcaa aattcaaggg 24780

gtcattgaca tgctcgatcg agagcaatat gtgtaagaag taccttcata tgtgccttga 24840

tcgcactcag ctgctcatcc ggcttggagt gtagctcgtc cacaaatcgc cttggaacga 24900

ccagaatgtt cgtgtccacg cgtgcgatcc tgaacatccc atccttgtat tgtcgacacc 24960

cctgcgtgat ctggtggagc gcatcttgcg aaaaacggac agcaaccagc cagcggggct 25020

cccagcgaga gcggaaacca acaaaaggcg cttgcaggcg atgtgagtgg aagaccaact 25080

tctgcaggaa tacaatgcct agggcgacca ggctgatttg gacgagggaa ctcgactcta 25140

cgagccagga agtggtgagg tccagtttcg tcatattcag tgaacgtgta ggtagctagc 25200

ggaagggaaa atggtaaaga gggcttgcca actatgccta catcgcatca aacgacttta 25260

taagaggcac acgctgaagc ctgcaagggg ctctatcagg cagacttcaa cgccagctca 25320

tcctccatcc tgcgatctct caccgtccac accggcactc catgataccc gcaccaactc 25380

cgccacgcga tcatcttctg cgcgaggggc gtcatttctt ccagaatatc tcgcgacagg 25440

tcaacatggg cctccatcgg ggtaaaatgc gcgggatgca tcgtcacact caacccacgg 25500

cggctctgca tggactgatt ctcgccagcc ccatgccaga cgcttcccaa gtacaagaca 25560

gcgtcacccg gccgcatcac cgcgcccact gtgttttctg gaactgcccc ggaaatctcg 25620

tctccactcc agcgatggct cccgggaatc agcctggtgg caccattatc ctcgcgaaat 25680

tcggtcagcg cgatgaaaaa gttcatcatg agttctggcg cgcccggtcc cagatacttc 25740

gtgaccccgt atagactgtc atcgcggtgc agaccctggg gtttctcacc gggttcaacc 25800

tggagaacgg cggctcggtt gacccaatag tcgccaaagg gtgcggtgaa gaaagagtcg 25860

gagacggcat gcatcatagg gtggttcagg atagtcgtgc ggtatgtcgg ggagatggcg 25920

gctaggtttc ccatatgctt cgtgcgcgag ccgacggtct ttttgtacaa ctcgccggat 25980

cttgcctggg ggccggtgat ggtggcattc aggtatgggt cgacttcttc attgagggca 26040

gcgacaaccg agattggaac aaactgtcgc acgatgacgg cgccgtcact cacgatgagc 26100

ttgctgattt cctctgtgga cgttgagggg tcgacagtac ggatggcctt tggagaaacc 26160

gagacagtca tggcgacgga gatcccagcg tgcacttctt tgaaatgagc tgatgcttgg 26220

attctttgaa cgagcttata acttagcttg atcgcaccaa atgcaatggt gaacggcggt 26280

gtgatgttga tctattagag gccatgttta tcccactgga aatgcaaggg gtagttagta 26340

gcgaaggggg cggatcaggg gagacagact tataatcatt gatgcaatca gggtcgtgac 26400

ggagagaagg aggcttgtcg taacagcgcc caccaaacca agatgatcgc ttttgtgctc 26460

tgtgcggtga tcacggtact gtatgtgatc ggaaccgccc ttcgagacct ttacctccac 26520

cctctgcgtc gagtcccttg ccactggcca tgggtggctt ttcctctgct ccgtcatata 26580

tccgccgtgc gcggcaacgt tgacctcgac atcaaacaat ggcacgaccg atacggcccg 26640

gtggtccggt tctctccaaa tgaggtctcc ttcaccacct ctgaagcctg gagtgaaatc 26700

tacggccgcc atggccgata ccaatgcctc ccaaagacca agttctcaaa cacgagcaca 26760

atagatctca tccacgcaaa cgatgcggat catgcccgat accgcaaggc tctcgcccat 26820

ggcttctcta ccaagggtgt tcgcgagcaa gagtccctaa ttcagggtta tatcgacaag 26880

ctcgtctccc aacttcaagc gtttgcagat gcacaccagc aggtagatct ggtgatttgg 26940

taccgactca ccactttcga tatcattggc gatttggcat ttggcgagca ctttggtggc 27000

ctcgacaagg ggcgctatca tccctgggtt accttcatga ccgggtacac gcgcatgatt 27060

cctttcttca aagcaatgga tgcgtatcca gctatctttc gcaccgcatt cgctttcatg 27120

tcatcctcat ctcaggcaat tgcgcagcag atgcagtaca gtcgggaact agtccagaaa 27180

cggatcaaat cggcctcatc gagccgtccg gactttgtgg actcgatcat gcgccagcag 27240

ggaaccaagg atgagctctc cgatgcggaa atcgaggcaa acgctagtgt cattataatt 27300

gctggaagtg agaccccggc tgatctgcta tgttcggtga catattggct cttacggact 27360

cccaacgttt ttgctcgtgt acggaatgag ttgcaagatg cgatcacctg cccagcggat 27420

ataacttttc agaccgtcac tcaaggacta cctctcctca cagcatgcct gaatgaggct 27480

ctgcggctct atccctctgt acctgggggc ctacagcgcg atacagtggg ctcggccacc 27540

ctctcgggat ataccatcgc tcccaatgtg aggaatccaa agatattggc catcagtgtc 27600

ctctgctgat cataaaaaaa acaacagacg caggtcggcc ttcatcaata cgcagcctac 27660

acttcgtcat ccaacttcca tctgcctgag tccttttgcc cagaacgctg ggacccagat 27720

gtgccgaata atccggcgtc cctgttttac aacgacaatc gtgacgtatt tcagcccttc 27780

tcggctggac cccggaattg tatcggcaag aacctggcgt acgcgatcat gcgaacggct 27840

ttagcaagag ttctatggga attcgaccta aagttgtgcc ctgaaagtga gaattggcat 27900

gtccagaaaa cttatgggct atgggacaag gggccgctgc tttgtcaact gagccgaagg 27960

gaatgcagaa agtgattctt gttggaagct ttacgtctca atgccagtag atcattgtcc 28020

aggagaatgt cccttcattc tggaattttc taatacaatc cgaacaagtt gttctattcg 28080

ttaacgctgg tatggtggct ttgacttgtt gtgtgaacac gcagtacaat ggtctag 28137

<210> 2

<211> 1524

<212> DNA

<213> Penicillium oxalicum

<400> 2

atgcagtacc aactttcagc cccaaccatt ctcatcctca tagctccctt agtcctggga 60

ctcagcctat accatctcgc ccgagcctgt tttcctctcc aacgccggcc aaaggacatc 120

tcatggatag gtcgcgagca gggcttgctc agcgcgttcc gtgcctgtct tgctcaatgg 180

cagtacaatc cggccatcct cgaggccggc tacaaagcct tcaacaaaac tggcaaagcc 240

tttcttatgc cgttgattag ttttgagccc gtcgtcatcc taccgcaaga gcacatacaa 300

tggattatcg atcaaccgcc cacggtcctg tgcccacgcc gcgccgcata ctcccggatg 360

ggcgtgcggt acgtggcgcc tggcttcaca ccagccacaa gtgagatact gcacaccgcg 420

atcaaagtcc acctgaacaa gaagtttgac aggttgcaac cggctatgta tgaccaactg 480

agttgggcga ttgatcgcag ttttggcacc gcaaactgtg tcagtaaggt gtcacttggc 540

gacgcgttgc gctacgccgt ttaccatacc ttggttcccg ttctggcggg tcgcgaattg 600

gccaaaaatg agcgctttgt agaggcgatc atatcgagct cacagtggtt tggggcggcc 660

tctacgataa cagggcaatg tttgccggcc ccttttcgag gcgtcatcgg gtgggtgctg 720

cagaagccca tcggatatgt ccagcgccgg tacctggctt acctgatgcc aattgtaaaa 780

gagagattga acaaattgca ggaggattca caggtcccgg aagacatggt cacttggctc 840

tgtcaagcca tcctcaagac acgcggccca gaaggagctg agggggtgtt cgctgacgct 900

tttaacttac tgcttggagc tgcatttaca agtaccgtat tgacggcgca ccatgccttg 960

ctcgacatac tcggctcgag cgaaaaggca gagatttacc aaattcttcg aagcgaggct 1020

gagtcggtgt ttgatggtcc tgctaaatgg gctgacccag ctactgttca tcgtttagga 1080

tacatcgata gcacccttcg agagagtctg cggcgggcgc cacccacctc gatggctctg 1140

ttgcgcgagg tcgttccccg agatgggctg gcgctgccaa atggacaact ccttaacaaa 1200

ggcagctggc tggctgttcc ttcaattccc attcataacg ataagagatt ctacgagaat 1260

gcagaacaat tcaagccttt tcgttttgtg caggatggga aatcagagtc ttgtgtctcg 1320

acaagcgaca catttctgtc ctttggacac ggtcgctcgg cctgcgccgg aagacagttt 1380

gcaacccgca tattgaaaat gatgctttct tacatcgtcc tgcattacga catcgaagag 1440

attgatggac ggcctccgaa ctttttcatg ggagagcatg ctgtgcctcc ggatgtggta 1500

gtgagagtgc gaagaagagc ataa 1524

<210> 3

<211> 507

<212> PRT

<213> Penicillium oxalicum

<400> 3

Met Gln Tyr Gln Leu Ser Ala Pro Thr Ile Leu Ile Leu Ile Ala Pro

1 5 10 15

Leu Val Leu Gly Leu Ser Leu Tyr His Leu Ala Arg Ala Cys Phe Pro

20 25 30

Leu Gln Arg Arg Pro Lys Asp Ile Ser Trp Ile Gly Arg Glu Gln Gly

35 40 45

Leu Leu Ser Ala Phe Arg Ala Cys Leu Ala Gln Trp Gln Tyr Asn Pro

50 55 60

Ala Ile Leu Glu Ala Gly Tyr Lys Ala Phe Asn Lys Thr Gly Lys Ala

65 70 75 80

Phe Leu Met Pro Leu Ile Ser Phe Glu Pro Val Val Ile Leu Pro Gln

85 90 95

Glu His Ile Gln Trp Ile Ile Asp Gln Pro Pro Thr Val Leu Cys Pro

100 105 110

Arg Arg Ala Ala Tyr Ser Arg Met Gly Val Arg Tyr Val Ala Pro Gly

115 120 125

Phe Thr Pro Ala Thr Ser Glu Ile Leu His Thr Ala Ile Lys Val His

130 135 140

Leu Asn Lys Lys Phe Asp Arg Leu Gln Pro Ala Met Tyr Asp Gln Leu

145 150 155 160

Ser Trp Ala Ile Asp Arg Ser Phe Gly Thr Ala Asn Cys Val Ser Lys

165 170 175

Val Ser Leu Gly Asp Ala Leu Arg Tyr Ala Val Tyr His Thr Leu Val

180 185 190

Pro Val Leu Ala Gly Arg Glu Leu Ala Lys Asn Glu Arg Phe Val Glu

195 200 205

Ala Ile Ile Ser Ser Ser Gln Trp Phe Gly Ala Ala Ser Thr Ile Thr

210 215 220

Gly Gln Cys Leu Pro Ala Pro Phe Arg Gly Val Ile Gly Trp Val Leu

225 230 235 240

Gln Lys Pro Ile Gly Tyr Val Gln Arg Arg Tyr Leu Ala Tyr Leu Met

245 250 255

Pro Ile Val Lys Glu Arg Leu Asn Lys Leu Gln Glu Asp Ser Gln Val

260 265 270

Pro Glu Asp Met Val Thr Trp Leu Cys Gln Ala Ile Leu Lys Thr Arg

275 280 285

Gly Pro Glu Gly Ala Glu Gly Val Phe Ala Asp Ala Phe Asn Leu Leu

290 295 300

Leu Gly Ala Ala Phe Thr Ser Thr Val Leu Thr Ala His His Ala Leu

305 310 315 320

Leu Asp Ile Leu Gly Ser Ser Glu Lys Ala Glu Ile Tyr Gln Ile Leu

325 330 335

Arg Ser Glu Ala Glu Ser Val Phe Asp Gly Pro Ala Lys Trp Ala Asp

340 345 350

Pro Ala Thr Val His Arg Leu Gly Tyr Ile Asp Ser Thr Leu Arg Glu

355 360 365

Ser Leu Arg Arg Ala Pro Pro Thr Ser Met Ala Leu Leu Arg Glu Val

370 375 380

Val Pro Arg Asp Gly Leu Ala Leu Pro Asn Gly Gln Leu Leu Asn Lys

385 390 395 400

Gly Ser Trp Leu Ala Val Pro Ser Ile Pro Ile His Asn Asp Lys Arg

405 410 415

Phe Tyr Glu Asn Ala Glu Gln Phe Lys Pro Phe Arg Phe Val Gln Asp

420 425 430

Gly Lys Ser Glu Ser Cys Val Ser Thr Ser Asp Thr Phe Leu Ser Phe

435 440 445

Gly His Gly Arg Ser Ala Cys Ala Gly Arg Gln Phe Ala Thr Arg Ile

450 455 460

Leu Lys Met Met Leu Ser Tyr Ile Val Leu His Tyr Asp Ile Glu Glu

465 470 475 480

Ile Asp Gly Arg Pro Pro Asn Phe Phe Met Gly Glu His Ala Val Pro

485 490 495

Pro Asp Val Val Val Arg Val Arg Arg Arg Ala

500 505

<210> 4

<211> 5926

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 4

cgacacaaat aaatattagc tgccagccca gcaagcgcag agcaagatca tgtgagactg 60

gatgaagcac ctgctagaaa tatcatggca tttgatcagg ttgaagtgag atcagtatcc 120

cagtagagta gcggggtgtt cttttccaaa ggaatgttcc accctggccg aacgttcttc 180

tcttccttgc ccgtgaatct ttaatgttct agcaaccaca gacggagaaa gactcagctg 240

agaccagcgg ctatacagga acaccagcta ctatttacac gtgttatgct agattgatgg 300

atatttgagt catttgtctt tgacatctgc gctcaagact tgacgaagaa agggcaaatt 360

caaaaaccca cagagaccga acaacaggct gaaagccctg atgggagttc ataggttggt 420

aatgagcagt aaaactggta ctgggcagtc atatgcaatt attcctgtag gagtaagggg 480

ctcgcctagc ccaattgcct tgcaagataa gctagtcacc aaataaatat agatcaattc 540

ggttggtttg gactctcatc tccatttctt gtcttcatca tcctgtagat atcgccaatg 600

tccctcgagc ccatagctat tgttggaaca ggatgccgct ttccgggttc ctcttcctca 660

ccgaatcgtc tctggcactt gcttcaaaat ccgcaaaatg tcgcctccaa agtccccagt 720

gagcgcttca acgtggactc attctaccac cctaatagcc agcagcatgg ctcgacaagc 780

gtggccgagt cttattttct tgaggaagat ataagagcct ttgacgcgcc tttcttcagc 840

atcagcccag cggaagcggc tgccatggat ccacagcaac gcttgcttct ggagacggtt 900

tatcactccc tcgaggccgg tggccataga cttgacgctt tgcagggctc ggccacagga 960

gtctactgtg gctttctccg gactgattac agccagatac agtttacaga cccggactcg 1020

ttgccaccgt acacggttac aggaaattct cccgcaatca tggcaaaccg catctcatac 1080

tttttcaact ggactgggcc atcgttcgcg gtggataccg ggtgctcttc gagcttgctg 1140

gcagttcacc tggctgttga atcgttgagg aaaagagact gtgatttggc tgtcgcggtg 1200

gggagtaatc tgcttctatc gcccaaccct tatatcgcgg atgcaaagac gggaatgttg 1260

tcagctacag gccgatcgcg gatgtgggat gcatccgcgg atggctacgc gcgcggagaa 1320

ggggttgcgt cggtagtact caagcgattg agcgacgccg tcgctgcagg ggacgagatt 1380

gagtgtgtaa ttcgagctac agggatgaac agcgacggcc ggacaatggg tatcaccatg 1440

cccagtggag aggcacagcg gaaactgatt gagtcgacct atgccagtat tggacttgat 1500

cccaaaaatg ctcaggacag atgtcaatat ttcgaggcgc acgggacggg aacgcaggcg 1560

ggagatccac aagaggccag tgcgattcat gcggcattct ttgggaacga agctgaaaac 1620

gacagctcta acgtcctgca tgtcggttca atcaagacag taatcggtca tacggaagca 1680

actgctggcc tggctggctt gatcaaggca tctctgtgtc tacagcatgg ggagatcaca 1740

ccgaaccttc tgttctccac gcctaaccct cgcataacac cgcatcttac tcgactccag 1800

gtgccgagtg agtctgtagc atggcctacc ctgccgcccg gggcaccacg tagggcttcg 1860

gtgaactcgt ttggctttgg cggtgctaat gttcatgcca tcctggaaag ctatgaaccc 1920

ccttcttcat ctcgccgagg ctcagaagat gcagaggcgg attgtttgct tcttcccttt 1980

gtggtttcag cggcatcaga accctcattg aggacagcac tggagaggct tttccaattc 2040

cttgaggatc agccggtgac aaacatgatc gactttgctc agaccctctt gacgcggcgt 2100

tcgtgccata aacatcgtat agtatttatc gctagctcat cggacgagct cagagacaag 2160

attctgcatg aaatatccta cccatccagt ggccagatat ggaggtcaac acatcaatgc 2220

ctattttggt ttagtcgtcc aggcggtgag cacaaaattt gtgtcgtttg acaagatggt 2280

tcatttaggc aactggtcag atcagcccca cttgtagcag tagcggcggc gctcgaagtg 2340

tgactcttat tagcagacag gaacgaggac attattatca tctgctgctt ggtgcacgat 2400

aacttggtgc gtttgtcaag caaggtaagt ggacgacccg gtcatacctt cttaagttcg 2460

cccttcctcc ctttatttca gattcaatct gacttaccta ttctacccaa gcatccaaat 2520

gaaaaagcct gaactcaccg cgacgtctgt cgagaagttt ctgatcgaaa agttcgacag 2580

cgtctccgac ctgatgcagc tctcggaggg cgaagaatct cgtgctttca gcttcgatgt 2640

aggagggcgt ggatatgtcc tgcgggtaaa tagctgcgcc gatggtttct acaaagatcg 2700

ttatgtttat cggcactttg catcggccgc gctcccgatt ccggaagtgc ttgacattgg 2760

ggagttcagc gagagcctga cctattgcat ctcccgccgt gcacagggtg tcacgttgca 2820

agacctgcct gaaaccgaac tgcccgctgt tctccagccg gtcgcggagg ccatggatgc 2880

gatcgctgcg gccgatctta gccagacgag cgggttcggc ccattcggac cgcaaggaat 2940

cggtcaatac actacatggc gtgatttcat atgcgcgatt gctgatcccc atgtgtatca 3000

ctggcaaact gtgatggacg acaccgtcag tgcgtccgtc gcgcaggctc tcgatgagct 3060

gatgctttgg gccgaggact gccccgaagt ccggcacctc gtgcatgcgg atttcggctc 3120

caacaatgtc ctgacggaca atggccgcat aacagcggtc attgactgga gcgaggcgat 3180

gttcggggat tcccaatacg aggtcgccaa catcctcttc tggaggccgt ggttggcttg 3240

tatggagcag cagacgcgct acttcgagcg gaggcatccg gagcttgcag gatcgccgcg 3300

cctccgggcg tatatgctcc gcattggtct tgaccaactc tatcagagct tggttgacgg 3360

caatttcgat gatgcagctt gggcgcaggg tcgatgcgac gcaatcgtcc gatccggagc 3420

cgggactgtc gggcgtacac aaatcgcccg cagaagcgcg gccgtctgga ccgatggctg 3480

tgtagaagta ctcgccgata gtggaaaccg acgccccagc actcgtccga gggcaaagga 3540

atagctcgag tttctccata ataatgtgtg agtagttccc agataaggga attagggttc 3600

ctatagggtt tcgctcatgt gttgagcata taagaaaccc ttagtatgta tttgtatttg 3660

taaaatactt ctatcaataa aatttctaat tcctaaaacc aaaatccagt actaaaatcc 3720

agatcccccg aattaattcg gcgttaattc agtacattaa aaacgtccgc aatgtgttat 3780

taagttgtct aagcgtcaat ttgtttccgc ggcgcaggaa gctgggttcc tagcgaatat 3840

agtggctgtc ttgatcgcga aagatatcct atccaagact gaacccgact cttcaatatt 3900

gcttttagaa cctgatgtga ccatcctgaa gatcctcgat tcactcgcgc ctttgcacaa 3960

gacaaagatt atatcggtca cacacaaggc aactgccaaa gccaacagaa agagtctgat 4020

ttatatcccc gagcgtacgc cctctcatcg catacggcaa atgattccac acaaaaaagt 4080

tgtcagagcc gttgtttttg attctaaccg cgtctgtaac ggacgaaatg atcgcatctg 4140

caacctcttt ccgaatgctc gacagcttga tatcgcgtcc ttctatcaaa ctgtgccgat 4200

gccaaactca ccagaacatg gttccatact gtgtattcct gcagcggttc agagtgtagc 4260

ggggtggctt caccccgaag attccacttt tgcagtaacc tcgatcacaa aacttatttc 4320

agaagaaatc gatctacgac caacctctgt gatcaaatgg tcatctgaga ctcagaaccc 4380

gatcaaagcg cagatacgtt cagcgacaga tgcggtcaat ttgtcgcaac aaggcgcata 4440

tgttttgtgg gagctgccca aggccttgag aaggaccgtt gccgattggc ttgtctccca 4500

tggagcgcag catcttgttt ttgttcagaa aattcccgat gatacccagt gggtgtccag 4560

cattacatgt ggtggtgcag aagttgttat tgtgcctcct caggaagatc tcgttcacac 4620

ggttcttgcg ctccgagacc actcgtctgt gccgcttgtt cggggtattg tatttactgg 4680

ggcactcgat aatgctgtgg ctgctgagac gatccaacgg gctaaatgct tgtcccaaca 4740

ttacgactct cccaatctag agatgttctt gagcattgac tgctgcccag cgataccgaa 4800

tccgcagcag tgcgctgtga ccgaatttct cgcagcacta gcacatcaac gagcaatgat 4860

caatcttgcg gcaagtgtcc tctgtcttgg acccgggttt gatctcgaca atccacacgg 4920

agatgatatt gcggagatac ttgcagaggc tgccttagcc ggccatccct ttgccggtgg 4980

cgatcgcgtg gttacagctg gcctctgtcc cggtactggc agtccagagt acaaggcgtg 5040

ggacactatc cactcgcgga acccagcaat gtcgaacatc cttgctttgt caaggaaagg 5100

tgggcaagaa gagactgctg gcgttgaggc agccacggag catatccctt tgaaagtcca 5160

actcgagcgt gctaaagaaa ccacatcggc agccttggct gtgcgggcta ttttgaatca 5220

gtactttacc agatacctcc ggatgcggct ccagtccacg gccgagatca atgagaatac 5280

cttattcaac gaacttggtg tggactcgat ggtcgcggca cagttggttg ggtggtttat 5340

gaaagaagtt ggcgtggagg tttcggttgt tttcattctc gctggcgcat ctgttggcga 5400

ggtcctccag gatgtcacgg agaagcttat cccttgaggt cgagattttt ctgtgtgaat 5460

aaatatagct ctcctgacgc gaccttagaa aaccacatgc gtaccagatg caaattttta 5520

ggtcattcaa tattaacatc tacatgcaga agcaattact tccttcatta tcagtctcat 5580

ttataatctg tgcactagac tgtaatagag gctgtgcagc atgactcaaa aactaggaaa 5640

aggtcacttc aacaggctag gtacgtttat caccaacaaa agatggaatc tgatccactc 5700

agctcatttg atgtagacat ggataaatat tggcaccgaa ggcatattta cactactgcc 5760

ggcgagattg agccaaacat aacaagctgc ccgaggtgcg gatttgcaat tgatccgtga 5820

catttccttg aaggacccaa ccgcctccca tcacaacgcc ccagctgagg caaaacggcg 5880

ctcggagaag acttgaacgt aaattgaacg agagttccta aggaat 5926

<210> 5

<211> 5716

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 5

atcatccgcc aaaaactaac acatcatttg gtcgatctca tcagaccgct gtctgaggag 60

gccgatgatt gtttacaccg gagttggaca gataattcag gtactccaaa tctccatgtc 120

gtagctcgtc catgaggatc cattcactta ttaatcctta gattggcacg aaatttctct 180

caaatccacc ctcctcgaca tgatatccca gcaatcggcc cacgtcttcc tcggccgcag 240

cttttcccat aacgtgagtt ggctagcgct gtcgcgcagc ataaccttgc aggccttcgg 300

cgccgtccgc gagcttcgcg tatacccatc cttcatacgc ccgcttgttg gctggtttct 360

ccccgcatgt aaatcacttc gcggagagat tgccaaagcc cggaagcttg ttgagcccct 420

tatactagct cgaagactcg aaagagagcg atgcatcgcc agtggccggg aaccacccgt 480

ctatcatgac actattgcat gggcagagga atgtgcacgt ggacgaaaat acgatccagc 540

tcttattcag ctcacgctcg cgctttcggc tatgcacaac acctctgact ttctcacgca 600

agtaatatat gacatagcgg cgaggccgaa actcgtggag gagttgagga aagagatcat 660

cgatgttcgg acgtgtggag atgcaacaga gtcatggaat aagggggcgg ttcacaagtt 720

gaagttgatg gatagtgtca tgaaagaaag tcagcgattg aagcctacgg gattgggtaa 780

gttttgctgg gatcaacgct tattctctac aaggctaata tgctaatcat atagtaaaca 840

tgcggcgcta tgcaactgag gacatccagc tctcttccgt cattcccgag cacaaggaag 900

gcagcatcac aatccgaaag ggggatctgg tcatgatatc gcaacacagc cactgggacg 960

aggatattta ccaagacgcg gcgtctttca acccataccg attctgcagg atgcgcgaac 1020

aacccacgca ggagcacaca gcacactttg tcgccacaag tgtcaaccat atcggcttcg 1080

ggcatggggt gcatggctgt cctggtcgat tctttgccgc cgctgagacg aagcttgcaa 1140

tgtgtcacat tttgatgaaa tacgacatta agcttatcga tcagcctaag gtcctcaatg 1200

taggttcgct tatggttgca aatcccgttg cgaaggttgc agtgagaagg aggaaggagg 1260

aggtttcatt gtgattgtga acagtgagct cgcccacatc tcactcagcc caaggagtac 1320

caaaggtagg tggagatgga ccgtaaccac attactgctt tcggacaaac tcaatttact 1380

acatacctcg tggaatactc accttcgcgt aaatgaaagt ctcccaacct ttgtaatcac 1440

agtatatatt gggcttccaa gcttccgtct atgtctgtga attctaaagc gttactatcg 1500

tcccttgaac ctctgtccca aacttgaatg atatcctttc tcgtccatca tgttgtcaat 1560

gatcgtaagg ggaagaatga taaaataaat tgaagtatgg ttattcagtt gaatctctgg 1620

cagactcaaa ttcacctatt caatctgaat tctaacttgt ccaggttcca tgtccgggtg 1680

gtttgtgacc gttgatatac ctatcgagca tacgtaatct tccaaagttt aaggttgcga 1740

cccaccaata cctgaaccag ggcgtagatc acacctagat acgtgtacaa cggctcatat 1800

tcgatcggtg tatcatatat gcctaggata atggctaaat gcagcctgcc taagaagcgg 1860

tcgggagacg gtgctccacc tacctagtag tagtagtagg actaggtact ccctatgcta 1920

cgtgtgtaat gactcaacac tttctcttgg ctatgaccgc ctctctggat gcaggtgaat 1980

tcacaattac taagtaaggt caagaaagcg gacataatgc aagagtggac attatgctct 2040

tcttcgcact ctcactacca catccggagg cacagcatgc tctcccatga ggaggtcaac 2100

acatcaatgc ctattttggt ttagtcgtcc aggcggtgag cacaaaattt gtgtcgtttg 2160

acaagatggt tcatttaggc aactggtcag atcagcccca cttgtagcag tagcggcggc 2220

gctcgaagtg tgactcttat tagcagacag gaacgaggac attattatca tctgctgctt 2280

ggtgcacgat aacttggtgc gtttgtcaag caaggtaagt ggacgacccg gtcatacctt 2340

cttaagttcg cccttcctcc ctttatttca gattcaatct gacttaccta ttctacccaa 2400

gcatccaaat gaaaaagcct gaactcaccg cgacgtctgt cgagaagttt ctgatcgaaa 2460

agttcgacag cgtctccgac ctgatgcagc tctcggaggg cgaagaatct cgtgctttca 2520

gcttcgatgt aggagggcgt ggatatgtcc tgcgggtaaa tagctgcgcc gatggtttct 2580

acaaagatcg ttatgtttat cggcactttg catcggccgc gctcccgatt ccggaagtgc 2640

ttgacattgg ggagttcagc gagagcctga cctattgcat ctcccgccgt gcacagggtg 2700

tcacgttgca agacctgcct gaaaccgaac tgcccgctgt tctccagccg gtcgcggagg 2760

ccatggatgc gatcgctgcg gccgatctta gccagacgag cgggttcggc ccattcggac 2820

cgcaaggaat cggtcaatac actacatggc gtgatttcat atgcgcgatt gctgatcccc 2880

atgtgtatca ctggcaaact gtgatggacg acaccgtcag tgcgtccgtc gcgcaggctc 2940

tcgatgagct gatgctttgg gccgaggact gccccgaagt ccggcacctc gtgcatgcgg 3000

atttcggctc caacaatgtc ctgacggaca atggccgcat aacagcggtc attgactgga 3060

gcgaggcgat gttcggggat tcccaatacg aggtcgccaa catcctcttc tggaggccgt 3120

ggttggcttg tatggagcag cagacgcgct acttcgagcg gaggcatccg gagcttgcag 3180

gatcgccgcg cctccgggcg tatatgctcc gcattggtct tgaccaactc tatcagagct 3240

tggttgacgg caatttcgat gatgcagctt gggcgcaggg tcgatgcgac gcaatcgtcc 3300

gatccggagc cgggactgtc gggcgtacac aaatcgcccg cagaagcgcg gccgtctgga 3360

ccgatggctg tgtagaagta ctcgccgata gtggaaaccg acgccccagc actcgtccga 3420

gggcaaagga atagctcgag tttctccata ataatgtgtg agtagttccc agataaggga 3480

attagggttc ctatagggtt tcgctcatgt gttgagcata taagaaaccc ttagtatgta 3540

tttgtatttg taaaatactt ctatcaataa aatttctaat tcctaaaacc aaaatccagt 3600

actaaaatcc agatcccccg aattaattcg gcgttaattc agtacattaa aaacgtccgc 3660

aatgtgttat taagttgtct aagcgtcaat tttgagaatg gttggggctg aaagttggta 3720

ctgcatcttg gtcacggcgg tcatgggcac gccacggagc aaggaattac cactgtttag 3780

tatgagagac tgaaaatata gatggtcgat cccgattgcc ctgattaaag agcggtatgg 3840

atggtgtgac gtccttgcat caagttttct tcgactttgc atgtaagggg tccctagcca 3900

cggactcgcc tgttctgaga atgctgatat aagaggcaca gctctctatc atggaattat 3960

ttacaggcca cagttctatc ccttcgtcac aatgatccgc agtcccactg ccccaagcag 4020

gcccctaggc cagatctcgt gggacctgat ccgcatctcg cgatttgaca agtacaactc 4080

atttctagcc ctctttgccg gaggttagtc cacccatccc aaattcatac actctaggca 4140

gtgggtgcta acaacacaca gtatggtcaa cccttcttgc ggggagcgca cgacttcgcg 4200

aagaccctga gcacgtctcc gttcaatata tccttagtcg tgcttttctg tgctccatag 4260

ccgcatatat attctctggg gcaggcatgg tgtggaatga ctgggttgac cgggacatcg 4320

atgctcgcgt ggcacgcacc aaggatcgtc ctttagctgc aggcagactg agcacagaag 4380

aagcaatgct ttggatgctg cttcaagctg gtgtagcaac gacatttttg tattggatga 4440

tggacggaca acatgtgttc gtgagcccct ggaaaagtca tctctctctc tctgctgtac 4500

caaggtcgac taacgaagcg gggctaccta gcttgcattc catgattcct ccaacattag 4560

gaacattgat atatccatat tgcaagcgtc ctctcgctcg ccgacttggt atctaccctc 4620

aatatgttct cggtctgaca gcttcctgcc ctgtcctctt tggccgtgct tcgatatacc 4680

ctgatataga atccttctct cgactcgtat cgtctagcct cccgctttgc ctagtggtgt 4740

ttacatggac tctctatttc aataccgcat acagctacca ggacatcgtt gatgacaaga 4800

aattgggggt gaactcacta tacaaccttg cgggaaagca catacatggc gtgcttgtgg 4860

ccctcgtgac aatcatggtg agcgcactgt ggtgggcact gtaccccttg ggatcagctt 4920

ggttgtggat ctcttggatg ggagtctgga tcgtgggatg tgtggaccaa atgcgcagat 4980

ttgatgcgaa ggatccttca agtggacagt acgtcttccg tagcaatgtc cttatggggc 5040

tctggacgat gcttgcttgt cttttggagg ttttttctac agggaagaga gtggctttgt 5100

gaacgaaatg gggaagacat agcgacacaa ataaatatta gctgccagcc cagcaagcgc 5160

agagcaagat catgtgagac tggatgaagc acctgctaga aatatcatgg catttgatca 5220

ggttgaagtg agatcagtat cccagtagag tagcggggtg ttcttttcca aaggaatgtt 5280

ccaccctggc cgaacgttct tctcttcctt gcccgtgaat ctttaatgtt ctagcaacca 5340

cagacggaga aagactcagc tgagaccagc ggctatacag gaacaccagc tactatttac 5400

acgtgttatg ctagattgat ggatatttga gtcatttgtc tttgacatct gcgctcaaga 5460

cttgacgaag aaagggcaaa ttcaaaaacc cacagagacc gaacaacagg ctgaaagccc 5520

tgatgggagt tcataggttg gtaatgagca gtaaaactgg tactgggcag tcatatgcaa 5580

ttattcctgt aggagtaagg ggctcgccta gcccaattgc cttgcaagat aagctagtca 5640

ccaaataaat atagatcaat tcggttggtt tggactctca tctccatttc ttgtcttcat 5700

catcctgtag atatcg 5716

Claims

The application of the OxaL protein or OxaL protein related biological material is as follows (a 1) or (a 2):

(a1) Use of OxaL protein or OxaL protein-related biological material as hydroxylase;

(a2) Use of OxaL protein or OxaL protein-related biological material in the preparation of hydroxylase;

The OxaL protein is a protein shown in a sequence 3 in a sequence table;

The OxaL protein related biological material is a gene encoding the OxaL protein, an expression cassette expressing the OxaL protein, an expression vector expressing the OxaL protein or a recombinant microorganism expressing the OxaL protein.
Use of an oxal protein in the synthesis of a compound oxalicine B; the OxaL protein is shown as a sequence 3 in a sequence table.
3. The use of a recombinant microorganism as described in (b 1) or (b 2) or (b 3) below:

(b1) Use in converting compound 3 to compound 8;

(b2) Use in converting compound 2to compound 9;

(b3) Use in converting compound 4 to compound oxalicineB;

the recombinant microorganism is a recombinant microorganism expressing OxaL protein;

the OxaL protein is shown as a sequence 3 in a sequence table;

compound 3 is shown as a formula I; compound 8 is shown as a formula II; compound 2 is shown as a formula III; compound 9 is shown in formula IV; compound 4 is shown in formula V; compound oxalicineB is shown in formula VI;

A formula I; /(I) A formula II;

a formula III; /(I) A formula IV;

Formula V; /(I) And the formula VI.