CN114272378B

CN114272378B - Use of an agent that causes a loss of function of CTTNBP2NL in the manufacture of a medicament for the treatment of a disease

Info

Publication number: CN114272378B
Application number: CN202011037339.0A
Authority: CN
Inventors: 白秀峰; 陈艳琼; 傅新元
Original assignee: West China Hospital of Sichuan University
Current assignee: West China Hospital of Sichuan University
Priority date: 2020-09-27
Filing date: 2020-09-27
Publication date: 2023-06-23
Anticipated expiration: 2040-09-27
Also published as: CN114272378A

Abstract

The invention provides a use of an agent which causes a loss of function of CTTNBP2NL in the manufacture of a medicament for the treatment of a disease. The use of an agent that causes a loss of CTTNBP2NL function in the manufacture of a medicament for the treatment of a disease caused by phosphorylation of STAT3 protein is mainly provided; the agent that causes the loss of function of CTTNBP2NL is an agent that inhibits expression of CTTNBP2NL or an agent that inhibits CTTNBP2NL from promoting STAT3 protein phosphorylation activity in tumor cells. The CTTNBP2NL deficiency reagent can be used for preparing medicines for treating tumors, autoimmune diseases and nerve diseases, and has good application prospects.

Description

Use of an agent that causes a loss of function of CTTNBP2NL in the manufacture of a medicament for the treatment of a disease

Technical Field

The invention relates to the use of an agent that lacks CTTNBP2NL functionality for the manufacture of a medicament for the treatment of a disease.

Background

Phosphorylation and dephosphorylation at specific sites on the surface of proteins are important post-translational modification methods for proteins. This biological process plays an important role in intracellular signal transduction and in altering the active state of enzymes. The most important distinction between phosphorylation and dephosphorylation is that during phosphorylation, phosphate is added to the amino acids of a protein by a protein kinase, whereas dephosphorylation refers to the removal of phosphate from the protein surface by hydrolytic enzymes, especially phosphatases. Phosphate is typically derived from ATP or ADP. This process is prevalent in many physiological processes within the organism, particularly in terms of regulating protein function, localization, conformation, interactions, and clearance. Phosphorylation and dephosphorylation are two key biological processes in organisms. Protein phosphorylation and dephosphorylation are critical for signal transduction, cell division, protein translation, metabolism, and survival. In cells, about 30% of the protein may be modified by phosphorylation.

Furthermore, phosphorylation plays a key role in extracellular signaling. Neurotransmitters, hormones, cytokines, etc. act by regulating the phosphorylation of target cells. More importantly, the processes of phosphorylation and dephosphorylation are present in almost all kinds of protein subtypes, such as structural proteins, enzymes, membrane channel proteins, signal molecules, etc. There are more than 200000 phosphorylation sites in human proteins. More than 500 different kinases are involved in the phosphorylation process. Protein phosphorylation plays an important role in the development of cancer cells.

Cortical actin-binding protein 2 (CTTNBP 2), a neuron-specific F-actin-related protein, controls dendritic spine formation by interacting with cortical actin, regulating movement of cortical actin. Sequence comparison shows that CTTNBP 2N-terminal-like protein (CTTNBP 2 NL) is a homologous protein of CTTNBP 2. Proteomic studies indicate that the striatum-protein phosphatase 2A (PP 2A) protein complex is associated with CTTNBP2NL in HEK293 cells. CTTNBP2NL is associated with a number of physiological activities. However, the use of the CTTNBP2 NL-deficiency agent of the present invention for the preparation of a medicament for the treatment of diseases has not been seen.

Disclosure of Invention

In order to solve the problems, the invention provides an application of an agent with CTTNBP2NL function deletion in preparing a medicament for treating diseases caused by STAT3 protein phosphorylation; the agent that causes the loss of function of CTTNBP2NL is an agent that inhibits expression of CTTNBP2NL or an agent that inhibits CTTNBP2NL from promoting STAT3 protein phosphorylation activity in tumor cells.

Further, the drug is a drug for treating diseases caused by phosphorylation of the STAT3 protein Y705 site.

Further, the agent that inhibits CTTNBP2NL expression is an agent that knocks out the CTTNBP2NL gene, knocks down the CTTNBP2NL gene, or interferes with CTTNBP2NL gene expression; preferably the agent is an agent for RNAi, shRNA, CRISPR/Cas9 methods;

it is further preferred that the composition comprises,

the RNA sequence of the CTTNBP2NL targeted by the reagent for the RNAi and shRNA method is as follows:

ATAACCCAGTTAGGTATTATA、GGTACTCACTAAGCGTTTATT、CTGAACTCCTGACACTATTTA、GCCCTCCATCCAGGGATTTAT、GCCACTCCTGCTTACTCATAT；

and/or, the agent used in the CRISPR/Cas9 technology targets the RNA sequence of CTTNBP2 NL:

ACTTTCATTGAAGAACGCTA、GCCGCTGCCTTTCTTCCTCA、TGTCACCTACATGCTAGAGA。

further, the agent that inhibits CTTNBP2NL from promoting STAT3 protein phosphorylation activity in tumor cells is an agent that inhibits CTTNBP2NL from promoting STAT3 protein Y705 site phosphorylation activity in tumor cells;

preferably the agent is an agent that causes mutation of CTTNBP2 NL; further preferably the agent is an agent that phosphorylates the 488 th and/or 527 th position of CTTNBP2NL, further preferably an agent that mutates the 488 th serine of CTTNBP2NL to glutamate and/or the 527 th serine to glutamate;

alternatively, the agent is a CTTNBP2NL mutant obtained by phosphorylation of CTTNBP2NL 488 and/or 527, more preferably a CTTNBP2NL mutant in which CTTNBP2NL 488 serine is mutated to glutamic acid and/or 527 serine is mutated to glutamic acid.

Further, the diseases caused by the phosphorylation of the STAT3 protein are tumors, autoimmune diseases and/or neurological diseases;

preferably, the tumor is lung cancer, liver cancer, leukemia, colorectal cancer;

and/or the autoimmune disease is rheumatoid arthritis, systemic lupus erythematosus, inflammatory bowel disease, psoriasis;

and/or, the neurological disease is senile dementia and parkinsonism.

Further, the agent for deleting the CTTNBP2NL function uses adenovirus, adeno-associated virus, lentivirus or cell as a vector.

The invention also provides a medicament for treating diseases caused by phosphorylation of STAT3 protein, which takes an agent with CTTNBP2NL function deletion as an active ingredient; the agent for deleting the function of CTTNBP2NL is an agent for inhibiting the expression of CTTNBP2NL or an agent for inhibiting the phosphorylation activity of STAT3 protein in tumor cells by CTTNBP2 NL;

preferably, the medicament is a medicament for treating a disease caused by phosphorylation of the STAT3 protein Y705 site.

it is further preferred that the composition comprises,

ACTTTCATTGAAGAACGCTA、GCCGCTGCCTTTCTTCCTCA、TGTCACCTACATGCTAGAGA。

and/or, the neurological disease is senile dementia and parkinsonism.

RNA interference (RNAi) is a natural mechanism by which short interfering RNAs (siRNAs) induce gene silencing. Vector-based short hairpin RNA (shRNA) is an RNA interference (RNAi) technique used to study the function of unknown genes and can also be used for disease treatment. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein 9 (CRISPR/Cas 9) is an RNA-guided targeted genome editing tool that allows researchers to make gene knockouts, insert foreign sequences, repair mutant bases, and delete sequences in cell lines and animals.

CTTNBP2NL overexpression causes increased phosphorylation of STAT3Y705 site, leading to disease. Loss of CTTNBP2NL functions, such as inhibition of CTTNBP2NL expression or inhibition of CTTNBP2NL promoting STAT3 protein phosphorylation activity in tumor cells, may be used to treat diseases caused by STAT3 protein phosphorylation, particularly diseases caused by phosphorylation of the STAT3 protein Y705 site. The CTTNBP2NL loss of function can effectively reduce phosphorylation of STAT3 protein Y705 locus in tumor cells, obviously increase apoptosis of the tumor cells, inhibit proliferation of the tumor cells and further inhibit growth of the tumor; meanwhile, the CTTNBP2NL function deficiency can reduce the generation of autoantibodies and treat systemic lupus erythematosus; can also relieve rheumatic arthritis symptoms, inflammatory bowel disease symptoms, psoriasis symptoms, etc., and effectively treat rheumatic arthritis, inflammatory bowel disease, psoriasis, etc. Therefore, the CTTNBP2NL deficiency reagent can be used for medicines for treating tumors, autoimmune diseases and nerve diseases, and has good application prospect.

It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.

Drawings

FIG. 1 shows that overexpression of CTTNBP2NL by Hela cells causes increased phosphorylation of STAT3Y705 site.

FIG. 2 shows that overexpression of CTTNBP2NL by HEK293 cells does not cause increased phosphorylation of STAT3Y705 site.

FIG. 3 is a graph showing that the S488E and S527E mutations of CTTNBP2NL disrupt their ability to promote STAT3 phosphorylation.

FIG. 4 is a graph showing that the S488E and S527E mutations of CTTNBP2NL disrupt their ability to promote STAT3 phosphorylation.

Fig. 5 is a graph showing that knockout of CTTNBP2NL promotes apoptosis while reducing cell proliferation.

FIG. 6 is a graph showing that interfering with CTTNBP2NL expression reduces cell proliferation and promotes apoptosis.

FIG. 7 is a graph showing that knockout of CTTNBP2NL inhibited tumor growth subcutaneously in nude mice.

FIG. 8 shows that knock-down CTTNBP2NL inhibits subcutaneous tumor growth in nude mice.

FIG. 9 shows the trend of weight loss in SLE-alleviating mice with knock-down CTTNBP2 NL.

FIG. 10 is a schematic of the knockdown of CTTNBP2NL in alleviating SLE mouse autoantibody production.

FIG. 11 shows the trend of increasing paw swelling thickness in collagen-induced arthritic mice with knock-down CTTNBP2 NL.

FIG. 12 shows that knock-down of CTTNBP2NL reduces inflammatory factor content of inflammatory bowel disease.

FIG. 13 is a graph showing that knock down of CTTNBP2NL reduces immune cell infiltration at skin lesions in psoriatic mice.

FIG. 14 is the effect of Hela cell over-expression of CTTNBP2NL on STAT S568 site phosphorylation.

Detailed Description

The materials and equipment used in the embodiments of the present invention are all known products and are obtained by purchasing commercially available products.

Example 1 overexpression of CTTNBP2NL causes increased phosphorylation of tumor cells CTTNBP2NL

1. Experimental method

1. Cell culture

HEK293T and HEK293, HELA and other cells were purchased from ATCC and cultured in DMEM high-sugar medium, 10% fetal bovine serum and 1% green streptomycin were added. Culturing cells in a cell culture incubator at 37deg.C, CO ₂ The concentration was 5%. The cells were passaged at a growth density approaching 90%. The kit was used once a month to identify mycoplasma, ensuring that the cells were free from mycoplasma infection. The seed-retaining cells were cultured using 75cm disposable cell culture flasks and the remaining cells were cultured using different format petri dishes.

2. Vector construction

(1) Cellular RNA extraction

HEK293 cells or HELA cells were cultured in a 10cm cell culture dish, and when the cell density was close to 70%, the dish was removed, the cell culture medium was poured out, and after three times of rapid washing with sterilized PBS (1% diabody was added after sterilization, temporary storage was performed at 4℃for 1 week, and pH 7.2), 1ml of TRZOL was added. Cells were quickly hung with a cell spatula, transferred to a 1.5ml EP tube (RNase free) with a 1ml pipette (RNase free), and placed on ice for 5min. 200 μl of chloroform was added, and after mixing, the mixture was left on ice for 5min, and the liquid was observed for delamination, and if delamination was good, the next operation was performed. The EP tube was placed in a pre-chilled 4℃centrifuge, 12000g was centrifuged at 4℃for 10min. After centrifugation, the EP tube was removed, 400. Mu.l of the upper colorless transparent liquid was gently pipetted into a fresh 1.5ml EP tube (RNase free), an equal volume of pre-chilled isopropanol (400. Mu.l) was added, mixed upside down, and placed on ice for 10min, and centrifuged in a centrifuge at 12000g for 30min at 4 ℃. After centrifugation, the EP tube was removed, and the bottom of the EP tube was observed for the presence of white precipitate, and if white precipitate was present, RNA was obtained. The tube was gently aspirated, 1ml of pre-chilled 75% ethanol was added to the EP tube, and the pellet was blown with a pipette until the pellet left the bottom of the EP tube. After that, the mixture was centrifuged at 12000g and 5min in a centrifuge at 4 ℃. The supernatant (ethanol) was completely removed as much as possible, the lid of the EP tube was opened in a kitchen, and after the residual ethanol was dried in the air, 20. Mu.l double distilled water (RNase free) was added, and the mixture was repeatedly blown with a pipette until it was completely dissolved. Mu.l were taken into fresh EP tubes for concentration detection, and reverse transcription was performed immediately after concentration detection.

(2) Determination of DNA and RNA concentration

Detection was performed using a Thermo company Nano Drop One instrument.

DNA concentration detection: after the start-up self-test, selecting a double-stranded DNA option, after the self-test is finished, adding 1 mu l of solvent consistent with the sample to be tested, performing background removal operation, after the background removal, wiping off residual liquid by using water absorbing paper, adding 1 mu l of the sample to be tested, detecting, and obtaining the readout value, namely the DNA concentration. Meanwhile, whether DNA pollution exists or not is judged by observing the ratio of absorption peaks at 260nm/280nm, wherein the ratio is DNA between 1.7 and 1.9, and the ratio is RNA with the ratio greater than 1.9.

And (3) RNA concentration detection: after the start-up self-test, a single-stranded RNA option is selected, and the rest steps are the same as DNA test.

(3) Reverse transcription

Using cDNA Synthesis kit from Tiangen, 1. Mu.g of RNA was taken into 200. Mu.l of PCR tube (RNase free), 1. Mu.l of DNase and 2. Mu.l of Buffer, 7. Mu.l of ddH were added ₂ O (RNase free), at 37℃for 20min, to remove the genomic DNA contamination which may be present. After the end of the genomic DNA removal procedure, 2. Mu.l of reverse transcriptase, 4. Mu.l of 5 Xreverse transcription Buffer, 4. Mu.l of ddH were added ₂ After O (RNase free), the sample was put into a PCR apparatus and subjected to a reverse transcription procedure: 42 ℃,30 min-95 ℃,5 min-4 ℃ and 5min.

(4) PCR amplification of CTTNBP2NL mRNA full Length

Nested PCR primers were designed outside the CDS region of CTTNBP2NL using SnapGene software, and specific primer information is as follows:

nested PCR outer primers:

upstream: 5'-GAGGACTGAAGTGTGACTCTGCCG-3'

Downstream: 5'-GGACGAAATCTGATGGAATGTCAAAC-3'

Nested PCR inner primer:

upstream: 5'-ATGAATCTGGAAAAACTCAGCAAGC-3'

Downstream: 5'-CTAGCTGCTGGTAGGCAAAAGTAACTC-3'

PCR system: 25 μl, pfu enzyme mix (2X) from Tiangen Co

Template DNA:1 μl;

upstream and downstream primers: 1 μl each;

ddH ₂ O：9.5μl；

2X Pfu Mix：12.5μl。

PCR procedure: 95 ℃,5 min-95 ℃,30 s-55 ℃ and 30s;72 ℃,3 min-72 ℃,10 min-4 ℃ and 5min. Cycle number: 30. since the subsequent ligation of the T vector is required, 5. Mu.l of ordinary Tag mix was added after the end of PCR at 95℃for 30s to 60℃for 30s; after 5min at 72℃and 5min at 4℃the PCR product was stored temporarily in a-20℃refrigerator.

Nucleotide sequence:

SEQIDNO.1：GAGGACTGAAGTGTGACTCTGCCG

SEQIDNO.2：GGACGAAATCTGATGGAATGTCAAAC

SEQIDNO.3：ATGAATCTGGAAAAACTCAGCAAGC

SEQIDNO.4：CTAGCTGCTGGTAGGCAAAAGTAACTC

(5) Nucleic acid electrophoresis

1% nucleic acid isolation gel was prepared with 1 XTAE Buffer: weigh 4g agarose and pour into 200ml Erlenmeyer flask. Measuring 40ml 1X TAE Buffer with a measuring cylinder, adding into a conical flask, shaking, heating to boil in a microwave oven, maintaining high temperature for 5min until agarose is thoroughly dissolved, and taking out the conical flask. Adding 2 μl GelRed, mixing, pouring into a glue plate, and inserting into a 10-hole comb. Standing at room temperature for 30min, solidifying, taking out nucleic acid gel, and placing into a horizontal electrophoresis tank. After loading the PCR product, 120v,30min. After electrophoresis, transferring the nucleic acid gel to a gel imager, cutting out nucleic acid strips at corresponding positions according to the size of a Marker, and placing the nucleic acid strips into a 2ml EP tube for subsequent operation.

(6) Glue recovery

The kit was recovered using the Tiangen company glue. 300. Mu.l of an equilibration Buffer,7000g, were added to the collection column in advance and centrifuged at room temperature for 5min. Taking out 2ml EP tube containing DNA gel, mashing with 1.5ml pipette tip, weighing gel block with electronic balance, adding equal amount of buffer PN (1 ml PN is added into 1g gel), dissolving at 60deg.C for 30min, and mixing upside down to ensure complete dissolution of nucleic acid gel. The EP tube was removed and cooled to room temperature. The dissolved liquid was transferred to a DNA collection column, 7000g, and centrifuged at room temperature for 5min. After the waste liquid was discarded, 500. Mu.l of a rinse solution (PW), 7000g, was added to the collection column, and the mixture was centrifuged at room temperature for 5 minutes. After rinsing twice, the hollow tube was centrifuged at room temperature for 5min, after the residual liquid in the collection tube was dried in a kitchen, 30. Mu.l of eluent (TB) was added to the collection tube, incubated at 60℃for 10min, and centrifuged at room temperature for 5min. After the DNA concentration was measured by Nano Drop, the subsequent operation was performed.

(7) Ligation of T vectors and transformation competent cells

Using a whole gold company T carrier, taking 1 mug of gel to recycle a PCR product, adding the 1 mug l T carrier, adjusting the volume to 5 mug by double distilled water, putting the mixture into a PCR instrument, reacting for 30min at 37 ℃ to obtain a connecting product of CTTNBP2NL and the T carrier, and temporarily storing at 4 ℃. Competent cells were purchased from the whole gold company (Trans T1), and when transformed, competent cells were taken out and stored at-80℃and thawed on ice. 2.5. Mu.l of the ligation product of CTTNBP2NL and T vector was added to 300. Mu.l of competent cells, incubated on ice for 20min, heat shocked in a water bath at 42℃for 90s, immediately placed on ice, 200. Mu.l of non-resistant liquid LB was added, placed in a horizontal bacterial shaker, at 37℃for 100 revolutions, and resuscitated for 30min. Taking out the recovered competent cells, placing in a centrifuge, centrifuging at room temperature for 5min, sucking the supernatant in an ultra-clean bench to leave 100 μl of bacterial liquid, re-suspending bacterial cell precipitate with a pipette, taking out solid LB bacterial culture plate containing 100 μg/ml ampicillin, and uniformly coating bacterial liquid on the surface of the bacterial culture plate with a glass rod. After culturing in an inverted manner in a bacterial incubator at 37℃for 12 hours, the colony growth state was observed.

(8) Bacterial monoclonal enlarged culture and strain preservation

A10 ml bacterial culture tube was taken, 5ml of liquid LB medium was added, and 1X antibiotic was added. Single colonies were picked with a 10. Mu.l sterile pipette tip and the tip was placed into a 10ml bacterial culture tube and incubated for 12h at 37℃in a horizontal bacterial shaker at 200 revolutions. Selecting bacterial liquid in logarithmic growth phase, sucking 700 μl bacterial liquid in a super clean bench, adding into 300 μl 50% glycerol (glycerol is sterilized in advance), mixing upside down, and storing in a refrigerator at-80deg.C.

(9) Plasmid extraction

Plasmid extraction used the full gold company plasmid miniprep kit. After centrifugation twice and centrifugation 2ml each time, 4ml of bacterial liquid was collected into a 2ml EP tube, the supernatant was discarded, 250. Mu.l of solution 1 (25 mM Tris-HCl, 10mM EDTA, 50mM glucose, pH adjusted to 8.0) was added, after vortexing, 250. Mu.l of solution 2 (0.2N NaOH, 1% SDS) was added, after inversion mixing, 5min at room temperature was performed, 350. Mu.l of solution 3 (2M acetic acid, 3M potassium acetate, 75% alcohol) was added, after inversion mixing, 10min at room temperature, 12000g was performed, and centrifugation at room temperature was performed for 10min. The supernatant was transferred to a collection column, 12000g, and centrifuged at room temperature for 2min. The waste liquid in the collection tube was poured off, 500. Mu.l of the rinse solution was added to the collection column, 12000g, and the mixture was centrifuged at room temperature for 2 minutes. The waste liquid in the collection tube was poured out, the collection tube was replaced with a new 1.5ml EP tube, 30. Mu.l of TB buffer was added to the collection column, incubated at 60℃for 10min,12000g, centrifuged at room temperature for 2min, and the liquid in the EP tube was the plasmid.

(10) PLVX-CTTNBP2NL-3x Flag plasmid construction (other plasmid construction principle steps are basically consistent)

The PLVX-3X Flag vector was used as eukaryotic expression vector, which was purchased from Addgene. And (5) selecting a double enzyme digestion scheme for construction. Upstream cleavage site selection: xhoI, downstream cleavage site selection: bamHI. Double enzyme digestion reaction is carried out by using NEB company endonuclease, and the reaction system is as follows: 50 μl, specific composition ratio:

DNA：1μg；

Cutsmart buffer：5μl；

XhoI：1μl；

BamHI：1μl；

H ₂ o: the amount was made up to 50. Mu.l.

Enzyme cutting conditions: 37℃for 1h.

After the completion of the enzyme digestion, 5. Mu.l of 10 Xloading Dye was added, the gel was recovered, and the gel recovered product was stored temporarily in a-20℃refrigerator. And taking out a T carrier bacterial liquid containing CTTNBP2 NLCDS, directly performing bacterial liquid PCR, wherein two sides of a PCR primer used contain XhoI and BamHI restriction sites and ATGC four bases as protective bases, recovering a PCR product by using a gel after the PCR is finished, and temporarily storing the product in a refrigerator at-20 ℃ after double restriction and gel recovery.

And (3) connection: the CTTNBP2NL CDS region fragment was ligated to the vector fragment in a molar ratio of 3:1, using the full gold T4 ligation kit, ligation system: 20 μl, ligation conditions: the ligation was carried out at 16℃overnight. The ligation product transformed competent cells were selected for monoclonal, sequenced to determine the correct insert, and the plasmid was extracted in large quantities.

(11) PLVX-CTTNBP2NL-mCherry plasmid construction (other plasmid construction principle steps are basically consistent)

The PLVX-C1-mCherry vector was used as eukaryotic expression vector, which was purchased from Addgene. And (5) selecting a double enzyme digestion scheme for construction. Upstream cleavage site selection: xhoI, downstream cleavage site selection: ecoRI. Double cleavage reactions were performed using NEB company endonucleases. The other steps are the same as those of PLVX-CTTNBP2NL-3x Flag plasmid construction.

(12) Construction of PLVX-CTTNBP2NL-AcGFP plasmid (other plasmid construction principle steps are basically consistent)

The PLVX-C1-mCherry vector is used as an initial vector, mCherry is replaced by AcGFP through a homologous recombination mode, after the sequencing is correct, the PLVX-C1-AcGFP vector is used as a eukaryotic expression vector, and a double-enzyme digestion scheme is selected for construction. Upstream cleavage site selection: xhoI, downstream cleavage site selection: ecoRI. Double cleavage reactions were performed using NEB company endonucleases. The other steps are the same as those of PLVX-CTTNBP2NL-3x Flag plasmid construction.

(13) Construction of PLVX-CTTNBP2NLC1-3XHA plasmid

The PLVX-3XFlag vector is used as an initial vector, 3xFlag is replaced by 3xHA through a homologous recombination mode, and after the sequencing is correct, the PLVX-3XHA vector is used as a eukaryotic expression vector to select a double-enzyme digestion scheme for construction. Upstream cleavage site selection: ecoRI, downstream cleavage site selection: bamHI. Double cleavage reactions were performed using NEB company endonucleases. The rest steps are the same as those of the CTTNBP2NL-3x Flag plasmid construction process.

3. Lentivirus package

Transfection of 293T cells with the constructed viral backbone vector along with the psPAX2, pMD2.G packaging plasmid, PLVX: psPAX2: pmd2.g=1:2:1 (molar ratio). Cell supernatants were collected 48 hours post transfection and secondary cell supernatants were collected 72 hours post transfection. The virus is concentrated by PEG, split charging and temporary storage in a refrigerator at-80 ℃.

4. Construction of stable knockout monoclonal cell line

293 cells were cultured in 10cm cell culture dishes, CTTNBP2NL knockdown lentiviruses were infected, after a period of infection Puromycin was added for selection, then adherent cells were digested, single cells were prepared as single cell suspensions in DMEM medium containing penicillin, and single cells were selected by flow cytometry. And (3) continuously culturing the obtained single cells, observing the growth state of the cells under a microscope, performing expansion culture on 20 monoclonal cells, identifying the expression state of CTTNBP2NL by a Western-Blot method and a gene sequencing method, and selecting cells with complete disappearance of CTTNBP2NL protein and fragmentation and frame shift of CTTNBP2NL CDS sequence as stable knockout monoclonal cell lines.

5、Western blot

The method comprises the following specific steps of: taking out cultured cells or isolated mitochondria, washing cell supernatant with PBS, adding 100-400 μl of unequal lysate respectively according to cell number, standing on ice for 5min, centrifuging at 4deg.C for 10min at 12000g, transferring supernatant to new EP tube, taking out 5 μl, adding 5X SDS protein loading buffer solution into the rest proteins, placing on a constant temperature metal heat block, denaturing at 95deg.C for 5min, and temporarily preserving at-20deg.C.

Electrophoresis was performed using a combination of 10% SDS separation gel and 5% SDS concentration gel, electrophoresis conditions: and (3) separating the gel from the gel after 70V for about 20min, and adjusting the voltage to 110V after the gel enters the separating gel, wherein the separating time is about 60min.

The transfer was performed using SDS-methanol transfer solution. Transfer conditions: 250mA, constant current, after film turning on ice for 90min, taking out PVDF film, sealing for 30min at room temperature in 5% skimmed milk powder, diluting primary antibody with TBST, dilution ratio: incubation was carried out at 1:1000,4℃overnight, after washing the primary antibody with TBST, the secondary antibody was added to a horizontal shaker at a dilution ratio of 1:2000, 37℃and incubated for 1h. After washing the secondary antibody on a horizontal shaker using TBST, it was exposed on a chemiluminescent apparatus and photographed.

2. Experimental results

Cell lines stably expressing CTTNBP2NL were obtained by constructing CTTNBP2NL over-expressing lentiviruses and infecting HEK293 cells and Hela cells, followed by monoclonal screening. STAT3 phosphorylation changes in both cell lines were detected by Western blot experiments. Overexpression of CTTNBP2NL in tumor cells significantly increased phosphorylation of the STAT3 protein Y705 site in the cells (fig. 1).

However, CTTNBP2NL fused to different tags, including CTTNBP2NL-3x HA, CTTNBP2NL-3x Flag, CTTNBP2NL-GFP, CTTNBP2NL-RFP, were overexpressed in normal cells, respectively, and the results showed that overexpression of CTTNBP2NL did not affect STAT3Y705 site phosphorylation status in normal cells, and that neither STAT3Y705 site had a phosphorylation phenotype in HEK293 control cells and CTTNBP2NL overexpressing cells (fig. 2). The above results indicate that CTTNBP2NL overexpression can cause increased phosphorylation at the STAT3Y705 site, and that this phenomenon is only present in tumor cells, normal cells are unaffected.

By base mutation, two mutants were obtained, i.e., mutation of serine (S) at position 527 into glutamic acid (E) and mutation of serine (S) at position 488 into glutamic acid (E), and by over-expression of the two mutants in Hela cells, it was found that CTTNBP2NL after mutation could not increase the phosphorylation level of tyrosine at position 705 of STAT3 (fig. 3). Since serine is mutated to glutamate, it mimics phosphorylated serine, and thus phosphorylation of both serine at positions 488 and 527 inhibits the phosphorylation of STAT3 by CTTNBP2 NL.

The experimental results show that: CTTNBP2NL overexpression causes increased phosphorylation of STAT3Y705 site, leading to disease; thus inhibiting CTTNBP2NL expression or inhibiting CTTNBP2NL promotes STAT3 protein phosphorylation activity in tumor cells, can treat diseases caused by STAT3 protein phosphorylation, in particular diseases caused by STAT3 protein Y705 site phosphorylation. Whereas phosphorylation of sites 488 and 527 of CTTNBP2NL effectively inhibited the phosphorylation of STAT3 by CTTNBP2 NL.

Example 2 knockout of CTTNBP2NL causes reduction of tumor cell STAT3 phosphorylation

1. Experimental method

Construction of Lenti-CRISPRV2-CTTNBP2NL-guide RNA vector

The lentiCRISPR v2 vector was used as eukaryotic expression vector, which was purchased from Addgene. Single cleavage was performed using NEB company BsmBI, cleavage System: 50 μl, buffer: NEB Buffer 3.1, reaction time: and 1h. And the glue recycling kit is used for recycling the glue of Tiangen company.

The insert is obtained in the form of double strands formed by annealing after the company synthesizes a single strand, annealing system: 20 μl, performed on a PCR apparatus, annealing conditions: 95℃for 5min,4℃for 5min.

The ligation adopts full gold company T4 ligase, and an inserted fragment and the cleaved lentiCRISPR v2 vector are ligated according to the molar ratio of 7:1, and the ligation conditions are as follows: ligation was performed at 16℃overnight, and the ligation product transformed Stbl3 competent cells. The other steps are the same as those of PLVX-CTTNBP2NL-3x Flag plasmid construction.

Lentivirus package

Transfection of 293T cells with the constructed viral backbone vector along with the psPAX2, pMD2.G packaging plasmid, lentiCRISPR v2: psPAX2: pmd2.g=1:2:1 (molar ratio). Cell supernatants were collected 48 hours post transfection and secondary cell supernatants were collected 72 hours post transfection. The virus is concentrated by PEG, split charging and temporary storage in a refrigerator at-80 ℃.

Construction of stable knockout monoclonal cell line

Western blot

2. Experimental results

STAT3 is an important member of the JAK-STAT family, regulating important processes such as cell proliferation and apoptosis. In tumor cells, STAT3 is often hyperphosphorylated, leading to an increase in the malignancy of the cell. Therefore, by knocking out CTTNBP2NL gene, STAT3 hyperphosphorylation can be inhibited, and the purposes of inhibiting tumor growth and treating tumor are achieved. In the invention, CTTNBP2NL knockout cells are successfully constructed by CRISPR-Cas9 technology, and STAT3 phosphorylation level change is detected by Western blot experiment. "ACTTTCATTGAAGAACGCTA", "GCCGCTGCCTTTCTTCCTCA", "TGTCACCTACATGCTAGAGA" are used; as a guide RNA targeting CTTNBP2NL, the sequence is constructed into a LentiCRISPR-GFP vector, hela and HEK293 cells are infected, monoclonal cells are selected, and a stable knockout cell line is obtained through Western blot identification. The results show that STAT3 is not phosphorylated in normal cells, and that knocking out CTTNBP2NL from normal cells does not affect the phosphorylation status of STAT 3. In tumor cells, STAT3 was always in the phosphorylated state, and phosphorylation at the Y705 site of STAT3 was significantly reduced after CTTNBP2NL was knocked out, while phosphorylation at the S727 site was unaffected. The above results demonstrate that there is a correlation between the content of CTTNBP2NL and the content of phosphorylated STAT3, and that the content of phosphorylated STAT3 decreases as the content of CTTNBP2NL decreases (fig. 4).

Nucleotide sequence:

SEQIDNO.5：ACTTTCATTGAAGAACGCTA

SEQIDNO.6：GCCGCTGCCTTTCTTCCTCA

SEQIDNO.7：TGTCACCTACATGCTAGAGA

the experimental results show that: the CTTNBP2NL gene can be knocked out by adopting the guide RNA targeting the CTTNBP2NL, so that the expression of the CTTNBP2NL can be inhibited, the phosphorylation of the Y705 site of STAT3 is reduced, and diseases caused by the phosphorylation of the Y705 site of the STAT3 protein are treated.

Example 3 knockdown or knockdown of CTTNBP2NL expression in tumor cells causes decreased cell proliferation and increased apoptosis in tumor cells

1. Experimental method

1. Interfering lentiviral vector construction

(1) Synthesizing DNA fragments, and annealing conditions: to the PCR tube, 10. Mu.l of sense strand+10. Mu.l of antisense strand DNA was added, and after mixing, the mixture was subjected to PCR at 95℃for 5min and 4℃for 5min.

The DNA sequence is:

guide RNA：ACTTTCATTGAAGAACGCTA：

upstream: CACCG ACTTTCATTGAAGAACGCTA (SEQ ID NO. 8)

Downstream: AAACTAGCGTTCTTCAATGAAAGTC (SEQ ID NO. 9)

guide RNA：GCCGCTGCCTTTCTTCCTCA：

Upstream: CACCG GCCGCTGCCTTTCTTCCTCA (SEQ ID NO. 10)

Downstream: AAACTGAGGAAGAAAGGCAGCGGCC (SEQ ID NO. 11)

guide RNA：TGTCACCTACATGCTAGAGA：

Upstream: CACCG TGTCACCTACATGCTAGAGA (SEQ ID NO. 12)

Downstream: AAACTCTCTAGCATGTAGGTGACAC (SEQ ID NO. 13)

(2) Double cleavage of the Plko.1 vector: ageI+EcoRI.

(3) The preparation method comprises the following steps of: fragment = 1:7 ratio ligation, 16 ℃,12h.

(4) Transformation competence, monoclonal selection and sequencing, sequencing primer U6 (sequence: ATGGACTATCATATGCTTACCGTA (SEQ ID NO. 14)), forward sequencing.

2. Apoptosis detection

Detection was performed using the Shanghai assist, san Biotechnology Co., ltd. Annexin V-PE/7-AAD apoptosis detection kit (product number: 40310ES 20), and specific procedures were performed with reference to manufacturer's instructions.

3. Cell proliferation assay

Using the BeyoClick of Biyundian Co ^TM EdU-555 cell proliferation assay kit (product number: C0075S) was used for the assay, and the specific procedures were carried out according to the manufacturer' S instructions.

2. Experimental results

In Hela cells cultured in vitro, the knock-out lentivirus expressing CTTNBP2NL caused reduced STAT3 phosphorylation, reduced cell proliferation, and increased apoptosis. Proliferation was detected by the EdU insertion method and apoptosis was detected by the Annexin V-PE/7-AAD apoptosis detection kit using "ACTTTCATTGAAGAACGCTA" (designated as guide 1), "GCCGCTGCCTTTCTTCCTCA" (designated as guide 2), "TGTCACCTACATGCTAGAGA" (designated as guide 3) as guide RNA targeting CTTNBP2NL, respectively. The results showed that the knockout of CTTNBP2NL significantly increased apoptosis (fig. 5 a), while at the same time a significant decrease in cell proliferation was found (fig. 5 b).

To further determine the effect of CTTNBP2NL on tumor cell growth, interfering RNAs targeting expression of CTTNBP2NL were synthesized, with the interfering sequences: "ATAACCCAGTTAGGTATTATA (named sh-1)", "GGTACTCACTAAGCGTTTATT (named sh-2)", "CTGAACTCCTGACACTATTTA (named sh-3)", "GCCCTCCATCCAGGGATTTAT (named sh-4)", "GCCACTCCTGCTTACTCATAT (named sh-5)"; the RNA fragment was transfected into HeLa cells using liposome 3000 transfection, and cell proliferation and apoptosis changes were observed. The results show that: interfering with CTTNBP2NL expression significantly reduced the proportion of cell proliferation of Hela cells (fig. 6 a), while apoptosis was found to be significantly increased (fig. 6 b).

Nucleotide sequence:

SEQIDNO.15：ATAACCCAGTTAGGTATTATA

SEQIDNO.16：GGTACTCACTAAGCGTTTATT

SEQIDNO.17：CTGAACTCCTGACACTATTTA

SEQIDNO.18：GCCCTCCATCCAGGGATTTAT

SEQIDNO.19：GCCACTCCTGCTTACTCATAT

to determine the effect of CTTNBP2NL knockout on tumor cell growth in vivo, CTTNBP2NL knockout cells were inoculated into nude mice subcutaneously, and tumor growth was observed and recorded. The results showed that after knocking out CTTNBP2NL, tumor growth was significantly inhibited (fig. 7).

To further determine the effect of CTTNBP2NL on tumor cell growth, interfering lentiviral vectors targeting CTTNBP2NL expression were synthesized, with interfering sequences of: "ATAACCCAGTTAGGTATTATA", "GGTACTCACTAAGCGTTTATT", "CTGAACTCCTGACACTATTTA", "GCCCTCCATCCAGGGATTTAT", "GCCACTCCTGCTTACTCATAT"; infection with Hela cells and selection of monoclonal cells stable to knock down CTTNBP2 NL. CTTNBP2NL knockdown cells were inoculated into nude mice subcutaneously, and tumor growth was observed and recorded. The results showed that after knocking down CTTNBP2NL, tumor growth was significantly inhibited (fig. 8).

The experimental results show that: the interference RNA for targeting CTTNBP2NL expression can interfere, reduce the expression of CTTNBP2NL genes and obviously inhibit tumor growth.

Example 4 AAV-sh-CTTNBP2NL treatment of systemic lupus erythematosus

Systemic lupus erythematosus (Systemic Lupus Erythematosus, SLE) is an autoimmune inflammatory connective tissue disease, which is frequently associated with multiple organs in young women. SLE causes great damage to health and causes numerous adverse effects to patients. The hyperphosphorylation of STAT3 plays an important role in SLE patients, and thus, blocking the hyperphosphorylation of STAT3 by knocking down CTTNBP2NL can achieve the purpose of treating SLE. The present invention contemplates treatment of SLE via intravenous injection by constructing a targeting CTTNBP2NL interfering AAV virus.

1. Experimental method

1. Interfering AAV virus construction:

(1) Synthesizing DNA fragments, and annealing conditions: 10ul of sense strand+10 antisense strand DNA was added to the PCR tube, and the mixture was mixed in a PCR instrument at 95℃for 5min and at 4℃for 5min.

The DNA sequence is:

nucleotide sequence of seq id No.15:

upstream:

GATCCATAACCCAGTTAGGTATTATACTCGAGTATAATACCTAACTGGGTTATTTTTTA(SEQIDNO.20)

downstream:

AGCTTAAAAAATAACCCAGTTAGGTATTATACTCGAGTATAATACCTAACTGGGTTATG(SEQIDNO.21)

nucleotide sequence of seq id No.16:

upstream:

GATCCGGTACTCACTAAGCGTTTATTCTCGAGAATAAACGCTTAGTGAGTACCTTTTTA(SEQIDNO.22)

downstream:

AGCTTAAAAAGGTACTCACTAAGCGTTTATTCTCGAGAATAAACGCTTAGTGAGTACCG(SEQIDNO.23)

nucleotide sequence of seq id No.17:

upstream:

GATCCCTGAACTCCTGACACTATTTACTCGAGTAAATAGTGTCAGGAGTTCAGTTTTTA(SEQIDNO.24)

downstream:

AGCTTAAAAACTGAACTCCTGACACTATTTACTCGAGTAAATAGTGTCAGGAGTTCAGG(SEQIDNO.25)

nucleotide sequence of seq id No.18:

upstream:

GATCCGCCCTCCATCCAGGGATTTATCTCGAGATAAATCCCTGGATGGAGGGCTTTTTA(SEQIDNO.26)

downstream:

AGCTTAAAAAGCCCTCCATCCAGGGATTTATCTCGAGATAAATCCCTGGATGGAGGGCG(SEQIDNO.27)

nucleotide sequence of seq id No.19:

upstream:

GATCCGCCACTCCTGCTTACTCATATCTCGAGATATGAGTAAGCAGGAGTGGCTTTTTA(SEQIDNO.28)

downstream:

AGCTTAAAAAGCCACTCCTGCTTACTCATATCTCGAGATATGAGTAAGCAGGAGTGGCG(SEQIDNO.29)

(2) Double digestion of pAAV-ZsGreen-shRNA vector: bamHI+HindIII.

(4) Transformation competence, monoclonal selection and sequencing, sequencing primer U6, forward sequencing.

2. Interfering with AAV viral therapy:

(1) Humanized immune system mice successfully inducing SLE were anesthetized and then subjected to AAV virus injection.

(2) Viral dose: 1X 10 ¹¹ GC/mice, diluted to 100. Mu.l, were injected into the tail vein by means of a microinjection apparatus.

(3) Mice were observed for phenotypic changes 15 days after AAV virus injection.

2. Experimental results

Female adult MRL/lpr Systemic Lupus Erythematosus (SLE) mice were used to successfully alleviate symptoms by tail vein injection of interfering RNA for CTTNBP2NL to express AAV virus. By weighing the body weight, it was found that knocking down CTTNBP2NL using AAV virus significantly reduced the body weight loss trend of SLE mice (fig. 9), while it was found that knocking down CTTNBP2NL significantly reduced SLE model mouse autoantibody production (fig. 10).

The experimental results show that: inhibition of CTTNBP2NL expression may treat systemic lupus erythematosus.

EXAMPLE 5 AAV-sh-CTTNBP2NL treatment of rheumatoid arthritis

Rheumatic arthritis (rheumatic arthritis, RA) is an autoimmune and inflammatory disease, usually caused by the immune system erroneously attacking the patient's own healthy cells, and the affected body parts cause inflammation (painful swelling). RA attacks mainly the joint tissue, often multiple joints at a time, with joints of the hand, wrist and knee affected. It was found that patient immune cells with RA usually show STAT3 hyperphosphorylation. Thus, blocking STAT3 hyperphosphorylation by knocking down CTTNBP2NL may be used for the treatment of RA. The present invention contemplates treatment of RA via intravenous injection by constructing a targeting CTTNBP2NL interfering AAV virus.

The method for constructing the targeted CTTNBP2NL interfering AAV virus is the same as example 4.

1. Experimental method

(1) Mixing bovine type II collagen with Freund's complete adjuvant according to the volume ratio of 1:1;

(2) 50 female adult humanized immune system DBA/1J mice were taken, and 0.1mg was subcutaneously injected into the root of each mouse

(3) A second injection 25 days later;

(4) AAV treatment was performed on the ill mice 50 days later: viral dose: 1X 10 ¹¹ GC/mice, diluted to 100. Mu.l, were injected into the tail vein by means of a microinjection apparatus.

(5) Mice were observed for phenotypic changes 15 days after AAV virus injection.

2. Experimental results

Female adult DBA/1J mice were used to induce rheumatoid arthritis production, and AAV virus was expressed by tail vein injection of interfering RNA of CTTNBP2NL, with successful symptomatic relief. By examining paw swelling thickness, it was found that knocking down CTTNBP2NL with AAV virus significantly reduced the symptoms in rheumarthritis mice (fig. 11).

The experimental results show that: inhibition of CTTNBP2NL expression may treat rheumatoid arthritis.

Example 6 AAV-sh-CTTNBP2NL treatment of inflammatory bowel disease

Inflammatory bowel disease (inflammatory bowel disease, IBD) is a type of autoimmune disease that causes inflammation of the intestinal tract, IBD usually resulting in continuous inflammation of the colon and rectum (large or large intestine) causing bloody diarrhea in patients. It was found that diseased immune cells of IBD patients often show STAT3 hyperphosphorylation. Thus, blocking STAT3 hyperphosphorylation by knocking down CTTNBP2NL may be used for the treatment of IBD. The present invention contemplates the treatment of IBD by intravenous injection by constructing a targeting CTTNBP2NL interfering AAV virus.

1. Experimental method

(1) Dissolving Dextran Sodium Sulfate (DSS) with water to a 5% solution;

(2) The humanized immune system C57BL/6 mice are repeatedly stimulated by drinking water administration, the interval time is one week, and the total stimulation is 2 months;

(3) AAV treatment of diseased mice: viral dose: 1X 10 ¹¹ GC/mice, diluted to 100. Mu.l, were injected into the tail vein by means of a microinjection apparatus.

(4) Mice were observed for phenotypic changes 15 days after AAV virus injection.

2. Experimental results

Female adult humanized immune system C57BL/6 mice were purchased and after one week of rearing in SPF-grade environment, an inflammatory bowel disease mouse model was constructed by oral DSS method. Mice with inflammatory bowel disease were treated by tail vein injection of interfering RNA for CTTNBP2NL to express AAV virus. By examining the inflammatory factor content of the intestinal tissue, it was found that the use of AAV virus to knock down CTTNBP2NL significantly reduced the symptoms in inflammatory bowel disease mice (fig. 12).

The experimental results show that: inhibition of CTTNBP2NL expression may treat inflammatory bowel disease.

Example 7 AAV-sh-CTTNBP2NL treatment of psoriasis

Psoriasis is an autoimmune disease, usually manifested as skin disease, but also occurs in a variety of visceral lesions. Psoriasis generally causes the skin of a patient to develop red itching flakes, commonly found in the knees, elbows, trunk and scalp. Psoriasis is a common and chronic disease and is currently cured thoroughly. Psoriasis usually has a periodic onset and usually regresses for a period of time or into remission after weeks or months. But continues to enter the onset period after a period of time. It was found that psoriatic patient's diseased immune cells generally exhibit STAT3 hyperphosphorylation. Thus, blocking STAT3 hyperphosphorylation by knocking down CTTNBP2NL may be used for the treatment of psoriasis. The present invention contemplates the treatment of psoriasis by intravenous injection by constructing a targeting CTTNBP2NL interfering AAV virus.

1. Experimental method

(1) Female humanized immune system Bab/c mice of about 7-8 weeks of age were shaved and depilatory cream treated to expose back skin.

(2) Using 5% imiquimod cream (dose: 50 mg/cm) ² ) Is applied to the dehairing part, and is administered once daily for 15 days.

(3) IFN-a (dose: 20U/g body weight) was administered once daily for 15 consecutive days.

(4) After the appearance of skin lesions, AAV treatment was performed on the diseased mice: viral dose: 1X 10 ¹¹ GC/mice, diluted to 100. Mu.l, were injected into the tail vein by means of a microinjection apparatus.

(5) After AAV virus injection for 15 days, mice were sacrificed, back skin was cut to make single cell suspensions, and the ratio of immune cell subsets was determined by staining and flow analysis.

2. Experimental results

SPF-class humanized immune system BALB/c mice were raised to 7 weeks, and female mice were selected for psoriasis induction. Treatment of psoriasis model mice was performed by tail vein injection of interfering RNA for CTTNBP2NL to express AAV virus. By examining the change in the proportion of immune cells at the site of psoriatic lesions in mice, it was found that the use of AAV virus to knock down CTTNBP2NL significantly reduced the symptoms in psoriatic mice (fig. 13).

The experimental results show that: inhibition of CTTNBP2NL expression may treat psoriasis.

Example 8 influence of overexpression of CTTNBP2NL on phosphorylation of tumor cells CTTNBP2NL

To determine the function of serine at position 568 of CTTNBP2NL protein, lentiviral vectors expressing CTTNBP2NL protein S568A (inactivating mutation that cannot be phosphorylated) and S568E (activating mutation that persists phosphorylate) were constructed and infected Hela cells and transfected with a dual luciferase reporter plasmid of STAT3 downstream transcriptional activity. The effect of over-expression of different CTTNBP2NL mutants on STAT3 transcriptional activity can be judged by the ratio between firefly luciferase and renilla luciferase. The results show (fig. 14) that the inactivating mutation at the S568 site overexpressing CTTNBP2NL did not affect STAT3 transcriptional activity, but that the activating mutation at the S568 site overexpressing CTTNBP2NL significantly inhibited STAT3 transcriptional activity. The above results suggest that the S568 site is also a key site for the function of CTTNBP2 NL.

In conclusion, CTTNBP2NL overexpression causes increased phosphorylation of STAT3Y705 site, leading to disease. Loss of CTTNBP2NL functions, such as inhibition of CTTNBP2NL expression or inhibition of CTTNBP2NL promoting STAT3 protein phosphorylation activity in tumor cells, may be used to treat diseases caused by STAT3 protein phosphorylation, particularly diseases caused by phosphorylation of the STAT3 protein Y705 site. The CTTNBP2NL loss of function can effectively reduce phosphorylation of STAT3 protein Y705 locus in tumor cells, obviously increase apoptosis of the tumor cells, inhibit proliferation of the tumor cells and further inhibit growth of the tumor; meanwhile, the CTTNBP2NL function deficiency can reduce the generation of autoantibodies and treat systemic lupus erythematosus; can also relieve rheumatic arthritis symptoms, inflammatory bowel disease symptoms, psoriasis symptoms, etc., and effectively treat rheumatic arthritis, inflammatory bowel disease, psoriasis, etc. Therefore, the CTTNBP2NL deficiency reagent can be used for medicines for treating tumors, autoimmune diseases and nerve diseases, and has good application prospect.

SEQUENCE LISTING

<110> Huaxi Hospital at university of Sichuan

<120> use of an agent for deleting function of CTTNBP2NL for preparing a medicament for treating a disease

<130> GYKH1669-2020P0111236CC

<160> 29

<170> PatentIn version 3.5

<210> 1

<211> 24

<212> DNA

<213> artificial sequence

<400> 1

gaggactgaa gtgtgactct gccg 24

<210> 2

<211> 26

<212> DNA

<213> artificial sequence

<400> 2

ggacgaaatc tgatggaatg tcaaac 26

<210> 3

<211> 25

<212> DNA

<213> artificial sequence

<400> 3

atgaatctgg aaaaactcag caagc 25

<210> 4

<211> 27

<212> DNA

<213> artificial sequence

<400> 4

ctagctgctg gtaggcaaaa gtaactc 27

<210> 5

<211> 20

<212> DNA

<213> artificial sequence

<400> 5

actttcattg aagaacgcta 20

<210> 6

<211> 20

<212> DNA

<213> artificial sequence

<400> 6

gccgctgcct ttcttcctca 20

<210> 7

<211> 20

<212> DNA

<213> artificial sequence

<400> 7

tgtcacctac atgctagaga 20

<210> 8

<211> 25

<212> DNA

<213> artificial sequence

<400> 8

caccgacttt cattgaagaa cgcta 25

<210> 9

<211> 25

<212> DNA

<213> artificial sequence

<400> 9

aaactagcgt tcttcaatga aagtc 25

<210> 10

<211> 25

<212> DNA

<213> artificial sequence

<400> 10

caccggccgc tgcctttctt cctca 25

<210> 11

<211> 25

<212> DNA

<213> artificial sequence

<400> 11

aaactgagga agaaaggcag cggcc 25

<210> 12

<211> 25

<212> DNA

<213> artificial sequence

<400> 12

caccgtgtca cctacatgct agaga 25

<210> 13

<211> 25

<212> DNA

<213> artificial sequence

<400> 13

aaactctcta gcatgtaggt gacac 25

<210> 14

<211> 24

<212> DNA

<213> artificial sequence

<400> 14

atggactatc atatgcttac cgta 24

<210> 15

<211> 21

<212> DNA

<213> artificial sequence

<400> 15

ataacccagt taggtattat a 21

<210> 16

<211> 21

<212> DNA

<213> artificial sequence

<400> 16

ggtactcact aagcgtttat t 21

<210> 17

<211> 21

<212> DNA

<213> artificial sequence

<400> 17

ctgaactcct gacactattt a 21

<210> 18

<211> 21

<212> DNA

<213> artificial sequence

<400> 18

gccctccatc cagggattta t 21

<210> 19

<211> 21

<212> DNA

<213> artificial sequence

<400> 19

gccactcctg cttactcata t 21

<210> 20

<211> 59

<212> DNA

<213> artificial sequence

<400> 20

gatccataac ccagttaggt attatactcg agtataatac ctaactgggt tatttttta 59

<210> 21

<211> 59

<212> DNA

<213> artificial sequence

<400> 21

agcttaaaaa ataacccagt taggtattat actcgagtat aatacctaac tgggttatg 59

<210> 22

<211> 59

<212> DNA

<213> artificial sequence

<400> 22

gatccggtac tcactaagcg tttattctcg agaataaacg cttagtgagt accttttta 59

<210> 23

<211> 59

<212> DNA

<213> artificial sequence

<400> 23

agcttaaaaa ggtactcact aagcgtttat tctcgagaat aaacgcttag tgagtaccg 59

<210> 24

<211> 59

<212> DNA

<213> artificial sequence

<400> 24

gatccctgaa ctcctgacac tatttactcg agtaaatagt gtcaggagtt cagttttta 59

<210> 25

<211> 59

<212> DNA

<213> artificial sequence

<400> 25

agcttaaaaa ctgaactcct gacactattt actcgagtaa atagtgtcag gagttcagg 59

<210> 26

<211> 59

<212> DNA

<213> artificial sequence

<400> 26

gatccgccct ccatccaggg atttatctcg agataaatcc ctggatggag ggcttttta 59

<210> 27

<211> 59

<212> DNA

<213> artificial sequence

<400> 27

agcttaaaaa gccctccatc cagggattta tctcgagata aatccctgga tggagggcg 59

<210> 28

<211> 59

<212> DNA

<213> artificial sequence

<400> 28

gatccgccac tcctgcttac tcatatctcg agatatgagt aagcaggagt ggcttttta 59

<210> 29

<211> 59

<212> DNA

<213> artificial sequence

<400> 29

agcttaaaaa gccactcctg cttactcata tctcgagata tgagtaagca ggagtggcg 59

Claims

1. Use of an agent that lacks CTTNBP2NL function for the manufacture of a medicament for the treatment of a disease caused by phosphorylation of STAT3 protein, characterized in that: the diseases caused by the phosphorylation of STAT3 protein are cervical cancer, rheumatoid arthritis, systemic lupus erythematosus, inflammatory bowel disease and psoriasis; the agent for deleting the function of CTTNBP2NL is an agent for inhibiting the expression of CTTNBP2NL or an agent for inhibiting the phosphorylation activity of STAT3 protein in tumor cells by CTTNBP2 NL; the agent for inhibiting CTTNBP2NL expression is an agent for RNAi and CRISPR/Cas9 methods; the RNA sequence of the CTTNBP2NL targeted by the reagent used in the RNAi method is as follows:

the CRISPR/Cas9 method targets the RNA sequence of CTTNBP2NL with a reagent as follows:

ACTTTCATTGAAGAACGCTA、GCCGCTGCCTTTCTTCCTCA、TGTCACCTACATGCTAGAGA；

the agent that inhibits CTTNBP2NL promoting STAT3 protein phosphorylation activity in tumor cells is an agent that causes the mutation of CTTNBP2NL 488 serine to glutamate and/or the mutation of serine at position 527 to glutamate.

2. Use according to claim 1, characterized in that: the medicine is used for treating diseases caused by phosphorylation of the STAT3 protein Y705 site.

3. Use according to claim 1 or 2, characterized in that: the agent for deleting CTTNBP2NL functions takes adenovirus, adeno-associated virus, lentivirus or cell as a vector.