CN114230649B - Tn1 protein related to rice tillering force, related biological material and application thereof - Google Patents

Abstract

The application discloses Tn1 protein related to rice tillering force, and a related biological material and application thereof. The Tn1 protein can be specifically the protein of the following A1), A2) or A3): a1 Amino acid sequence is protein of SEQ ID No.1 in a sequence table; a2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of A1), has more than 90 percent of identity with the protein shown in A1) and has activity of regulating plant tillering force; a3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of A1) or A2). Tn1 protein and related biological materials can be used for regulating and controlling the tillering force of plants.

Description

Tn1 protein related to rice tillering force, related biological material and application thereof

Technical Field

The application relates to Tn1 protein related to rice tillering force in the field of biotechnology, and a coding gene and application thereof.

Background

Rice (Oryza Sativa l.) is one of the major food crops in the world, and more than half of the world's population is on rice as the principal food. Under the severe situation that the available cultivated area cannot be increased or even is reduced year by year, the improvement of varieties is promoted, and the exploration of the high yield potential of rice is still an important task for rice breeding in a period of time in the future. The spike number is one of three factors of rice yield, and has important research significance in variety improvement. The number of ears is often based on the number of tillers. Therefore, the novel gene for regulating and controlling rice tillering is continuously discovered, the regulating and controlling mechanism is clarified, and the novel gene is helpful for providing rich gene sources and theoretical guidance for ideal plant type breeding of rice.

The rice tillers essentially belong to stem branches formed by the lateral meristems, each tillering starts from tillering buds formed by the lateral meristems in the axilla, the tillering buds which are initially in a dormant state are activated under proper conditions, then extend out and grow into tillers, and under proper conditions, the tillers enter a reproductive growth stage and finally are converted into effective ears. The method improves the tiller number of rice, promotes tiller to occur early, and has important significance for the establishment of spike number in later period. Meanwhile, a novel rice tillering gene is developed, and the novel rice tillering gene has important application value and theoretical significance for further improving a molecular mechanism and a genetic control network of rice tillering morphology.

Disclosure of Invention

The application aims to solve the technical problem of controlling the tillering force of plants.

The application provides a protein, the name of which is Tn1, which is protein of the following A1), A2) or A3):

a1 Amino acid sequence is protein of SEQ ID No.1 in a sequence table;

a2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of A1), has more than 90 percent of identity with the protein shown in A1) and has activity of regulating plant tillering force;

a3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of A1) or A2).

Wherein SEQ ID No.1 consists of 501 amino acid residues.

The protein can be derived from rice.

The protein can be synthesized artificially or obtained by synthesizing the coding gene and then biologically expressing.

Among the above proteins, the protein tag (protein-tag) refers to a polypeptide or protein that is fusion expressed together with a target protein by using a DNA in vitro recombination technique, so as to facilitate the expression, detection, tracing and/or purification of the target protein. The protein tag may be a Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag, and/or SUMO tag, etc.

In the above proteins, the identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity.

In the above protein, the 90% or more identity may be at least 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

Biological materials related to protein Tn1 are also within the scope of the present application.

The biological material related to the protein Tn1 provided by the application is any one of the following B1) to B7):

is any one of the following B1) to B7):

b1 A DNA molecule encoding said protein;

b2 An expression cassette comprising B1) said DNA molecule;

b3 A recombinant vector comprising the DNA molecule of B1) or a recombinant vector comprising the expression cassette of B2);

b4 A recombinant microorganism comprising B1) said DNA molecule, or a recombinant microorganism comprising B2) said expression cassette, or a recombinant microorganism comprising B3) said recombinant vector;

b5 A transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the DNA molecule of B1), or a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the expression cassette of B2);

b6 A nucleic acid molecule which reduces the expression of the DNA molecule according to B1);

b7 An expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the nucleic acid molecule of B6).

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

In the above biological material, the DNA molecule of B1) is a gene represented by the following B1) or B2):

b1 A cDNA molecule or a DNA molecule of SEQ ID No. 2;

b2 The nucleotide encoding the strand is a cDNA molecule or a DNA molecule of SEQ ID No. 2.

Wherein, the sequence 2 in the sequence table consists of 1503 nucleotides and codes the protein shown in SEQ ID No.1 in the sequence table.

In the above biological material, the expression cassette (Tn 1 gene expression cassette) containing the DNA molecule described in B2) refers to a DNA molecule capable of expressing Tn1 in a host cell, and the DNA molecule may include not only a promoter for initiating the transcription of Tn1 gene but also a terminator for terminating the transcription of Tn1. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present application include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: a constitutive promoter of cauliflower mosaic virus 35S; wound-inducible promoters from tomato, leucine aminopeptidase ("LAP", chao et al (1999) Plant Physiology 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR 1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester); tomato protease inhibitor II promoter (PIN 2) or LAP promoter (both inducible with jasmonic acid ester); heat shock promoter (us patent 5,187,267); tetracycline-inducible promoters (U.S. patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN 101063139B (China patent 200710099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta-cone (Beachy et al (1985) EMBO J. 4:3047-3053)). They may be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator (see, e.g., odell et al (1985) Nature 313:810; rosenberg et al (1987) Gene,56:125; guerineau et al (1991) mol. Genet. 262:141; proudfoot (1991) Cell,64:671; sanfacon et al Genes Dev.,5:141; mogen et al (1990) Plant Cell,2:1261; munroe et al (1990) Gene,91:151; ballad et al (1989) Nucleic Acids Res.17:7891; jo et al (1987) Nucleic Acid Res., 15:9627).

Recombinant vectors containing the gene encoding the protein Tn1 or the gene expression cassette encoding the protein Tn1 can be constructed using existing plant expression vectors. The plant expression vector may be a Gateway system vector or a binary agrobacterium vector, etc., such as pro super1300, pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pGWB18, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb. When the Tn1 gene is used for constructing a recombinant vector, any one of enhanced, constitutive, tissue-specific or inducible promoters such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin gene Ubiqutin promoter (pUbi) and the like can be added before the transcription initiation nucleotide thereof, and can be used alone or in combination with other plant promoters; in addition, when the gene of the present application is used to construct a plant expression vector, enhancers, including translational enhancers or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.), or anti-chemical marker genes (e.g., anti-herbicide genes), etc., which may be expressed in plants.

In the above biological material, the recombinant microorganism may specifically be yeast, bacteria, algae and fungi; the bacterium may be an agrobacterium EHA105 strain.

The use of the above proteins, or any of the following C1-C2 of the above biological materials, is also within the scope of the present application:

c1 Regulating and controlling tillering force;

c2 Preparing a product for regulating and controlling tillering force.

The tillering force is regulated and controlled to be improved or reduced. The tillering force is increased and/or tillering bud extension is promoted, and the tillering force is reduced and/or tillering bud extension is inhibited. The improvement of tillering force can be achieved by inhibiting or reducing the expression of the gene encoding the protein Tn 1; the reduction of tillering power can be achieved by promoting or increasing the expression of the gene encoding the protein Tn1.

The application also provides a method for improving the tillering force of rice, which comprises the following steps: inhibiting or reducing the expression of Tn1 genes in the receptor rice to obtain target rice with higher tillering power than the receptor rice; the Tn1 gene is a gene for encoding the Tn1 protein.

In the above method, the inhibition or reduction of expression of the Tn1 gene in the recipient rice is achieved by gene editing of the Tn1 gene in the rice. The gene editing is achieved by means of a CRISPR/Cas9 system.

In the method, the CRISPR/Cas9 system comprises a plasmid for expressing Cas9 and gRNA, and the target sequence of the gRNA is a DNA fragment shown in SEQ ID No.2 and accords with 5' -N _X -NGG-3 'or 5' -CCN-N _X -3' fragments of regular sequence arrangement, wherein N represents any one of A, G, C and T, 14.ltoreq.X.ltoreq.30, and X is an integer, N _X X consecutive deoxyribonucleotides are represented. The target sequence of the gRNA can be specifically 148-167 of SEQ ID No. 2.

In the method, the inhibition or reduction of the expression of the gene in the acceptor rice is to delete 6 nucleotides from 2075 th to 2080 th nucleotide of the sequence 3 in the genome of the rice.

In order to solve the technical problems, the application also provides a plant reagent which is used for regulating and controlling the tillering force of plants.

The plant reagent provided by the application contains the protein or/and the protein related biological material.

The active ingredient of the plant agent may be the protein or/and the protein-related biological material, and the active ingredient of the plant agent may further contain other biological components or/and non-biological components, and the other active components of the plant agent may be determined by those skilled in the art according to the plant tillering effect.

The plant of interest may be a monocot or dicot. The monocotyledonous plant may be a plant of the Gramineae family, in particular rice.

Experiments for knocking out Tn1 genes in rice prove that the number of tillers of transgenic rice for knocking out Tn1 genes is increased, and the extension of tillers is promoted. The over-expression experiment of introducing Tn1 gene coding sequence into rice proves that compared with receptor rice, the transgenic rice over-expressing Tn1 protein has reduced tillering number and the tillering bud extension is inhibited. The knockout experiment and the over-expression experiment show that the Tn1 protein is a gene related to the tillering force of plants, and the tillering force of the plants is improved by inhibiting the Tn1 protein. The method of the application has simple operation and low cost, greatly accelerates the breeding process and has wide application prospect.

Drawings

FIG. 1 is a Manhattan plot of genome-wide association analysis of 295 parts of rice germplasm material with respect to effective ear count in example 1 of the present application.

FIG. 2 is a schematic diagram showing the positions of the target sequences of Tn1 gene in the Tn1 gene knockout test in example 2 of the present application.

FIG. 3 is a DNA level identification chart of Tn1 gene overexpression material in example 2 of the present application.

FIG. 4 is a diagram showing the T0 generation sequencing peaks of the Tn1 gene knockout material in example 2 of the present application.

FIG. 5 is a tillering phenotype and a statistical chart of Tn1 gene knockout material Tn1-1 and wild type NiP in example 2 of the present application. The data shown in the figures are mean ± standard deviation, repetition number is 15, representing significance analysis results P <0.01,Tiller number as tillers in units of units/strain.

FIG. 6 is a chart showing tillering phenotypes and statistics of Tn1 gene overexpression materials (Tn 1-OE1 and Tn1-OE 2) and wild-type in example 2 of the present application. The data shown in the figures are mean ± standard deviation, repetition number of 15, P <0.05, P <0.01,Tiller number, units of tillers/strain. In the left panel, three pot plants from left to right are Japanese sunny (NIP), the overexpressing materials Tn1-OE1 and Tn1-OE2, respectively.

FIG. 7 is a photograph showing the phenotype of tillered buds after three weeks of emergence of Tn1 gene knockout material, over-expression material and wild type in example 2 of the present application.

FIG. 8 shows the expression of Tn1 gene in the tillering bud basal portion at each stage in example 3 of the present application. The internal reference is LOC_Os03g13170 (Ubiquitin 1) gene. Root, shath, leaf represent Root in vegetative growth period, leaf sheath, leaf, dt30_ab, dt45_ab, dt60_ab represent tillering bud basal portion 30 days, 45 days, 60 days after transplanting, respectively, st_1, st_2, st_3 represent inverted one, inverted two, inverted three internode basal portion 75 days after transplanting, respectively. The data shown in the figures are mean ± standard deviation, repetition number is 3, x represents significance analysis result P <0.01, ns represents no difference.

FIG. 9 is a subcellular localization of Tn1 in example 3 of the application. GFP (Prosuper 1300 empty) was used as a control.

Detailed Description

The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.

The quantitative tests in the following examples were all performed in triplicate, and the results were averaged.

The experimental methods in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The vectors SK-gRNA and pC1300-Cas9 of the following examples are described in non-patent literature, "Wang, chun et al," A simple CRISPR/Cas9 system for multiplex genome editing in service. Journal of Genetics and Genomics, "available to the public from the national university of agriculture (i.e., applicants) to repeat the experiments of the present application, and are not useful for other applications.

The vector Prosuper1300 in the examples described below is described in non-patent literature "Li, gangling et al, RGN1 controls grain number and shapes panicle architecture in price.plant biotechnology journal", available to the public from the university of agricultural China (i.e., the applicant) for repeated experiments of the present application, and is not useful for other applications.

Example 1, obtaining Tn1 Gene

The application utilizes 295 parts of rice germplasm materials to plant in Beijing and survey the effective spike number, utilizes an MLM model to carry out whole genome association analysis, combines the expression condition of RiceXPro website genes, and screens to obtain Tn1 genes.

Effective spike number correlation analysis was performed with 295 parts of rice germplasm material at p=10 ^-4 For the threshold, at least three distinct SNP sites in succession, and intervals no more than 170kb apart by two, are defined as one QTL, defining a total of 13 QTLs (qTn-qTn 13) (as shown in fig. 1). According to the qTn, the obvious SNP loci are annotated to 12 candidate genes, wherein 5 genes are not expressed in each period of rice growth and development, only Tn1 genes are highly expressed in roots in vegetative growth periods, and obvious non-synonymous mutation SNP loci exist in the remaining 7 genes, so that the expression mode of the tillering genes is met.

cDNA of rice variety Nippon-Qing is used as a template, and Tn1 gene is obtained through PCR amplification, and the primers are as follows:

Tn1-F：5’-ATGGATGGTAGTAATGAGAATATC-3’；

Tn1-R：5’-TTACTTTCCCATCTTACTCGCAAAG-3’。

through sequencing, the nucleotide sequence of the coding sequence of the Tn1 gene is shown as SEQ ID No.2, the protein Tn1 is coded, and the amino acid sequence of the protein is shown as SEQ ID No.1.

Functional verification of the Tn1 protein of example 2

1. Construction of knockout vectors

(1) The nucleotide sequence of the genomic gene of Tn1 is SEQ ID No.3, 10 exons total, 10 introns (wherein SEQ ID No.3 is 5' UTR at positions 1-139, first intron at positions 140-1872, 5' UTR at positions 1873-1916, first exon at positions 1917-2249, second intron at positions 2250-3035, second exon at positions 3036-3204, third intron at positions 3205-3317, third exon at positions 3318-3763, fourth intron at positions 3764-4558, fourth exon at positions 4559-4582), 4583-4754 is the fifth intron, 4755-4847 is the fifth exon, 4848-5824 is the sixth intron, 5825-5903 is the sixth exon, 5904-5997 is the seventh intron, 5998-6082 is the seventh exon, 6083-6497 is the eighth intron, 6498-6609 is the eighth exon, 6610-6690 is the ninth intron, 6691-6807 is the ninth exon, 6808-6901 is the tenth intron, 6902-6949 is the tenth exon, 6950-7468 is the 3' UTR. The target sites were screened by logging onto website http:// www.genome.arizona.edu/crispr/crisprsearch. The off-target condition was then assessed to the http:// www.rgenome.net/cas-offfinder/website. The sequences with low off-target rates were selected as target sequences for this study, as follows:

target sequence: 5'-GGTGAGTCTGAACCTTACAT-3' (positions 148-167 of SEQ ID No.2 and positions 2064-2083 of SEQ ID No. 3).

The location of the Tn1 knockout target sequence on its genome is shown in FIG. 2 as being located in the first exon.

(2) Two complementary DNA sequences were designed, GGCA was added before the forward target sequence and AAAC was added before the reverse complementary target sequence, as follows:

F：5’-GGCAGGTGAGTCTGAACCTTACAT-3’；

R：5’-AAACATGTAAGGTTCAGACTCACC-3' (underlined indicationIs reverse complementary to the sequence indicated by the underline in F).

(3) Construction of intermediate vectors:

a. the vector SK-gRNA is subjected to AarI digestion (Ferment company) to form a linear vector with a sticky end;

b.F strands are denatured and annealed after mixing with R strands to form fragments with cohesive ends;

c. c, connecting the linear vector obtained in the step a and the fragment obtained in the step b (molar concentration is 1:3-10), and converting DH5 alpha to obtain recombinant plasmid; colony PCR positive detection can be carried out by collocation of a primer T3 and an R chain, and the primer has the following sequence:

T3：5’-ATTAACCCTCACTAAAGGGA-3’；

R：5’-AAACATGTAAGGTTCAGACTCACC-3’。

d. sequencing assays were performed using the public primers T7 (5'-TAATACGACTCACTATAGGG-3') or T3 (5'-ATTAACCCTCACTAAAGGGA-3') to verify that the correct vector was designated SK-gRNA-Tn1.

(4) Constructing to a final vector:

the vector pC1300-Cas9 is subjected to enzyme digestion by KpnI and BamHI, so that a linearized pC1300-Cas9 vector is obtained. And (3) carrying out KpnI and BglII digestion on the SK-gRNA-Tn1 constructed in the step (3), and recovering the target fragment. The target fragment is connected to a linearized pC1300-Cas9 vector to obtain a knockout vector, and the specific structure is as follows: the target fragment after SK-gRNA-Tn1 is used for replacing the fragment (including the small fragment of KpnI recognition site and BamHI recognition site) between the restriction endonuclease KpnI and BamHI recognition site of the vector pC1300-Cas9, and other sequences of the pC1300-Cas9 vector are kept unchanged to obtain the recombinant vector. After proper sequencing, the resulting knockout vector was designated Tn1-CR.

The knockdown vector Tn1-CR expresses gRNA, the target sequence of which is positioned on the first exon of the rice Tn1 gene, and the specific target sequence is shown as 148 th-167 th positions of SEQ ID No. 2.

2. Construction of the overexpression vector

The overexpression vector used in this experiment was designated Tn1-OE, and was ligated to the plant expression vector Prosuper1300 with a 35S strong promoter by seamless ligation of CDS (nucleotides 1-1503 in SEQ ID No. 2) from which the stop codon was removed from Tn1 in Japanese sunny. The cleavage sites were HindIII and KpnI, and the primers used were as follows:

Tn1-OE-F：AATCTCGATACACCAAATCGACTCTAGAAAGCTTATGGATGGTTAATGAGAATATC

Tn1-OE-R：

CGGTGAACAGCTCCTCGCCCTTGCTCACCATGGTACCCTTTCCCATCTTACTCGCAAAGGTC

the primers are written in the 5 'to 3' direction.

The structure of the Tn1-OE vector is described as: the small fragment between the enzyme cutting sites HindIII and KpnI of the Prosuper1300 vector is replaced by a positive plasmid which is obtained by keeping other sequences of the Prosuper1300 vector unchanged by the Tn1 coding region sequence, namely the recombinant expression vector of the Tn1 protein. The Tn1 coding sequence is shown as 1 st-1503 rd nucleotide of SEQ ID No. 2.

3. Obtaining transgenic Rice

(1) Recombinant bacterium

And (3) transforming the knock-out vector Tn1-CR prepared in the step one into agrobacterium tumefaciens EHA105 by a freeze thawing method to obtain recombinant bacterium EHA105-Tn1-CR.

And (3) transforming the overexpression vector Tn1-OE prepared in the step (II) into agrobacterium tumefaciens EHA105 by a freeze thawing method to obtain recombinant strain EHA105-Tn1-OE.

(2) Rice transfer

The two recombinant bacteria are subjected to classical agrobacterium-mediated callus infection methods, and the callus receptor varieties used for infecting the receptor varieties are Japanese sunny. The method comprises the following specific steps:

a. embryogenic callus acquisition: mature seeds are dehulled, sterilized with 75% alcohol, sterilized with 20% sodium hypochlorite solution, rinsed once with sterile water and air-dried for 6h. Inoculating to NB medium, dark culturing at 28deg.C for 2 weeks, removing embryogenic callus, subculturing to new NB medium, and subculturing for 2 weeks.

b. Preparing an aggressive dyeing liquid: sucking the stored agrobacterium liquid, coating on a solid medium containing rifampicin and kanamycin, inversely culturing for 2 days at 28 ℃, scraping a small amount of agrobacterium into an AAM liquid medium, blowing and mixing uniformly, and measuring the concentration OD600 of the bacterial liquid to be about 0.3.

c. Co-cultivation: selecting granular callus which is naturally dispersed, fresh yellow in color and about 3-5 mm in diameter, putting the granular callus into a triangular flask, adding the prepared invasion solution, infecting for 15min, sucking the redundant invasion solution by using sterile filter paper, and putting the sterile filter paper on a co-culture medium paved with a layer of filter paper for co-culture for 2-3 d at 20 ℃.

d. Screening of resistant calli: taking out the co-cultured callus, rapidly shaking and cleaning for 5-6 times by using sterile water, cleaning for 20min by using the sterile water containing the cephalosporin and the carbenicillin, and finally draining on sterile filter paper for 3h. And then transferred to a delay screening medium. One week later, onto the first round of screening media, two weeks later, onto the second round of screening media, and culturing for two weeks.

e. And (3) differentiation culture: and (3) inoculating the resistant callus obtained by screening into a pre-differentiation culture medium, performing dark culture at 28 ℃ for 2 weeks, transferring to a differentiation culture medium, and performing illumination culture for 2-3 weeks to obtain a regenerated transgenic seedling plant.

f. And (3) transferring the seedlings to a strong seedling culture medium, removing the culture flask after rooting and growing the seedlings, cleaning the culture medium on the roots, hardening the seedlings for 1-2 weeks, and transferring to a field for planting until the seedlings are mature.

The medium formulations used in the above-described transgenesis are shown in Table 1.

TABLE 1 Medium formulations for use in transgenesis

Note that: the basic components of the NB culture medium comprise N6 macroelements, B5 microelements, B5 organic components, 150mg/L inositol, 300mg/L hydrolyzed casein, 500mg/L glutamine, 600mg/L proline, 30g/L sucrose and 3g/L plant gel.

(3) PCR identification to obtain positive transgenic material

And (3) respectively carrying out PCR identification and sequencing identification on DNA level on the T0 generation Tn1-OE transgenic material obtained in the step (2) and the rice plant of the T0 generation Tn1-CR transgenic material.

The Tn1-OE transgenic material identification primers are Tn1-OE-check-F and Tn1-OE-check-R:

Tn1-OE-check-F：5’-GACGCCATTTCGCCTTTTCAG-3’；

Tn1-OE-check-R：5’-CTTTCCAATGTAAGGTTCAG-3’。

the size of the target fragment is 310bp, the plants containing the target fragment in the amplified product are positive, the plants not containing the target fragment are negative, the identification result of part of positive samples is shown in figure 3, and the positive plants are T0 generation Tn1-OE transgenic materials (namely Tn1 gene overexpression materials).

The Tn1-CR transgenic material identification sequencing primers are Tn1-CR-check-F and Tn1-CR-check-R:

Tn1-CR-check-F：5’-GGTTTGTATGTTTGTTGACCACC-3’；

Tn1-CR-check-R：5’-TCTAGCTACCGATATGGCTTCTC-3’。

the sequencing peak pattern of the T0 generation of Tn1-CR transgenic material (i.e., tn1 knockout material) is shown in FIG. 4, and the homozygous material is designated Tn1-1.

4. Identification of tillering number-related traits of transgenic materials

The homozygous positive strain of Tn1-CR is the T1 generation obtained after the T0 generation strain of Tn1-1 in the third step is harvested, and the homozygous positive strain (Tn 1-1) of Tn1-CR is obtained by sequencing, which is also called as Tn1 gene knockout material Tn1-1.

The homozygous positive line (Tn 1-1) for Tn1-CR had a mutation in the gene of Tn1 in the rice genome compared to wild type rice Nippon: in the two homologous chromosomes, the genome genes of Tn1 with nucleotide sequences of sequence 3 in the sequence table are changed as follows: deletion of 6 nucleotides from 2075 th to 2080 th of sequence 3 in the sequence table, namely deletion of 6 nucleotides from 148 th to 167 th of sequence 2 in the sequence table, results in mutation of three amino acids of 53 rd glutamic acid (Glu), 54 th proline (Pro) and 55 th tyrosine (Tyr) into one aspartic acid (Asp), so that the Tn1 gene is knocked out.

Homozygous positive lines (Tn 1-1) of Tn1-CR and NiP were sown at the Beijing China university of agriculture laboratory station. After seed soaking and germination accelerating, the seedlings are grown on a seedbed for 30 days, then the seedlings are transplanted into a field, 7 plants are planted in each row, the plant spacing is 20cm, the row spacing is 25cm, and 10 rows are planted respectively. The tillering phenotype at 50 days after transplanting was statistically investigated, 15 plants were investigated for tn1-1 and NIP (no statistics was made for the side line individuals), and the results are shown in FIG. 5, which indicate that tillering numbers of the knocked-out material tn1-1 at 50 days after transplanting are significantly more than tillering numbers of wild type Japanese sunny.

After the T0 generation positive strain of Tn1-OE is harvested, 20mg/L hygromycin solution is used for seed soaking and germination before the T1 generation sowing, seeds which can normally root are selected and transplanted to a field, the DNA is extracted from leaves, and the Tn1-OE-check-F and Tn1-OE-check-R are used for DNA level identification to obtain positive single plants. Before sowing the T2 generation, carrying out 20mg/L hygromycin solution treatment on all positive single plant seeds of the T1 generation, wherein all T1 single plants which can root normally are homozygous lines, marked as Tn1-OE1 and Tn1-OE2, transplanting the plants into a field, and counting the tillering phenotype 50 days after transplanting. And quantitatively analyzing the expression quantity of Tn1 in Tn1-OE1 and Tn1-OE2 in real time. The results are shown in FIG. 6: on day 50 after transplanting, the overexpressing materials Tn1-OE1 and Tn1-OE2 exhibit a reduced tiller number phenotype compared to wild-type Japanese sunny.

To investigate the effect of Tn1 on the protrusion of tillering buds of rice, seeds of wild type Nippon, tn1 knockout material Tn1-1, tn1 overexpressing materials Tn1-OE1 and Tn1-OE2 were sterilized with sterile water. Planting in a 1/2MS culture medium, culturing in an illumination incubator for 3 weeks, investigating the phenotype of tillering buds at the base of stems, and planting 10 plants in each plant line. FIG. 7 is a comparison of three week seedling tillering with NiP, knockout material (Tn 1-1), overexpressing material (Tn 1-OE1 and Tn1-OE 2), with the tillering bud length of the NIP being shorter than Tn1-1 but longer than Tn1-OE1 and Tn1-OE2. Compared with wild type Japanese sunny plants, tn1 knockout material Tn1-1 tillering bud extension is promoted, and Tn1 overexpression materials Tn1-OE1 and Tn1-OE2 tillering bud extension is inhibited.

Example 3 expression of Tn1 in Rice individual tissues and subcellular localization analysis

1. Real-time fluorescent quantitative PCR

After total RNA is extracted from the basal tissues of tillering buds of rice varieties in all stages, reverse transcription is carried out by using reverse transcriptase M-MLV to synthesize a cDNA first strand, the cDNA first strand is used as a template, a specific fragment of a Tn1 gene is amplified by using primers Tn1-RT-F and primers Tn1-RT-R, and a specific fragment of the rice Ubiquitin gene is amplified by using primers Ubiquitin-F and primers Ubiquitin-R to be used as an internal reference for real-time quantitative analysis. The sequences of the primers used are specifically as follows:

Tn1-RT-F：5’-GGCGTTGGCCTTGCTGAT-3’；

Tn1-RT-R：5’-GTTGACGATTCCTCTCATCCTTTG-3’。

Ubiquitin-F：5’-ACCAGCTGAGGCCCAAGA-3’；

Ubiquitin-R：5’-ACGATTGATTTAACCAGTCCATGA-3’。

real-time fluorescent quantitative PCR was performed on a real-time fluorescent quantitative PCR instrument Applied Biosystems 7500Real Time PCR system (ABI, USA), with 3 biological replicates per test, each biological replicate being performed 3 mechanical replicates. Methods reported using Livak KJ and Schmittgen TD (2001), i.e. 2 ^-ΔΔCT The relative expression level was calculated.

ΔΔCT＝(CT.Target－CT.Ubiquitin)Time x－(CT.Target－CT.Ubiquitin)Time 0

Time x represents any Time point, and Time 0 represents 1-fold the target gene expression after the Ubiquitin correction.

As a result, as shown in FIG. 8, the Tn1 gene was detected in the basal tissues of tillering buds at various stages of Japanese sunny.

2. Subcellular localization of Tn1 in rice protoplasts

To study subcellular localization of Tn1, the present study utilized the Tn1-OE vector constructed in step two of example 2 (the starting vector used was Prosuper 1300), which was transformed into rice protoplasts to observe localization results.

(1) Sterilizing shelled seeds of Paddy rice with 75% alcohol for 3-5min, and washing with sterilized water twice. Then the solution is sterilized by 20% sodium hypochlorite solution (160 turns of a shaking table at 28 ℃) and the sodium hypochlorite solution is replaced once for 20 minutes for two times. Finally, using sterilized water to rinse for 5-8 times, and placing the mixture in an ultra-clean bench to dry for 4-5 hours

(2) The seeds after disinfection treatment are inoculated in a 1/2MS culture medium and grown for 12 days in dark.

(3) Cutting the young rice seedling in step (2) by a blade, putting into a buffer Enzyme solution I, and gently shaking and mixing. After filtration through a 400 mesh nylon membrane, minced tissue was added to Enzyme solution II.

(4) Enzyme solution II containing minced tissue was placed in a vacuum pump, evacuated at 50kpa for 0.5h, and then subjected to 40-turn shaking table treatment at room temperature for 3-4 hours to promote dissociation and release of protoplasts.

(5) The Enzyme solution II containing the protoplasts was filtered through a 400 mesh nylon membrane, the minced rice tissue was removed, and the protoplasts were collected in a 50ml centrifuge tube. Protoplasts were washed with 100ml of W5 solution, 150g, and collected by centrifugation in 5min (3 acel 9 brake).

(6) Protoplasts collected in (5) were resuspended with MMG solution.

(7) Adding the extracted Tn1-OE plasmid into a 2ml small tube, adding the mixed solution of the protoplast and the MMG obtained in the step (6), and flicking the mixture by hand.

(8) 110 μl of 40% PEG was added, gently mixed upside down, and left standing at 28℃for 15 minutes in the dark.

(9) Fill up with W5, gently mix, centrifuge 150g for 5min to remove supernatant.

(10) Add 800. Mu. l W5 to lateral place and incubate overnight at 28℃for 16 hours.

(11) And (5) performing confocal laser observation.

The formulation of the reagents used in the protoplast extraction procedure described above is shown in Table 2.

TABLE 2 reagents for protoplast extraction

/>

The results are shown in FIG. 9, which shows that Tn1 is a protein localized on the nucleus.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Sequence listing

<110> Chinese university of agriculture

<120> Tn1 protein related to rice tillering force, related biological material and application thereof

<130> GNCSY213250

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 501

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Met Asp Gly Ser Asn Glu Asn Ile Gln Phe Ser Trp Gly Lys Lys Arg

1 5 10 15

Ala Lys Gly Gly Ile Lys Met Asp Thr Gln Phe Tyr Asp Ser Phe Thr

20 25 30

Phe Asp Asn Val Lys Tyr Ser Leu Tyr Asp Asn Val Tyr Leu Phe Lys

35 40 45

Ser Gly Glu Ser Glu Pro Tyr Ile Gly Lys Ile Ile Lys Ile Trp Gln

50 55 60

Gln Asn Gln Ala Lys Lys Val Lys Ile Leu Trp Phe Phe Leu Pro Asp

65 70 75 80

Glu Ile Arg Lys His Leu Ser Gly Pro Val Met Glu Lys Glu Ile Phe

85 90 95

Leu Ala Cys Gly Glu Gly Val Gly Leu Ala Asp Ile Asn Pro Leu Glu

100 105 110

Ala Ile Gly Gly Lys Cys Thr Val Leu Cys Ile Ser Lys Asp Glu Arg

115 120 125

Asn Arg Gln Pro Ser Pro Arg Glu Leu Ala Met Ala Asp Tyr Ile Phe

130 135 140

Tyr Arg Phe Phe Asp Val Asn Ser Cys Thr Leu Ser Glu Gln Leu Pro

145 150 155 160

Glu Lys Ile Ala Gly Val Glu Gly Asn Leu Leu Leu Asn Ser Lys Val

165 170 175

Glu Gln Val Thr Ser Cys Ser Asp Gln Glu Val His Gly Val Asp Gln

180 185 190

Lys Met Leu Asn Val Pro Val Pro Leu Pro Gln Ser Thr Val Met Glu

195 200 205

Asp Glu Ser Pro Val Ala Ala Val Ser Leu Pro Pro Ser Val Phe Lys

210 215 220

Glu Glu Asn Val Ala Ser Ala Ile Pro Phe Pro Gln Pro Val Val Lys

225 230 235 240

Glu Glu Ser Ala Ala Ala Ala Ile Pro Pro Pro His Val Ala Leu Lys

245 250 255

Glu Glu Ser Val Ser Lys Ser Thr Glu Asn Ile Thr Lys Pro Ala Gln

260 265 270

Lys Val Leu Pro Gly Glu Arg Pro Pro Lys Arg Val Lys Phe Ser Glu

275 280 285

Asn Val Thr Val Gln Asn Val Pro Leu Asp Val Pro Glu Arg Pro Ser

290 295 300

Arg Thr Gly Pro Leu Glu Leu Ala Gly Arg Gln Ala Asp Arg Ser Lys

305 310 315 320

Trp Phe Lys Ile Pro Trp Asp Thr Arg Leu Arg Asn Ala Asp Glu Gln

325 330 335

Gly Thr Leu Val Tyr Ile Gln Asn Leu Asp Ile Gln Phe Ala Ala Ala

340 345 350

Asp Ile Glu Glu Leu Ile Arg Asp Ala Leu Gln Leu Asn Cys Ile Ala

355 360 365

Lys Pro Ile Asn His Pro Thr Tyr Asp Asp Pro Asn Asn Gly Lys Ala

370 375 380

Tyr Ala Ile Phe Lys Thr Lys Ser Ala Ala Asp Ser Ala Ile Ser Lys

385 390 395 400

Ile Asn Ser Gly Leu Val Val Gly Gly Arg Pro Leu Tyr Cys Ser Lys

405 410 415

Gly Leu Leu Lys Val Pro Lys Pro Ser Glu Thr Leu Leu Gly His Leu

420 425 430

Thr Ile Asn Asn Ile Arg Met Gly Ile Arg Gln Arg Glu Glu Gln Lys

435 440 445

Lys Ala Val Ser Thr Ser His Cys Ser Gln Pro Asn Thr Met Glu Tyr

450 455 460

Asp Leu Ala Leu Asp Trp Met Leu Val Arg Ala Lys Gln Glu Thr Lys

465 470 475 480

Phe Arg Thr Leu His Lys Lys His Lys Asp Glu Arg Lys Thr Phe Ala

485 490 495

Ser Lys Met Gly Lys

500

<210> 2

<211> 1506

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atggatggta gtaatgagaa tatccaattc tcatggggga agaagagagc aaaaggtggt 60

attaagatgg atacacagtt ttatgactcc ttcacatttg acaatgtgaa gtactcactg 120

tatgacaatg tatatctttt taagagtggt gagtctgaac cttacattgg aaagataata 180

aagatatggc agcaaaatca ggctaagaaa gtaaagattc tttggttttt tctcccggat 240

gagattcgaa aacatttaag tggccctgta atggaaaagg agatatttct tgcttgtggt 300

gaaggcgttg gccttgctga tatcaaccca ctggaagcta ttggtgggaa atgcactgtg 360

ctttgcattt caaaggatga gaggaatcgt caaccttccc ccagggaact agcaatggct 420

gattatatct tctacaggtt ttttgatgtt aacagttgca cactttctga acaattacct 480

gagaaaattg caggggtgga aggaaatctt ttgcttaatt caaaagttga gcaagtgaca 540

tcctgttcag accaggaagt gcatggtgtt gatcagaaga tgcttaatgt cccagttccc 600

cttccccagt caacggttat ggaggatgaa agtccagttg ctgcagtttc ccttcccccg 660

tcagtattca aggaggaaaa tgtggcttca gccattccct ttccccagcc agtggtcaag 720

gaggaaagtg cggctgctgc cattccccct ccccatgtag cactgaaaga ggagagtgtg 780

tccaaatcta cagagaacat taccaaacct gcacagaaag ttctccctgg ggagaggcca 840

ccaaagaggg tcaaattttc tgaaaatgtt acagtgcaaa atgtgccatt agatgttcct 900

gaaagaccaa gtcgcactgg acctttggaa ctagcaggta gacaagctga cagaagcaaa 960

tggttcaaga ttccatggga taccagacta cgaaatgctg atgagcaggg gacacttgtg 1020

tacattcaaa atcttgacat acagtttgca gctgctgaca tagaggagct tatacgtgat 1080

gctttacaac taaattgtat cgctaagcct attaaccacc caacttatga tgatccaaac 1140

aatggaaaag catatgctat attcaaaaca aaaagtgccg cagactctgc tatttcaaaa 1200

attaattcag gcttggtggt cggtggaaga cccctttatt gcagcaaagg attgcttaag 1260

gttccaaaac cttcagaaac tcttctcggg cacttaacaa tcaacaatat tagaatgggt 1320

ataagacaac gagaagaaca gaagaaggca gtttcaacct cgcattgttc tcaacccaat 1380

acaatggagt atgatttggc cttggattgg atgcttgtcc gagcaaagca agaaacgaaa 1440

tttaggacac ttcacaagaa gcataaagat gagaggaaga cctttgcgag taagatggga 1500

aagtaa 1506

<210> 3

<211> 7468

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gcgtccgtac tgagacccaa ccacaaaaat ctcacctcct cctcctcctc cctctcccac 60

cgcggcctcc tcctgctacc tgggagccac gcgcccccgg cctccacctc gccgccctcc 120

tcgccggcgg ccgccacgcg tgagtcctct cccctcttcc tccccgccgt cccccgtcac 180

tgttccgcgc tggatttcgc tgcgcggccg cgcgtggttc cgcccccaac cccccaccgg 240

ggaccgcggg gctccggtcg ctggagagcg ctccgcgtcg ccccgtcggg ctccggggcc 300

gctggtcgtg gtcccccgcg cgcgcggcct ccggttgcgc ggcgcgggcg aggaatgccg 360

gcgcgcgtgc gggcgggcgg gccgaacgac cccggtcgaa cggctagggc gctaaatttt 420

ggtgctcgaa tggaggtgtc cttgcgaggt tttgggggat ttcgtgtggg ggcgtcgcac 480

gttcggtttg cgtttccccc gtctagggtt tggggtttgg tggattcgtc gtcggtgtga 540

tcgcatttag tggctctagc tgctgttggt ggtaatttta gttctcatat tatggattgg 600

tcatgtcaaa accctagatg agttccctgg aacccgttag ctcacctcat gggtttgttc 660

ttcgtcgtgc tggacaccct cctttgctct tgttctaaaa actaaggcat gcatgacgat 720

ccttgttgcg gtggtactgt tttatatatg cttatggtta atggtgagcc tattagtaag 780

gtgaaacagc ggatacgaac atgtcagttg aaaaagcatt catgttttta tttcctaccc 840

tatttaagaa cacacgtttg atcaaaggcg ctaactgttg ccttttaggt tgaaaacagg 900

gtactccaag ccattgttga gcctcaagtt ttatgcatgt actatgtagt tactcctcta 960

atggccttct tattcaccat gagcattcat gaaacttatt acattttctt tactcctgtt 1020

tagtgagcat gtagaattca tgccaaccgg aaaatgtagc agattgattt gtccaaaaga 1080

taaaaaatcg aacgacttcc tgtgggattt tattccagca taacctaaaa tgtaactaat 1140

cagcatgaca gatttattta tcaagcagat ggatctgtac ttccattatg tttgcttatt 1200

taccgcgaat attttggaac tttagaataa ccacagccta tccagaaaaa taagaattaa 1260

ttaggttggt ttaaaatgca tcaccatgca gcaatcggtt gcaatttcat atctttatat 1320

ttttttatgt gttatctttg atgttcccgc atgcattcag ctgtagataa aacattgcta 1380

cattcagttg caaaataggg ttcagctgtg aaataggact tttcaagaag tctgagagaa 1440

gctgtccctt tctttgttga gaaaataaca tctgctgcag ttaatatttc atctttctca 1500

attcattaaa ctaactaatg tatatacagc gtattagcta ggttaactaa tcttgcaaat 1560

gacatagatt tgctaggtta actaaaatgt taacaactca aattcaacat gtgtgaagaa 1620

actagattta cgattttcgt tatgaagcga atgtctaaat tcacacttga tacggtaata 1680

gtactattag tttgtaagca tggtttgtat gtttgttgac cacctagcat aaacagcaca 1740

attaacagac accacccttt cgagcttcag aaactacgta tgttctgtgc taacattatc 1800

aatagtcaag tctgatgtgt tgatattgcc taatttgatc taaagtttga cctgctgatt 1860

ttatcactct aggcttatgg tgagtgcaca gtgagctaca agttaccatt atcagaatgg 1920

atggtagtaa tgagaatatc caattctcat gggggaagaa gagagcaaaa ggtggtatta 1980

agatggatac acagttttat gactccttca catttgacaa tgtgaagtac tcactgtatg 2040

acaatgtata tctttttaag agtggtgagt ctgaacctta cattggaaag ataataaaga 2100

tatggcagca aaatcaggct aagaaagtaa agattctttg gttttttctc ccggatgaga 2160

ttcgaaaaca tttaagtggc cctgtaatgg aaaaggagat atttcttgct tgtggtgaag 2220

gcgttggcct tgctgatatc aacccactgg taagttcata tattttcccc ttcgtttttg 2280

aattggtttt cttgaatatc attttacctt atgctttctt gcaatatatt taaatatttt 2340

cattttgatc actcaatgga cagataatca ctattatgtg aacactatat caaatttgtt 2400

tctaattgtg aaaagtcatt ggatgggcaa tagtgtcgac attttgttaa ttccaaatat 2460

ctgttgttga gaagccatat cggtagctag aatcctagag ctacaagtta ccttatcaag 2520

ttgtatctag tactagttga tgtgaggaga tcatttccca cttttttttg ttgggaatcg 2580

tccaccttgt atttgtggta tatttagtta ttcacgcatg acatgaataa ttcgaagtta 2640

gagttttaat tctcatgtat aaaaagtgca tcacaatttt caaagagcaa tatttaaatt 2700

cacatttttg gaagtgaaaa tgcagtccaa ctgagttaga cagagtaggc attagcgtgt 2760

tacccatttg catgacctga gaagagccag cttggttgcg acaatcaact tgaaaattga 2820

gatcatttct agctggtaca gttaaacatc cttttgagct aattggcata ccattttagt 2880

agagcatggt taggtattaa cagtcatgat acaagattga aactttcctg ctattgtgta 2940

ttacctgtga atgttaagtc atttgccttt tccatccttt tactttttct gagaactaaa 3000

atattataat acccttttgt ttattggtca cccaggaagc tattggtggg aaatgcactg 3060

tgctttgcat ttcaaaggat gagaggaatc gtcaaccttc ccccagggaa ctagcaatgg 3120

ctgattatat cttctacagg ttttttgatg ttaacagttg cacactttct gaacaattac 3180

ctgagaaaat tgcaggggtg gaaggtcagc aatatatcag atttcatcag tgcattaaat 3240

tgcattttta atatggcaaa aaatttctcc accctcagta tccaaattgg tatttaatta 3300

tttttcttct ggcacaggaa atcttttgct taattcaaaa gttgagcaag tgacatcctg 3360

ttcagaccag gaagtgcatg gtgttgatca gaagatgctt aatgtcccag ttccccttcc 3420

ccagtcaacg gttatggagg atgaaagtcc agttgctgca gtttcccttc ccccgtcagt 3480

attcaaggag gaaaatgtgg cttcagccat tccctttccc cagccagtgg tcaaggagga 3540

aagtgcggct gctgccattc cccctcccca tgtagcactg aaagaggaga gtgtgtccaa 3600

atctacagag aacattacca aacctgcaca gaaagttctc cctggggaga ggccaccaaa 3660

gagggtcaaa ttttctgaaa atgttacagt gcaaaatgtg ccattagatg ttcctgaaag 3720

accaagtcgc actggacctt tggaactagc aggtagacaa gctgtaagta tctgaaccaa 3780

cactgaggat acatttccac cttatcaatg aatagcttta tgccattgat gttatgatat 3840

catgttaaac tttaaacatt cccccaggta actcagttaa tattatctcc acaactcatc 3900

tgcatctaat ctgttgtttg tatataagta aaataaaaca gttaacctgg actggccctg 3960

caatcttccc ataaaaaagg ccagaccgag ctcctgggct gatcccctgg acctgtccag 4020

cacaagggac tatatgagca gttgacctgg gaaaatctca gtgcaactgc tagttttttt 4080

tccccacctg ggcaagtcat tctatcctct atcgaccaac ggtgccccta tgtggcattt 4140

ggagttagca aaaattacat gaaaggctgg cctgggaacc caggaggcca ggatgtggta 4200

cttaaagctc tcatgtgaaa cctacttgta tgcattctta actaaggtat aaagtactat 4260

atgtgcctca tgcattctga ttgtcaattg agcagttttg ccgactgccc agttacccaa 4320

tgcattgaat gggttgattt acgatctggg tctaagagca atgagtaaaa gggccacatg 4380

ttccttcaat tatttctgtt caagaatttt attcggctga acatcatctg cttttactat 4440

taaggttcaa ccaatttcta agaaacaagc cataatcaaa atgttctggt tctacaattt 4500

tcctactgat agccgtgttt acttttgtgt gcttacaccc ttttctgcta tttaacagga 4560

cagaagcaaa tggttcaaga ttgtgagtaa tcatttttcc tacattgtct cttctctctt 4620

gcgtatatac tatgattgta cagaagattt acatctatgc ttcatgagtc aatgcttcaa 4680

aactattaga aaaacaaaaa tatttcagtt gaccttattt gtgggtgggt ttacctttta 4740

aatggaaatt tcagccatgg gataccagac tacgaaatgc tgatgagcag gggacacttg 4800

tgtacattca aaatcttgac atacagtttg cagctgctga catagaggta ttgtcttgtc 4860

tatctggttg acataaagcc caaactgctt tttttattat attcttggct tataatttat 4920

cacttcttta ctagctttgc tatgttctct gttgcacaaa ctttgcgatt tgttttcaat 4980

gtcttacacc tcttaatttc cacaaggcct tgtatatgag aatttgtaca gggaaggatt 5040

tcatatggct cggaaagaac tcccgtccga gtttccccag tgctgtagat ttccctcttc 5100

atgcgataaa catgacgcta actaataata ctaatatata tatatatata tatatatata 5160

tatatatatt gggcaccact tctgaacggg tgggcgaatg gatgagcaaa agatgcaaca 5220

aagtggggat tatcccgagt ctaaagtgtc atttttatgt aacctatttg tttttttgtt 5280

ttctctgctc tataaagtaa aaaaaaagat ccacttttac tatttttctc tcgatgagac 5340

aatggtacat gtttctctat tgagtgcgcc tttacgtacg cgtttccgct acccactaat 5400

tttgaaagat gtataaattg gaaagaatgt agggagcagt aaaaaagaga aatgttttgt 5460

ttacaggaac atatttgatt ttagaatctg ttttaatctt ttttgtgctt tctgtttcct 5520

aatttttgcc aattttcttg ggctggtgta gttaacactt ttgctataaa gagattaaaa 5580

atattggttc tacaacatca ctttctaccc ctaatttcag tacctaagag aggttgagta 5640

ggtgtaccat actatttgat gcttccttgt tctgccatac ttggacaata acttctaaaa 5700

tggatacgtg catgtcccac tctcttaggt gtccatgttt gctactttct gtgccttatc 5760

tgctcttttt tccagtatca tcaacatact taatgaatat ttatcttgat taccatgttt 5820

acaggagctt atacgtgatg ctttacaact aaattgtatc gctaagccta ttaaccaccc 5880

aacttatgat gatccaaaca atggtgagtg agttttgttt gtaatacctt gcaagtttgc 5940

cacattcagg caatgttctc gaatgcgatt taaaacaatc tgcttccttg tttgtaggaa 6000

aagcatatgc tatattcaaa acaaaaagtg ccgcagactc tgctatttca aaaattaatt 6060

caggcttggt ggtcggtgga aggtatctca ctctgttgct tgcagatttg ctggacgaaa 6120

tttactacta tatatgtgtt catgttgcat ttattgtgct ctgttttaag tggggtcact 6180

gtctgttata gttcacatga tggcatattg tcatctcatt acaaccccaa ctgcagaatt 6240

aagagatctt ttctttagga aagttaaggg aaacttctat tagcaattgg ttggttctat 6300

cttgatacca cctcagggac acattaccac actgcaattg cttattaggc aatttgtcaa 6360

caaaattgca tgtgatgcca tttgcactag ttacttactg ttattatttt tcaaatttct 6420

accgtggatt aaataacaat atgttgttca atatttttgg ttgacccttt ataattctct 6480

tattgaatta tttgcagacc cctttattgc agcaaaggat tgcttaaggt tccaaaacct 6540

tcagaaactc ttctcgggca cttaacaatc aacaatatta gaatgggtat aagacaacga 6600

gaagaacagg tgctgatgtt gtcctatgaa gtttgctcta tttcttttct ctgtcttaat 6660

atttttgcac aaccattatt ctttctccag aagaaggcag tttcaacctc gcattgttct 6720

caacccaata caatggagta tgatttggcc ttggattgga tgcttgtccg agcaaagcaa 6780

gaaacgaaat ttaggacact tcacaaggta tgtgcacttc cactggagat ctctgtgtat 6840

accagctttc agttttatcc atacagacct taaattttga atgctcaatt tatatctata 6900

gaagcataaa gatgagagga agacctttgc gagtaagatg ggaaagtaag tggcttccat 6960

ggatttggtt aagcgatggg aactgtcctg ttccgtgctt atcttggagt cctctactga 7020

gtactgacta tcattcctcg gagctttatg cactttttgc ctgaagcaac acttatctgc 7080

gagtttttct gctgcgcaag aatgaaatgc aacgaccatt tgagggggac aactaactgc 7140

accacactga ctctgctcat gttccgtaga gcattatttt tagaaaggaa agaattgtgc 7200

catagcttaa gaaaccaaag taacattggt agaagtagcc cttgcagcaa gttaggaaag 7260

ccagaggctg ttttaggtta ccccgcacat caatttgatc tcacatggac acatcagtta 7320

gatctgttgc tccatgttag atagcaaatc aacgcgtgcc gtcatgaaat gtgtatgtat 7380

atatttttaa attcatgacc tggctattag ttcattcatg tgactgctta tgtgtcttga 7440

gttacaagtt acaacttgac tccgttcc 7468

Claims (8)

1. Use of a protein or any of the following C1-C2 of a protein-related biomaterial:

c1 Regulating and controlling tillering force;

c2 Preparing a product for regulating and controlling tillering force;

the protein is the protein of A1) or A2) as follows:

a1 Amino acid sequence is protein of SEQ ID No.1 in a sequence table;

a2 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of A1);

the biological material is any one of the following B1) to B7):

b1 A DNA molecule encoding the protein of claim 1;

b2 An expression cassette comprising B1) said DNA molecule;

b3 A recombinant vector comprising the DNA molecule of B1) or a recombinant vector comprising the expression cassette of B2);

b4 A recombinant microorganism comprising B1) said DNA molecule, or a recombinant microorganism comprising B2) said expression cassette, or a recombinant microorganism comprising B3) said recombinant vector;

b5 A transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the DNA molecule of B1), or a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the expression cassette of B2);

b6 A nucleic acid molecule which reduces the expression of the DNA molecule according to B1);

b7 An expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the nucleic acid molecule of B6).

2. The use according to claim 1, characterized in that: the protein is derived from rice.

3. The use according to claim 1, characterized in that: b1 The DNA molecule is a gene shown in the following b 1) or b 2):

b1 A cDNA molecule or a DNA molecule of SEQ ID No. 2;

b2 The nucleotide encoding the strand is a cDNA molecule or a DNA molecule of SEQ ID No. 2.

4. The use according to claim 1, characterized in that: the control of the tillering force is to improve the tillering force; the tillering promotion force is to increase tillering number and/or promote tillering bud extension.

5. The use according to claim 1, characterized in that: the control of the tillering force is to reduce the tillering force; the tillering force is reduced by reducing tillering number and/or inhibiting tillering bud extension; the reduced tillering power is achieved by promoting or increasing the expression of a gene encoding the protein of claim 1.

6. A method for improving the tillering force of rice is characterized by comprising the following steps: comprises inhibiting or reducing the expression of genes in receptor rice to obtain target rice with higher tillering power than the receptor rice; the gene is a gene encoding the protein according to claim 1.

7. The method according to claim 6, characterized in that: the inhibition or reduction of gene expression in the recipient rice is achieved by knocking out the gene in the recipient rice through a CRISPR/Cas9 system; the CRISPR/Cas9 system includes a plasmid expressing Cas9 and a gRNA whose target sequence is positions 148-167 of SEQ ID No. 2.

8. A plant agent, characterized in that: the reagent contains the protein of claim 1 or/and the biological material of claim 1.