CN114146180A

CN114146180A - Application of substance inhibiting CHCHCHD 2 activity in preparation of product for treating NASH and hepatic fibrosis caused by hepatic injury

Info

Publication number: CN114146180A
Application number: CN202111582252.6A
Authority: CN
Inventors: 李越; 王春炅; 王�琦; 修雯靖; 徐静文
Original assignee: Tianjin Medical University; Beijing Ditan Hospital
Current assignee: Tianjin Medical University; Beijing Ditan Hospital
Priority date: 2021-12-22
Filing date: 2021-12-22
Publication date: 2022-03-08
Anticipated expiration: 2041-12-22
Also published as: CN114146180B

Abstract

The invention discloses application of a substance inhibiting CHCHCHD 2 activity in preparation of a product for treating NASH and hepatic fibrosis caused by hepatic injury. The invention also discloses application of the substance inhibiting the activity of CHCHD2 in preparing a product for inhibiting the progress of non-alcoholic steatohepatitis to hepatic fibrosis and improving the hepatic fibrosis caused by the non-alcoholic steatohepatitis or hepatic injury, and application of the substance enhancing or improving the activity of CHCHD2 in preparing a product for promoting hepatic fibrosis. The invention has important significance for the pathogenesis and treatment of non-alcoholic steatohepatitis or hepatic fibrosis.

Description

Application of substance inhibiting CHCHCHD 2 activity in preparation of product for treating NASH and hepatic fibrosis caused by hepatic injury

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to application of a substance inhibiting CHCHHD 2 activity in preparation of a product for treating NASH and hepatic fibrosis caused by hepatic injury.

Background

Non-alcoholic fatty liver disease (NAFLD) is characterized by accumulation of fat in the liver, and includes a series of histologic changes, mainly simple fatty liver, Non-alcoholic steatohepatitis (NASH), liver fibrosis/cirrhosis and liver cancer. The incidence rate of the liver disease is 30% in developed countries, nearly 10% in developing countries, 20-30% in general population and 75-100% in obese population, which are one of the most common liver diseases at present and can develop into end-stage liver diseases. Obesity, hypertension, dyslipidemia and insulin resistance are closely related to NAFLD. Simple fatty liver can be reversibly transformed into normal liver, and after NASH, steatosis will be accompanied by inflammation, hepatocyte apoptosis and hepatic fibrosis of various degrees. Liver fibrosis is highly correlated with the occurrence of end-stage liver disease. Currently, there is no clinically effective means for treating NASH and liver fibrosis.

CHCHHD 2 (conjugated-coil-helix-conjugated-coil-helix domain 2) is a protein with double localization of mitochondria and nucleus. In recent years, researchers at home and abroad have conducted certain research on the novel medical stone. It is reported that: the mutation of the CHCHHD 2 gene locus is closely related to the generation of Parkinson's disease, Huntington and other central nervous system degenerative diseases; the encoded protein can regulate and control the transfer capacity of lung cancer cell lines and kidney cancer and the energy metabolism level of breast cancer, and can also be used as a candidate diagnostic marker of follicular thyroid cancer. However, the role of CHCHHD 2 in the liver is only rarely reported at present.

Disclosure of Invention

In a first aspect, the present invention protects a novel use of a substance that inhibits the activity of chchchhd 2 protein.

The invention protects the application of a substance inhibiting the activity of CHCHD2 protein in any one of the following a1) -a 8):

a1) preparing a product for preventing and/or treating non-alcoholic steatohepatitis or hepatic fibrosis;

a2) preventing and/or treating non-alcoholic steatohepatitis or liver fibrosis;

a3) preparing a product for inhibiting the progress of the non-alcoholic steatohepatitis to the hepatic fibrosis;

a4) inhibiting the progression of non-alcoholic steatohepatitis to liver fibrosis;

a5) preparing a product for improving hepatic fibrosis caused by non-alcoholic steatohepatitis;

a6) improving hepatic fibrosis caused by non-alcoholic steatohepatitis;

a7) preparing a product for improving hepatic fibrosis caused by hepatic injury;

a8) improving hepatic fibrosis caused by liver injury.

In a second aspect, the present invention protects a novel use of a substance inhibiting the expression of CHCHD2 gene or a substance knocking out CHCHHD 2 gene.

The invention protects the application of a substance inhibiting the expression of CHCHD2 gene or a substance knocking out CHCHCHD 2 gene in any one of the following a1) -a 8):

a2) preventing and/or treating non-alcoholic steatohepatitis or liver fibrosis;

a6) improving hepatic fibrosis caused by non-alcoholic steatohepatitis;

a8) improving hepatic fibrosis caused by liver injury.

In the application of a1) or a2), the liver fibrosis is liver fibrosis caused by liver injury, and specifically may be liver fibrosis caused by chemical factors (e.g., thioacetamide-induced liver fibrosis).

The application of a3) -a8) above, wherein the inhibition of the progression of non-alcoholic steatohepatitis into liver fibrosis, the improvement of liver fibrosis caused by non-alcoholic steatohepatitis or the improvement of liver fibrosis caused by liver injury is to reduce the expression level of a fibrosis marker or the collagen deposition level in the liver of a subject suffering from non-alcoholic steatohepatitis or a subject suffering from liver fibrosis.

Further, the marker of fibrosis in the liver is at least one of the following markers: des, Col1a1, Col3a1, TIMP1, TGF β.

Further, the body with the nonalcoholic steatohepatitis can be a human or animal model with the nonalcoholic steatohepatitis.

In a specific embodiment of the invention, the non-alcoholic steatohepatitis patient is a MCD diet combined with high fat diet (MCD/HFD) induced non-alcoholic steatohepatitis mouse model.

In another embodiment of the present invention, the body of the non-alcoholic steatohepatitis patient is a high fructose high palmitic acid high cholesterol (FPC) -induced non-alcoholic steatohepatitis mouse model.

The hepatic fibrosis patient body can be a human or animal model with hepatic fibrosis. In one embodiment of the present invention, the liver fibrosis patient is a thioacetamide-induced liver fibrosis mouse model.

In the application of a8), the liver fibrosis caused by liver injury may be liver fibrosis caused by chemical factors, and specifically may be liver fibrosis induced by thioacetamide.

In a third aspect, the invention provides a novel use of a substance that enhances or increases the activity of the CHCHCHD 2 protein.

The invention protects the application of a substance which enhances or enhances the activity of CHCHHD 2 protein in any one of the following b1) -b 6):

b1) preparing a product for promoting the progress of the non-alcoholic steatohepatitis to the hepatic fibrosis;

b2) promoting the progression of non-alcoholic steatohepatitis to liver fibrosis;

b3) preparing a product for promoting liver fibrosis;

b4) promoting liver fibrosis;

b5) preparing a product which increases the expression level (e.g. protein expression level) of osteopontin in hepatocytes or promotes the secretion of osteopontin by hepatocytes;

b6) increasing the level of osteopontin expression (e.g., protein expression) in hepatocytes or promoting secretion of osteopontin by hepatocytes.

The application of b1) -b4) above, wherein the promotion of the progression of non-alcoholic steatohepatitis into hepatic fibrosis or the promotion of liver fibrosis is an improvement in the expression level of a fibrosis marker or collagen deposition level in the liver of a subject suffering from non-alcoholic steatohepatitis.

Further, the marker of fibrosis in the liver is at least one of the following markers: col3a1, TIMP1, Col1a1, CTGF.

In the application of b1) -b4), the substance for enhancing or increasing the activity of CHCHD2 protein promotes liver fibrosis or the progression of nonalcoholic steatohepatitis to liver fibrosis by promoting the secretion of osteopontin by liver cells.

The above b1) -b6), wherein the substance enhancing or increasing the activity of CHCHHD 2 protein is a substance overexpressing CHCHCHHD 2. In a specific embodiment of the invention, the material overexpressing chchchchhd 2 is an adeno-associated virus overexpressing chchchhd 2.

In a fourth aspect, the invention provides a method for constructing an animal model of the progression of nonalcoholic steatohepatitis to liver fibrosis.

The method for constructing the animal model of the non-alcoholic steatohepatitis progressing to the hepatic fibrosis, which is protected by the invention, comprises the following steps: increasing or increasing CHCHHD 2 protein content and/or activity in an animal, thereby obtaining an animal model of progression of the non-alcoholic steatohepatitis to liver fibrosis. Further, the animal model is a mouse model.

In a fifth aspect, the invention resides in a product; the active ingredients of the product are substances inhibiting the activity of CHCHD2 protein or substances inhibiting the expression of CHCHD2 gene or substances knocking out CHCHCHD 2 gene;

the product has any one of the following functions of c1) -c 4):

c1) preventing and/or treating non-alcoholic steatohepatitis or liver fibrosis;

c2) inhibiting the progression of non-alcoholic steatohepatitis to liver fibrosis;

c3) improving hepatic fibrosis caused by non-alcoholic steatohepatitis;

c4) improving hepatic fibrosis caused by liver injury.

In a fifth aspect, the invention protects a new use of CHCHHD 2 as a target.

The invention protects the application of CHCHHD 2 in any one of the following d1) -d4) as a target point:

d1) developing or preparing a product for preventing and/or treating non-alcoholic steatohepatitis or liver fibrosis;

d2) developing or preparing a product for inhibiting the progress of the non-alcoholic steatohepatitis to the hepatic fibrosis;

d3) developing or preparing a product for improving the hepatic fibrosis caused by the non-alcoholic steatohepatitis;

d4) developing or preparing products for improving hepatic fibrosis caused by hepatic injury.

In any of the above applications or products, the substance inhibiting the activity of chchchhd 2 protein may be a substance that can achieve the loss of activity of chchchhd 2 protein in the body in any way, such as a protein, polypeptide or small molecule compound that inhibits the synthesis of chchhd 2 protein or promotes the degradation of chchhd 2 protein or inhibits the function of chchhd 2 protein. The small molecule compound can be specifically a CHCHHD 2 protein activity inhibitor.

The substance inhibiting the expression of the chchchhd 2 gene may be a substance that does not allow the chchhd 2 gene to be expressed in the body in any way, and specifically may be a substance that removes or changes regulatory components (such as promoter editing) so that the chchhd 2 gene sequence is not transcribed, prevents translation by binding to mRNA, or the like. Further, the substance inhibiting the expression of the CHCHHD 2 gene can be miRNA, siRNA, dsRNA or shRNA for silencing CHCHHD 2 gene or interfering the expression of CHCHHD 2 gene.

The substance for knocking out the CHCHHD 2 gene can be a substance for realizing that the organism does not generate a functional protein product of the CHCHHD 2 gene in any way, and the specific way can be to remove all or part of the CHCHHD 2 gene sequence, introduce deletion mutation and/or insertion mutation and/or base substitution in the CHCHHD 2 gene and the like. Typically, the knockout is performed at the genomic DNA level, such that progeny of the cell also permanently carry the knockout. Further, the substance for knocking out the CHCHHD 2 gene can be a CHCHHD 2 gene knock-out gene editing system, such as a zinc finger protein ZFN gene editing system or TALENs gene editing system or CRISPR/Cas9 gene editing system and the like. Furthermore, the substance for knocking out the CHCHCHD 2 gene is a CRISPR/Cas9 gene editing system. In a specific embodiment of the invention, the sgRNA in the CRISPR/Cas9 gene editing system recognizes the target sequences as the DNA molecule shown in sequence 5 and the DNA molecule shown in sequence 6.

In any of the above applications or products, the chchchhd 2 protein may be a chchchhd 2 protein derived from a human (the amino acid sequence is shown as sequence 1 in the sequence table) or a chchhd 2 protein derived from a mouse (the amino acid sequence is shown as sequence 2 in the sequence table). The CHCHCHD 2 gene can be a genome DNA molecule shown in a sequence 3 in a sequence table or a cDNA molecule shown in 64 th to 519 th positions of a sequence 4.

In any of the uses or products described above, the product is a medicament.

The invention firstly discovers that CHCHHD 2 is highly expressed in the liver of NAFLD patients and the liver of NASH mice through research, and the expression quantity of the CHCHHD 2 has a remarkable increasing trend along with the aggravation of hepatic fibrosis. Then, a CHCHHD 2 knockout mouse model is further constructed to find that the CHCHHD 2 knockout can improve the hepatic fibrosis related to NASH and the hepatic fibrosis caused by hepatic injury. And further, by constructing an adeno-associated virus over-expressing CHCHD2, the liver fibrosis is promoted by specifically over-expressing CHCHD2 in the liver. Finally, in order to research the mechanism of CHCHD2 over-expression promoting hepatic fibrosis, it is found that the up-regulation of CHCHD2 expression can promote hepatic fibrosis by promoting the secretion of osteopontin by hepatocytes. The invention has important significance for the pathogenesis and treatment of non-alcoholic steatohepatitis or hepatic fibrosis.

Drawings

FIG. 1 is a graph showing the expression level of CHCHHD 2 in the liver of NAFLD patients. A. H & E staining and Masson staining of NAFLD patients and healthy control livers; B. chchchhd 2 immunohistochemical staining of NAFLD patients and healthy control liver tissue sections; C-D, cumulative optical density in FIG. 1B to reflect protein expression levels of CHCHD 2: comparing the expression level (C) of CHCHHD 2 in healthy controls and NAFLD patients; the expression levels (D) of CHCHHD 2 in livers with different degrees of fibrosis were compared. S: grade of liver fibrosis; p < 0.05.

FIG. 2 is a graph of MCD/HFD induced expression levels of CHCHCHD 2 in the liver of NASH mice. A. H & E staining of liver and chchchhd 2 immunohistochemical staining; B-C and western blot are used for detecting the expression level of CHCHCHD 2 in the liver; D. qPCR detects the mRNA expression level of chchchd 2 in the liver; E-F and western blot are used for detecting the expression level of CHCHHD 2 in the hepatic nucleoprotein and the cytoplasmic protein; G-H and western blot were used to detect the expression level of CHCHCHD 2 in liver mitochondrial proteins. A-D: n is 4; E-H, n ═ 3; p < 0.05.

FIG. 3 is a graph of the expression level of CHCHHD 2 in the liver of FPC-induced NASH mice. Wild type C57BL/6 male mice were fed with FPC or ND diet for 24 weeks, and western blots were used to detect the expression level of CHCHCHD 2 in the liver. n is 4-5, P < 0.05.

FIG. 4 is a CHCHHD 2 knockout mouse. A. Detecting the protein expression level of CHCHHD 2 in the livers of a CHCHHD 2 knockout mouse and a control wild type mouse by using western blot; B. h & E staining of liver; C. body weight; D. liver, inguinal fat and epididymal adipose tissue weight. A-B: n is 3; c: n is 10-16; d: n is 3-5, P < 0.05.

FIG. 5 is a graph of the effect of CHCHHD 2 knockout on MCD/HFD diet-induced NASH mouse liver lipid deposition, inflammation, and fibrosis. Chchchhd 2 knockout mice and wild-type control mice were fed an MCD/HFD diet for 4 weeks: A. western blot to detect the expression level of chchchhd 2 in the liver; B. plasma ALT and AST levels; C. liver oil red O staining, H & E staining, F4/80 immunohistochemical staining; D. liver cholesterol and triglyceride levels; E. liver sirius red staining; F. qPCR measures mRNA expression levels of Des, Col1a1, Col3a1, TIMP1 and CTGF in the liver. n is 7-8, P < 0.05.

FIG. 6 shows western blot analysis of the expression levels of flag in liver, epididymal fat, inguinal fat and pancreatic tissue.

FIG. 7 is a graph of the effect of hepatocyte-specific overexpression of CHCHCHD 2 on liver. Wild type mice were given AAV-CHCHD2 and AAV-Ctrl tail intravenous injections, followed by normal diet for 4 weeks 10 days after AAV injection: A. western blot to detect the expression level of chchchhd 2 in the liver; B. plasma ALT and AST levels; C. mouse weight and liver weight; D. liver oil red O staining, H & E staining, F4/80 immunohistochemical staining; E. liver sirius red staining; F. qPCR measures mRNA expression levels of Col1a1, Col3a1, TIMP1 and CTGF in the liver. n-12-13, P < 0.05.

FIG. 8 is a graph of the effect of hepatocyte-specific overexpression of CHCHCHD 2 on MCD/HFD diet-induced NASH mouse liver lipid deposition, inflammation and fibrosis. Wild type mice were given AAV-CHCHD2 and AAV-Ctrl tail intravenous injections, and after 10 days of AAV injection MCD/HFD diet was continued for 4 weeks: A. western blot to detect the expression level of chchchhd 2 in the liver; B. plasma ALT and AST levels; C. mouse weight and liver weight; D. liver oil red O staining, H & E staining, F4/80 immunohistochemical staining; E. liver sirius red staining; F. qPCR measures mRNA expression levels of Col1a1, Col3a1, TIMP1 and CTGF in the liver. n-12-13, P < 0.05.

FIG. 9 is a graph of the effect of CHCHHD 2 knockdown on TAA-induced liver fibrosis in mice. A. Injecting TAA or physiological saline into abdominal cavity of wild C57BL/6 male mouse, and detecting protein expression level of CHCHD2 in liver by western blot; B-C, CHCHD2 knockout and control mice were injected intraperitoneally with TAA: liver sections were stained with sirius red; C. qPCR measures mRNA expression levels of fibrotic markers. A: n is 7-8; B-C: n is 6-7, P < 0.05.

FIG. 10 shows that CHCHHD 2 can up-regulate Osteopontin (OPN) expression level. A. Using adenovirus to overexpress CHCHCHHD 2 in primary hepatocytes of a mouse, and detecting the protein expression level of Osteopontin (OPN) in western blot after 48 hours; B. wild type mice were given AAV-CHCHD2 and AAV-Ctrl tail intravenous injections, and were fed on a normal diet for 4 weeks after AAV injection 10 days, and western blot was used to detect protein expression levels of Osteopontin (OPN) in the liver. A: n is 5; b: n-12-13, P < 0.05.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 CHCHCHD 2 was highly expressed in the liver of NAFLD patients and in the liver of NASH mice

Firstly, CHCHD2 is highly expressed in liver of NAFLD patient, and its expression level is increased with the liver fibrosis degree

1. Test materials and methods

42 liver tissue samples were collected from Beijing Ditan Hospital affiliated to the university of capital medical science, and then clinical diagnosis was performed by a clinician, and pathological diagnosis was independently performed by 2 pathologists. All the above specimens clearly exclude viral hepatitis, drug-induced liver disease, alcoholic liver disease, autoimmune liver disease, cholestatic liver disease and hereditary metabolic liver disease. The hepatic histology score of a patient diagnosed with NAFLD specifically comprises 4 aspects of 0-3 steatosis score, 0-3 lobular inflammation score, 0-2 balloon sample change score, 0-4 hepatic fibrosis score and the like according to the NASH-CRN system. Each liver tissue sample was sectioned at 5 μm thickness, and then hematoxylin/eosin (H & E) stained and Masson stained, and subjected to chchhd 2 immunohistochemical analysis. A total of 38 NAFLD/NASH patients and 4 healthy human liver tissue specimens were collected from this study. Samples were divided into 4 groups, namely, Healthy Control (HC) group, NAFLD S0 group, NAFLD S1-2 group and NAFLD S3-4 group, according to the fibrosis grade (S) in the NASH-CRN system. Of the 38 patients, 12 male (32%) and 26 female (68%) had an average age of 45.5 years (28-70 years).

2. Test results

The results of H & E and Masson staining showed a significant increase in collagen deposition, ballooning degeneration and inflammatory cell infiltration in liver tissues from NAFLD/NASH patients, while similar behavior was not seen in liver tissues from HC (FIG. 1A).

The results of immunohistochemical analysis showed that CHCHHD 2 was expressed at a low level in HC group, but was expressed at an elevated level in liver tissues of NAFLD/NASH patients, and its expression level tended to increase significantly as the degree of liver fibrosis increased (FIGS. 1B-D). Data analysis shows that there are significant statistical differences between NAFLD S3-4 and HC, S0, S3-4. The above results suggest that the expression of chchchhd 2 may be involved in the development and progression of liver fibrosis in NAFLD.

Secondly, CHCHHD 2 is highly expressed in the liver of NASH mice

1. Test materials and methods

Wild type C57BL/6 male mice were used as test material, and NASH was induced by feeding mice with MCD diet in combination with high fat diet (MCD/HFD) for 4 weeks according to the method in "Hepatocyte-specific IL11cis-signaling driver lipoxygenase and underfiles the transition from NAFLD to NASH (DOI:10.1038/s 41467-020-20303-z)", to obtain MCD/HFD-induced NASH mouse model.

Wild type C57BL/6 male mice were used as test materials, and NASH-induced NASH mouse model was obtained by feeding mice with a high fructose, high palmitic acid, high cholesterol (FPC) diet for 24 weeks, according to the method described in "Hepatocyte TAZ/WWTR1 proteins Inflammation and Fibrosis in Nonalcoholic stephotatitis (DOI:10.1016/j. cmet.2016.09.016)".

The expression level of CHCHHD 2 in liver and hepatic nucleoprotein, cytoplasmic protein and mitochondrial protein of the NASH mouse model is detected. Wild type mice on a Normal Diet (ND) for 4 weeks were also fed as a normal control group.

2. Test results

Total protein levels of chchchhd 2 were significantly increased in NASH mouse livers compared to normal controls (fig. 2A-C), but mRNA levels were unchanged (fig. 2D). Since chchchhd 2 is a mitochondrion and nucleus dual localization protein. Nuclear and cytoplasmic proteins of the liver were isolated and increased expression of chchchhd 2 was found (fig. 2E-F); further extraction of mitochondrial proteins in the liver revealed a significant increase in chchchhd 2 expression in mitochondria (fig. 2G-H). Upregulation of protein expression of chchchhd 2 was also found in the liver of NASH mice fed a high fructose high palmitic acid high cholesterol (FPC) diet for 24 weeks (fig. 3).

The above studies showed that chchchhd 2 protein expression was increased in the liver of NASH mice.

Example 2 knockdown of CHCHHD 2 ameliorates NASH-associated liver fibrosis

Construction of CHCHHD 2 knockout mice

To investigate the role of chchchhd 2 in NASH, chchhd 2 knockout mice were constructed. The method comprises the following specific steps:

1. construction of T7 Chchd2 sgRNA expression plasmid

According to the base sequences of the first exon to the third exon of the CHCHCHD 2 gene, sgRNA (single guide RNA) aiming at the CHCHHD 2 gene is designed, and a sgRNA expression plasmid is constructed. The method comprises the following specific steps:

1) design of sgRNA

Sgrnas were selected according to off-target probability and cleavage efficiency. Designing 2 sgrnas in the first coding region, preferentially using sgrnas with higher off-target scores and cleavage efficiency scores, and respectively naming the sgrnas as usgRNA1 and usgRNA 2; 2 sgrnas were designed in the third intron, with sgrnas with higher off-target scores and cleavage efficiency scores being preferentially used, and named dsgRNA1 and dsgRNA2, respectively. sgRNA sequence information is shown in table 1.

TABLE 1 sequence information of sgRNA

sgRNA name	Sequence (5 '-3')
		Chchd2 usgRNA1	ACCTGGCCGGAGGAGTCACCCGG
Chchd2 usgRNA2	CGAGGGTCTCACCTGGCCGGAGG
		Chchd2 dsgRNA1	CACTACAGCATGAGGGCCTAAGG
Chchd2 dsgRNA2	GGGAGGGCGGTGAGGTATTTAGG

2) Design of primers

The designed primer sequences are shown in Table 2. Wherein, the upstream primer comprises the following components in sequence from 5 'to 3': t7 RNA polymerase promoter, sgRNA sequence, and sequence that binds to sgRNA vector template.

TABLE 2 primer sequences for PCR amplification of sgRNA

3) Annealing

Synthesizing the primer sequences designed in the step 2), diluting the upstream primer sequences and the downstream primer sequences to the concentration of 100 mu mol/L respectively, and performing programmed annealing according to the following systems respectively: t7 sgRNA F (100. mu. mol/L) 10. mu. L, T7 sgRNA R (100. mu. mol/L) 10. mu. L, NEB digested buffer 25. mu.L and water 25. mu.L, to obtain annealing products, respectively.

4) Enzyme digestion plasmid vector

The T7 sgRNA plasmid vector (described in "genome engineering using the crimpr-cas 9 system") was digested with BsaI endonuclease at 37 ℃ and then recovered with a DNA purification recovery kit, and the resulting product was eluted with water and diluted to 100 ng/. mu.L to obtain a digested T7 sgRNA vector.

5) Connection of

To 0.5. mu.L of the digested T7 sgRNA vector (100 ng/. mu.L) obtained in step 4), 1. mu.L of the annealed product obtained in step 3), 1. mu. L T4 DNA Ligase, 1. mu. L T4 DNA Ligase Buffer (10X), and 6.5. mu.L of water were added, and ligated at 16 ℃ for 3 hours, respectively, to obtain ligated products.

6) Sequencing identification

Transforming and plating the ligation product obtained in the step 5), culturing at 37 ℃ for 10-12 hours, picking single colonies, sequencing by using M13F-47, and picking 2 single colonies on each bacterial plate. And (3) comparing the sequencing result with the designed sequence, and extracting the sequence if the connection is correct to obtain T7 Chchd2 sgRNA expression plasmids respectively.

2. Preparation of sgRNA and Cas9 mRNA

Respectively taking the T7 Chchd2 sgRNA expression plasmid prepared in the step 1 as a template, and carrying out in vitro transcription by using T7 RNA polymerase to obtain sgRNAs, wherein the total number of the sgRNAs is as follows: usgRNA1, usgRNA2, dsgRNA1, and dsgRNA 2.

Cas9 mRNA was obtained by in vitro transcription with T7 RNA polymerase using Cas9 plasmid vector (described in "genome engineering using the crispr-Cas9 system" as a template).

3. Microinjection

Referring to the method in the manual of experiments on embryo manipulation of mice (third edition), Cas9 mRNA, usgRNA1 and dsgRNA2 (the mass ratio of Cas9 mRNA, usgRNA1 and dsgRNA2 is 2:1:1) were microinjected into fertilized eggs of wild type C57BL/6 mice, then embryo transplantation was carried out, and 20 days after transplantation, mice were born to obtain F₀Mouse generation.

4. Establishment of CHCHHD 2 knockout mouse strain

1)F₀Genotype identification of surrogate mice

Sequencing assay F₀F is obtained by substituting the mutation condition of the mouse CHCHHD 2 gene₀Generation CHCHCHD 2 +/-mice (heterozygous).

2)F₁Acquisition of mouse

F is to be₀Mating the generation CHCHCHD 2 +/-male mouse and the wild type C57BL/6 female mouse to obtain F₁Generation of CHCHHD 2 +/-mice (heterozygous), and sequencing of their CHCHHD 2 gene.

F compared to wild type C57BL/6 mice₁The CHCHCHD 2 gene on one of two homologous chromosomes of a generation CHCHCHD 2 +/-mouse is subjected to fragment insertion with the size of 14bp and fragment deletion with the size of 5271bp, the position of the fragment insertion is between 253 rd position and 254 th position of the sequence 3, and the inserted fragment sequence is specifically as follows: TGAGGTATTTAGGA, respectively; the deletion fragment is located at position 254-5524 of the sequence 2.

3) Acquisition and identification of CHCHHD 2 knockout mice

Chchchhd 2 +/-female and chchchhd 2 +/-male mice were mated to obtain littermates of wild type mice and chchhd 2 knockout mice (homozygous).

western blot detects the expression level of chchchhd 2 protein in the livers of chchchhd 2 knockout mice and wild-type control mice, and detects the histological morphology of the livers, body weight, liver, epididymal fat and inguinal fat tissue weight of chchhd 2 knockout mice and wild-type control mice.

The results show that: the chchchhd 2 gene was successfully knocked out in chchchhd 2 knock-out mice (fig. 4A). The chchchhd 2 knockout had no effect on mouse liver histology morphology (fig. 4B) and mouse body weight, liver weight, epididymal fat and inguinal fat weight (fig. 4C-D), and the chhd 2 knockout mouse was normal in mental status.

Second, the effect of CHCHHD 2 knock-out on MCD/HFD diet-induced liver lipid deposition, inflammation and fibrosis

Wild type control mice and chchchhd 2 knockout mice at 10 weeks of age were fed MCD/HFD diet for 4 weeks to induce NASH, and the effect of chchhd 2 knockout on MCD/HFD diet-induced liver lipid deposition, inflammation and fibrosis was examined and analyzed.

The results show that: the chchchhd 2 knockout of chchchhd 2 gene was successfully knocked out in NASH mice (fig. 5A). Chchchhd 2 knockdown had no effect on plasma ALT, AST levels compared to control mice (fig. 5B); it also has no obvious effect on liver lipid deposition and inflammation (FIG. 5C-D). But sirius red staining showed improved liver fibrosis (fig. 5E). Liver fibrosis the expression levels of multiple markers were significantly down-regulated, including Des, Col1a1, Col3a1, TIMP1 (fig. 5F).

The above results show that: the CHCHCHD 2 knockout improves hepatic fibrosis due to NASH.

Example 3 hepatocyte-specific overexpression of CHCHCHD 2 promotes liver fibrosis

Construction of mice overexpressing CHCHCHD 2

1. Construction of adeno-associated virus overexpressing CHCHCHD 2

The construction of the adeno-associated virus with TBG promoter over-expression CHCHHD 2 (with flag tag) comprises the following specific steps: the CHCHCHD 2 gene fragment (NM-016139.4) shown in the sequence 4 is cloned into a GV625 vector (Shanghai Jikai Gene medicine science and technology, Inc., with the product number of AAV8CON308 and the sequence of main elements in the vector as follows: TBGp-MCS-3Flag-SV40 PolyA) to obtain a recombinant expression vector GV 625-CHCHHD 2. Then the recombinant expression vector GV625-CHCHD2, a pHelper vector (Shanghai Jikai gene medicine science and technology Co., Ltd.) and a pAAV-RC vector (Shanghai Jikai gene medicine science and technology Co., Ltd.) are transfected into AAV-293 cells for packaging, and then the virus is harvested, centrifuged and ultrafiltered for purification to obtain the over-expressed CHCHCHD 2 adeno-associated virus (AAV-CHCHD2, AAV-D2 for short).

The negative control virus (AAV-Ctrl) was obtained by replacing the recombinant expression vector GV 625-CHCHHD 2 with the empty vector GV625 as described above.

2. Injection mouse

The adeno-associated virus constructed in step 1 was administered at 1.0X 10 per mouse¹¹v.g doses were injected via the tail vein. The expression level of exogenous chchhd 2 was shown by measuring flag expression levels in liver, pancreas, epididymal fat, and inguinal adipose tissue 2 weeks after injection.

The results show that: only liver overexpresses chchchchhd 2 (fig. 6).

Second, the effect of over-expression of CHCHHD 2 on MCD/HFD diet-induced NASH mouse liver lipid deposition, inflammation and fibrosis

Wild type C57BL/6 mice were injected with AAV-CHCHD2 and AAV-Ctrl at 1.0X 10¹¹v.g dose per mouse was administered by tail vein injection, starting with normal diet or MCD/HFD diet 10 days after virus injection for 4 weeks, tested and administeredThe effect of chchchhd 2 overexpression on MCD/HFD diet-induced liver lipid deposition, inflammation and fibrosis was analyzed.

The results show that: plasma ALT, AST levels, body weight, liver lipid content, and macrophage infiltration were unchanged under normal dietary feeding (fig. 7A-D). Sirius red staining, however, showed that chchhd 2 overexpression increased collagen deposition in the liver (fig. 7E) and that the liver fibrosis markers Col3a1 and TIMP1 expression were significantly increased (fig. 7F), indicating that chhd 2 overexpression could lead to increased liver collagen deposition on a normal diet.

CHCHCHD 2 was also overexpressed on plasma ALT, AST levels in MCD/HFD-fed mice (FIGS. 8A-B); body weight, liver weight (fig. 8C); liver lipid deposition and macrophage infiltration were not significantly affected (fig. 8D). Sirius red staining, however, showed significant exacerbation of liver fibrosis (fig. 8E), and also increased expression of the liver fibrosis markers Col3a1, TIMP1, Col1a1, and CTGF (fig. 8F).

The above studies indicate that increased chchchhd 2 expression can lead to increased liver collagen deposition in normal diet-fed mice and that increased chchhd 2 expression at the time of NASH development can promote liver fibrosis.

Example 4, chchchhd 2 knock-out significantly improved thioacetamide-induced liver fibrosis

First, the effect of TAA induced liver fibrosis on the CHCHHD 2 protein expression level in mouse liver

A wild type C57BL/6 male mouse is used as a test material, and a mouse model of hepatic Fibrosis caused by hepatic injury caused by chemical factors is constructed by using a method of intraperitoneal injection of Thioacetamide (TAA) according to a method in a document of Tissue Transglutaminase Does Not Affect fibrous Matrix Stability or Regression of Liver Fibrosis in Mice (DOI:10.1053/j. gastro.2011.01.040). And the control was saline injection. western blot detects protein expression levels of chchchhd 2 in the livers of TAA mouse models and control mice.

The results show that: the expression level of chchchhd 2 protein in the liver of the TAA mouse model was significantly increased compared to the control mice (fig. 9A).

Second, the Effect of CHCHHD 2 knock-out on TAA-induced liver fibrosis

Wild type C57BL/6 male Mice and CHCHHD 2 knockout Mice are used as test materials, and a mouse model of hepatic Fibrosis caused by hepatic injury caused by chemical factors is constructed by using Thioacetamide (TAA) for intraperitoneal injection according to a method in a document of Tissue Transglutaminase Does Not Affect fibrous Matrix Stability or Regression of Liver Fibrosis in Mice (DOI:10.1053/j. gastro.2011.01.040). The effect of chchchhd 2 knockdown on TAA-induced liver fibrosis was detected and analyzed.

The results show that: after 7 weeks of i.p. injection of TAA, chchhd 2 knockout mice significantly improved TAA-induced liver fibrosis compared to control mice (fig. 9B). Markers of liver fibrosis Des, Col1a1, Col3a1, TIMP1 and TGF β were reduced in expression level (fig. 9C).

The above results show that: the chchchhd 2 knockout improves liver fibrosis due to liver injury.

Example 5 CHCHCHD 2 increased Osteopontin (OPN) expression in hepatocytes

Increased OPN secretion in hepatocytes activates hepatic stellate cells by paracrine means, which is a key link in the development of liver fibrosis, and the literature, "Hepatocyte Notch activation indels liver fibrosis in nonalcoholic stephanitis" (doi: 10.1126/reticulum. aat0344.) shows: increased OPN expression in hepatocytes can promote liver fibrosis. To investigate the mechanism by which chchchhd 2 overexpression promotes liver fibrosis, OPN expression levels were examined in primary hepatocytes overexpressing chchchhd 2 and in the livers of mice overexpressing chchchhd 2, respectively. The method comprises the following specific steps:

first, OPN expression levels in primary hepatocytes overexpressing CHCHHD 2

1. Construction of an adenovirus overexpressing CHCHCHD 2

The method comprises the following specific steps:

the fragment of CHCHCHD 2 gene (NM-016139.4) shown in sequence 4 was cloned into the GV138 vector (Shanghai Jikai Gene medicine science and technology, Inc.), the sequence of the main elements in the vector was as follows: CMV-MCS-3FLAG, and recombinant expression plasmid GV138-CHCHD2 is obtained. The recombinant expression plasmid and adenovirus packaging helper Plasmid (PBHG) (Shanghai Jikai Gen. science and technology Co., Ltd.) were co-transfected into HEK293 cells for packaging. The adenovirus was then amplified and purified to give an over-expressed chchchhd 2 adenovirus.

2. Preparation of CHCHCHD 2-overexpressing Primary hepatocytes

1) The primary mouse hepatocytes were prepared by collagenase perfusion. The method comprises the following specific steps: anesthetizing male mice of 5-6 weeks old, sequentially administering heparin sodium, perfusion solution I (Kreb solution +0.1mM EGTA), and perfusion solution II (Kreb solution +2.74mM CaCl) via inferior vena cava₂+ 0.05% collagenase i) was perfused into the liver, the perfused liver was washed with pre-cooled 1640 medium with a filter mesh (38 microns in diameter), hepatocytes were collected and cultured in 1640 medium containing 10% serum.

2) After 4-6 hours, the solution was changed and chchhd 2 adenovirus with a multiplicity of infection of 10 was added to infect the primary hepatocytes prepared in step 1). After 6 hours the virus-containing medium was replaced and after 42 hours the expression level of OPN protein in primary hepatocytes overexpressing chchchhd 2 was measured using a western blot. Negative control virus (AAV-Ctrl) was also used as a control.

The results show that: OPN protein expression levels were significantly increased in primary hepatocytes overexpressing chchchhd 2 compared to controls (fig. 10A).

II, OPN expression level in liver of mice over-expressing CHCHHD 2

Construction of mice overexpressing chchchchhd 2 reference step one of example 3. western blot the OPN protein expression level in the liver of mice overexpressing chchchchhd 2 was measured. Mice injected with negative control virus (AAV-Ctrl) in tail vein were used as controls.

The results show that: OPN expression levels were also significantly increased in the liver of mice overexpressing chchchhd 2 compared to controls (fig. 10B).

The above results show that: up-regulation of chchchhd 2 expression may promote liver fibrosis by promoting the secretion of OPN by hepatocytes.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> Yangdu medical university affiliated to Beijing Di Tan Hospital Tianjin medical university

<120> application of substance inhibiting CHCHCHD 2 activity in preparation of product for treating NASH and hepatic fibrosis caused by hepatic injury

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 151

<212> PRT

<213> Artificial Sequence

<400> 1

Met Pro Arg Gly Ser Arg Ser Arg Thr Ser Arg Met Ala Pro Pro Ala

1 5 10 15

Ser Arg Ala Pro Gln Met Arg Ala Ala Pro Arg Pro Ala Pro Val Ala

20 25 30

Gln Pro Pro Ala Ala Ala Pro Pro Ser Ala Val Gly Ser Ser Ala Ala

35 40 45

Ala Pro Arg Gln Pro Gly Leu Met Ala Gln Met Ala Thr Thr Ala Ala

50 55 60

Gly Val Ala Val Gly Ser Ala Val Gly His Thr Leu Gly His Ala Ile

65 70 75 80

Thr Gly Gly Phe Ser Gly Gly Ser Asn Ala Glu Pro Ala Arg Pro Asp

85 90 95

Ile Thr Tyr Gln Glu Pro Gln Gly Thr Gln Pro Ala Gln Gln Gln Gln

100 105 110

Pro Cys Leu Tyr Glu Ile Lys Gln Phe Leu Glu Cys Ala Gln Asn Gln

115 120 125

Gly Asp Ile Lys Leu Cys Glu Gly Phe Asn Glu Val Leu Lys Gln Cys

130 135 140

Arg Leu Ala Asn Gly Leu Ala

145 150

<210> 2

<211> 153

<212> PRT

<213> Artificial Sequence

<400> 2

Met Pro Arg Gly Ser Arg Ser Arg Thr Ser Arg Val Thr Pro Pro Ala

1 5 10 15

Ser Arg Ala Pro Gln Met Arg Ala Ala Pro Arg Arg Ala Pro Ala Ala

20 25 30

Gln Pro Pro Ala Ala Ala Ala Pro Ser Ala Val Gly Ser Pro Ala Ala

35 40 45

Ala Pro Arg Gln Pro Gly Leu Met Ala Gln Met Ala Thr Thr Ala Ala

50 55 60

Gly Val Ala Val Gly Ser Ala Val Gly His Thr Leu Gly His Ala Ile

65 70 75 80

Thr Gly Gly Phe Ser Gly Gly Gly Ser Ala Glu Pro Ala Lys Pro Asp

85 90 95

Ile Thr Tyr Gln Glu Pro Gln Gly Ala Gln Leu Gln Asn Gln Gln Ser

100 105 110

Phe Gly Pro Cys Ser Leu Glu Ile Lys Gln Phe Leu Glu Cys Ala Gln

115 120 125

Asn Gln Ser Asp Val Lys Leu Cys Glu Gly Phe Asn Glu Val Leu Arg

130 135 140

Gln Cys Arg Ile Ala Asn Gly Leu Met

145 150

<210> 3

<211> 6310

<212> DNA

<213> Artificial Sequence

<400> 3

aacttcgtaa cttccgggcc taggacgctg agtccaggct ctgcccatta ctgatatctc 60

ctttgtccaa taacctttag cgcccgagct tttcctgatt tcttattggt tgcccggtga 120

ggtaccgcct ccacccttcc tctctccttg gtagaaattg ctggacgctt ctgtacgttt 180

cgcagtttgt cttcgctgat cggtgagact tcgagcagtt aggatgccgc gtggaagccg 240

aagccgcact tcccgggtga ctcctccggc caggtgagac cctcggggcc gggaaccgag 300

cgcgggccgc cagggcaagg ttctgtagcc tgagggctgc gaaggcgacc ggtgaagaga 360

cggagcgagc ggtcgggaag ggatccgctg gtggggcgga cttcctgaga acagggacat 420

ggtcggtgca ctcggggaga ggactctgaa acgtgacctt ttccctagac aggctggggg 480

aagggctgtc gagggcgtag tatacaagga ggcgaggaaa gaaagatgcg tggtaaactc 540

ttggccaggg gtgggggtgg ggtggttttt gtattttctt tgttctactc actgcgtttt 600

tgagtctcag gttagccttg aactttatgg cctcgcttgg ccttccttga ttttcctgac 660

tccgcttcct tagggctggg attgccggct ttaaagattt tcttttcttt tatttattta 720

tttttttaag gaaaaagaaa caaagaaaat tgcgggctgt gtgtagaggg ccgaaaattt 780

aaagctatgt ctttccatca cttgggtcca agatgtctac cattttgtgg taaacgatct 840

attgagctac cttgccggcc gacctaaaaa acaaatagga aattgttgac acccctcccc 900

ccagtccaga ttctgaggtc cctccttggg gtaataaaat cgtagaaaac taaaattgtg 960

ctcatactgg gagtgaacct cgggagtgca tgttgtagcg catgcgtcat ctgtcatcaa 1020

gatagtccct tgtgcctcct tctcccggaa ggcaagcggg ggttgcaacc agttcaaggc 1080

tagcaaggct acccatagag agattcctgt ccagaacccc cccaaaaata tgagtcaaag 1140

ttgcagctca ggcaggtcac tttccctaga tttttctttt tggattggcg tggtggtttg 1200

ttgtttcctt gaaaggggtt ttcactatgg ccctggctgg ccttgaactc caaagaggct 1260

gcccgcctct gcctcccaag gactgggatt aaaggtatgg gctaccagac cttgcccacg 1320

gcaccctaac ccggccccca cttttttttt tttttttaag attttttttt tcttagttta 1380

ttttatgggc tggcgagatg gctcagcagg taagagcact gactgttctt tggaaggtcc 1440

tgagttcaag tcctggcaat cacatggtgg ctcacaacca tctgtaatga ggtcagatgc 1500

cctcttctgg ggtgtctgaa gacagctaca gtgtacttat gtataaaata aatctttaaa 1560

aatttttatt ttatgtatat gaggagtaca caggtggttg tgagccacca tgtggttgct 1620

gggaattgaa ctcaggacct ttagaagagc agtctgtgct cttaactcct gagccatctc 1680

tccagcccaa acctttcttg atttatttat ttatttttga ggcaggattt ttctgtgcag 1740

ctctggctgt cctggaactc actctgtaga ccaggctggc ctcgaactca gaaatccgcc 1800

tgcctctgcc tcccaagtgc tggttaagtt cagccctttc taactgggta aaatgaaggc 1860

attggactgc attcctaata tcacctcatg acttttagat tttgttgact tgtgactgtc 1920

tttctccatt gtcaacactg gttctaaatc cttcttctaa atggccttgt tcactaactg 1980

aatagccggg atggccagtg tatttatgcc tctgtgtgtg ctggagaacc tcggtacctg 2040

tgtgaaggtc caagggcacc ttattggggt tggttgtttc tttccacctt ctgggttcca 2100

ggagtcaacc aacctcaagg tgtcaagcat ccttctccag tgagtctttg accagccgcc 2160

tgtcctcctt ccagctctaa atcttaattc agatgttcac taggttagtc cttgactgtc 2220

ctcaattttt ttttacatgg caacacctgt ctgatatttc tgaaactgat agaccaataa 2280

aaggaaagct gtttgctcat tctgtttttg tttttttttt ttgaaacagg gtttctctgt 2340

gtagccctgg ctgtcctgga actcactctg tagaccaggc tggccttgac tcagaaatcc 2400

gcctgcctct gcctcccaag tgtttgctca ttctatagct tctaatgcct cggagctcag 2460

agaggtccaa ctgtcattta aataaatcaa tcctttgggg aactttctaa ctttaattgt 2520

ccatgagtgg acatatgcaa atgaatgggc actagagcct tggaaactca gaggggtcag 2580

atgacctggc cctgagtttc cacgttactg cttcctgagt gtgcactacc acgcctaact 2640

gtatgacagc attgctcacc attttgagac aagggtattg attgttaggt tggccttaaa 2700

aatcactgta tagagcaagg atgagagtag atatgccaaa ctgtactgtg ctgtacagtg 2760

aaaagtccac agacctcagc cttacataaa gaatacagca acttgggctg gagagatgac 2820

tcagaggtta ggagcactgc tcttccagag gtcctgagtt caaatcccag caaccacatg 2880

gggactcaca accatctcta atgagatctg atgccctctt ctgttgtgtg tgaagacagc 2940

tacaatgtac tcacatagat gaaatgaata aataaataaa tattaaaaaa gaatacagca 3000

actaattcgg aagcaggagc acaccaagcg gtcagcaatg tacagaaatg tgtgtgtgcc 3060

cacaggtatg catctaataa agatgatgaa aaaggaggct atcagtttga aaatagatca 3120

aggaagggta tttgggagag ggttaaagta gaaataagtc actgtatggt gaagatggcc 3180

cagatctggt ttttctacct atgtgcctct gaacctggcc catttggtct cttgagtaga 3240

ttgcaaagcc atttgtctgg gacctgagga gttttgttct tttccagccg ggcccctcag 3300

atgagggctg ctccccgaag agcacctgca gctcagcctc cagcagcagc tgcgccatct 3360

gcagttggct cacctgccgc tgcgccccgg cagccaggcc tgatggccca gatggctacc 3420

accgcggccg gtgtggctgt gggctctgca gtgggacaca ccctgggtca cgccatcact 3480

gggggcttca gcggaggtgg cagtgctgag cccgcaaagc ccgacatcac ttaccaggtg 3540

agctttgggg cagcttctcc tttctgagat gagttggcag ctggcgagca tcttttatga 3600

ataagcattt actctgatac catgaggacc tgagttcaaa tcctatgagc ccacaaaaaa 3660

atcaggcata gccatacata actgtaacca catgcattgt ggggtggaga caggcagttt 3720

ccacagcagg gccagccggc ctgctgagat gaaattagtt tctggttcag tgagaggttc 3780

tgtctccagg aaataaaaga gagtggttga gggtatgttt ggtctatctc cccttgggca 3840

catctgtcca cacactcatg ggagcatcac acacaaagcc acatagagtg gtccgagtta 3900

caacaggagt tcagcctagg ttactgtaca acagccgttt tccctttagg tgatgcttgt 3960

ttttgagagc atatcactca aattagcctt gaactggcaa gcctcctgcc ttggctttaa 4020

gtacttatct tggccacact tttactgttg cttttgaaga caaagtcttc actgtgtgac 4080

ccaaactgac ttctaacttg taacagtctt cttggcctct caagtgctgg tgtcacaggc 4140

agagccctga gccctgaggc ctggcctttg aagtcagcct tccttacaca atcagtccct 4200

tttggggctt tatgacccct tacctagttt ttttgttgtt gttgttgttt ttgtttatat 4260

gtttttttac tatttctttg tctggggtag atgtattttc taaggagcat gtatttctgg 4320

tatgtctgaa attctcatcc atctctttcc catgatccag ttttccttat gaatgcttca 4380

atatacatac atacatatat ataaaataca catatatatc cacatatata tacacaccaa 4440

tatacatata taaacatata tgtatacata tatatataaa atacacacat gctcacgtga 4500

cagtgtgtgg gtgtgttgtg ctgggatcaa acctcaaacc cggggcaaag aatacagtct 4560

tactgtggag tccctagccc gtttttaaag ttttggtctt aatgtttaca atggtaaggc 4620

ccagcccaga gccttgagtg tactgagcaa ggtcttcata gaaccttggc tcccatttac 4680

gctccagatg atgtgattcg gtgtttgttg cttttggttc tgagttggcg aggacatctt 4740

tgttctttac atcgttttca ctgccatgtt cctggctggc actaaacttg cacctttctc 4800

cagttgttcc ccagctccca gtgtgtgagc gctgcccttg ggtggtgccc tgtgctttct 4860

catctcaaca caagatgctg tgtctttgca ggagcctcag ggagcccagc tgcagaacca 4920

gcagtctttt ggaccttgct ctctagagat caagcagttt ctggagtgtg ctcagaacca 4980

gagcgatgtc aagctctgtg agggcttcaa cgaggtgctg cggcagtgca ggattgcaaa 5040

tggtaggcga cttgtccctc tgctcggggt gatggtcctg aaccctattt agttttggag 5100

ttaagtattt acagttcagt gcttgttttt gttttcccag tttcaattag agtactggtt 5160

ctcaacctta ggccctcatg ctgtagtgac ctggaaccat aaagttattt ttgttgcctt 5220

tttttttttt tttttttttt tgagacaggg tttctctgtg tagccctggc tgtcctggaa 5280

ctcactttgt agagcaggct ggtctcgaac tcagaaatcc gcctgcctct gcctcccaag 5340

tgctgggatt aaaggcgtgg gccaccacac tagctttgtt gctattttgt aattataatt 5400

ttgatactgt tatgaactgt agggtaaatg tcttatatgc aggatatctg gtatgtgatt 5460

cctctgaaag gggtggagac cgtcagggtg aaaatagctg agttagatgg gagggcggtg 5520

aggtatttag gaatggaatt aagaggtact tgtcctagcc aggtggaggt catgcacagt 5580

tttaatccac tcaggaaaca agaaaaccct gtctctcaaa aaagctaaag ttcatgaagt 5640

tctctgcctg atagaactga tatcagaccg tcccacaaca gggaagaccc aggcctgagg 5700

ccgatcctca acctgagaac tcccagacag aatgctgtgg acgaactggt ccacgaaata 5760

tctatttcca ggacagggtt gttaggtagg cactacactg ccgtgcccat cgaggaaacc 5820

ctccccttag cttctgacag agggttagta atagaattga gagagacaga gataagatac 5880

ttgtcttaat tcatagcttc ttgttggttt aacatctacc aaattggcta accctctgct 5940

tcgggccgtt gtagacacat gcaccgtgtc ttagttatgg caaagataga atggaggttt 6000

gattggatga accctgaaat ggtggtgttg ggtgtcttct aacttaaact tgtctttttt 6060

ttttttttta ataggtttaa tgtaatcaag aaattcaagc tgaagagatg taacattggt 6120

tctgtataat tgatagtaca agtgtggacc cttatatttc taacagttca ttgctttgga 6180

atggccgtga aagagatcta actgtggatg cttactgagg cttgtatgta gtgttggtta 6240

ctggggaagt gtttggcctc cttggactgt gttgtgattg tgagttaaaa aaaataaatt 6300

ggttattctg 6310

<210> 4

<211> 797

<212> DNA

<213> Artificial Sequence

<400> 4

agaagtcgct tagctcttcg gtggttgtcc cacgtccgga ggcctagccg tcgcttacct 60

aggatgccgc gtggaagccg aagccgcacc tcccgcatgg cccctccggc cagccgggcc 120

cctcagatga gagctgcacc caggccagca ccagtcgctc agccaccagc agcggcaccc 180

ccatctgcag ttggctcttc tgctgctgcg ccccggcagc caggtctgat ggcccagatg 240

gcaaccactg cagctggcgt ggctgtgggc tctgctgtgg ggcacacatt gggtcacgcc 300

attactgggg gcttcagtgg aggaagtaat gctgagcctg cgaggcctga catcacttac 360

caggagcctc agggaaccca gccagcacag cagcagcagc cttgcctcta tgagatcaaa 420

cagtttctgg agtgtgccca gaaccagggt gacatcaagc tctgtgaggg tttcaatgag 480

gtgctgaaac agtgccgact tgcaaacgga ttggcctaat gaagaagttc aacctggaga 540

gatggaaaat cagctctcat aactaagtta atttagtata aaaatagaat tgatagtgag 600

ggtataaagt gtaaccatca gttaaacctc tcctgtcatt cctggcttcc ttgcttcaga 660

attgaaatgg aagtgggggt gtccctactc tgtagaatct gggactgggc aaatgtttgt 720

gtggcctcct taaactagct gttatgttat gattttattc tttgtgagtt aattagaata 780

aagtcatttt cttccaa 797

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 5

acctggccgg aggagtcacc cgg 23

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 6

gggagggcgg tgaggtattt agg 23

Claims

1. Use of a substance inhibiting the activity of chchchhd 2 protein in any one of the following a1) -a 8):

a2) preventing and/or treating non-alcoholic steatohepatitis or liver fibrosis;

a6) improving hepatic fibrosis caused by non-alcoholic steatohepatitis;

a8) improving hepatic fibrosis caused by liver injury.

2. Use of a substance inhibiting the expression of CHCHD2 gene or a substance knocking out CHCHHD 2 gene in any one of the following a1) -a 8):

a2) preventing and/or treating non-alcoholic steatohepatitis or liver fibrosis;

a6) improving hepatic fibrosis caused by non-alcoholic steatohepatitis;

a8) improving hepatic fibrosis caused by liver injury.

3. Use according to claim 1 or 2, characterized in that: the liver fibrosis caused by the liver injury is the liver fibrosis caused by chemical factors.

4. Use according to claim 1 or 2, characterized in that: the inhibition of the progress of the non-alcoholic steatohepatitis to the hepatic fibrosis or the improvement of the hepatic fibrosis caused by the non-alcoholic steatohepatitis is embodied in the reduction of the expression quantity of the fibrosis marker in the organism with the non-alcoholic steatohepatitis or the liver of the organism with the hepatic fibrosis.

5. Use of a substance that enhances or increases the activity of chchchchhd 2 protein in any of b1) -b6) as follows:

b3) preparing a product for promoting liver fibrosis;

b4) promoting liver fibrosis;

b5) preparing a product for increasing the expression level of osteopontin in hepatocytes or promoting the hepatocytes to secrete osteopontin;

b6) increasing the expression level of osteopontin in hepatocytes or promoting the secretion of osteopontin by hepatocytes.

6. Use according to claim 5, characterized in that: the promotion of the progress of the non-alcoholic steatohepatitis to the hepatic fibrosis or the promotion of the liver cell fibrosis is embodied in the improvement of the expression quantity or the collagen deposition quantity of a fibrosis marker in the liver of a human body with the non-alcoholic steatohepatitis.

7. Use according to claim 5, characterized in that: the substance for enhancing or improving the activity of CHCHD2 protein can promote liver fibrosis or non-alcoholic steatohepatitis to progress to liver fibrosis by promoting the secretion of osteopontin by liver cells.

8. A method for constructing an animal model of the progression of non-alcoholic steatohepatitis to hepatic fibrosis comprises the following steps: increasing or increasing CHCHHD 2 protein content and/or activity in an animal, thereby obtaining an animal model of progression of the non-alcoholic steatohepatitis to liver fibrosis.

9. A product contains active ingredients of CHCHD2 protein inhibiting substance or CHCHD2 gene expression inhibiting substance or CHCHD2 gene knock-out substance;

the product has any one of the following functions of c1) -c 4):

c1) preventing and/or treating non-alcoholic steatohepatitis or liver fibrosis;

c3) improving hepatic fibrosis caused by non-alcoholic steatohepatitis;

c4) improving hepatic fibrosis caused by liver injury.

Use of chchchhd 2 as a target in any of the following d1) -d 4):