CN114015636B

CN114015636B - Recombinant acetic acid bacteria and preparation method and application thereof

Info

Publication number: CN114015636B
Application number: CN202111489857.0A
Authority: CN
Inventors: 周雪峰; 何锦荣
Original assignee: Tiandiyihao Beverage Co ltd
Current assignee: Tiandiyihao Beverage Co ltd
Priority date: 2021-12-08
Filing date: 2021-12-08
Publication date: 2023-09-29
Anticipated expiration: 2041-12-08
Also published as: CN114015636A

Abstract

The invention relates to the field of microorganisms, and in particular provides recombinant acetic acid bacteria, a preparation method and application thereof. The recombinant acetic acid bacteria provided by the invention are acetic acid bacteria containing phenylalanine ammonia lyase coding genes, the amino acid sequence of the phenylalanine ammonia lyase is shown as SEQ ID NO.3, and the promoter of the phenylalanine ammonia lyase coding genes is a nucleotide sequence shown as SEQ ID NO. 1. The recombinant acetic acid bacteria not only shortens the slow fermentation period and improves the fermentation rate, but also has important significance in the aspects of reducing energy consumption, improving the quality of vinegar and the like.

Description

Recombinant acetic acid bacteria and preparation method and application thereof

Technical Field

The invention relates to the field of microorganisms, in particular to recombinant acetic acid bacteria and a preparation method and application thereof.

Background

The edible vinegar has main components of acetic acid (acetic acid and glacial acetic acid), is one of seasonings with the largest consumption in the world, and is also one of compounds widely applied in the fields of food, medicine, chemical industry, textile and the like. Acetobacter (Acetic acid bacteria, AAB), also known as Acetobacter, refers to a generic term for a class of gram-negative bacteria that are capable of oxidizing sugars and alcohols to the corresponding organic acids. The main species of acetic acid bacteria known at present include Acetobacter (Acetobacter), gluconobacter (Gluconobacter) and the like, among which Acetobacter and Gluconobacter are widely used for the fermentative production of vinegar due to their strong ability to oxidize ethanol to produce acetic acid. In recent years, the domestic vinegar industry develops rapidly, but the acid resistance of thalli is a key factor restricting the production of high-acidity vinegar, and how to improve the fermentation acidity and improve the acid resistance of thalli is a problem to be solved urgently.

In view of this, the present invention has been made.

Disclosure of Invention

The first object of the present invention is to provide a recombinant acetic acid bacterium.

The second object of the present invention is to provide a method for producing recombinant acetic acid bacteria.

The third object of the invention is to provide an application of recombinant acetic acid bacteria.

The fourth object of the present invention is to provide an acetic acid fermentation method.

In order to achieve the above object of the present invention, the following technical solutions are specifically adopted:

a recombinant acetic acid bacterium, wherein the recombinant acetic acid bacterium is an acetic acid bacterium containing a phenylalanine ammonia lyase encoding gene;

the amino acid sequence of phenylalanine ammonia lyase is shown as SEQ ID NO.3, and the promoter of phenylalanine ammonia lyase coding gene is the nucleotide sequence shown as SEQ ID NO. 1.

Further, the acetic acid bacteria oxidize ethanol to acetic acid.

Further, the acetic acid bacteria include Gluconobacter, acetobacter or Gluconobacter, preferably Acetobacter or Gluconobacter, further preferably Acetobacter aceti or Acetobacter pasteurella, still further preferably Acetobacter pasteurella CGMCC 3089 or Acetobacter pasteurella NBRC 3283.

Further, the nucleotide sequence of the phenylalanine ammonia lyase encoding gene is shown as SEQ ID NO. 2.

Further, the promoter and phenylalanine ammonia lyase encoding genes are introduced into acetic acid bacteria through a recombinant vector;

preferably, the backbone vector of the recombinant vector comprises the plasmid pBBR1p264 (Verena Kallmik, maria Meyer, uwe Deppenmeier, et al construction of expression vectors for protein production in Gluconobacter oxydans. Journal of Biotechnology 150 (2010) 460-465).

The preparation method of the recombinant acetic acid bacteria comprises the step of introducing a recombinant vector containing a promoter and a phenylalanine ammonia lyase coding gene into the acetic acid bacteria to obtain the recombinant acetic acid bacteria.

The application of the recombinant acetic acid bacteria in acetic acid fermentation.

Further, acetic acid fermentation comprises liquid surface standing vinegar fermentation;

preferably, the acetic acid fermented product comprises beverage vinegar or flavouring vinegar.

An acetic acid fermentation method comprises fermenting the recombinant acetic acid bacteria as fermentation bacteria to produce acetic acid.

Further, the fermented raw material includes fruit, sorghum, corn, wheat or potato;

Compared with the prior art, the invention has the beneficial effects that:

the recombinant acetic acid bacteria provided by the invention adopts a promoter of acetic acid tolerance protein GroESL in Acetobacter pastoris as a promoter of phenylalanine ammonia lyase gene pal in rhodotorula mucilaginosa (Rhodotorula glutinis) to realize the expression of phenylalanine ammonia lyase in the acetic acid bacteria. The nucleotide sequence of a promoter of acetic acid tolerance protein GroESL in the recombinant acetic acid bacteria is shown as SEQ ID NO.1, the amino acid sequence of phenylalanine ammonia lyase is shown as SEQ ID NO.3, and the promoter can cooperate with the expression of phenylalanine ammonia lyase, so that the transcription level of the phenylalanine ammonia lyase gene is greatly improved, the energy metabolism and the ammonia metabolism level are effectively enhanced, the intracellular ammonium ion concentration of the strain is increased, the pH change is relieved, and the acid tolerance of the recombinant acetic acid bacteria is improved. Meanwhile, the acetic acid fermentation by the recombinant acetic acid bacteria has the advantages of short slow fermentation period, high fermentation rate and the like, so that the energy consumption is reduced, the production efficiency is improved, and the enterprise benefit is improved. In addition, trans-cinnamic acid generated by deamination reaction of phenylalanine ammonia lyase has good fragrance-preserving effect as a spice, and can improve the flavor of vinegar.

Therefore, the recombinant acetic acid bacteria provided by the invention can be used as zymophyte in the acetic acid fermentation industry, can improve the acidity of the product and can improve the flavor of the product. Such as the production of beverage vinegar and condiment vinegar.

The preparation method of the recombinant acetic acid bacteria provided by the invention realizes the expression of phenylalanine ammonia lyase (SEQ ID NO. 3) with a promoter of SEQ ID NO.1 in the acetic acid bacteria by adopting a genetic engineering means, and the method is simple to operate, good in reproducibility and low in cost in the method of modifying the acetic acid bacteria.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 shows agarose gel electrophoresis of the cleavage products of the plasmid pBBR1-Pgro-pal in example 1, wherein M: a Marker; 1. 2: the plasmid pBBR1-Pgro-pal was digested with EcoR V and Cla I;

FIG. 2 shows the acetic acid tolerance effects of the original strain and the recombinant strain in example 2;

FIG. 3 is a comparison of intracellular ammonium ion content of the original strain and recombinant strain in example 2;

FIG. 4 is a graph showing the fermentation process of vinegar by standing fermentation on a liquid surface in example 3.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer.

Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any method or material similar or equivalent to those described may be used in the present invention.

The invention provides a recombinant acetic acid bacterium which contains a phenylalanine ammonia lyase coding gene, wherein the amino acid sequence of the phenylalanine ammonia lyase is shown as SEQ ID NO.3, and the promoter of the phenylalanine ammonia lyase coding gene is a nucleotide sequence shown as SEQ ID NO. 1.

The inventor introduces phenylalanine ammonia lyase into acetic acid bacteria for the first time, and relieves the intracellular pH change by adjusting a biological deamination path so as to improve the acid resistance of the bacteria and improve the fermentation efficiency of the bacteria. Wherein the promoter is derived from acetic acid tolerance protein GroES in Acetobacter pasteurii, and the promoter is derived from acetic acid bacteria, so that the expression level of phenylalanine ammonia lyase can be improved to the greatest extent and the stimulus response to host bacteria can be reduced; the phenylalanine ammonia lyase is derived from phenylalanine ammonia lyase gene pal in rhodotorula glutinis (Rhodotorula glutinis), and experiments show that the recombinant acetic acid bacteria can improve acid resistance of the strain and increase acid production rate.

CCTTGGCAAAGTTTTCACAAACCTGCCGAATATGGTGGTTCACACCAAAAATTTCCTGCAGCACCACAAGTGTGTAAGGATGATGGCTGCCTTCGGTTTCCCATGCAGAAAACTCATGTCCATCTGCGGCCTGAAGTGTTGTGATATGACCCATGTAAGCACCTCCTATGTGCTCTCAGGTTACAGCAAAAAGAAACTTTATCCACATTCCTTGACTCTGCCTTTGGGCAGACCTATCTCCTTTTCTGGCACTCCCGGGGTGGGAGTGCTAACGTAACGCGGCGTTATGTTACGCGCGACAAAGCGGATGGGGCTGCTTTCTGTTAAGGGCACCATCCCAAAAATGAATGTGGAGCGATCCATA(SEQ ID NO.1)。

MAEEITLYTSDSPAKHLTVSRAVLAAHSTVFRDLLSIPTSAPDVADPAHKDCSVAVAETEAEIKPFLSILTGEFDEPLELSEDEWKDVARRADKYDSKVARGLVENKVRASTNDESADFALNLAYHTRDDALLTSAAFHVLRLEDANPNLLEEERKSLTELIKQDLARWKPMLREHALGIGYHDAPQYLSSCASGSCTRLSAELAWYRGVHKALAAGSAKTSKTETKFFAPFRRKIEEAAQERDVRLCALHREGLCREAREFEEEFYRKTAPPFPR(SEQ ID NO.3)。

In a preferred embodiment, the acetic acid bacteria oxidize ethanol to acetic acid. Most acetic acid fermentation strains in the prior art use ethanol as a raw material, so that the acetic acid bacteria which are obtained by oxidizing the ethanol as the raw material are selected as host strains, and the general transformation of fermentation strains in the existing production process can be realized.

In a preferred embodiment, the acetobacter comprises Gluconobacter, acetobacter or Gluconobacter, preferably Acetobacter or Gluconobacter, more preferably Acetobacter aceti or Acetobacter pasteurella, still more preferably Acetobacter pasteurella CGMCC 3089 or Acetobacter pasteurella NBRC 3283.

In a preferred embodiment, the nucleotide sequence of the gene encoding phenylalanine ammonia lyase is shown in SEQ ID NO. 2. More specifically, the promoter and phenylalanine ammonia-lyase encoding gene are introduced into acetic acid bacteria by a recombinant vector, the backbone vector of which is preferably plasmid pBBR1p264 (Verena Kallnik, maria Meyer, uwe Deppenmeier, et al construction of expression vectors for protein production in Gluconobacter oxydans. Journal of Biotechnology 150 (2010) 460-465). The plasmid can be stably replicated in acetic acid bacteria.

ATGGCCGAAGAAATCACACTGTACACCAGCGACTCCCCGGCGAAACACCTTACAGTCAGCCGGGCCGTCCTTGCCGCGCATTCCACAGTGTTCCGCGATCTGCTGAGCATTCCGACAAGCGCGCCAGATGTCGCGGATCCAGCGCATAAAGATTGCAGCGTCGCGGTGGCCGAAACCGAAGCGGAAATCAAGCCGTTTCTGTCCATTCTGACCGGCGAATTCGATGAACCGCTGGAACTGAGCGAGGATGAGTGGAAAGACGTGGCGCGGCGGGCGGATAAATACGACAGCAAAGTGGCCCGGGGGCTGGTGGAAAACAAAGTGCGGGCGAGCACAAACGATGAATCCGCCGACTTCGCGCTGAATCTGGCGTACCATACACGGGATGACGCCCTTCTGACAAGCGCCGCGTTCCACGTGCTTCGGCTGGAAGACGCGAACCCAAATCTGCTGGAGGAAGAACGGAAGTCGCTGACCGAGCTGATCAAACAAGATCTGGCCCGGTGGAAACCGATGCTGCGGGAACATGCGCTGGGCATCGGCTACCATGATGCCCCGCAGTATCTGTCCAGCTGTGCGAGCGGGAGCTGTACACGCCTTAGCGCGGAACTGGCGTGGTATCGGGGCGTCCATAAAGCCCTTGCCGCCGGGAGCGCGAAAACATCCAAGACCGAGACCAAGTTCTTCGCGCCGTTCCGGCGCAAAATTGAGGAAGCCGCGCAAGAACGGGATGTGCGCCTTTGTGCGCTGCATCGGGAAGGCCTTTGTCGGGAAGCCCGGGAGTTCGAAGAAGAGTTCTACCGGAAGACCGCCCCACCGTTCCCACGGTGA(SEQ ID NO.2)。

The invention also provides a preparation method of the recombinant acetic acid bacteria, which comprises the step of introducing a recombinant vector containing a promoter and a phenylalanine ammonia lyase coding gene into the acetic acid bacteria to obtain the recombinant acetic acid bacteria.

Preferably, the preparation method can be as follows:

(1) The promoter gene of acetic acid tolerance protein GroESL in the strain is obtained by PCR amplification by taking Acetobacter pasteurianus CGMCC 3089 genome as a template (primers are as follows). Recombinant plasmids pBBR1-Pgro were constructed with the pBBR1p264 plasmid.

Pgro-1：TCGATATCCCTTGGCAAAGTTTTCACAAAC (SEQ ID NO. 4), underlined indicates EcoR V cleavage site;

Pgro-2：GTATCGATTATGGATCGCTCCACATTCATT (SEQ ID NO. 5), underlined indicates ClaI cleavage site.

(2) The phenylalanine ammonia lyase gene pal derived from rhodotorula mucilaginosa (Rhodotorula glutinis) is obtained by a gene synthesis method and is connected to the pBBR1-Pgro plasmid to obtain a recombinant plasmid pBBR1-Pgro-pal.

(3) The recombinant plasmid pBBR1-Pgro-pal was transformed into Acetobacter pasteurianus CGMCC 3089 for expression.

The acetic acid fermentation method can be referred to as follows:

(1) Preparation of the culture medium:

the culture medium contains nutrients required by microorganism growth, such as carbon source such as glucose or ethanol, nitrogen source such as urea, ammonium salt, yeast extract or yeast powder, phosphate (phosphorus source) and sulfate (sulfur source); the concentration of phenylalanine in the culture medium is 0.2-1g/L; the concentration of ethanol in the culture medium is 30-200g/L.

(2) Seed culture:

the shake flask of 250-1000mL is used, 30-100mL of the culture medium is filled, the genetically engineered acetic acid bacteria containing recombinant plasmids pBBR1-Pgro-pal are inoculated for shake flask culture, the rotation speed of the shake flask is 100-300 rpm, the temperature is 27-30 ℃, and the culture time is 20-30 hours, so that seed liquid is prepared.

(3) Acetic acid fermentation:

the genetically engineered acetic acid bacteria can be applied to the production of vinegar or acetic acid by fermentation with ethanol or ethanol-containing wine mash as raw materials.

The invention also provides application of the recombinant acetic acid bacteria in acetic acid fermentation. Acetic acid fermented products include beverage vinegar or condiment vinegar. The fermented material includes fruit, sorghum, corn, wheat or potato.

The invention is further illustrated by the following specific examples, however, it should be understood that these examples are for the purpose of illustration only in greater detail and are not to be construed as limiting the invention in any way.

The preparation of the primer, PCR reaction, purification of nucleotide fragment, recovery, cleavage, ligation, DNA introduction, artificial synthesis of nucleotide sequence, etc. according to the present invention are well known to those skilled in the art, and can be carried out according to the method described in, for example, the guidelines for molecular cloning experiments (science publishers, fourth edition, 2017), or according to the conditions recommended by the manufacturer.

EXAMPLE 1 construction of Gene engineering bacteria of Acetobacter pasteurism containing recombinant plasmid pBBR1-Pgro-pal

1.1 acetic acid tolerance protein GroESL promoter Pgro sequence amplification

The primer sequences were as follows:

Pgro-1：TCGATATCCCTTGGCAAAGTTTTCACAAAC(SEQ ID NO.4)

Pgro-2：GTATCGATTATGGATCGCTCCACATTCATT(SEQ ID NO.5)

TABLE 1 composition of PCR reaction System

The PCR reaction conditions were: (1) pre-denaturation at 98 ℃ for 30s; (2) 98 ℃ for 10s; (3) the time at 72℃is 20-30kb/s depending on the length of the target gene, and (2) to (3) 30 cycles; (4) 72 ℃ for 2min; (5) preserving heat at 4-10 ℃.

The target gene Pgro sequence was amplified using the extracted Acetobacter pasteurianus CGMCC 3089 (purchased from China general microbiological culture Collection center, address: north West Lu No.1, 3, institute of microorganisms, national academy of sciences, post code 100101) total DNA as a template. Amplified PCR products were detected by 1% agarose gel electrophoresis. The PCR amplification product was recovered using a Omega Gel Extraction kit, and the concentration and purity of DNA were measured using a nucleic acid analyzer.

1.2 linearization of plasmid vector and construction of recombinant plasmid pBBR1-Pgro-pal

E.coli DH 5. Alpha./pBBR 1p264 bacteria were transferred from glycerol tubes at 1% inoculum size to 5ml YPG tubes containing 50. Mu.g/ml kanamycin, cultured at 200r/min overnight with shaking at 37 ℃. Bacterial liquid was collected by centrifugation at 12000r/min, bacterial pellet was taken out, and plasmid was extracted using Omega plasmid extraction kit.

And (3) carrying out double digestion on the pBBR1p264 plasmid and the recovered PCR target product by adopting proper restriction enzyme, and carrying out digestion reaction for 90min at 37 ℃. Ligating the vector plasmid and the target fragment after enzyme digestion and purification in a ratio of 1:3 (the ratio of the amount of substances) (16 ℃ for 12 hours); the ligation product is transferred into escherichia coli DH5 alpha, and the recombinant plasmid pBBR1-Pgro is obtained through screening.

1.3 construction of recombinant plasmid pBBR1-Pgro-pal

Phenylalanine ammonia lyase gene pal (SEQ ID NO. 5) derived from rhodotorula mucilaginosa (Rhodotorula glutinis) is obtained by a gene synthesis method and is connected to plasmid pBBR1-Pgro which can be stably replicated in acetic acid bacteria to obtain recombinant plasmid pBBR1-Pgro-pal. The results of the double cleavage assay are shown in FIG. 1.

1.4 electric conversion experiments with Acetobacter pasteurisum

The recombinant plasmid which is successfully verified is electrically transformed into simple arthrobacter competence, and is coated into YPG solid flat plate containing kanamycin with the final concentration of 50 mug/mL, and is inversely cultured for 48 hours at the temperature of 30 ℃ to obtain Acetobacter pasteurianus CGMCC 3089 genetically engineered bacterium containing the recombinant plasmid pBBR1-Pgro-pal. Transformants were picked from YPG solid plates and inoculated into YPG tube medium containing 50. Mu.g/mL kanamycin resistance, cultured for 18-24h, the cells were collected and plasmids were extracted, and plasmid PCR verification was performed. Plasmid PCR products were detected by 1.0% agarose gel electrophoresis. And storing the engineering bacteria with correct verification at-80 ℃ for standby.

EXAMPLE 2 genetically engineered acetic acid bacteria key physicochemical detection of recombinant plasmid pBBR1-Pgro-pal

2.1 tolerance test

The culture medium comprises the following components: 15g/L yeast extract, 20g/L glucose, 0.5g/L phenylalanine concentration and the balance of water.

Inoculating acetic acid bacteria containing recombinant plasmid pBBR1-Pgro-pal and original strain respectively in culture medium containing 1% (v/v) acetic acid concentration, and regulating initial OD ₆₀₀ And consistent. Samples were taken at 24h and 48h, respectively, to compare the growth. The comparison of the tolerance of the Acetobacter pasteurianus CGMCC 3089 genetically engineered bacterium containing the recombinant plasmid pBBR1-Pgro-pal and the original strain Acetobacter pasteurianus CGMCC 3089 is shown in FIG. 2.

2.2 intracellular ammonium ion content detection

And meanwhile, 1% acetic acid is selected, and the salicylic acid spectrophotometry is adopted to measure the intracellular ammonium ion content of the thalli under the conditions of 48 hours. After washing the cells with 1 XPBS buffer, high-efficiency RIPA tissue/cell quick lysate was added to the cells for sonication. 8mL of sample is taken in a 10mL colorimetric tube, 1mL of a color reagent (salicylic acid-potassium sodium tartrate solution), 2 drops of sodium nitrosoferricyanide (0.01 g/mL) and 2 drops of sodium hypochlorite (3.5 g/L of available chlorine and 0.75mol/L of free alkali) are added, water is added for dilution to a marked line, and color development is carried out for 60min after uniform mixing. Absorbance at 697nm was measured using a 10mm cuvette with water as a blank reference. The intracellular ammonium ion content of the original strain and the recombinant strain was measured according to a standard curve. The results are shown in FIG. 3.

2.3 detection of Total phenol content

Drawing a standard curve: and respectively sucking 0.2ml of gallic acid with different concentrations into a 10ml colorimetric tube with a plug, adding 0.8ml of Fu Lin Fen reagent, uniformly mixing, reacting for 5min, then adding 1.5ml of sodium carbonate solution (10%), adding deionized water to 10ml, reacting at room temperature for 2h, measuring absorbance value at 765nm, and performing the whole experiment in dark place. On the abscissa, the gallic acid content A ₇₆₅ And drawing a standard curve on the ordinate.

Sample measurement: the sample is diluted, 0.2ml is measured in a 10ml colorimetric tube with a plug, then the standard curve is used for calculating the total phenol content in the sample according to the standard curve measurement operation, and the result is expressed as mgGAE/ml.

Example 3 production of Vinegar by liquid surface stationary fermentation of acetic acid bacteria containing recombinant plasmid pBBR1-Pgro-pal

3.1 preparation of seed solution

The Acetobacter pasteurianus CGMCC 3089 genetically engineered bacteria containing the recombinant plasmid pBBR1-Pgro-pal are taken from the inclined plane and are subjected to shaking culture in a seed culture medium at 30 ℃ for 25 hours under the condition of 160 revolutions per minute. The seed culture was transferred to fresh seed medium at an inoculum size of 10% (v/v) for scale-up. Seed medium composition: 15g/L yeast extract, 20g/L glucose, 3.5% (v/v) ethanol, 0.5g/L phenylalanine concentration and the balance of water.

3.2 alcohol fermentation

Weighing 1kg of crushed sorghum, pouring into a gelatinization barrel, and adding boiled water until the sorghum is submerged. 220. Mu.L of high temperature resistant alpha-amylase was added and stirred well. Heating at 85-100deg.C for 30-40min to gelatinize jowar. Naturally cooling to about 55 ℃ after heating, adding 23g of solid saccharifying enzyme, uniformly stirring, and preserving the temperature for 1h for saccharification. After saccharification, adding 0.65kg of Daqu, putting into a jar for fermentation, and adding water to supplement weight to 5kg. 3g of yeast was added and stirred well. After liquid sealing, the mixture is put into a 28 ℃ incubator to ferment for about 7-9d.

3.3 acetic acid fermentation

Before acetic acid fermentation starts, a part of alcohol is supplemented to make the alcohol concentration reach about 8% (V/V). Adding activated acetic acid bacteria into the beer, wherein the inoculation amount is 10%, the fermentation temperature is maintained at 30 ℃, the initial acetic acid concentration is 10g/L, and the acetic acid fermentation process adopts a liquid surface standing fermentation method.

The original strain Acetobacter pasteurianus CGMCC 3089 is utilized to sample once in 48 hours at 30 ℃, the fermentation is finished in 28 days, the final concentration of acetic acid is 82g/L, the acid conversion rate of ethanol is about 87.7%, the average acid production rate is about 2.43 g/(L.d), the total phenol content is 0.94mg/ml, and the trans-cinnamic acid content is 0.12mg/L.

The Acetobacter pasteurianus CGMCC 3089 genetically engineered bacterium containing recombinant plasmid pBBR1-Pgro-pal is used for sampling once at 30 ℃ for 48 hours, after 24d fermentation is finished, the final concentration of acetic acid is 87g/L, the alcohol acid conversion rate is about 93.5%, the average acid production rate is about 3.21 g/(L.d), and the total phenol content is measured to be 1.23mg/ml.

FIG. 4 shows the acetic fermentation comparison of Acetobacter pasteurianus CGMCC 3089 genetically engineered bacteria containing recombinant plasmid pBBR1-Pgro-pal with the original strain.

While particular embodiments of the present invention have been illustrated and described, it will be appreciated that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.

SEQUENCE LISTING

<110> Guangdong Di Yi food institute Co., ltd

<120> recombinant acetic acid bacteria, preparation method and application thereof

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 364

<212> DNA

<213> artificial sequence

<400> 1

ccttggcaaa gttttcacaa acctgccgaa tatggtggtt cacaccaaaa atttcctgca 60

gcaccacaag tgtgtaagga tgatggctgc cttcggtttc ccatgcagaa aactcatgtc 120

catctgcggc ctgaagtgtt gtgatatgac ccatgtaagc acctcctatg tgctctcagg 180

ttacagcaaa aagaaacttt atccacattc cttgactctg cctttgggca gacctatctc 240

cttttctggc actcccgggg tgggagtgct aacgtaacgc ggcgttatgt tacgcgcgac 300

aaagcggatg gggctgcttt ctgttaaggg caccatccca aaaatgaatg tggagcgatc 360

cata 364

<210> 2

<211> 831

<212> DNA

<213> artificial sequence

<400> 2

atggccgaag aaatcacact gtacaccagc gactccccgg cgaaacacct tacagtcagc 60

cgggccgtcc ttgccgcgca ttccacagtg ttccgcgatc tgctgagcat tccgacaagc 120

gcgccagatg tcgcggatcc agcgcataaa gattgcagcg tcgcggtggc cgaaaccgaa 180

gcggaaatca agccgtttct gtccattctg accggcgaat tcgatgaacc gctggaactg 240

agcgaggatg agtggaaaga cgtggcgcgg cgggcggata aatacgacag caaagtggcc 300

cgggggctgg tggaaaacaa agtgcgggcg agcacaaacg atgaatccgc cgacttcgcg 360

ctgaatctgg cgtaccatac acgggatgac gcccttctga caagcgccgc gttccacgtg 420

cttcggctgg aagacgcgaa cccaaatctg ctggaggaag aacggaagtc gctgaccgag 480

ctgatcaaac aagatctggc ccggtggaaa ccgatgctgc gggaacatgc gctgggcatc 540

ggctaccatg atgccccgca gtatctgtcc agctgtgcga gcgggagctg tacacgcctt 600

agcgcggaac tggcgtggta tcggggcgtc cataaagccc ttgccgccgg gagcgcgaaa 660

acatccaaga ccgagaccaa gttcttcgcg ccgttccggc gcaaaattga ggaagccgcg 720

caagaacggg atgtgcgcct ttgtgcgctg catcgggaag gcctttgtcg ggaagcccgg 780

gagttcgaag aagagttcta ccggaagacc gccccaccgt tcccacggtg a 831

<210> 3

<211> 276

<212> PRT

<213> artificial sequence

<400> 3

Met Ala Glu Glu Ile Thr Leu Tyr Thr Ser Asp Ser Pro Ala Lys His

1 5 10 15

Leu Thr Val Ser Arg Ala Val Leu Ala Ala His Ser Thr Val Phe Arg

20 25 30

Asp Leu Leu Ser Ile Pro Thr Ser Ala Pro Asp Val Ala Asp Pro Ala

35 40 45

His Lys Asp Cys Ser Val Ala Val Ala Glu Thr Glu Ala Glu Ile Lys

50 55 60

Pro Phe Leu Ser Ile Leu Thr Gly Glu Phe Asp Glu Pro Leu Glu Leu

65 70 75 80

Ser Glu Asp Glu Trp Lys Asp Val Ala Arg Arg Ala Asp Lys Tyr Asp

85 90 95

Ser Lys Val Ala Arg Gly Leu Val Glu Asn Lys Val Arg Ala Ser Thr

100 105 110

Asn Asp Glu Ser Ala Asp Phe Ala Leu Asn Leu Ala Tyr His Thr Arg

115 120 125

Asp Asp Ala Leu Leu Thr Ser Ala Ala Phe His Val Leu Arg Leu Glu

130 135 140

Asp Ala Asn Pro Asn Leu Leu Glu Glu Glu Arg Lys Ser Leu Thr Glu

145 150 155 160

Leu Ile Lys Gln Asp Leu Ala Arg Trp Lys Pro Met Leu Arg Glu His

165 170 175

Ala Leu Gly Ile Gly Tyr His Asp Ala Pro Gln Tyr Leu Ser Ser Cys

180 185 190

Ala Ser Gly Ser Cys Thr Arg Leu Ser Ala Glu Leu Ala Trp Tyr Arg

195 200 205

Gly Val His Lys Ala Leu Ala Ala Gly Ser Ala Lys Thr Ser Lys Thr

210 215 220

Glu Thr Lys Phe Phe Ala Pro Phe Arg Arg Lys Ile Glu Glu Ala Ala

225 230 235 240

Gln Glu Arg Asp Val Arg Leu Cys Ala Leu His Arg Glu Gly Leu Cys

245 250 255

Arg Glu Ala Arg Glu Phe Glu Glu Glu Phe Tyr Arg Lys Thr Ala Pro

260 265 270

Pro Phe Pro Arg

275

<210> 4

<211> 30

<212> DNA

<213> artificial sequence

<400> 4

tcgatatccc ttggcaaagt tttcacaaac 30

<210> 5

<211> 30

<212> DNA

<213> artificial sequence

<400> 5

gtatcgatta tggatcgctc cacattcatt 30

Claims

1. The recombinant acetic acid bacteria is characterized by comprising a phenylalanine ammonia lyase encoding gene and a promoter of the phenylalanine ammonia lyase encoding gene;

the amino acid sequence of phenylalanine ammonia lyase is shown as SEQ ID NO.3, and the promoter of the phenylalanine ammonia lyase coding gene is a nucleotide sequence shown as SEQ ID NO. 1;

the acetic acid bacteria are Acetobacter pasteurii CGMCC 3089.

2. The recombinant acetic acid bacteria of claim 1, wherein the acetic acid bacteria oxidize ethanol to acetic acid.

3. The recombinant acetic acid bacterium according to claim 1, wherein the nucleotide sequence of the gene encoding phenylalanine ammonia lyase is shown in SEQ ID No. 2.

4. The recombinant acetic acid bacterium according to any one of claims 1 to 3, wherein the promoter and the phenylalanine ammonia lyase encoding gene are introduced into the acetic acid bacterium via a recombinant vector;

the backbone vector of the recombinant vector includes plasmid pBBR1p264.

5. The method for producing a recombinant acetic acid bacterium according to any one of claims 1 to 4, wherein a recombinant vector comprising a promoter and a gene encoding phenylalanine ammonia lyase is introduced into an acetic acid bacterium to obtain the recombinant acetic acid bacterium.

6. Use of the recombinant acetic acid bacterium of any one of claims 1-4 in acetic acid fermentation.

7. The use according to claim 6, wherein acetic acid fermentation comprises liquid surface resting vinegar fermentation;

acetic acid fermented products include beverage vinegar or condiment vinegar.

8. An acetic acid fermentation method, characterized in that the recombinant acetic acid bacteria according to any one of claims 1 to 4 are used as fermentation bacteria for fermentation to produce acetic acid.

9. The acetic acid fermentation process of claim 8, wherein the fermented feedstock comprises fruit, sorghum, corn, wheat, or potato;

acetic acid fermented products include beverage vinegar or condiment vinegar.