CN113995842A

CN113995842A - Application of Hippo signal channel blocker in preparation of medicine for resisting ER + breast tumor

Info

Publication number: CN113995842A
Application number: CN202111571676.2A
Authority: CN
Inventors: 庄婷; 朱建; 杨会洁; 卓秫; 李欣
Original assignee: Xinxiang Medical University
Current assignee: Xinxiang Medical University
Priority date: 2021-12-21
Filing date: 2021-12-21
Publication date: 2022-02-01

Abstract

The invention belongs to the technical field of anti-tumor drugs, and particularly discloses an application of a Hippo signal pathway blocker in preparation of an ER + breast tumor resistant drug. Experiments prove that: MST1/2 kinase inhibitors as Hippo signaling pathway blockers inhibit the growth of ER + breast tumor cells MCF-7 and T47D by down-regulating ER α protein levels in MCF-7 and T47D cells, inhibiting the binding of ER α to its target promoter, and the like.

Description

Application of Hippo signal channel blocker in preparation of medicine for resisting ER + breast tumor

Technical Field

The invention belongs to the technical field of anti-tumor drugs, and particularly discloses an application of a Hippo signal pathway blocker in preparation of an ER + breast tumor resistant drug.

Background

Cancer, a malignant tumor, is a serious disease that seriously harms human life. The treatment of cancer is of widespread interest to society. Breast cancer, like most other countries, is the most common cancer in women in china. Currently, breast cancer is the cancer with the highest incidence in women in China.

The Hippo signaling pathway controls tissue growth and organ size by simultaneously limiting cell growth and proliferation, promoting cell death. The core Hippo pathway consists of a kinase cascade: the upstream kinase MST1/2 phosphorylates and activates the downstream kinase LATS1/2, resulting in phosphorylation and inactivation of the reverse transcription co-activator YAP/TAZ. When the Hippo signaling pathway is impaired, unphosphorylated YAP/TAZ enters the nucleus and binds to the pathway transcription factor TEAD1-4 to regulate Hippo pathway target gene expression. There is increasing evidence that the mammalian Hippo pathway regulates cell contact inhibition, organ size and tumorigenesis. In many human cancers, including liver, lung, colon, esophageal, and cervical cancers, YAP is amplified with elevated protein levels and nuclear localization. In addition, YAP overexpression or MST1/2 knockout in mouse liver leads to hepatocellular carcinoma, i.e., the Hippo signal acts as a tumor suppressor pathway by blocking the oncogenic potential of YAP. However, whether the blockade of the Hippo signaling pathway can be used as a therapeutic target of breast cancer has not been reported.

Estrogen receptor alpha (era) belongs to the ligand-dependent subfamily of the nuclear receptor superfamily of transcription factors, the activity of which is mainly regulated by estrogen, and which is programmed to respond in a hormone-dependent manner and is associated with the pathogenesis of breast cancer. As such, hormone depletion and era antagonists are widely used to treat ER + breast cancer patients. However, in advanced disease, resistance to such therapeutic agents is still unavoidable.

Disclosure of Invention

Based on the above problems, the present invention provides the following technical solutions:

the invention provides an application of a Hippo signal pathway blocker in preparing an anti-ER + breast tumor medicament.

Preferably, the Hippo signalling pathway blocker is a MST1/2 kinase inhibitor.

Preferably, the MST1/2 kinase inhibitor is used for preparing growth inhibitors of ER + breast tumor cells MCF-7 and T47D;

the MST1/2 kinase inhibitor is used for preparing ER alpha protein level down-regulator in MCF-7 and T47D cells;

the MST1/2 kinase inhibitor is used for preparing an ER alpha binding inhibitor and an ER alpha target gene expression inhibitor.

Preferably, the MST1/2 kinase inhibitor is capable of inhibiting the growth of ER + breast tumor cells by activating YAP.

Preferably, the YAP inhibits ER α binding to its target promoter by competing TEAD.

Preferably, the era target genes are GREB1, PS2, PDZK1, and CCND 1.

Preferably, the MST1/2 kinase inhibitor is XMU-MP-1.

Preferably, the MST1/2 kinase inhibitor is capable of ameliorating resistance to hormone therapy of ER + breast tumours, the resistance being caused by a mutation in the ER α ligand binding domain.

Preferably, the MST1/2 kinase inhibitor is used to prepare a transcriptional activity inhibitor of a tamoxifen resistant era mutant.

The invention also provides a drug for resisting the drug resistance of hormone therapy ER + breast tumor, which is characterized by comprising the MST1/2 kinase inhibitor.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides an application of a Hippo signal pathway blocker in preparing an anti-ER + breast tumor medicament. Experiments prove that: MST1/2 kinase inhibitors as Hippo signaling pathway blockers inhibit the growth of ER + breast tumor cells MCF-7 and T47D by down-regulating ER α protein levels in MCF-7 and T47D cells, inhibiting the binding of ER α to its target promoter, and the like. Meanwhile, the invention also proves that: MST1/2 kinase inhibitors can improve the resistance of hormone therapy to ER + breast tumors.

Drawings

FIG. 1 is a Kaplan-Meier progression-free survival diagram; a. YAP is associated with poor prognosis of ER α negative breast tumors; b. the high YAP is beneficial to the survival of Er alpha positive breast cancer patients;

FIG. 2 is YAP mRNA levels for normal breast and breast cancer tissues;

FIG. 3 is the expression of YAP in ER α positive and negative breast cancer cells; a. expression patterns of ER α and YAP in breast cancer; b. era signal and YAP signaling pathway target gene expression heatmap in TCGA era high (left) and era low (right) breast cancer datasets;

FIG. 4 is a heatmap of the ER α target gene and YAP target gene association in TCGA ER α high (left) and ER α low (right) breast cancer datasets; compared with the normal mammary gland tissue, the tissue has the advantages that,^*p<0.05，^**p<0.01；

FIG. 5 is a graph of YAP immunohistochemistry in normal breast samples and breast tumor samples of clinical specimens;

FIG. 6 is a graph of immunohistochemical analysis of clinical specimens for the correlation of YAP expression with ER α/PR positivity;

FIG. 7 is a graph of the effect of XMU-MP-1 on proliferation of ER α -positive breast cancer classical cell lines MCF-7 and T47D;

FIG. 8 is a graph of the effect of tamoxifen and XMU-MP on proliferation of ER α positive breast cancer classical cell lines MCF-7 and T47D;

FIG. 9 is the effect of XMU-MP-1 on the cellular localization of YAP proteins; a. immunofluorescent staining of YAP in MCF-7; b. quantification of the relative levels of cytoplasm (C) and nucleus (N) of YAP; c. immunoblot analysis to detect YAP content in nuclear (N) and cytoplasmic (C) fractions or whole cell lysates (WC);

FIG. 10 is the effect of YAP siRNA blocking XMU-MP-1 on the growth of MCF-7 and T47D cancer cells;

FIG. 11 is a graph of the effect of YAP silencing on the proliferation of MCF-7 and T47D cells;

FIG. 12 is the effect of overexpression of wild-type YAP or YAP-5SA on proliferation of MCF-7 and T47D cells;

FIG. 13 is a graph of the effect of XMU-MP-1 on the growth of NOD Scid Gamma (NSG) subcutaneous transplants of MCF-7 cells; a. a tumor growth curve; b. a picture of a tumor sample; c. quantification of tumor weight;

FIG. 14 is a graph of the effect of YAP-5SA, YAP-5SAS94A on the growth of NOD Scid Gamma (NSG) subcutaneous transplants of MCF-7 cells; a. a tumor growth curve; b. a picture of a tumor sample; c. quantification of tumor weight at the end of treatment;

FIG. 15 is the effect of YAP depletion on the expression level of XMU-MP-1 inhibited ER α target genes; a. YAP depletion rescues XMU-MP-1 inhibited ER α target gene expression; b. YAP depletion increases ER α target gene expression;

FIG. 16 is the effect of overexpression of YAP-WT or YAP-5SA on ER α target gene expression; a. MCF-7 cells; b. T47D cells;

FIG. 17 is a GO enrichment analysis plot of differentially expressed genes;

FIG. 18 is a gene enrichment analysis diagram of RNA-seq: a. gene Set Enrichment Analysis (GSEA) showed that the estrogen responsive trait gene was enriched in the down-regulated genes in MCF-7 cells treated with XMU-MP-1; b. volcano plots show the opposite effect on estrogen-responsive signature gene (blue) and YAP-responsive signature gene (red) in XMU-MP-1 treated MCF-7 cells (threshold P <0.05 and fold change > 1.5); c. enrichment of estrogen response genes in MCF-7 cells expressing inducible YAP-5 SA; d. enrichment of YAP-responsive genes in MCF-7 cells expressing inducible YAP-5 SA;

FIG. 19 is the effect of XMU-MP-1 on ER α protein levels in MCF-7 and T47D cells; a. MCF-7 cells; b. T47D cells;

FIG. 20 is the effect of YAP KD on ER α protein levels in MCF-7 and T47D cells; a. MCF-7 cells; b. T47D cells; c. YAP KD reverses XMU-MP-1 effect on ER α protein levels in MCF-7 cells;

FIG. 21 is the effect of overexpression of YAP-WT or YAP-5SA, YAP-S94A on ER α protein levels in MCF-7 and T47D cells; a. MCF-7 cells; b. T47D cells;

FIG. 22 is a graph of the effect of XMU-MP-1 on the half-life of ER α; a. a DMSO treatment group; b. XMU-MP-1 treatment;

FIG. 23 is a graph of the effect of different drugs on XUM-MP-1 induced levels of cellular ER α protein; a. MG132 processing group; b. an LMB processing group;

FIG. 24 is a graph of the effect of LMB treatment on ER α -mediated transcription at the cellular level induced by XUM-MP-1; a. mRNA levels; b. binding of ER α to its target gene promoter;

FIG. 25 is a graph of the effect of XUM-MP-1 treatment and doxycycline-induced expression of YAP5SA on ER α protein levels; a. ER α Western blot pattern after different time of XUM-MP-1 treatment; b. a doxycycline-induced era western blot plot of YAP5SA expression;

FIG. 26 is a graph of the effect of XUM-MP-1 treatment with doxycycline-induced expression of YAP5SA on ER α target gene expression; a. RT-qPCR analysis of ER alpha target gene expression; b. ChIP qPCR analysis of ER α binding to promoter region;

FIG. 27 is the effect of inducible expression of YAP-5SA on ER α transcriptional activity and binding to its target promoter; a. ChIP-qPCR analysis of ER alpha binding to the promoter region of its target gene; b. RT-qPCR analysis of ER alpha target gene expression;

FIG. 28 is the effect of doxycycline-induced YAP-5SAS94A expression on ER α binding to its target promoter and ER α target gene expression; a. ER α western blot; b. RT-qPCR analysis of ER alpha target gene expression; c. ChIP-qPCR analysis of ER α binding to promoter region;

FIG. 29 is a graph of TEAD4 correlation with breast cancer patient survival and ER α expression; a. high levels of TEAD4 were associated with low survival of endocrine treated breast cancer patients; b. the effect of depletion of TEAD4 on TEAD4 and ER α expression in MCF-7;

FIG. 30 is the effect of TEAD4 depletion on the growth of ER + breast cancer cells; a. MCF-7 cells; b. T47D cells;

FIG. 31 is the effect of TEAD4 depletion on ER α target gene expression and its target gene promoter; a. ER α target gene expression; b. a promoter of a target gene;

FIG. 32 is the effect of TEAD WT expression on ER α target gene expression by TEAD4 KD; a. western blot analysis of ER α and TEAD4 expression; b. the effect of insensitive wild-type TEAD4 on the expression of a given era target gene in MCF-7 cells;

FIG. 33 is the effect of depletion of TEAD1 on ER α target gene expression; a. western blot analysis of TEAD1 expression; b. RT-qPCR analysis of the designated ER alpha target gene;

FIG. 34 is the effect of depletion of multiple TEAD family members on ER α target gene expression; a. western blot analysis of the expression of TEAD1 and TEAD 4; b. RT-qPCR analysis of the designated ER alpha target gene;

FIG. 35 is a Western blot analysis of ER α and TEAD4 expression and RT-qPCR analysis of ER α target gene expression; a. western blot analysis of ER alpha and TEAD4 expression; b. analyzing the expression of ER alpha target gene by RT-qPCR;

FIG. 36 is a ChIP-qPCR determination of ER α binding to its target gene promoter region;

FIG. 37 is a schematic representation of TEAD4 and ER α co-occupying the promoter region of a designated ER α target gene;

FIG. 38 is a comprehensive analysis of the co-binding of ER α, TEAD and YAP; a. the amount of overlap of ER α binding peaks with TEAD1 and YAP ChIP-seq binding peaks in MCF-7 cells; b. heatmap of ER α, YAP, TEAD1 and H3K27Ac ChIP-Seq readings of MCF-7 cells;

FIG. 39 is an enrichment analysis of a given gene set in RNA sequencing; a. XMU-MP-1 treated MCF-7 cells in RNA sequencing specified gene set enrichment analysis diagram; b. (ii) enrichment profile of assigned genome in RNA sequencing of YAP-5 SA-overexpressed MCF-7 cells;

FIG. 40 is a graph of the number of distribution of the ER α/TEAD1 common binding peak and the ER α binding peak alone in 165 XMU-MP-1 downregulated ER α target genes;

FIG. 41 is a chip seq signal trace of ER α, TEAD1, YAP and H3K27Ac in the promoter/enhancer region down-regulated by XMU-XP-1 in MCF-7 cells; a. the GREB1 gene; b. the CCND1 gene;

FIG. 42 is the chip seq signal traces of ER α, TEAD1, YAP and H3K27Ac in the promoter/enhancer region down-regulated by XMU-XP-1 in MCF-7 cells; a. ESR1 gene; b. PDZK1 gene;

FIG. 43 is a chip seq signal trace of ER α, TEAD1, YAP and H3K27Ac in the promoter/enhancer region down-regulated by XMU-XP-1 in MCF-7 cells; a. the PS2 gene; b. the SLC9A3R1 gene;

FIG. 44 is a chip seq signal trace of ER α, TEAD1, YAP and H3K27Ac in the promoter/enhancer region down-regulated by XMU-XP-1 in MCF-7 cells; a. a MYOF gene; b. a PGR gene;

FIG. 45 is a chip seq signal trace of ER α, TEAD1, YAP and H3K27Ac in the promoter/enhancer region down-regulated by XMU-XP-1 in MCF-7 cells; a. SEC14L 2; b. a TH gene;

FIG. 46 is the results of a Co-IP experiment; a. TEAD4 did not form complexes with YAP with ER α in MCF-7 cells; b. ER α forms a complex with TEAD 1;

FIG. 47 is the domain of interaction mediated by TEAD4 and ER α in HEK293T cells; a. a TEAD4 domain structure; b. an ER α domain structure;

FIG. 48 is a Co-IP and Western blot analysis of different truncations of TEAD4 and different truncations of ER α transfection; a. Co-IP and Western blot analysis of different truncations of Flag-TEAD4 with HA-ER α; b, c, Co-IP and Western blot analysis of different truncations of HA-ER α and TEAD 4;

FIG. 49 is the result of ChIP-qPCR experiment; a. the effect of TEAD4 on the recruitment of era to its target gene promoter; b. c, TEAD4 requires the AF2 domain to facilitate binding of era to its target promoter;

FIG. 50 is interference of YAP with ER α -TEAD synergy by competitive TEAD; a. effect of YAP co-expression with era and TEAD4 on era interaction with TEAD 4; b. the effect of YAP on TEAD 4-mediated binding of era to its target promoter;

FIG. 51 is a graph of the effect of XUM-MP-1 on the binding of TEAD4 to ER α and YAP;

FIG. 52 is YAP inhibiting ER α -TEAD4 binding by binding to TEAD 4;

FIG. 53 is a graph of the effect of XUM-MP-1 on the occupancy of the promoter of the ER α target gene for YAP action; a. XMU-MP-1 is used for ChIP-qPCR analysis of ER alpha target gene; b. XMU-MP-1 was analyzed by ESR1, GREB1, PS2 and PDZK1 with TEAD4 ChIP-qPCR; c. XMU-MP-1 effect on the binding of YAP to the ER α target gene promoter region; d. effect of expression of YAP5SA on binding of YAP to ER α and ER α target promoter;

FIG. 54 is XMU-MP-1 inhibiting ER α target gene expression in MCF-7 and T47D cells; a. MCF-7; b. T47D;

FIG. 55 is the effect of overexpression of YAP on expression of ER α target genes; a. MCF-7; b. T47D;

FIG. 56 is the effect of XMU-XP-1 and YAP-5SA, YAP-5SAS94A on ESR1, GREB1, PS2 and PDZK1 expression; a. XMU-XP-1; b. YAP-5SA, YAP-5SAS 94A;

FIG. 57 is ER α -WT and ER α -Y537S in MCF-7 cell line;

FIG. 58 is a graph of the effect of XMU-MP-1 and tamoxifen on ER α -Y537S and ER α -WT gene expression of ER α target in stably transfected cells;

FIG. 59 is a graph of the effect of XMU-MP-1 and tamoxifen on ER α -Y537S and ER α -WT on proliferation of stably transfected cells; a. tamoxifen treatment; b. XMU-MP-1 treatment;

FIG. 60 is a graph of the effect of XMU-MP-1 on the interaction of TEAD4 with ER α or ER α -Y537S;

FIG. 61 is a graph of the effect of XMU-MP-1 on the growth of subcutaneous transplantable tumors in MCF-7 cell mice overexpressing ER α -Y537S; a. a tumor growth curve; b. a picture of the tumor; c. quantification of tumor weight at the end of treatment;

FIG. 62 is a graph of the effect of XMU-MP-1 on the growth of breast cancer tumors expressing ER α -Y537S in xenografts; a. tumor weight; b. tumor growth curve.

Detailed Description

In order to make the technical solutions of the present invention better understood and enable those skilled in the art to practice the present invention, the following embodiments are further described, but the present invention is not limited to the following embodiments.

The following sources of reagents or materials were used: XMU-MP-1(MCE, cat # HY-100526), doxycycline (Dox) (Sigma, cat # 33429), 17 b-estradiol (E2) (Sigma, cat # HY-100526), LeptomycinB (LMB) (Santa Cruz, cat # sc-358688).

Example 1

Expression and prognosis of YAP in ER + breast cancer

1. Progression free survival data analysis

Progression Free Survival (PFS) survival data for YAP was obtained from KMPLOT online analytical database (http:// KMPLOT. com/analysis/index. phpp ═ service & cancer ═ break). The gene affyID is 224894_ at. The "best cutoff for auto-selection" and "ER positive" were selected for ER positive breast cancer analysis. The "best cutoff for automatic selection" and "ER negative" were selected for ER negative breast cancer analysis.

Pfa survival data in endocrine treated patients with TEAD4 was from the KMPLOT database. The gene affyID is 41037_ at. The "automatically selected optimal cutoff value" and "endocrine treatment patient" were selected for analysis. PFS survival data for MST1(STK4), MST2(STK3) and TAZ (WWTR1) from the KMPLOT database in endocrine treatment patients. The gene association IDs were 225364(MST1), 204068(MST2), and 202133(TAZ) _ at. The "automatically selected optimal cutoff value" and "endocrine treatment patient" were selected for analysis. The PFS survival of YAP in different databases was generated from 23 kmPLot databases. The gene affyID is 224894_ at. The "best cutoff for auto-selection" and "ER positive" were selected for ER positive breast cancer analysis. "GSE 16931", "GSE 9195", "E-MTAB-365", and "GSE 21653" are used for different datasets.

The results are shown in FIG. 1. Kaplan-Meier progression free survival plots showed that high YAP was associated with a poor prognosis for era negative breast tumors (fig. 1a), and high YAP was beneficial for survival of era positive breast cancer patients (fig. 1 b).

2. TCGA database analysis

Gene expression data of 1218 TCGA breast cancer patients are downloaded from a webpage (http:// xena. ucsc. edu /), and an ER high expression group is ESR1Log2(FPKM-UQ +1) ≥ 9.49. MORPHEUS (https:// software. broadassociation. org/MORPHEUS /) was used to generate gene expression heat maps (data normalization was done by z-score) and gene correlation heat maps (inter-gene Spearman correlation was done by Graphpadprism 8).

By analyzing the TCGA database, the following findings were made: YAP mRNA was reduced in breast cancer tissue compared to normal breast tissue (fig. 2). YAP expression was negatively correlated with ER α expression in breast cancer samples (FIG. 3a, data from the TCGA database (https:// www.cbioportal.org)). Furthermore, analysis of 1247 TCGA breast cancer samples showed a negative correlation of ER α and YAP signal activity in the era breast cancer dataset (fig. 3b, fig. 4).

3. Immunohistochemical (IHC) detection of YAP expression in breast cancer

To detect YAP expression in breast cancer from the protein level, we analyzed YAP expression in breast cancer patient samples by Immunohistochemistry (IHC). YAP expression was significantly reduced in breast cancer compared to normal breast tissue (24/25vs 7/25; P <0.001, FIG. 5).

Furthermore, by studying the correlation between YAP expression and breast cancer molecular markers, including ER α, PR (progestogen receptor) and HER2 (human epidermal growth factor receptor 2), YAP expression was negatively correlated with ER α/PR (P ═ 0.0007 and P ═ 0.009, respectively; fig. 6) in 140 breast tumor tissues analyzed by IHC, consistent with the results analyzed by the TCGA database.

Example 2

Inhibition of MST1/2 or activation of YAP blocks the growth of ER + breast cancer cells

To determine whether increasing YAP activity could inhibit the growth of ER + breast cancer cells, we utilized a pharmacological small molecule inhibitor XMU-MP-1, which specifically inhibited the activity of the kinase MST1/2, thereby promoting YAP nuclear localization and activation.

As a result, XMU-MP-1 was found to inhibit the growth of ER + breast cancer cell lines, including MCF-7 and T47D, in a dose-dependent manner (FIGS. 7-8). Immunostaining or fractionation of MCF-7 cells treated with XMU-MP-1 showed increased YAP nuclear localization (FIG. 9). Furthermore, the inhibition of MCF-7 cell growth by XMU-MP-1 was partially reversed by siRNA-mediated YAP Knockdown (KD) (fig. 10), indicating that MST1/2 inhibition blocked ER + breast cancer cell growth by YAP.

Consistent with the notion that YAP activation inhibits ER + breast cancer cells, YAP Knockdown (KD) (labeled with YAPKD) was increased, while overexpression of wild-type (YAP-WT) or constitutively active forms of YAP (YAP-5SA) inhibited the growth of MCF-7 and T47D cells (fig. 11-12).

Example 3

Inhibition of the Hippo signaling pathway or activation of YAP inhibits ER + breast cancer progression in xenograft tumor models

1. Injection of XMU-MP-1 into female NODscid γ (NSG) mice supplemented with estrogen daily for 3 weeks significantly inhibited tumor growth compared to control treatment (FIG. 13), indicating that MST1/2 inhibition can reduce the growth of ER + breast cancer in vivo.

2. We also generated MCF-7 cell lines stably expressing inducible YAP-5SA (Tet-O-YAP-5SA) or its TEAD binding deficient form (Tet-O-YAP-5SAs94A) and derived xenografts carrying these cell lines. Mice were injected intraperitoneally daily with either PBS or PBS containing Dox (20mg/kg) for the indicated time period. Dox-induced YAP-5SA expression significantly reduced tumor growth, while YAP-5SAs94A expression had no effect (fig. 14), indicating that YAP activation inhibited the growth of ER + breast cancer in vivo and was inhibited by binding to TEAD.

Example 4

Effect of MST1/2 inhibition on ER α target Gene expression

1. MCF-7 or T47D cells were stably infected with wild-type YAP, YAP-5SA or control virus. After 48 hours, total RNA was extracted for RT-qPCR analysis of GREB1, PS2, and PDZK1 expression. Cells were treated with 3. mu.M XMU-MP-1 for 8 hours, then 10nM E2 or vector for 6 hours, and then subjected to RT-qPCR.

The results show that: YAPKD of two independent siRNAs increased ER α target gene expression and mitigated XMU-MP-1 inhibition (FIG. 15). On the other hand, overexpression of YAP-WT or YAP-5SA suppressed ER α target gene expression (fig. 16).

2. RNAseq experiment

MCF-7 or T47D cells were stably infected with YAP or control virus. After 48 hours, total RNA was extracted for RT-qPCR analysis of GREB1, PS2, and PDZK1 expression, and the first 10 signaling pathways were significantly reduced (top) or increased (bottom) in XMU-MP-1 treated MCF-7 cells. Regulated genes were deduced by threshold P <0.001 and foldchange >2 using a pathway enrichment assay. Cells were treated with vehicle or 3. mu.M XMUMP-1 for 8 hours. Whole mRNA was extracted for RNA sequence analysis (n-3).

GO enrichment analysis of differentially expressed genes showed significant down-regulation of the era transcriptome, while Hippo/YAP pathway target genes were significantly up-regulated (fig. 17).

Gene Set Enrichment Analysis (GSEA) revealed an enrichment of the estrogen response gene that was down-regulated by XMU-MP-1 (FIG. 18 a). ESR1 encoding ER α was also down-regulated by XMU-MP-1, probably because ER α automatically regulated its own transcription (FIG. 18 b).

GSEA analysis of RNAseq data set showed that in MCF-7 cells expressing inducible YAP-5SA, the estrogen responsive gene was enriched in the down-regulated gene, while the YAP responsive gene was enriched in the up-regulated gene (fig. 18c, d).

Example 5

YAP inhibits ER alpha from binding to its target promoter and promotes ER alpha degradation

1. Western blot analysis showed that XMU-MP-1 down-regulated ER α protein levels in MCF-7 and T47D cells in a dose-dependent manner (FIG. 19). YAPKD, on the other hand, increased ER α protein levels and reversed the effect of XMU-MP-1 (FIG. 20). Overexpression of YAP-WT or YAP-5SA also down-regulated ER α protein in MCF-7 and T47D cells (FIG. 21).

2. MCF-7 cells were treated with vehicle or 3. mu.M XMU-MP-1 in the presence of cycloheximide for the indicated time and cell lysates were subjected to Western blot analysis. As a result, XUM-MP-1 was found to shorten the half-life of ER α protein (FIG. 22).

3. Treatment of MCF-7 cells with vehicle or 3. mu.M of proteasome inhibitor MG132 in the absence or presence of 10. mu.M followed by Western blot analysis with the indicated antibodies showed that treatment of cells with proteasome inhibitor MG132 prevented XUM-MP-1 induced downregulation of ER α protein (FIG. 23 a).

4. MCF-7 cells were treated with vehicle or 3. mu.M XMU-MP-1 in the absence or presence of 50nM of FINEMB, and then subjected to Western blot analysis with the indicated antibodies. Treatment of cells with the nuclear export inhibitor, Leptomycin (LMB), also restored ER α protein levels in MCF-7 cells treated with XUM-MP-1 (FIG. 23b), indicating that ER α is exported to the cytoplasm and degraded by the ubiquitin/proteosome (UPS) system. However, LMB treatment failed to rescue XUM-MP-1 from ER α -mediated down-regulation, even though ER α protein levels were largely rescued (fig. 23b, fig. 24a), suggesting that ER α protein degradation is not the primary cause of XUM-MP-1-mediated inhibition of ER α transcription programs.

5. Whether XUM-MP-1 interferes with ER α binding to the promoter/enhancer (promoter) region of its target gene

MCF-7 cells were treated with vector or 3. mu.MXMU-MP-1 in the absence or presence of 50nM LMB, and then ChIPqPCR analysis was performed for ER α binding to the promoter regions of PS2, GREB1 and PDZK 1.

ChIP-qPCR experiments showed that even though ER α degradation was blocked by LMB, XUM-MP-1 inhibited ER α promoter occupancy on multiple target genes (FIG. 24 b). Furthermore, treatment of MCF-7 cells with XUM-MP-1 for shorter time (2 or 4 hours) reduced binding of era to its target promoter and era target gene expression without significantly affecting era protein levels (fig. 25a, fig. 26). Similarly, doxycycline-induced YAP5SA expression for 10 hours also inhibited era binding to its target promoter and era target gene expression, without affecting era protein levels (fig. 25b, fig. 27). These data indicate that ER α dissociates from its target promoter prior to its protein degradation. Finally, doxycycline-induced YAP5SAS94A expression neither inhibited ER α binding to its target promoter, nor ER α target gene expression (fig. 28), indicating that YAP inhibited ER α binding to its target promoter.

Example 6

YAP interference with ER alpha-TEAD synergy by competitive TEAD

1. TEAD is essential for ER α transcriptional activity and ER + breast cancer cell growth

YAP acts through the TEAD transcription factor family to regulate the expression of Hippo signaling pathway target genes. Indeed, the TEAD binding-deficient form of YAP (YAP-5SAS94A) failed to inhibit ER + breast cancer cell growth or down-regulate era target genes (fig. 14, 28). Therefore, we found that high levels of TEAD4 were associated with a poor prognosis in ER + breast cancer patients (fig. 29a), in contrast to YAP (fig. 1b), suggesting that TEAD might promote ER + breast cancer progression.

Consistent with clinical data, we found that siRNA-mediated depletion of TEAD4 down-regulated era target gene expression and inhibited ER + breast cancer cell growth (fig. 29b, 30 and 31 a). TEAD4KD also down-regulated ESR1 expression, ER α protein levels and binding of ER α to its target promoter (fig. 29b, fig. 31). Expression of RNAi-insensitive TEAD4(TEADWT) rescued the down-regulation of era target gene expression by TEAD4KD (fig. 32).

MCF-7 cells transfected with either control (Ctrl) or two independent TEAD1 siRNAs were grown for 48 hours and MCF-7 cells transfected with two independent TEAD1,3,4 siRNAs were grown for 48 hours, and then Western blot analysis was used to analyze the expression of TEAD1 and TEAD4 or RT-qPCR analysis of the indicated ER α target genes. The results showed that knockdown of TEAD1 or TEAD1/3/4 also suppressed era target gene expression (fig. 33-34), suggesting that multiple TEAD family members may act additively to regulate era target gene expression.

2. TEAD physically interacts with ER α and promotes ER α binding to its target promoter

To determine whether TEAD modulates ER α binding to its target promoter prior to down-regulation of protein ER α levels, we knocked down TEAD4 in MCF-7 cells under hormone-depleted conditions, where inhibition of ER α binding to chromatin did not affect its stability. Control and TEAD4RNAi cells were stimulated with E2 for 3 hours, followed by Western blot, RT-qPCR and ChIP-qPCR analysis. We found that TEAD4KD reduced era occupancy on its target promoter and suppressed era target gene expression without affecting era protein levels (fig. 35 and 36).

3. YAP interference with ER alpha-TEAD synergy by competitive TEAD

Cells were crosslinked for 10 minutes by adding 1% final concentration of formaldehyde or 2mM DSG crosslinker (CovaChem, cat # 13302), fixed at room temperature for 1 hour, then fixed a second time with 1% formaldehyde (Pierce, cat # 28908) for 10 minutes, then quenched by addition of glycine. Subsequently, the cells were washed with PBS and lysed. The cell extract is sonicated. After centrifugation, the cell extracts were incubated with the prepared ER α/TEAD/YAP antibody-Dynabeads (Invitrogen, cat # 11031), washed with buffer and cross-linked overnight at 65 ℃.

The antibodies used in ChIP-qPCR were anti-ER α (Santa Cruz, Cat. sc-8002x), anti-TEAD 4(Santa Cruz, Cat. sc-101184) and anti-YAP (Santa Cruz, Cat. sc-271134). The enriched DNA was extracted by DNA extraction kit (Qiagen, catalog No. 28106) and subjected to quantitative PCR analysis. Here, 21 primer sequences for ChIP-qPCR are shown:

ESR1，F：AAGCAAGGGAGGAATGCCAG，R：AGGCATAGCTCACTCCTGTC；

GREB1，F：GGCTCCAGTCCAAGTACACA，R：GCCCTGAAGTGTTTTGCTGG；

TFF1(PS2)，F：GGCAGGCTCTGTTTGCTTAAA，R：TTCCATGTAGCTTGACCATGTCT；

PDZK1，F：AGGCCCAGCAAAGACAAATG，R：AAACCACAGGCTGAGGACTG；

CCND1，F：AACAAAACCAATTAGGAACCTT，R：CTTGGGGTCCATGTTCTGC T。

TEAD4 was knocked down in MCF-7 cells under hormone-depleted conditions, where inhibition of ER α binding to chromatin did not affect its stability. Control and TEAD4RNAi cells were stimulated with E2 for 3 hours, followed by Western blot, RT-qPCR and ChIP-qPCR analysis. We found that TEAD4KD reduced era occupancy on its target promoter and suppressed era target gene expression without affecting era protein levels (fig. 35 and 36).

By ChIP-qPCR, we found that TEAD4 co-occupied the promoter region of the ER α target gene with ER α (FIG. 37). It also occupied the same region on the ER α target promoter as YAP, compared to CTGF promoter binding (fig. 37).

To fully understand how ER α, TEAD, YAP bind Chromatin in MCF-7 cells, we analyzed previously published ChIP seq datasets (Elster, D.et al. TRPS1 maps YAP/TEAD-dependent transcription in break cancer cells. Nat Commun 9,3115(2018) and Swinstead, E.E.et al. Stemid Receptors Repurram FoxA1 Occupency through Chromatin chromatography transitions. cell 165,593-605 (2016)). We found that era and TEAD1 co-bound 10848 peaks on chromatin, the fraction (3040) of which was also YAP-constrained (fig. 38). GSEA analysis showed that the ER α/TEAD1 co-binding gene was enriched in XMU-MP-1 or YAP-5SA down-regulated genes in MCF-7 cells (FIG. 39). Of the 165 XMU-MP-1 downregulated ER α target genes, 139 (84%) contained the ER binding peak, 139 (84%) contained the ER α/TEAD co-binding peak, and 26 (16%) contained the ER peak only (FIGS. 40-45). Thus, TEAD and era may synergistically regulate most ER α target genes.

Co-IP experiments showed that TEAD4 and TEAD1 formed complexes with ER α (FIG. 46). In contrast, although YAP interacted with TEAD4 in the same Co-IP experiment (fig. 46a), YAP did not form a complex with era (fig. 46a), indicating that era/TEAD and YAP/TEAD were present in the isolated complexes. To determine whether the formation of the TEAD/era complex on chromatin promotes the binding of era to its target promoter, we mapped domains of TEAD4 and era that direct their interaction in HEK293T cells. The TEAD4 protein contained an N-terminal TEA domain that interacted with DNA and a C-terminalYAP binding domain (fig. 47 a).

The ER α protein consists of the AF1 domain (aa1-180), the DNA binding domain (aa181-300) that binds to the ER Response Element (ERE), and the AF2 domain (aa300-595) that binds to the ligand (FIG. 47 b). Deletion analysis indicated that TEAD4 interacted with era through its YAP binding domain, while era interacted with TEAD4 through its AF2 domain (fig. 48). ChIP-qPCR experiments showed that expression of full-length TEAD4(1-434) enhanced the binding of co-expressed ER α to its target promoter in HEK293T cells, but failed to do so (FIG. 49a) in the absence of either the DNA binding domain (TEAD4_131-434) or a TEAD4 deletion mutant of the ER α binding domain (TEAD4_ 1-220). In addition, deletion of the TEAD binding domain from era (ER α _ AF1+ DBD) also abolished its ability to bind synergistically with TEAD4 on its target promoter (fig. 49b, c).

When co-expressed in HEK293T cells, GFP-TEAD4 formed a complex with HA-ER α and promoted binding of ER α to its target promoter (FIG. 50). HEK293T cells were transfected with fixed amounts of GFP-TEAD4 and HA-ER α and increasing amounts of Flag-YAP, followed by Co-IP and Western blot analysis, and the results showed that Co-expression of Flag-YAP decreased the amount of HA-ER α pulled down by GFP-TEAD4, along with an increase in YAP-TEAD4 complex formation (FIG. 50 a). Furthermore, different plasmids were separately overexpressed in HEK293T cells and analyzed for HA-era binding to their target promoter using ChIP-qPCR, showing that co-expression of Flag-YAP blocked the ability of GFP-TEAD4 to promote HA-era binding to its target promoter in HEK293T cells (fig. 50 b). Treatment of MCF-7 cells with XMU-MP-1 increased the association between endogenous TEAD4 and YAP, but decreased the association between endogenous TEAD4 and ER α (FIG. 51). In addition, YAP was treated with 0.2 μ g/ml Dox for 10 hours with control MCF-7 cells or MCF-7 cells expressing Tet-O-YAP5SA or Tet-O-YAP5SAS94A, followed by Co-IP and western blot analysis, and the results showed that Dox-induced YAP5SA, but not YAP5SAS94A, reduced the association of ER α with TEAD4 (fig. 52), indicating that binding of YAP to TEAD blocks ER α/TEAD interaction.

Although treatment of MCF-7 cells with XMU-MP-1 separated ER α from its target promoter (FIG. 26b, FIG. 53a), the binding of TEAD4 to the ER α target promoter remained relatively unchanged (FIG. 53 b). In contrast, XMU-MP-1 increased YAP binding to the ER α target gene promoter region, including ESR1 (FIG. 53 c). Similarly, expression of YAP5SA increased YAP binding while blocking ER α binding to ER α target promoter (fig. 27a, fig. 53 d). These observations indicate that YAP-TEAD and ER α -TEAD are present in two different complexes that competitively bind with the 12 promoter regions of ER α target genes, including ESR 1. MST1/2 suppression or YAP overexpression promoted promoter occupancy switching from ER α -TEAD to YAP-TEAD complexes.

Example 8

YAP inhibits hormone-independent ESR1 transcription

XMU-XP-1 or the observation that YAP overexpression repressed basal expression of ER α target genes under hormone-depleted conditions suggests that binding of YAP to ER α target promoters may also actively repress gene expression in addition to blocking ER α recruitment (FIGS. 54-55). To determine whether YAP also inhibited basal expression of ESR1, MCF-7 cells grown under hormone-depleted conditions were treated with XMU-XP-1, and then subjected to RT-PCR to determine expression of ESR1 and other era target genes. We found that in addition to GREB1, PS2 and PDZK1, XMU-XP-1 treatment inhibited basal transcription of ESR1 (FIG. 56 a). Similarly, expression of YAP-5SA in MCF-7 cells grown under hormone-depleted conditions, but not YAP-5SAS94A, also inhibited basal expression of ESR1, GREB1, PS2, and PDZK1 (FIG. 56 b). These results indicate that YAP inhibits the expression of ESR1 and other era target genes, both by inhibiting the binding of era to its promoter region and blocking its basal transcription, possibly by recruiting co-suppressors.

Example 9

MST1/2 inhibition can overcome hormone therapy resistance

1. MST1/2 inhibits transcriptional activity of tamoxifen resistant ER alpha mutant

Mutations in the ER α ligand binding domain, including Y537C/S/N and D538G, are hot spots in ER + cancer patients who are resistant to hormone therapy. Of these mutations, Y537S is the most common one among tamoxifen resistant patients. We used a lentiviral system to generate MCF-7 cell lines stably expressing either wild-type (ER α -WT) or mutant ER α (ER α -Y537S) (FIG. 57). The specific methods of viral infection and transient transfection are:

for viral infection, by Lipofectamine2000(ThermoFisher scientific, Cat. No.11668) or Polyjet (Signagen laboratories, cat # SL 100688). After 48 hours, the culture supernatant was collected and filtered through a 0.45 μm filter. The virus-containing supernatant was stored at 4 ℃ for cell infection. Breast cancer cells were cultured in fresh medium and subsequently infected overnight with lentivirus together with polybrene (Sigma, cat. No. h 9268). For cell transfection, Lipofectamine2000(Invitrogen) was used according to the instructions. RNA extraction and RT-qPCR analysis were performed according to the instructions (Qiagen, cat # 74106). After RNA extraction, 20 cDNAs were synthesized by reverse transcription PCR of RNA according to RT-PCR kit (applied biosystems, Cat. No. 4368814). Relative gene expression was measured according to the 2- Δ Δ CT method. Housekeeping gene 36B4 was used for internal controls.

The primer sequence is as follows: YAP, F: TCCACCAGTGCAGCAGAATA, R: TTGGGTCTAGCCAAGAGGTG are provided.

CTGF，F：CTCGCGGCTTACCGACTG，R：GGCTCTGCTTCTCTAGCCTG。

CYR61,F:AGCAGCCTGAAAAAGGGCAA,R:AGCCTGTAGAAGGGAAACGC。

36B4，F：GGCGACCTGGAAGTCCAACT；R：CCATCAGCACCACAGCCTTC。

GREB1，F：CGTGTGGTGACTGGAGTAGC，R：ACCTCTTCAAAGCGTGTCGT。

ESR1，F：GCTACGAAGTGGGAATGAAAG，R：TCTGGCGCTTGTGTTTCAAC。

PS2(TFF1)，F：CATCGACGTCCCTCCAGAAGAG，R：CTCTGGGACTAATCACCGTGCTG。

CCND1，F：ATCAAGTGTGACCCGGACTG，R：CTTGGGGTCCATGTTCTGCT。

PDZK1，F：CCTGAGTGAACGAACAGAGC，R：TCTCTGCTGGGCTACACTTC。

As expected, ER α -Y537S-expressing cells exhibited resistance to tamoxifen treatment in terms of cell proliferation and expression of ER α target genes; however, ER α -Y537S and ER α -WT expressing cells were also sensitive to XMU-MP-1 treatment (FIGS. 58 and 59). Furthermore, XMU-MP-1 inhibited the interaction between TEAD4 and ER α -Y537S (FIG. 60), which may explain why XMU-MP-1 may inhibit the transcriptional activity of this tamoxifen resistant ER α mutant.

2. Inhibition of hormone therapy resistant ER alpha mutants by MST1/2 in vivo

MCF-7 xenografts expressing era-Y537S and patient-derived xenograft (PDX) models with WHIM20 breast cancer cells were generated. The model establishing method comprises the following steps:

procedures for all animal experiments were reviewed and approved by IACUC of UT southwest medical school. Female nodscidgama (nsg) mice were supplemented with estrogen by subcutaneous injection. Slow-release 17 beta-estradiol particles (0.72mg/90 day release; 24 US Innovation research) (2X 10) were implanted one day before tumor cells were injected into mammary fat pad⁶MCF-7 cells suspended in 100ul matrigel solution) when the mean volume of tumor xenografts reached-60 mm³(length × width 2/2), mice were randomly assigned to experimental treatment groups (7-8 mice/group). XMU-MP-1 (dissolved in 20% Kolliphor HSS 15. in 0.1% citric acid aqueous solution) was administered to the abdominal cavity at a dose of 3mg or 10mg/kg daily for 1 month, and the control group was injected with the solvent. Dox in PBS was injected intraperitoneally at 20mg/kg daily. Patient-derived breast cancer cells WHIM20(Horizo n discovery, st. louis, MO) were derived from skin metastases of breast cancer patients and characterized as HER2-, ER + and PR +. WHIM20 tumor cells (5X 10) suspended in 100ul matrigel and DMEM mixture (1:1)⁵Individual cells) were injected subcutaneously into NSG mice (without any treatment). Tumor size was measured weekly after visualization, and XMU-MP-1 treatment was the same as described above.

WHIM20 is a well-characterized HER2-, ER +, PR + PDX model of breast cancer. The cell line was derived from skin metastases, had a Y537S mutation in era, a C182X mutation in P53, an E542K mutation in PIK3CA, and grew independently of estradiol. In both cases, female NSG mice bearing MCF-7 tumors overexpressing ER α -Y537S received intraperitoneal injections of 3mg/kg XMU-MP-1 or solvent daily for up to one month significantly attenuated tumor growth (FIGS. 61-62), suggesting that targeting the Hippo pathway may overcome the therapeutic resistance conferred by mutant ER α.

It should be noted that when the following claims refer to numerical ranges, it should be understood that both ends of each numerical range and any value between the two ends can be selected, and since the steps and methods used are the same as those of the embodiments, the preferred embodiments of the present invention have been described for the purpose of preventing redundancy, but once the basic inventive concept is known, those skilled in the art may make other variations and modifications to the embodiments. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Claims

Application of a Hippo signal pathway blocker in preparing an ER + breast tumor resisting medicine.
2. The use according to claim 1, wherein the Hippo signalling pathway blocker is a MST1/2 kinase inhibitor.
3. The use according to claim 2,

the MST1/2 kinase inhibitor is used for preparing growth inhibitors of ER + breast tumor cells MCF-7 and T47D; and/or

The MST1/2 kinase inhibitor is used for preparing ER alpha protein level down-regulator in MCF-7 and T47D cells; and/or

The MST1/2 kinase inhibitor is used for preparing a binding inhibitor of ER alpha and a target promoter thereof; and/or

The MST1/2 kinase inhibitor is used for preparing an ER alpha target gene expression inhibitor.
4. The use according to claim 3, wherein the MST1/2 kinase inhibitor is capable of inhibiting the growth of ER + breast tumor cells by activating YAP.
5. The use of claim 4 wherein the YAP inhibits ER α binding to its target promoter by competing for TEAD.
6. The use according to claim 3, wherein the ER α target genes are GREB1, PS2, PDZK1 and CCND 1.
7. The use according to any one of claims 2 to 6, wherein the MST1/2 kinase inhibitor is XMU-MP-1.
8. The use according to claim 2, wherein the MST1/2 kinase inhibitor is capable of ameliorating resistance to hormone therapy of ER + breast tumours, wherein the resistance is caused by a mutation in the era ligand binding domain.
9. The use according to claim 8, wherein the MST1/2 kinase inhibitor is used to prepare an inhibitor of transcriptional activity of a tamoxifen resistant era mutant.
10. A medicament against the resistance of hormone therapy ER + breast tumours comprising an MST1/2 kinase inhibitor as claimed in any one of claims 8 to 9.