CN113957087B - Application of Sub gene in regulation and control of rice cold resistance - Google Patents
Application of Sub gene in regulation and control of rice cold resistance Download PDFInfo
- Publication number
- CN113957087B CN113957087B CN202111388006.7A CN202111388006A CN113957087B CN 113957087 B CN113957087 B CN 113957087B CN 202111388006 A CN202111388006 A CN 202111388006A CN 113957087 B CN113957087 B CN 113957087B
- Authority
- CN
- China
- Prior art keywords
- ala
- gly
- ser
- val
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/63—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21062—Subtilisin (3.4.21.62)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides application of a Sub gene in regulating and controlling plant cold resistance, and the nucleotide sequence of the Sub gene is shown as SEQ ID No. 1. The invention uses CRISPR technology to knock out Sub gene in plant to obtain cold-resistant transgenic plant, and applies Sub gene to the improvement of rice cold resistance, which has important meaning for cultivating new variety of stress-resistant rice and even genetic improvement of plant stress resistance.
Description
Technical Field
The invention relates to the fields of genetic engineering and molecular biology, in particular to application of a Sub gene in regulating and controlling plant cold resistance.
Background
The original China of rice is one of the important grain crops worldwide. With the increasing world population, the area of cultivated land is gradually reduced, and how to increase the yield and quality of grains has become a subject of considerable research. The rice is taken as the most important grain crop in China, the yield is the first place of the grain crop, and the sowing area accounts for 1/3 of the total area of the grain crop. The low-temperature cold injury is used as main adversity stress, has serious influence on the growth of rice in each period, especially in the bud seedling period, and is a main limiting factor in the rice crop production in China. Serious low-temperature cold damage can lead to the average annual yield reduction of 50-100 hundred million kilograms in the main production area of the northeast japonica rice, which is about 20 percent of the total yield of the normal year. Meanwhile, the direct seeding of rice is a necessary development trend of Chinese rice production, one of the biggest problems at present is poor cold resistance of rice in a bud seedling stage, and the direct seeding period of the rice is greatly limited, so that the cultivation of cold-resistant varieties of the rice has great significance in improving the yield and quality of the rice in China, popularizing the direct seeding area of the rice and guaranteeing the grain safety.
Sub（Os01g0769200) The gene belongs to the rice subtilisin family, the functional report of the protein in plants is very few, and whether the protein is related to the cold resistance of plants is not reported yet.
Disclosure of Invention
The invention aims to solve the problem of poor cold resistance of rice in a bud seedling stage and provides application of a Sub gene in regulating and controlling the cold resistance of the rice.
In order to achieve the technical purpose, the invention adopts the following technical scheme:
the invention provides an application of a Sub gene in regulating and controlling plant cold resistance, wherein the Sub gene has any one of the following nucleotide sequences:
i) A nucleotide sequence shown as SEQ ID No. 1; or (b)
ii) the nucleotide sequence shown in SEQ ID No.1 is substituted, deleted and/or added with one or more nucleotides and expresses the nucleotide sequence of the same functional protein; or (b)
iii) A nucleotide sequence which hybridizes under stringent conditions to the sequence shown in SEQ ID No. 1; or (b)
iv) a nucleotide sequence which has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses the same functional protein.
The coding region of the Sub gene consists of 2550 bases, and the Sub gene is derived from rice variety ZH11.
The invention also provides an application of the protein coded by the Sub gene in regulating and controlling plant cold resistance, wherein the protein has any one of the following amino acid sequences:
i) An amino acid sequence shown in SEQ ID No. 2; or (b)
ii) the amino acid sequence shown in SEQ ID No.2 is substituted, deleted and/or added with one or more amino acids and expresses the amino acid sequence of the same functional protein; or (b)
iii) An amino acid sequence which hybridizes under stringent conditions to the sequence shown in SEQ ID No. 2; or (b)
iv) fusion proteins obtained by ligating a tag to the N-and/or C-terminus of the protein as shown in i), ii) or iii).
Stringent conditions in the above applications refer to: hybridization in 0.1 XSSPE containing 0.1% SDS or 0.1 XSSC containing 0.1% SDS at 65℃and washing the membrane with the solution;
it will be appreciated that, given the degeneracy of codons and the preference of codons of different species, one skilled in the art can use codons suitable for expression of a particular species as desired.
The invention also provides a method for regulating and controlling cold resistance of plants, which is realized by knocking out the Sub genes in plants or reducing the expression of the Sub genes in receptor plants.
Preferably, the method uses CRISPR gene editing technology to make site-directed mutagenesis on the Sub gene, so that the function of the Sub gene is deleted or expression is reduced.
Preferably, the plant is a monocotyledonous plant, more preferably rice.
After site-directed mutagenesis of the Sub gene of the invention, a rice mutant with a loss of function is obtained. Mutant rice exhibits a cold-tolerant phenotype. To facilitate identification and selection of transgenic plants, the vectors used may be processed, for example by the addition of plant selectable markers or antibiotic markers of resistance, etc.
Compared with the prior art, the invention has the following beneficial effects:
according to the invention, through research on a gene Os01g0769200 for encoding plant subtilisin, the plant subjected to deletion mutation has a remarkable cold-resistant phenotype compared with a wild plant.
The Sub gene is separated from rice, and is applied to the improvement of the cold resistance of the rice, so that the method has very important significance for cultivating new varieties of stress-resistant rice and even genetic improvement of plant stress resistance.
Drawings
FIG. 1 shows the sequencing results of the mutant and wild-type controls in example 1 of the present invention.
FIG. 2 shows the growth phenotype of the mutant in example 2 of the present invention at normal temperature and low temperature (wherein A is a photograph of the growth of the plant after the normal growth condition and the low temperature treatment for 1,2,3 days, and B is the survival rate of the plant after the normal growth condition and the low temperature treatment for 1,2,3 days).
Detailed Description
Hereinafter, embodiments of the present invention will be described in detail. In order to avoid unnecessary detail, well-known structures or functions will not be described in detail in the following embodiments. Approximating language, as used in the following examples, may be applied to create a quantitative representation that could permissibly vary without resulting in a change in the basic function. Unless defined otherwise, technical and scientific terms used in the following examples have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Unless otherwise indicated, the examples are in accordance with conventional experimental conditions, such as the molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell DW, molecular cloning: a laboratory manual, 2001), or in accordance with the manufacturer's instructions.
The main reagents in the following examples were: various restriction enzymes, taq DNA polymerase, available from biological companies such as NEB, TAKARA, etc.; plasmid miniprep kit and agarose gel recovery kit were purchased from Tiangen biosystems, inc; agar powder, agarose, various antibiotics, glucose, BSA, LB Medium, etc. are available from Sigma, bio-Rad, etc.; the various other chemical reagents used in the examples were all imported or home-made analytically pure reagents.
EXAMPLE 1 homozygous identification of Sub Gene deletion mutants
Deletion mutant T of Sub Gene 1 The generation seeds are purchased from external companies, and homozygous mutant plants are screened through PCR identification and sequencing, and subsequent cold-resistant phenotype identification experiments are carried out.
The mutation site detection process of the wild type and the mutant is as follows:
1. sampling
The mutant and control (wild type) plants were sampled, 3-5cm of the middle leaf segment was labeled in a 2ml centrifuge tube containing beads and stored at-80 ℃.
2. CTAB method for extracting DNA
1. Taking out from-80 deg.C, and grinding with SCIENTZ-192 high throughput tissue grinder.
2. After sample milling, 750ul of CTAB was added to each tube and shaken well.
The mixture was taken out and shaken several times every 15min in a water bath at 3.65℃for 45 min.
4. 500ul of chloroform was added to each tube, shaken well, and allowed to stand for delamination.
5. At normal temperature, the mixture was centrifuged at 12000rpm for 10min. The supernatant (500-600 ul) was taken into a 1.5ml centrifuge tube.
6. 500ul of isopropanol was added to each tube, and the tubes were shaken well and then frozen at-20℃for 2h.
7. After removal from-20℃the mixture was centrifuged at 12000rpm for 10min at 4℃and the supernatant was discarded.
8. 1ml of 75% ethanol was added to each tube, and the mixture was centrifuged at 12000rpm at room temperature for 3 minutes, and the supernatant was carefully poured off.
9. The step 8 is repeated once.
10. Uncovering the cover for 15-30min in a baking oven at normal temperature or 37 ℃, and airing residual ethanol and water in the pipe.
11. Adding proper distilled water to dissolve DNA, and mixing with a shaker.
12. DNA concentration was determined using NANODROP 1000.
3. PCR
The mutant DNA and the DNA of the control group ZH11 were subjected to PCR with the F-primer (CTACTAGCTTCATCAGCTCCAC) and the R-primer (GGAGAGATTCTCACCCAAACTG), and a 30ul system reaction system was as follows:
Template 3 ul
2*MIX 15 ul
primer F1.5 ul
Primer R1.5 ul
ddH2O 9 ul
The PCR procedure was as follows:
95℃ 3min
95℃ 30s
56℃ 30s
72℃ 30s
72℃ 5min
16℃ foever
4. 1% agarose gel electrophoresis
Taking 5ul sample of PCR product, running electrophoresis at 250v for 12min. The mutant and control DNA had bright bands at about 500bp, and the remaining 25ul PCR products were sequenced.
5. Sequencing result analysis
The sequencing results were analyzed using Snapgene software and the mutant sequences were aligned with the ZH11 sequences to determine the mutation sites of each mutant.
As a result of detection, when the mutant is compared with the wild type, it can be seen in FIG. 1 that deletion occurs at 567 th base, leading to premature termination of translation (Sub gene sequence is sequence shown as Seq ID No.1, dotted line box marks 567C mutation site; complete protein sequence is sequence shown as Seq ID No. 2. Sub mutation gene sequence is sequence shown as Seq ID No. 3. Sub mutation protein sequence is sequence shown as Seq ID No. 4. Sub mutation protein sequence which is generated to terminate in advance is sequence shown as Seq ID No. 4.)
Example 2 Cold tolerance detection of mutant plants
The control material wild type (zh 11) rice seedlings and the sub mutant obtained in the example 1 are respectively selected to be 40 full seeds, planted in rice culture soil, cultured in a 28 ℃ illumination incubator for about fifteen days to two leaves and one center period, moved to a 4 ℃ illumination incubator for 0,1,2 and 3 days respectively, moved to the 28 ℃ illumination incubator for 7 days for recovery and phenotype observation, and the plant survival rate is counted.
The results show (FIG. 2) that the mutants showed stronger cold resistance after different times of low temperature treatment than the wild type, and the data statistics indicate that the mutants have higher survival rate. This demonstrates that the cold tolerance of the sub mutant plants is significantly improved. Therefore, the cold resistance of the plant can be obviously improved after the mutation of the rice Sub gene.
The foregoing describes the embodiments of the present invention in detail, but the description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent replacement, improvement, etc. made within the scope of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Tianjin agricultural academy of sciences
Application of <120> Sub gene in regulation of rice cold resistance
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2550
<212> DNA
<213> Artificial Sequence
<400> 1
atgggttggg cgtggcggag ggagcagtgg gcggttgcat ggctgtccgt ggcggttctt 60
ggggcggcgc tggtgggcgc cgctggcgcg ttcgaggagg gcacggcggt gtacattgtg 120
accatgaagc aggcgccggt gttccacaag cgcctcgacc tggagaggtt tgggagcagc 180
agagtcgccg gcggcggcgg cggcggcggg ggggacaccc cgtccactag catcctcatg 240
aagccaaggc atggtccagc ccaacctatg aattatggct cgtacttagt tcgtcttcaa 300
aattcactct tgaagagaac actgagagga gagcgctata taaagctcta cagctaccgc 360
tatctgatta atggttttgc tgttgtcatc actcctcagc aggcagagag gctatctatg 420
acgaaagaag tggcaaatgt aatgttggac ttctcagtta ggacggcaac aactcatacc 480
cctgaattcc ttggtttgcc acaaggagca tgggttcaag agggtggccc acaatgtgct 540
ggtcagggtg ttgttgttgg cctcatcgac acaggaatcg atccaactca tcccagcttc 600
gcagacgact tgataactga cagttatcct gttcctgctc attactctgg catttgcgag 660
gttacaaatg attttccatc tggatcctgc aacagaaaac ttgtgggagc taggcatttt 720
gcagcctctg caataaccag gggagtgttc aatgcctctc aagatcatgc ttcaccttct 780
gatagtgatg gtcatgggac ccatacagca tccatagcag ctggtaatca tggaattcct 840
gttgttgtgg ctgggcatca ttttgggaat gcaagtggaa tggctcctcg tgcacacatt 900
gctgtctata aagctctgta caaaagcttt ggagggtttg ctgctgatgt agtagctgca 960
atagatcagg cagctgaaga taatgttgat ataatcagct tatccattac cccaaataga 1020
aggcctcctg gactagccac cttctttaat ccaattgaca tggctcttct ttcagctgta 1080
aaagctggca tatttgtcgt gcaagctgca ggaaatacag gtccttcccc caagagcatg 1140
tcatcataca gtccatggat ttttactgta ggagcatctg cccatgacag ggaatacaac 1200
aactatgttg tacttggcaa caatctgacc attacaggag ttggccttgc tcctggaaca 1260
gatggtgatt ccatgttcac tctagttgct gcacctcatg cactgaaaaa caatgtagcc 1320
agtcctactg aaatgtccct aggggagtgc caagattcaa gccaccttga tgaagatctg 1380
ataaggggaa agatactggt ctgcagctat tccatacgat ttgtacttgg cctgtcgtct 1440
gtgaagcaag ctttagatac tgcaaagaat gtcagtgctg caggagttat attctatctg 1500
gatccatttg tcattggatt ccagctgaat ccaactccaa tggatatgcc tggacttata 1560
ataccatcat ctgatgactc taaggtattt ctaaattatt acaatgagtc ccttgtgaga 1620
gatgagacct caaacaaaat cgtcagcttt ggtgcaattg caaaaatact aggaggccaa 1680
aatccaaatt atggtatttc tgccccaaaa gtaatgtttt attctgccag gggtcctgat 1740
cctgaggaca actcactggc caatgctgat atcctgaagc caaatctgat agcacctggc 1800
agttccattt ggggtgcttg gagttctctt ggattggact ctgctgaatt tgctggtgaa 1860
agttttgcaa taatttccgg tacaagtatg gctgcaccac acgttgctgg gcttgctgct 1920
ctagtcaagc agaagttccc ttattttagc cctgcagcta taggttctgc attatcgact 1980
actacaagtc tcagtgacag ggaggggaat ccaatcatgg cacagagaac atacggcaat 2040
ccaaattcaa ctcaatctcc agctacacct tttgacatgg gaaatggatt tgtcaatgct 2100
actgctgctt tggatcctgg gctcatattt gattccagtt acgacgactt cttctccttt 2160
ctatgtggca taaacggctc tgctccagta gtgatgaatt acaccggcaa cagctgcagc 2220
tcctccgcca tgacaggggc tgatctgaac ctcccctcca tcaccattgc agtgctcaac 2280
cagtcaagaa cgataacaag aactgtaacc aacgtggcga gcgacgagcg ctacacggtc 2340
agttacagcg ccccttacgg ggtcgccgtc tccgcgtcgc cggcccagtt cttcatcccc 2400
agcgggcaga ggcagcaggt gaccttcgtc gtcaacgcca ccatgaacgg cacctccgcg 2460
agcttcggca gcgtcggctt ctacggcgac aagggccacc gggtgatgat cccgttctca 2520
gttatctcca aggttgtgca ccgttcatga 2550
<210> 2
<211> 849
<212> PRT
<213> Artificial Sequence
<400> 2
Met Gly Trp Ala Trp Arg Arg Glu Gln Trp Ala Val Ala Trp Leu Ser
1 5 10 15
Val Ala Val Leu Gly Ala Ala Leu Val Gly Ala Ala Gly Ala Phe Glu
20 25 30
Glu Gly Thr Ala Val Tyr Ile Val Thr Met Lys Gln Ala Pro Val Phe
35 40 45
His Lys Arg Leu Asp Leu Glu Arg Phe Gly Ser Ser Arg Val Ala Gly
50 55 60
Gly Gly Gly Gly Gly Gly Gly Asp Thr Pro Ser Thr Ser Ile Leu Met
65 70 75 80
Lys Pro Arg His Gly Pro Ala Gln Pro Met Asn Tyr Gly Ser Tyr Leu
85 90 95
Val Arg Leu Gln Asn Ser Leu Leu Lys Arg Thr Leu Arg Gly Glu Arg
100 105 110
Tyr Ile Lys Leu Tyr Ser Tyr Arg Tyr Leu Ile Asn Gly Phe Ala Val
115 120 125
Val Ile Thr Pro Gln Gln Ala Glu Arg Leu Ser Met Thr Lys Glu Val
130 135 140
Ala Asn Val Met Leu Asp Phe Ser Val Arg Thr Ala Thr Thr His Thr
145 150 155 160
Pro Glu Phe Leu Gly Leu Pro Gln Gly Ala Trp Val Gln Glu Gly Gly
165 170 175
Pro Gln Cys Ala Gly Gln Gly Val Val Val Gly Leu Ile Asp Thr Gly
180 185 190
Ile Asp Pro Thr His Pro Ser Phe Ala Asp Asp Leu Ile Thr Asp Ser
195 200 205
Tyr Pro Val Pro Ala His Tyr Ser Gly Ile Cys Glu Val Thr Asn Asp
210 215 220
Phe Pro Ser Gly Ser Cys Asn Arg Lys Leu Val Gly Ala Arg His Phe
225 230 235 240
Ala Ala Ser Ala Ile Thr Arg Gly Val Phe Asn Ala Ser Gln Asp His
245 250 255
Ala Ser Pro Ser Asp Ser Asp Gly His Gly Thr His Thr Ala Ser Ile
260 265 270
Ala Ala Gly Asn His Gly Ile Pro Val Val Val Ala Gly His His Phe
275 280 285
Gly Asn Ala Ser Gly Met Ala Pro Arg Ala His Ile Ala Val Tyr Lys
290 295 300
Ala Leu Tyr Lys Ser Phe Gly Gly Phe Ala Ala Asp Val Val Ala Ala
305 310 315 320
Ile Asp Gln Ala Ala Glu Asp Asn Val Asp Ile Ile Ser Leu Ser Ile
325 330 335
Thr Pro Asn Arg Arg Pro Pro Gly Leu Ala Thr Phe Phe Asn Pro Ile
340 345 350
Asp Met Ala Leu Leu Ser Ala Val Lys Ala Gly Ile Phe Val Val Gln
355 360 365
Ala Ala Gly Asn Thr Gly Pro Ser Pro Lys Ser Met Ser Ser Tyr Ser
370 375 380
Pro Trp Ile Phe Thr Val Gly Ala Ser Ala His Asp Arg Glu Tyr Asn
385 390 395 400
Asn Tyr Val Val Leu Gly Asn Asn Leu Thr Ile Thr Gly Val Gly Leu
405 410 415
Ala Pro Gly Thr Asp Gly Asp Ser Met Phe Thr Leu Val Ala Ala Pro
420 425 430
His Ala Leu Lys Asn Asn Val Ala Ser Pro Thr Glu Met Ser Leu Gly
435 440 445
Glu Cys Gln Asp Ser Ser His Leu Asp Glu Asp Leu Ile Arg Gly Lys
450 455 460
Ile Leu Val Cys Ser Tyr Ser Ile Arg Phe Val Leu Gly Leu Ser Ser
465 470 475 480
Val Lys Gln Ala Leu Asp Thr Ala Lys Asn Val Ser Ala Ala Gly Val
485 490 495
Ile Phe Tyr Leu Asp Pro Phe Val Ile Gly Phe Gln Leu Asn Pro Thr
500 505 510
Pro Met Asp Met Pro Gly Leu Ile Ile Pro Ser Ser Asp Asp Ser Lys
515 520 525
Val Phe Leu Asn Tyr Tyr Asn Glu Ser Leu Val Arg Asp Glu Thr Ser
530 535 540
Asn Lys Ile Val Ser Phe Gly Ala Ile Ala Lys Ile Leu Gly Gly Gln
545 550 555 560
Asn Pro Asn Tyr Gly Ile Ser Ala Pro Lys Val Met Phe Tyr Ser Ala
565 570 575
Arg Gly Pro Asp Pro Glu Asp Asn Ser Leu Ala Asn Ala Asp Ile Leu
580 585 590
Lys Pro Asn Leu Ile Ala Pro Gly Ser Ser Ile Trp Gly Ala Trp Ser
595 600 605
Ser Leu Gly Leu Asp Ser Ala Glu Phe Ala Gly Glu Ser Phe Ala Ile
610 615 620
Ile Ser Gly Thr Ser Met Ala Ala Pro His Val Ala Gly Leu Ala Ala
625 630 635 640
Leu Val Lys Gln Lys Phe Pro Tyr Phe Ser Pro Ala Ala Ile Gly Ser
645 650 655
Ala Leu Ser Thr Thr Thr Ser Leu Ser Asp Arg Glu Gly Asn Pro Ile
660 665 670
Met Ala Gln Arg Thr Tyr Gly Asn Pro Asn Ser Thr Gln Ser Pro Ala
675 680 685
Thr Pro Phe Asp Met Gly Asn Gly Phe Val Asn Ala Thr Ala Ala Leu
690 695 700
Asp Pro Gly Leu Ile Phe Asp Ser Ser Tyr Asp Asp Phe Phe Ser Phe
705 710 715 720
Leu Cys Gly Ile Asn Gly Ser Ala Pro Val Val Met Asn Tyr Thr Gly
725 730 735
Asn Ser Cys Ser Ser Ser Ala Met Thr Gly Ala Asp Leu Asn Leu Pro
740 745 750
Ser Ile Thr Ile Ala Val Leu Asn Gln Ser Arg Thr Ile Thr Arg Thr
755 760 765
Val Thr Asn Val Ala Ser Asp Glu Arg Tyr Thr Val Ser Tyr Ser Ala
770 775 780
Pro Tyr Gly Val Ala Val Ser Ala Ser Pro Ala Gln Phe Phe Ile Pro
785 790 795 800
Ser Gly Gln Arg Gln Gln Val Thr Phe Val Val Asn Ala Thr Met Asn
805 810 815
Gly Thr Ser Ala Ser Phe Gly Ser Val Gly Phe Tyr Gly Asp Lys Gly
820 825 830
His Arg Val Met Ile Pro Phe Ser Val Ile Ser Lys Val Val His Arg
835 840 845
Ser
<210> 3
<211> 2549
<212> DNA
<213> Artificial Sequence
<400> 3
atgggttggg cgtggcggag ggagcagtgg gcggttgcat ggctgtccgt ggcggttctt 60
ggggcggcgc tggtgggcgc cgctggcgcg ttcgaggagg gcacggcggt gtacattgtg 120
accatgaagc aggcgccggt gttccacaag cgcctcgacc tggagaggtt tgggagcagc 180
agagtcgccg gcggcggcgg cggcggcggg ggggacaccc cgtccactag catcctcatg 240
aagccaaggc atggtccagc ccaacctatg aattatggct cgtacttagt tcgtcttcaa 300
aattcactct tgaagagaac actgagagga gagcgctata taaagctcta cagctaccgc 360
tatctgatta atggttttgc tgttgtcatc actcctcagc aggcagagag gctatctatg 420
acgaaagaag tggcaaatgt aatgttggac ttctcagtta ggacggcaac aactcatacc 480
cctgaattcc ttggtttgcc acaaggagca tgggttcaag agggtggccc acaatgtgct 540
ggtcagggtg ttgttgttgg cctcatgaca caggaatcga tccaactcat cccagcttcg 600
cagacgactt gataactgac agttatcctg ttcctgctca ttactctggc atttgcgagg 660
ttacaaatga ttttccatct ggatcctgca acagaaaact tgtgggagct aggcattttg 720
cagcctctgc aataaccagg ggagtgttca atgcctctca agatcatgct tcaccttctg 780
atagtgatgg tcatgggacc catacagcat ccatagcagc tggtaatcat ggaattcctg 840
ttgttgtggc tgggcatcat tttgggaatg caagtggaat ggctcctcgt gcacacattg 900
ctgtctataa agctctgtac aaaagctttg gagggtttgc tgctgatgta gtagctgcaa 960
tagatcaggc agctgaagat aatgttgata taatcagctt atccattacc ccaaatagaa 1020
ggcctcctgg actagccacc ttctttaatc caattgacat ggctcttctt tcagctgtaa 1080
aagctggcat atttgtcgtg caagctgcag gaaatacagg tccttccccc aagagcatgt 1140
catcatacag tccatggatt tttactgtag gagcatctgc ccatgacagg gaatacaaca 1200
actatgttgt acttggcaac aatctgacca ttacaggagt tggccttgct cctggaacag 1260
atggtgattc catgttcact ctagttgctg cacctcatgc actgaaaaac aatgtagcca 1320
gtcctactga aatgtcccta ggggagtgcc aagattcaag ccaccttgat gaagatctga 1380
taaggggaaa gatactggtc tgcagctatt ccatacgatt tgtacttggc ctgtcgtctg 1440
tgaagcaagc tttagatact gcaaagaatg tcagtgctgc aggagttata ttctatctgg 1500
atccatttgt cattggattc cagctgaatc caactccaat ggatatgcct ggacttataa 1560
taccatcatc tgatgactct aaggtatttc taaattatta caatgagtcc cttgtgagag 1620
atgagacctc aaacaaaatc gtcagctttg gtgcaattgc aaaaatacta ggaggccaaa 1680
atccaaatta tggtatttct gccccaaaag taatgtttta ttctgccagg ggtcctgatc 1740
ctgaggacaa ctcactggcc aatgctgata tcctgaagcc aaatctgata gcacctggca 1800
gttccatttg gggtgcttgg agttctcttg gattggactc tgctgaattt gctggtgaaa 1860
gttttgcaat aatttccggt acaagtatgg ctgcaccaca cgttgctggg cttgctgctc 1920
tagtcaagca gaagttccct tattttagcc ctgcagctat aggttctgca ttatcgacta 1980
ctacaagtct cagtgacagg gaggggaatc caatcatggc acagagaaca tacggcaatc 2040
caaattcaac tcaatctcca gctacacctt ttgacatggg aaatggattt gtcaatgcta 2100
ctgctgcttt ggatcctggg ctcatatttg attccagtta cgacgacttc ttctcctttc 2160
tatgtggcat aaacggctct gctccagtag tgatgaatta caccggcaac agctgcagct 2220
cctccgccat gacaggggct gatctgaacc tcccctccat caccattgca gtgctcaacc 2280
agtcaagaac gataacaaga actgtaacca acgtggcgag cgacgagcgc tacacggtca 2340
gttacagcgc cccttacggg gtcgccgtct ccgcgtcgcc ggcccagttc ttcatcccca 2400
gcgggcagag gcagcaggtg accttcgtcg tcaacgccac catgaacggc acctccgcga 2460
gcttcggcag cgtcggcttc tacggcgaca agggccaccg ggtgatgatc ccgttctcag 2520
ttatctccaa ggttgtgcac cgttcatga 2549
<210> 4
<211> 203
<212> PRT
<213> Artificial Sequence
<400> 4
Met Gly Trp Ala Trp Arg Arg Glu Gln Trp Ala Val Ala Trp Leu Ser
1 5 10 15
Val Ala Val Leu Gly Ala Ala Leu Val Gly Ala Ala Gly Ala Phe Glu
20 25 30
Glu Gly Thr Ala Val Tyr Ile Val Thr Met Lys Gln Ala Pro Val Phe
35 40 45
His Lys Arg Leu Asp Leu Glu Arg Phe Gly Ser Ser Arg Val Ala Gly
50 55 60
Gly Gly Gly Gly Gly Gly Gly Asp Thr Pro Ser Thr Ser Ile Leu Met
65 70 75 80
Lys Pro Arg His Gly Pro Ala Gln Pro Met Asn Tyr Gly Ser Tyr Leu
85 90 95
Val Arg Leu Gln Asn Ser Leu Leu Lys Arg Thr Leu Arg Gly Glu Arg
100 105 110
Tyr Ile Lys Leu Tyr Ser Tyr Arg Tyr Leu Ile Asn Gly Phe Ala Val
115 120 125
Val Ile Thr Pro Gln Gln Ala Glu Arg Leu Ser Met Thr Lys Glu Val
130 135 140
Ala Asn Val Met Leu Asp Phe Ser Val Arg Thr Ala Thr Thr His Thr
145 150 155 160
Pro Glu Phe Leu Gly Leu Pro Gln Gly Ala Trp Val Gln Glu Gly Gly
165 170 175
Pro Gln Cys Ala Gly Gln Gly Val Val Val Gly Leu Met Thr Gln Glu
180 185 190
Ser Ile Gln Leu Ile Pro Ala Ser Gln Thr Thr
195 200
Claims (3)
- Application of Sub gene in regulating and controlling rice cold resistance, wherein the Sub gene has the following nucleotide sequence:the nucleotide sequence shown as SEQ ID No.1, which knocks out the 567 th base thereof.
- 2. A method for regulating and controlling the cold resistance of rice is realized by knocking out a Sub gene in a plant body or reducing the expression of the Sub gene in a receptor rice body, wherein the Sub gene is shown as SEQ ID No.1, and the 567 th base of the Sub gene is knocked out.
- 3. The method for regulating and controlling cold tolerance of rice according to claim 2, wherein: the method uses CRISPR gene editing technology to make 567 th site knockout on the Sub gene, so that the function of the Sub gene is deleted or the expression is reduced.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111388006.7A CN113957087B (en) | 2021-11-22 | 2021-11-22 | Application of Sub gene in regulation and control of rice cold resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111388006.7A CN113957087B (en) | 2021-11-22 | 2021-11-22 | Application of Sub gene in regulation and control of rice cold resistance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113957087A CN113957087A (en) | 2022-01-21 |
| CN113957087B true CN113957087B (en) | 2023-04-28 |
Family
ID=79471530
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111388006.7A Active CN113957087B (en) | 2021-11-22 | 2021-11-22 | Application of Sub gene in regulation and control of rice cold resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113957087B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101155922A (en) * | 2005-02-09 | 2008-04-02 | 巴斯福植物科学有限公司 | Expression cassettes for regulation of expression in monocotyledonous plants |
| CN106754957A (en) * | 2016-12-05 | 2017-05-31 | 上海市农业生物基因中心 | The application of OsSCAMP13 genes and encoding proteins with resistance and acquisition methods |
| CN108070600A (en) * | 2012-02-29 | 2018-05-25 | 先正达参股股份有限公司 | The adjusting of seed vitality |
| CN113150097A (en) * | 2021-05-11 | 2021-07-23 | 黑龙江八一农垦大学 | Protein OsERF096 related to plant stress tolerance, and coding gene and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170218383A1 (en) * | 2001-11-19 | 2017-08-03 | Swetree Technologies Ab | Transcription regulators for improving plant performance |
-
2021
- 2021-11-22 CN CN202111388006.7A patent/CN113957087B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101155922A (en) * | 2005-02-09 | 2008-04-02 | 巴斯福植物科学有限公司 | Expression cassettes for regulation of expression in monocotyledonous plants |
| CN108070600A (en) * | 2012-02-29 | 2018-05-25 | 先正达参股股份有限公司 | The adjusting of seed vitality |
| CN106754957A (en) * | 2016-12-05 | 2017-05-31 | 上海市农业生物基因中心 | The application of OsSCAMP13 genes and encoding proteins with resistance and acquisition methods |
| CN113150097A (en) * | 2021-05-11 | 2021-07-23 | 黑龙江八一农垦大学 | Protein OsERF096 related to plant stress tolerance, and coding gene and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Liang HaiFu等.Development of specific molecular marker of coldtolerance gene CTB4a in rice base on PARMS..《Genomics and Applied Biology》.2021,第40卷(第4期),第1719-1724页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113957087A (en) | 2022-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109456394B (en) | Tomato SlPIF4 gene, protein and application thereof in improving low temperature resistance of plants | |
| CN109988231B (en) | Application of rice gene OsGRF4 in improving cold resistance of plants | |
| CN110540582B (en) | Application of protein OrC1 in regulating color of rice husk and awn | |
| CN108642065A (en) | A kind of paddy endosperm silty related gene OsSecY2 and its coding protein and application | |
| CN114369147B (en) | Application of BFNE gene in tomato plant type improvement and biological yield improvement | |
| CN108570474B (en) | Rice flower development gene EH1 and application thereof | |
| CN109721649A (en) | A kind of plant type of rice regulation related gene, protein and application | |
| CN107217058B (en) | Sesame SiCOL1 and SiCOL2 genes and application thereof | |
| CN113957087B (en) | Application of Sub gene in regulation and control of rice cold resistance | |
| CN110484555B (en) | Construction method of transgenic rice with multi-seed cluster character | |
| CN116064568A (en) | Alfalfa MsASG166 gene and application thereof in improving drought tolerance of plants | |
| CN111560055B (en) | Application of rice gene OsLAT3 in regulation of absorption and accumulation of diquat | |
| CN112029746B (en) | Plant TMK1 gene and application thereof in resisting sclerotinia sclerotiorum | |
| CN114853860A (en) | Protein related to shortening larch breeding cycle and application thereof | |
| CN111808872B (en) | Gene DPY1 for regulating and controlling panicolaceae plant type and application and method thereof | |
| CN111304219B (en) | GL1 gene separated from rice WZ1 and application thereof in increasing rice grain length | |
| CN109593768B (en) | Application of Pagl1 gene in regulating and controlling plant epidermal hair | |
| CN109912706B (en) | Gene, protein and molecular marker related to rice weakness and premature senility and application | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN109456984B (en) | Rice glume development gene AH1 and application thereof | |
| CN109554374B (en) | Application of PaMYB82 gene in regulating and controlling plant epidermal hair | |
| CN113444736A (en) | Application of GhbHLH122 gene in regulation and control of plant flowering | |
| CN113929756A (en) | Application of GL11 protein and gene for encoding GL11 protein in regulation of rice grain shape and thousand kernel weight | |
| CN113637700B (en) | Method for preparing photosensitive male sterile material of rice and related genes | |
| CN111826391A (en) | Application of NHX2-GCD1 double genes or protein thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |