CN113933508A

CN113933508A - Use of human BATF gene and related product

Info

Publication number: CN113933508A
Application number: CN202010670918.2A
Authority: CN
Inventors: 丁珊; 曹跃琼
Original assignee: Shanghai Jikai Gene Medical Technology Co ltd
Current assignee: Shanghai Jikai Gene Medical Technology Co ltd
Priority date: 2020-07-13
Filing date: 2020-07-13
Publication date: 2022-01-14

Abstract

The invention belongs to the field of biomedical research, and particularly relates to application of a human BATF gene as a target in preparation of a gastric cancer treatment drug or a gastric cancer diagnosis drug. Extensive and intensive research shows that the expression of human BATF gene is down-regulated by RNAi method, so that the proliferation of gastric cancer cells can be effectively inhibited, and the growth process of gastric cancer can be effectively controlled. The siRNA or the nucleic acid construct containing the siRNA sequence and the lentivirus provided by the invention can specifically inhibit the proliferation rate of gastric cancer cells and inhibit the growth of gastric cancer, thereby treating gastric cancer and opening up a new direction for treating gastric cancer.

Description

Use of human BATF gene and related product

Technical Field

The invention belongs to the field of biomedical research, and particularly relates to application of a human BATF gene and a related product.

Background

The protein coded by BATF gene is a nuclear alkaline leucine zipper protein, belonging to transcription factor AP-1/ATF superfamily. The leucine zipper of this protein mediates dimerization reactions with members of the Jun family. This protein is thought to be a negative regulator of the AP-1/ATF transcription event. SARI, also known as BATF2, belongs to the BATF family and is associated with tumor cell growth inhibition. However, the role and mechanism of SARI in tumor angiogenesis is not clear. The results of this study indicate that SARI Inhibits Angiogenesis by reducing VEGF expression, and is a potential target for the treatment of Colon Cancer, as well as a prognostic indicator in patients with Colon Cancer (Lei Dai, et al. SARI inhibitors Angiogenesis and Tumour Growth of Human Colon Cancer thru directive Targeting Ceruloplastin Nat Commun.2016Jun 29; 7:11996.doi:10.1038/ncomms 11996.). High expression of BATF and BATF3, specific inactivation of BATF and BATF3 genes or overall inhibition of AP-1 (transcription factor) in Anaplastic Large Cell Lymphoma (ALCL) leads to reduction of proliferation and/or death of ALCL in vitro and in vivo. This study highlighted the key role of AP-1/BATFs in ALCL and triggered some suggestion that ALCL might have originated in ILC3 (indigenous lymphocytes) (Nikolai Schleussner, et al. the AP-1-BATF and-BATF3 modules Is Essential for Growth, Survival and TH17/ILC3 Skewing of Anaplastic Large Cell Lymphoma. Leukemia.201Sep; 32(9):1994-2007.doi:10.1038/s 41375-018-. At present, no report related to the application of the BATF gene in gastric cancer treatment exists.

Disclosure of Invention

In order to overcome the problems in the prior art, the invention aims to provide the application of the human BATF gene and related products.

In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:

in the first aspect of the invention, the application of the human BATF gene as a target in preparing a gastric cancer treatment drug or a gastric cancer diagnosis drug is provided.

The application of the human BATF gene as a target in preparing gastric cancer treatment medicines specifically comprises the following steps: the BATF gene is used as an action object, and a drug or a preparation is screened to find a drug capable of inhibiting the expression of the human BATF gene as a candidate drug for treating gastric cancer. The BATF gene small interfering RNA (siRNA) is obtained by screening human BATF gene as an action object and can be used as a medicine for inhibiting gastric cancer cell proliferation. In addition, the BATF gene can be used as an active substance, such as an antibody drug, a small molecule drug, or the like.

The application of the human BATF gene as a target in preparing gastric cancer diagnosis medicines specifically comprises the following steps: the BATF gene expression product is used as a gastric cancer diagnosis index to be applied to the preparation of gastric cancer diagnosis medicines.

The gastric cancer treatment drug is a molecule capable of specifically inhibiting the transcription or translation of the BATF gene or specifically inhibiting the expression or activity of the BATF protein, so that the expression level of the BATF gene in gastric cancer cells is reduced, and the purpose of inhibiting the proliferation, growth, differentiation and/or survival of the gastric cancer cells is achieved.

The gastric cancer therapeutic drug or gastric cancer diagnostic drug prepared from the BATF gene includes, but is not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins, or interfering lentiviruses.

Such nucleic acids include, but are not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozymes, small interfering RNA produced by endoribonuclease III or short hairpin RNA (shRNA).

The gastric cancer therapeutic agent is administered in an amount sufficient to reduce transcription or translation of the human BATF gene, or to reduce expression or activity of the human BATF protein. Such that the expression of the human BATF gene is reduced by at least 50%, 80%, 90%, 95% or 99%.

The method for treating gastric cancer by adopting the gastric cancer treatment drug achieves the treatment purpose by mainly reducing the expression level of human BATF gene and inhibiting the proliferation of gastric cancer cells. Specifically, in treatment, a substance effective in reducing the expression level of the human BATF gene is administered to the patient.

In one embodiment, the target sequence of the BATF gene is as set forth in SEQ ID NO:1 and SEQ ID NO:2, respectively. The method comprises the following steps: 5'-ACGCATTCCACCAACCTCA-3', and 5'-TCATCTGATGATGTGAGAA-3'.

In a second aspect of the invention, there is provided the use of a BATF inhibitor in the manufacture of a product having at least one of the following effects:

treating gastric cancer;

inhibiting the proliferation rate of gastric cancer cells;

inhibiting the growth of gastric cancer.

The product necessarily comprises a BATF inhibitor, and the BATF inhibitor is used as an effective component of the above effects.

In the product, the effective component for playing the above functions can be only a BATF inhibitor, and other molecules for playing the above functions can also be contained.

That is, the BATF inhibitor is the only active ingredient or one of the active ingredients of the product.

The product may be a single component material or a multi-component material.

The form of the product is not particularly limited, and can be various substance forms such as solid, liquid, gel, semifluid, aerosol and the like.

The product is primarily directed to mammals. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human.

Such products include, but are not limited to, pharmaceuticals, nutraceuticals, foods, and the like.

The BATF inhibitor can be nucleic acid molecule, antibody, small molecule compound.

As exemplified in the examples herein, the BATF inhibitor can be a nucleic acid molecule that reduces the expression of the BATF gene in gastric cancer cells. Specifically, it may be a double-stranded RNA or shRNA.

In a third aspect of the present invention, there is provided a method of treating gastric cancer by administering a BATF inhibitor to a subject.

The subject may be a mammal or a mammalian gastric cancer cell. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human. The gastric cancer cell may be an isolated gastric cancer cell.

The subject may be a patient suffering from gastric cancer or an individual in whom treatment is desired. Or isolated gastric cancer cells of a subject who is a gastric cancer patient or an individual expected to treat gastric cancer.

The BATF inhibitor can be administered to a subject before, during, or after receiving treatment for gastric cancer.

The fourth aspect of the invention discloses a nucleic acid molecule for reducing BATF gene expression in gastric cancer cells, wherein the nucleic acid molecule comprises double-stranded RNA or shRNA.

Wherein the double-stranded RNA contains a nucleotide sequence capable of hybridizing with BATF gene;

the shRNA contains a nucleotide sequence capable of hybridizing with a BATF gene.

Further, the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand are complementary to form an RNA dimer, and the sequence of the first strand is substantially identical to a target sequence in the BATF gene.

The target sequence in the BATF gene is the segment in the BATF gene corresponding to the mRNA segment which is identified and silenced by the nucleic acid molecule when the nucleic acid molecule is used for specifically silencing the expression of the BATF gene.

Further, the target sequence of the double-stranded RNA is shown as SEQ ID NO:1 and SEQ ID NO:2, respectively. The method specifically comprises the following steps: 5'-ACGCATTCCACCAACCTCA-3' (SEQ ID NO: 1), TCATCTGATGATGTGAGAA (SEQ ID NO: 2). Further, the sequence of the first strand of the double-stranded RNA is shown as SEQ ID NO:3 and SEQ ID NO:4, respectively. Specifically 5'-ACGCAUUCCACCAACCUCA-3' (SEQ ID NO: 3) and UCAUCUGAUGAUGUGAGAA (SEQ ID NO: 4).

Further, the double-stranded RNA is small interfering RNA (siRNA).

SEQ ID NO:3 is one strand of small interfering RNA designed by taking the sequence shown in SEQ ID NO. 1 as an RNA interference target sequence and aiming at the human BATF gene, and the sequence of the other strand, namely the second strand, is complementary with the sequence of the first strand; SEQ ID NO:4 is one strand of small interfering RNA designed by taking the sequence shown in SEQ ID NO. 2 as an RNA interference target sequence and aiming at human BATF gene, the sequence of the other strand, namely the second strand, is complementary with the sequence of the first strand, and the two siRNAs can play a role in specifically silencing the expression of endogenous BATF gene in gastric cancer cells.

The shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand segment is basically identical to a target sequence in the BATF gene.

Further, the target sequence of the sh RNA is shown as SEQ ID NO:1 and SEQ ID NO:2, respectively.

The shRNA can become small interfering RNA (siRNA) after enzyme digestion processing, and further plays a role in specifically silencing endogenous BATF gene expression in gastric cancer cells.

Further, the sequence of the stem-loop structure of the shRNA can be selected from any one of the following sequences: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, and CCACACC.

Further, the sequence of the shRNA is shown as SEQ ID NO: 5 and SEQ ID NO: and 6. Specifically 5'-ACGCAUUCCACCAACCUCACUCGAGUGAGGUUGGUGGAAUGCGU-3' (SEQ ID NO: 5) and UCAUCUGAUGAUGUGAGAACUCGAGUUCUCACAUCAUCAGAUGA (SEQ ID NO: 6).

Further, the BATF gene is derived from a human.

In the fifth aspect of the invention, the BATF gene interference nucleic acid construct contains a gene segment for coding shRNA in the nucleic acid molecule and can express the shRNA.

The BATF gene interfering nucleic acid construct can be obtained by cloning a gene segment for coding the human BATF gene shRNA into a known vector.

Further, the BATF gene interfering nucleic acid construct is a BATF gene interfering lentiviral vector.

The BATF gene interference lentiviral vector disclosed by the invention is obtained by cloning a DNA fragment for coding the BATF gene shRNA into a known vector, wherein the known vector is mostly a lentiviral vector, the BATF gene interference lentiviral vector is packaged into infectious viral particles through viruses, gastric cancer cells are infected, the shRNA is further transcribed, and the siRNA is finally obtained through steps of enzyme digestion processing and the like and is used for specifically silencing the expression of the BATF gene.

Further, the BATF gene interference lentiviral vector also contains a promoter sequence and/or a nucleotide sequence encoding a marker which can be detected in gastric cancer cells; preferably, the detectable label is Green Fluorescent Protein (GFP).

Further, the lentiviral vector may be selected from the group consisting of: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti 6-GW/U6-laminsham, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or pLenti 6.2/N-Lumio/V5-GW/lacZ.

The embodiment of the invention specifically enumerates human BATF gene interference lentiviral vectors constructed by taking pGCSIL-GFP as a vector, and the human BATF gene interference lentiviral vectors are named as pGCSIL-GFP-BATF-siRNA-1 and pGCSIL-GFP-BATF-siRNA-2.

The BATF gene siRNA can be used for inhibiting the proliferation of gastric cancer cells, and further can be used as a medicine or a preparation for treating gastric cancer. The BATF gene interference lentiviral vector can be used for preparing the BATF gene siRNA. When used as a medicament or formulation for treating gastric cancer, a safe and effective amount of the nucleic acid molecule is administered to a mammal. The particular dosage will also take into account factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled practitioner.

The invention also discloses a method for preparing the BATF gene interfering slow virus, which is characterized in that the BATF gene interfering nucleic acid construct is packaged by virus under the assistance of slow virus packaging plasmid and cell line. The lentivirus can infect gastric cancer cells and generate small interfering RNA aiming at BATF gene, thereby inhibiting the proliferation of gastric cancer cells. The BATF gene interference lentivirus can be used for preparing medicine for preventing or treating gastric cancer.

In a seventh aspect, the invention provides the use of the nucleic acid molecule, or the BATF gene interfering nucleic acid construct, or the BATF gene interfering lentivirus, as follows: can be used for preparing medicine for preventing or treating gastric cancer, or kit for reducing BATF gene expression in gastric cancer cell.

The application of the medicament for preventing or treating the gastric cancer provides a method for treating the gastric cancer, in particular to a method for preventing or treating the gastric cancer in a subject, which comprises the step of administering an effective dose of the medicament to the subject.

Further, when the drug is used for preventing or treating gastric cancer in a subject, an effective dose of the drug needs to be administered to the subject. With this method, the growth, proliferation, and recurrence of gastric cancer are inhibited. Further, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the growth, proliferation, recurrence of the gastric cancer is inhibited.

The subject of the method may be a human.

In an eighth aspect of the present invention, there is provided a composition for preventing or treating gastric cancer, comprising, as active ingredients:

the aforementioned nucleic acid molecules; and/or, the aforementioned BATF gene interfering nucleic acid construct; and/or, the aforementioned BATF gene interfering lentivirus, and a pharmaceutically acceptable carrier, diluent or excipient.

The composition may be a pharmaceutical composition.

When the composition is used for preventing or treating gastric cancer in a subject, an effective dose of the composition needs to be administered to the subject. With this method, the growth, proliferation, and recurrence of gastric cancer are inhibited. Further, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the growth, proliferation, recurrence of the gastric cancer is inhibited.

The form of the composition is not particularly limited, and may be in the form of various substances such as solid, liquid, gel, semifluid, aerosol, etc.

The subject to which the composition is primarily directed is a mammal. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human.

In conclusion, the RNAi target sequence of the human BATF gene is designed, and the corresponding BATF RNAi vector is constructed, wherein the RNAi vectors pGCSIL-GFP-BATF-siRNA-1 and pGCSIL-GFP-BATF-siRNA-2 can obviously reduce the expression of the BATF gene at the mRNA level and the protein level. The slow virus (Lv) is used as a gene operation tool to carry an RNAi vector pGCSIL-GFP-BATF-siRNA, so that the RNAi sequence aiming at the BATF gene can be efficiently introduced into gastric cancer AGS cells in a targeted manner, the expression level of the BATF gene is reduced, and the proliferation capacity of the tumor cells is obviously inhibited. Lentivirus-mediated silencing of the BATF gene is therefore a potential clinical non-surgical treatment modality for malignancies.

Compared with the prior art, the invention has the following beneficial effects:

the invention finds that the proliferation of gastric cancer cells can be effectively inhibited after the expression of human BATF gene is down-regulated by RNAi method, and the growth process of gastric cancer can be effectively controlled, and the research result shows that the BATF gene is protooncogene and can be used as a target point for tumor treatment. The siRNA or the nucleic acid construct containing the siRNA sequence and the lentivirus provided by the invention can specifically inhibit the proliferation rate of gastric cancer cells and inhibit the growth of gastric cancer, thereby treating gastric cancer and opening up a new direction for treating gastric cancer.

Drawings

FIG. 1-1: and RT-PCR is used for detecting the target gene reduction efficiency of the mRNA level after the AGS cells are infected with BATF-shRNA lentivirus 1.

FIGS. 1-2: and RT-PCR is used for detecting the target gene reduction efficiency of the mRNA level after the AGS cells are infected with BATF-shRNA lentivirus 2.

FIG. 2-1: the results of the automatic analysis of Celigo cells revealed the proliferation of gastric cancer cells after the infection with BATF-shRNA lentivirus 1. (cell lines are AGS cells and cell numbers were counted 1, 2, 3, 4 and 5 days after viral infection)

FIG. 2-2: the result of automatic analysis of Celigo cells shows the proliferation of gastric cancer cells after the infection of BATF-shRNA lentivirus 2. (cell lines are AGS cells and cell numbers were counted 1, 2, 3, 4 and 5 days after viral infection)

Detailed Description

The invention proves the function of the BATF gene in the generation of gastric cancer from the perspective of cell function. Through constructing target gene shRNA lentivirus and then transfecting gastric cancer cells, comparing the target gene shRNA lentivirus with transfection control lentivirus, detecting the expression conditions of mRNA and protein level target genes in two groups of gastric cancer cell lines; and then cell proliferation, apoptosis and other detection are carried out through cytofunctional experiments, and the results show that the gastric cancer cell proliferation inhibition degree of the shRNA group is obviously higher than that of the control group compared with the shRNA group and the control group.

According to the research results, a new method for diagnosing and treating the gene is further explored and developed, so that more choices can be provided for the diagnosis and treatment of the gastric cancer patient.

BATF inhibitors

Refers to a molecule having inhibitory effect on BATF. Having inhibitory effects on BATF include, but are not limited to: inhibiting expression or activity of BATF.

Inhibiting the activity of BATF means reducing the activity of BATF. Preferably, the activity of BATF is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, and most preferably by at least 90% compared to that before inhibition.

The inhibition of the expression of BATF may specifically be inhibition of transcription or translation of BATF gene, and specifically may be: making the gene of BATF untranscribed, or reducing the transcriptional activity of the gene of BATF, or making the gene of BATF untranslatable, or reducing the translational level of the gene of BATF.

The gene expression of BATF can be regulated by one skilled in the art using conventional methods, such as gene knock-out, homologous recombination, interfering RNA, etc.

Inhibition of gene expression of BATF was verified by PCR and Western Blot detection of expression level.

Preferably, the expression of the BATF gene is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, even more preferably by at least 90%, most preferably by no expression of the BATF gene, compared to the wild type.

Small molecule compounds

The invention refers to a compound which is composed of several or dozens of atoms and has the molecular mass of less than 1000.

Preparation of medicine for preventing or treating gastric cancer

Nucleic acid molecules that reduce the expression of the BATF gene in gastric cancer cells can be used; and/or, a BATF gene interfering nucleic acid construct; and/or, the BATF gene interferes with lentivirus, and is used as an effective component for preparing a medicament for preventing or treating gastric cancer. Generally, the medicament can comprise one or more pharmaceutically acceptable carriers or auxiliary materials besides the effective components according to the requirements of different dosage forms.

By "pharmaceutically acceptable" is meant that the molecular entities and compositions do not produce adverse, allergic, or other untoward reactions when properly administered to an animal or human.

The "pharmaceutically acceptable carrier or adjuvant" should be compatible with the active ingredient, i.e., capable of being blended therewith without substantially diminishing the effectiveness of the drug under ordinary circumstances. Specific examples of some substances that can serve as pharmaceutically acceptable carriers or adjuvants are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethylcellulose and methylcellulose; powdered gum tragacanth; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyhydric alcohols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; a colorant; a flavoring agent; tabletting agents, stabilizers; an antioxidant; a preservative; pyrogen-free water; isotonic saline solution; and phosphate buffer, and the like. These materials are used as needed to aid in the stability of the formulation or to aid in the enhancement of the activity or its bioavailability or to produce an acceptable mouthfeel or odor upon oral administration.

In the present invention, unless otherwise specified, the pharmaceutical dosage form is not particularly limited, and may be prepared into injection, oral liquid, tablet, capsule, dripping pill, spray, etc., and may be prepared by a conventional method. The choice of the pharmaceutical dosage form should be matched to the mode of administration.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts.

Example 1 preparation of RNAi lentivirus against human BATF Gene

1. Screening of effective siRNA target against human BATF Gene

The gene information of BATF (NM-006399) is retrieved from Genbank; designing effective siRNA target point aiming at BATF gene. Table 1-1 lists the effective siRNA target sequences selected against the BATF gene.

TABLE 1-1 siRNA target sequences targeting the human BATF Gene

SEQ ID NO	TargetSeq(5’-3’)
		1	ACGCATTCCACCAACCTCA
2	TCATCTGATGATGTGAGAA

2. Preparation of Lentiviral vectors

Synthesizing double-stranded DNA Oligo sequences (Table 1-2) containing Age I and EcoR I enzyme cutting sites at two ends aiming at siRNA targets (taking SEQ ID NO:1 and 2 as examples); the restriction enzymes Age I and EcoR I act on pGCSIL-GFP vector (provided by Shanghai Jikai Gene chemistry Co., Ltd.), linearize it, and identify the enzyme-cleaved fragments by agarose gel electrophoresis.

TABLE 1-2 double-stranded DNA Oligo with Age I and EcoR I cleavage sites at both ends

The vector DNA linearized by double digestion (digestion system shown in tables 1-4, 37 ℃ C., reaction 1h) and the purified double-stranded DNA Oligo were ligated by T4 DNA ligase at 16 ℃ C. overnight in an appropriate buffer system (ligation system shown in tables 1-5), and the ligation product was recovered. The ligation product was transformed into calcium chloride prepared fresh E.coli competent cells (transformation protocol reference: molecular cloning protocols second edition, pages 55-56). Dipping the surface of the clone of the strain growing out of the connected transformation product, dissolving the surface in 10 mul LB culture medium, uniformly mixing and taking 1 mul as a template; in a lentiviral vector for SEQ ID NO:1, designing universal PCR primers at the upstream and downstream of the RNAi sequence, wherein the upstream primer sequence is as follows: 5'-CCTATTTCCCATGATTCCTTCATA-3' (SEQ ID NO: 11); the sequence of the downstream primer is as follows: 5'-GTAATACGGTTATCCACGCG-3' (SEQ ID NO: 12); in a lentiviral vector for SEQ ID NO:2, designing universal PCR primers at the upstream and downstream of the RNAi sequence, wherein the upstream primer sequence: 5'-CCTATTTCCCATGATTCCTTCATA-3' (SEQ ID NO: 13); the sequence of the downstream primer is as follows: 5'-GTAATACGGTTATCCACGCG-3' (SEQ ID NO: 14) was subjected to PCR identification experiments (PCR reaction system shown in tables 1-6, reaction conditions shown in tables 1-7). Sequencing and comparing the clones which are identified to be positive by the PCR, wherein the correctly compared clones are the clones which are successfully constructed and are directed at the nucleotide sequence shown in SEQ ID NO:1 and SEQ ID NO:2, and the RNAi expression vectors are named pGCSIL-GFP-BATF-siRNA-1 and pGCSIL-GFP-BATF-siRNA-2, respectively.

pGCSIL-GFP-Scr-siRNA negative control plasmid was constructed with negative control siRNA target sequence 5'-TTCTCCGAACGTGTCACGT-3' (SEQ ID NO: 15). When pGCSIL-GFP-Scr-siRNA negative control plasmids are constructed, double-stranded DNA Oligo sequences (tables 1-3) containing adhesive ends of Age I and EcoR I enzyme cutting sites at two ends are synthesized aiming at the Scr siRNA target spots, and the rest construction methods, identification methods and conditions are the same as pGCSIL-GFP-BATF-siRNA.

TABLE 1-3 double-stranded DNA Oligo with Age I and EcoR I cleavage sites at both ends

TABLE 1-4 pGCSIL-GFP plasmid digestion reaction System

Reagent	Volume (μ l)
		pGCSIL-GFP plasmid (1. mu.g/. mu.l)	2.0
10×buffer	5.0
		100×BSA	0.5
Age I(10U/μl)	1.0
		EcoR I(10U/μl)	1.0
dd H₂O	40.5
		Total	50.0

TABLE 1-5 ligation reaction System of vector DNA and double-stranded DNA Oligo

Reagent	Positive control (μ l)	Self-contained control (μ l)	Connecting group (mu l)
				Linearized vector DNA (100 ng/. mu.l)	1.0	1.0	1.0
Annealed double stranded DNA Oligo (100 ng/. mu.l)	1.0	-	1.0
				10 XT 4 phage DNA ligase buffer	1.0	1.0	1.0
T4 phage DNA ligase	1.0	1.0	1.0
				dd H₂O	16.0	17.0	16.0
Total	20.0	20.0	20.0

TABLE 1-6 PCR reaction System

Reagent	Volume (μ l)
		10×buffer	2.0
dNTPs(2.5mM)	0.8
		Upstream primer	0.4
Downstream primer	0.4
		Taq polymerase	0.2
Form panel	1.0
		ddH₂O	15.2
Total	20.0

TABLE 1-7 PCR reaction System Programming

3. Packaging of BATF-shRNA lentivirus

The DNA of RNAi plasmids pGCSIL-GFP-BATF-siRNA-1 and pGCSIL-GFP-BATF-siRNA-2 was extracted with a plasmid extraction kit from Qiagen corporation to prepare 100 ng/. mu.l stock solution.

24h before transfection, human embryonic kidney 293T cells in logarithmic growth phase were trypsinized and cell density was adjusted in DMEM complete medium containing 10% fetal bovine serumDegree of 1.5X 10⁵Cells/ml, seeded in 6-well plates at 37 ℃ with 5% CO₂Culturing in an incubator. The cell density can reach 70-80% to be used for transfection. 2h before transfection, the original medium was aspirated and 1.5ml of fresh complete medium was added. Mu.l of Packing Mix (PVM), 12. mu.l of PEI, and 400. mu.l of serum-free DMEM medium were added to a sterilized centrifuge tube according to the instructions of the MISSION Lentiviral Packing Mix kit from Sigma-aldrich, and 20. mu.l of the above-mentioned extracted plasmid DNA was added to the above-mentioned PVM/PEI/DMEM mixture.

The transfection mixture was incubated at room temperature for 15min, transferred to medium of human embryonic kidney 293T cells at 37 ℃ with 5% CO₂Culturing for 16h in an incubator. The medium containing the transfection mixture was discarded, washed with PBS solution, 2ml of complete medium was added and incubation continued for 48 h. The cell supernatant was collected, and the lentivirus was purified and concentrated by a Centricon Plus-20 centrifugal ultrafiltration device (Millipore) according to the following steps: (1) centrifuging at 4 deg.C and 4000g for 10min to remove cell debris; (2) filtering the supernatant with a 0.45 μm filter in a 40ml ultracentrifuge tube; (3) centrifuging at 4000g for 10-15min to obtain the required virus concentration volume; (4) after the centrifugation is finished, separating the filter cup from the lower filtrate collecting cup, reversely buckling the filter cup on the sample collecting cup, and centrifuging for 2min until the centrifugal force is not more than 1000 g; (5) the centrifuge cup is removed from the sample collection cup, and the virus concentrate is obtained. Subpackaging the virus concentrated solution and storing at-80 ℃. The sequence of the first strand of siRNA contained in the virus concentrate is shown in SEQ ID NO. 3 and SEQ ID NO. 4. The packaging process of the control lentivirus is the same as that of the BATF-shRNA lentivirus 1 or the BATF-shRNA lentivirus 2, and only pGCSIL-GFP-BATF-siRNA-1 or pGCSIL-GFP-BATF-siRNA-vector is replaced by the pGCSIL-GFP-Scr-siRNA vector.

Example 2 detection of Gene silencing efficiency by real-time fluorescent quantitative RT-PCR

Human gastric cancer AGS cells in logarithmic growth phase are trypsinized to prepare cell suspension (the number of cells is about 5X 10)⁴/ml) were inoculated in 6-well plates and cultured until the degree of cell confluence reached about 30%. According to the complex infection value (MOI, AGS: 10), the proper amount of the lentivirus prepared in example 1 is added, the culture medium is replaced after 24h of culture,after the infection time reached 5 days, cells were collected. Total RNA was extracted according to the Trizol protocol of Invitrogen corporation. The RNA was reverse-transcribed to obtain cDNA according to the M-MLV protocol of Promega (reverse transcription reaction system shown in Table 2-1, reaction at 42 ℃ for 1 hour, and then reverse transcriptase was inactivated by water bath for 10min at 70 ℃ in a water bath).

Real-time quantitative detection was carried out using a TP800 Real time PCR instrument (TAKARA). Primers for the BATF gene of lentivirus BATF-shRNA lentivirus 1 were as follows: an upstream primer 5'-AGAAGAGTTCAGAGGAGGGA-3' (SEQ ID NO: 18) and a downstream primer 5'-CGTTCTGTTTCTCCAGGTCT-3' (SEQ ID NO: 19). Primers for the BATF gene of lentivirus BATF-shRNA lentivirus 2 were as follows: an upstream primer 5'-AGAAGAGTTCAGAGGAGGGA-3' (SEQ ID NO: 20) and a downstream primer 5'-CGTTCTGTTTCTCCAGGTCT-3' (SEQ ID NO: 21). The two lentiviruses use housekeeping gene GAPDH as internal reference, and the primer sequences are as follows: an upstream primer 5'-TGACTTCAACAGCGACACCCA-3' (SEQ ID NO: 22) and a downstream primer 5'-CACCCTGTTGCTGTAGCCAAA-3' (SEQ ID NO: 23). The reaction system was prepared in the proportions shown in Table 2-2.

TABLE 2-1 reverse transcription reaction System

Reagent	Volume (μ l)
		5×RT buffer	4.0
10mM dNTPs	2.0
		RNasin	0.5
M-MLV-RTase	1.0
		DEPC H₂O	3.5
Total	11.0

TABLE 2-2 Real-time PCR reaction System

Reagent	Volume (μ l)
		SYBR premix ex taq	10.0
Upstream primer (2.5 μ M):	0.5
		downstream primer (2.5 μ M):	0.5
cDNA	1.0
		ddH₂O	8.0
Total	20.0

the program was a two-step Real-time PCR: pre-denaturation at 95 ℃ for 15 s; then, denaturation is carried out at 95 ℃ for 5s in each step; annealing and extending for 30s at 60 ℃; a total of 45 cycles were performed. Each time reading the absorbance value during the extension phase. After the PCR was completed, the DNA was denatured at 95 ℃ for 1min, and then cooled to 55 ℃ to allow the DNA double strands to be sufficiently bound. Melting curves were prepared by increasing the temperature from 55 ℃ to 95 ℃ by 0.5 ℃ for 4 seconds and reading the absorbance. By adopting 2-^ΔΔCtThe assay calculated the expression abundance of BATF mRNA from cells infected with lentivirus. Cells infected with the control virus served as controls. The experimental result is shown in figure 1-1, which shows that the expression level of BATF mRNA in human gastric cancer AGS cells infected with BATF-shRNA lentivirus 1 is down-regulated by 51.2%; as shown in FIGS. 1-2, it was demonstrated that the expression level of BATF mRNA was down-regulated by 62.4% in human gastric cancer AGS cells infected with BATF-shRNA lentivirus 2.

Example 3 examination of the proliferative Capacity of tumor cells infected with BATF-shRNA lentivirus

Human gastric cancer AGS cells in logarithmic growth phase are trypsinized to prepare cell suspension (the number of cells is about 5X 10)⁴/ml) were inoculated in 6-well plates and cultured until the degree of cell confluence reached about 30%. According to the infection complex number (MOI, AGS: 10), adding a proper amount of virus, culturing for 24h, then replacing the culture medium, and collecting cells of each experimental group in the logarithmic growth phase after the infection time reaches 5 days. Complete medium resuspension into cell suspension (2X 10)⁴Per ml) at a cell density of about 2000 per well, 96-well plates were seeded. Each set of 5 duplicate wells, 100. mu.l per well. After the plate is laid, the plate is placed at 37 ℃ and 5% CO₂Culturing in an incubator. The plate reading was performed once a day with Celigo instrument (Nexcelom) starting the next day after plating, and the plate reading was performed continuously for 5 days. The number of green fluorescent cells in the well plate of each scan was accurately calculated by adjusting the input parameters of analysis settings, and the data were statistically plotted to generate cell proliferation curves (the results are shown in FIGS. 2-1 and 2-2). The results show that after each tumor of the lentivirus infection group is cultured in vitro for 5 days, the proliferation speed is obviously slowed down and is far lower than that of the tumor cells of the control group, the number of the active cells of the BATF-shRNA lentivirus 1 group and the BATF-shRNA 2 group are respectively reduced by 76.5 percent and 45.1 percent,showing that BATF gene silencing leads to the inhibition of human gastric cancer AGS cell proliferation capacity.

While the invention has been described with respect to a preferred embodiment, it will be understood by those skilled in the art that the foregoing and other changes, omissions and deviations in the form and detail thereof may be made without departing from the scope of this invention. Those skilled in the art can make various changes, modifications and equivalent arrangements, which are equivalent to the embodiments of the present invention, without departing from the spirit and scope of the present invention, and which may be made by utilizing the techniques disclosed above; meanwhile, any changes, modifications and variations of the above-described embodiments, which are equivalent to those of the technical spirit of the present invention, are within the scope of the technical solution of the present invention.

Sequence listing

<110> Shanghai Jikai Gene medicine science and technology Co., Ltd

Application of <120> human BATF gene and related product

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acgcattcca ccaacctca 19

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcatctgatg atgtgagaa 19

<210> 3

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

acgcauucca ccaaccuca 19

<210> 4

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ucaucugaug augugagaa 19

<210> 5

<211> 44

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

acgcauucca ccaaccucac ucgagugagg uugguggaau gcgu 44

<210> 6

<211> 44

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ucaucugaug augugagaac ucgaguucuc acaucaucag auga 44

<210> 7

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccggccacgc attccaccaa cctcactcga gtgaggttgg tggaatgcgt ggtttttg 58

<210> 8

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aattcaaaaa ccacgcattc caccaacctc actcgagtga ggttggtgga atgcgtgg 58

<210> 9

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ccggactcat ctgatgatgt gagaactcga gttctcacat catcagatga gttttttg 58

<210> 10

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aattcaaaaa actcatctga tgatgtgaga actcgagttc tcacatcatc agatgagt 58

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cctatttccc atgattcctt cata 24

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gtaatacggt tatccacgcg 20

<210> 13

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cctatttccc atgattcctt cata 24

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gtaatacggt tatccacgcg 20

<210> 15

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ttctccgaac gtgtcacgt 19

<210> 16

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ccggttctcc gaacgtgtca cgtttcaaga gaacgtgaca cgttcggaga atttttg 57

<210> 17

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

aattcaaaaa ttctccgaac gtgtcacgtt ctcttgaaac gtgacacgtt cggagaa 57

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

agaagagttc agaggaggga 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

cgttctgttt ctccaggtct 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

agaagagttc agaggaggga 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

cgttctgttt ctccaggtct 20

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

tgacttcaac agcgacaccc a 21

<210> 23

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

caccctgttg ctgtagccaa a 21

Claims

1. The application of the human BATF gene as a target in preparing a gastric cancer treatment drug or a gastric cancer diagnosis drug.

Use of a BATF inhibitor for the manufacture of a product having at least one of the following effects:

treating gastric cancer;

inhibiting the proliferation rate of gastric cancer cells;

inhibiting the growth of gastric cancer.

3. Use according to claim 2, further comprising one or more of the following features:

1) the BATF inhibitor is a molecule having inhibitory effect on BATF;

2) the BATF inhibitor is the only effective component or one of the effective components of the product;

3) the BATF inhibitor is selected from double-stranded RNA, shRNA, antibody or small molecule compound.

4. Use according to claim 3, further comprising one or more of the following features:

1) the shRNA or double-stranded RNA target sequence is shown as SEQ ID NO:1 and SEQ ID NO:2 is shown in the specification;

2) the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand being complementary to form an RNA dimer, the first strand being directed to SEQ ID NO:1 and SEQ ID NO:2 are respectively shown in SEQ ID NO:3 and SEQ ID NO:4 is shown in the specification;

3) the shRNA is directed against SEQ ID NO:1 and SEQ ID NO:2 are respectively shown as SEQ ID NO: 5 and SEQ ID NO: and 6.

5. A nucleic acid molecule for reducing expression of a BATF gene in a gastric cancer cell, the nucleic acid molecule comprising:

a. a double-stranded RNA containing a nucleotide sequence capable of hybridizing to a BATF gene; or

shRNA containing a nucleotide sequence capable of hybridizing with a BATF gene;

wherein the double-stranded RNA comprises a first strand and a second strand, wherein the first strand and the second strand are complementary to form an RNA dimer, and the sequence of the first strand is substantially identical to a target sequence in the BATF gene; the shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand segment is basically identical to a target sequence in the BATF gene.

6. A nucleic acid molecule according to claim 5, further comprising one or more of the following characteristics:

2) the double-stranded RNA is siRNA, and the first strand of the siRNA is directed against the nucleotide sequence shown in SEQ ID NO:1 and SEQ ID NO:2 are respectively shown in SEQ ID NO:3 and SEQ ID NO:4 is shown in the specification;

7. A BATF gene interfering nucleic acid construct comprising a gene fragment encoding the shRNA of the nucleic acid molecule of any one of claims 5 to 6, capable of expressing said shRNA.

8. A BATF gene interfering lentivirus, which is formed by virus packaging of the interfering nucleic acid construct of claim 7 with the help of a lentivirus packaging plasmid and a cell line.

9. Use of a nucleic acid molecule according to any one of claims 5 to 6, or a BATF gene interfering nucleic acid construct according to claim 7, or a BATF gene interfering lentivirus according to claim 8, for: can be used for preparing medicine for preventing or treating gastric cancer, or kit for reducing BATF gene expression in gastric cancer cell.

10. A composition for preventing or treating gastric cancer, which comprises the following effective substances:

the nucleic acid molecule of any one of claims 5-6; and/or, the BATF gene interfering nucleic acid construct of claim 7; and/or the BATF gene interfering lentivirus of claim 8, and a pharmaceutically acceptable carrier, diluent or excipient.