CN113897419B

CN113897419B - Kit and method for capturing extracellular vesicles or quantitatively analyzing extracellular vesicle contents

Info

Publication number: CN113897419B
Application number: CN202111313090.6A
Authority: CN
Inventors: 姚波; 孙丹阳
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2021-11-08
Filing date: 2021-11-08
Publication date: 2023-04-28
Anticipated expiration: 2041-11-08
Also published as: CN113897419A

Abstract

The invention relates to a kit and a method for capturing extracellular vesicles or quantitatively analyzing extracellular vesicle contents, belonging to the technical field of extracellular vesicle separation and detection. The kit comprises magnetic beads and a first probe combined with the magnetic beads, wherein the first probe is modified with a group combined with the magnetic beads and cholesterol. The kit can realize enrichment of extracellular vesicles, and further realize quantitative analysis of extracellular vesicles or quantitative analysis of extracellular vesicle contents.

Description

Kit and method for capturing extracellular vesicles or quantitatively analyzing extracellular vesicle contents

Technical Field

The invention relates to the technical field of extracellular vesicle separation and detection, in particular to a kit and a method for extracellular vesicle capture or extracellular vesicle quantitative analysis or extracellular vesicle content quantitative analysis.

Background

Extracellular vesicles (Extracellular Vesicles, EVs) refer to vesicle-like bodies of double-layer phospholipid membrane structure that are detached from or secreted by the cell membrane, varying in diameter from 30nm to 1000 nm. Extracellular vesicles mainly consist of Microvesicles (MVs, diameter >200 nm) and Exosomes (Exosomes, diameter <200 nm), are widely present in cell culture supernatants and various body fluids (blood, lymph, saliva, urine, semen, milk), carry various proteins, lipids, DNA, mRNA, miRNA, etc. related to cell sources, and participate in processes such as intercellular communication, cell migration, angiogenesis, and immunomodulation. In recent years, research shows that extracellular vesicles and nucleic acid proteins carried by the extracellular vesicles have very important effects on occurrence and development of diseases, and the extracellular vesicles are also regarded as novel drug carriers, have very high biocompatibility, can penetrate through blood brain barriers and have very wide application prospects.

Currently, research surrounding extracellular vesicles has focused mainly on several aspects of isolation, detection, disease diagnosis and drug delivery, where isolation and detection techniques are the basis of extracellular vesicle-related research efforts. The efficient and rapid separation method can provide high-purity and high-concentration extracellular vesicle samples for subsequent research work. While sensitive, reliable, and convenient detection methods can provide more accurate information about extracellular vesicles. Existing extracellular vesicle detection techniques mainly include nanoparticle tracking analysis (Nanoparticle tracking analysis, NTA), transmission electron microscopy (Transmission electron microscopy, TEM) and Western Blot (WB) techniques. These three methods are the techniques recommended by the international association of extracellular vesicles (ISEV) for the analysis and identification of extracellular vesicles. In addition, there are nanoflow cell technology, surface plasmon resonance technology, enzyme-linked immunosorbent assay (ELISA), quantitative PCR, biosensing and chromogenic methods, and the like. The quantitative PCR technology is mainly used for nucleic acid in extracellular vesicles, such as DNA, mRNA, miRNA, and the like, and the method is also more conventional technology such as real time qPCR, digital PCR, and the like. However, qPCR techniques for quantitative analysis of extracellular vesicles currently lack the appropriate housekeeping genes as internal references. The expression levels of housekeeping genes such as GAPDH, U6, beta-actin, etc. commonly used in cell assays in extracellular vesicles are not well defined, i.e. it is not determined whether they can be used as housekeeping genes to detect the nucleic acid content in extracellular vesicles. However, the method of adding the cel-miR-39 external reference, which is frequently used at present, has certain limitation, and the external reference can eliminate errors caused by sample quantity loss due to extracellular vesicle extraction, but can not measure the difference of total extracellular vesicles in different samples, and also can bring errors. Therefore, a quantitative method for simply examining gene expression without regard to the number of extracellular vesicles is not accurate enough. For example, the content of miR-122 in one extracellular vesicle sample is higher than that in the other extracellular vesicle sample, but without the proper internal reference gene, we do not know whether the total extracellular vesicles in the two samples are the same, and then it is uncertain whether the content of miR-122 is increased due to the fact that the content of extracellular vesicles is rich or the quantity of extracellular vesicles is high. The distinction between the two is of great importance for the study of the function and mechanism of tumor extracellular vesicles. Although NTA techniques can be used to characterize the number of extracellular vesicles, NTA itself has drawbacks such as large sample volumes, expensive equipment, general need to send samples for testing, and lack of resolution for the size of the nearly heterogeneous proteins in the samples. In view of the foregoing, there is a need to find efficient methods for isolating or detecting extracellular vesicles.

Disclosure of Invention

The invention aims to provide a kit and a method for capturing extracellular vesicles or quantitatively analyzing extracellular vesicle contents. The kit can realize enrichment (namely separation) of the extracellular vesicles, and further realize quantitative analysis of the extracellular vesicles or quantitative analysis of the extracellular vesicle contents.

The invention provides a kit for extracellular vesicle capture or extracellular vesicle quantitative analysis or extracellular vesicle content quantitative analysis, which comprises magnetic beads and first probes combined with the magnetic beads, wherein the first probes are modified with groups combined with the magnetic beads and cholesterol.

Preferably, one end of the first probe is labeled with cholesterol, and the other end is labeled with a group bound to a magnetic bead; the group bound to the magnetic beads includes biotin, amino, carboxyl or epoxy groups.

Preferably, the nucleotide sequence of the first probe is shown as SEQ ID NO. 1.

Preferably, when the kit is used for extracellular vesicle quantitative analysis, the kit further comprises a second probe; one end of the second probe is marked with cholesterol.

Preferably, the nucleotide sequence of the second probe is shown as SEQ ID NO. 2.

Preferably, the content of the extracellular vesicles comprises mirnas of the extracellular vesicles, mrnas of the extracellular vesicles or surface proteins of the extracellular vesicles.

Preferably, when the kit is used for quantitative analysis of surface proteins of extracellular vesicles, the kit further comprises a third probe; the third probe contains a nucleoside aptamer sequence designed for a protein to be tested.

The invention also provides a method for capturing extracellular vesicles based on the kit, which comprises the following steps:

mixing the magnetic beads with the first probes to obtain magnetic beads fixed with the first probes;

extracting extracellular vesicles from a sample to obtain extracellular vesicle solution;

the extracellular vesicle solution is mixed with the magnetic beads immobilized with the first probe, thereby capturing the extracellular vesicles.

The invention also provides a method for detecting the extracellular vesicle concentration based on the kit of the technical scheme, which comprises the following steps:

mixing extracellular vesicle solutions with different concentrations and extracellular vesicle solutions to be detected with magnetic beads fixed with a first probe respectively, and cleaning to obtain captured extracellular vesicles;

Mixing the captured extracellular vesicles with a second probe, and cleaning to obtain extracellular vesicles immobilized with the second probe; mixing the extracellular vesicles fixed with the second probes with double distilled water, heating for 5-15 min at 90-100 ℃, cooling, placing on a magnetic rack, taking the supernatant as a template, performing qPCR (quantitative polymerase chain reaction) amplification by using primers designed for the nucleotide sequences of the second probes, taking the concentrations of the extracellular vesicles with different concentrations as horizontal coordinates, taking Ct values obtained by qPCR amplification as vertical coordinates, drawing a standard curve, and determining the concentrations of the extracellular vesicles to be detected according to the Ct values of the extracellular vesicles to be detected.

The invention also provides a method for quantitatively analyzing mRNA of the extracellular vesicles based on the kit, which comprises the following steps:

mixing extracellular vesicle solutions with different concentrations with magnetic beads fixed with a first probe respectively to obtain captured extracellular vesicles;

mixing the captured extracellular vesicles with DEPC water, heating for 5-15 min at 90-100 ℃, cooling, placing on a magnetic rack, taking the supernatant as a template, carrying out RT-qPCR amplification by using a primer pair designed for mRNA to be detected, taking the concentration of the extracellular vesicles as an abscissa, and drawing a standard curve by taking a Ct value as an ordinate to obtain the relation between the concentration of the extracellular vesicles and the Ct value, wherein the Ct value represents the content of mRNA in the extracellular vesicles.

The invention also provides a method for quantitatively analyzing miRNA of the extracellular vesicles based on the kit, which comprises the following steps:

mixing the extracellular vesicle solution with magnetic beads fixed with a first probe to obtain captured extracellular vesicles;

mixing the captured extracellular vesicles with DEPC water, heating for 5-15 min at 90-100 ℃, cooling, placing on a magnetic rack, taking supernatant for reverse transcription to obtain cDNA, taking the cDNA as a template, using a primer of the miRNA to be detected, using an internal reference or an external reference, and detecting the expression level of the miRNA through qPCR.

The invention also provides a method for quantitatively analyzing the surface protein of the extracellular vesicle based on the kit, which comprises the following steps:

mixing the captured extracellular vesicles with a third probe to obtain extracellular vesicles fixed with the third probe, mixing the extracellular vesicles fixed with the third probe with double distilled water, heating at 90-100 ℃ for 5-15 min, cooling, placing on a magnetic frame, taking a supernatant as a template, carrying out qPCR amplification by using a primer designed for the third probe, taking the concentration of the extracellular vesicles as an abscissa, taking a Ct value as an ordinate, drawing a standard curve to obtain the relation between the concentration of the extracellular vesicles and the Ct value, wherein the Ct value represents the content of surface proteins of the extracellular vesicles.

The invention provides a kit and a method for capturing extracellular vesicles or quantitatively analyzing extracellular vesicle contents. The kit is low in cost and rapid, can detect various markers simultaneously, and can customize specific probes and primers according to substances to be detected.

Drawings

FIG. 1 is a schematic diagram of a method for extracellular vesicle capture or extracellular vesicle quantitative analysis or extracellular vesicle inclusion quantitative PCR analysis provided by the present invention;

FIG. 2 shows TEM characterization of extracellular vesicles secreted by HepG2 (A), huh7 (B), A375 (C), hela (D) cells provided by the invention;

FIG. 3 is an NTA image of several cell line-derived extracellular vesicles provided by the present invention. (a) HepG2; (B) Huh7; (C) a375; (D) Hela;

FIG. 4 is a graph showing the comparison of DNA concentration in solution before and after binding of Probe1 to magnetic beads according to the present invention;

FIG. 5 is a fluorescent chart of a magnetic bead solution before and after binding of Probe1-FAM and streptavidin-coated magnetic beads provided by the invention;

FIG. 6 is a schematic diagram showing fluorescence of a magnetic bead solution before and after PKH67 stained extracellular vesicles are bound to the magnetic beads;

FIG. 7 is a graph showing the results of gel electrophoresis provided by the present invention; wherein (A) gel electrophoresis verifies the binding of extracellular vesicles to Probe 2; (B) Gel electrophoresis verifies the binding of extracellular vesicles to Probe 3;

FIG. 8 shows a fluorescent quantitative PCR assay (A) HepG2 provided by the present invention; (B) Huh7; (C) a375; (D) phospholipid content of Hela cell-derived extracellular vesicles;

FIG. 9 shows a fluorescent quantitative PCR assay (A) HepG2 provided by the present invention; (B) Huh7; (C) a375; (D) GAPDH gene content of Hela cell-derived extracellular vesicles;

FIG. 10 shows a fluorescent quantitative PCR assay (A) HepG2 provided by the present invention; (B) Huh7; (C) a375; (D) Surface CD63 protein content of Hela cell-derived extracellular vesicles;

FIG. 11 is a graph showing the results of the NTA method provided by the present invention and the measurement of the number of extracellular vesicles according to the present invention;

FIG. 12 is a graph showing the results of a linear fit of the results of experiments provided by the present invention for the simultaneous detection of extracellular vesicle content in several cell lines; wherein (a) the relationship between the concentration of extracellular vesicles derived from different cells and the content of surface phospholipids; (B) When the extracellular vesicle concentration is 1×10 ⁶ In terms of individual/. Mu.L, according to individual stripsThe Ct values for phospholipid content of several cell lines were calculated by fitting lines.

Detailed Description

The invention provides a kit for extracellular vesicle capture or extracellular vesicle quantitative analysis or extracellular vesicle content quantitative analysis, comprising a magnetic bead and a first Probe (Probe 1) bound to the magnetic bead, the first Probe being modified with a group bound to the magnetic bead and cholesterol.

In the present invention, one end of the first probe is labeled with cholesterol, and the other end is labeled with a group bound to a magnetic bead; the group bound to the magnetic beads preferably includes biotin, amino, carboxyl, or epoxy groups. In the present invention, the first probe is preferably a DNA sequence having a nucleotide sequence of more than 5nt in length. The length of the sequence of the first probe is shorter, preferably 5-50 nt, and the sequence of the first probe is not hybridized with the second probe and the third probe, so that the normal operation of the subsequent qPCR reaction can be ensured. In the present invention, the nucleotide sequence of the first probe is preferably as shown in SEQ ID NO. 1: AAAAAAAAAATTGCTTATCTGACTGATGGC. Specifically, the structure of the probe of the present invention is preferably Biotin-AAAAAAAAAATTGCTTATCTGACTGATGGC-Chol (5 '-3'). The primary function of the first probe is to bind firmly to the magnetic beads on the one hand and to capture extracellular vesicles in solution efficiently on the other hand, and not to interfere with amplification and detection in subsequent PCR reactions. In particular, in the present invention, the first probe has the following advantages: (1) can be combined with magnetic beads and extracellular vesicles simultaneously; (2) DNA is more stable and less expensive; (3) the reaction time between the first probe and the magnetic beads is very short, and the first probe can be combined on the magnetic beads only for 15 min. In the present invention, the group on the first probe to be bound to the magnetic bead is selected correspondingly according to the type of the magnetic bead, such as biotin modification of the first probe when the magnetic bead is a streptavidin-coated magnetic bead. After the magnetic beads are combined with the Probe1 combined with the groups combined with the magnetic beads, the magnetic beads can be used for grabbing the extracellular vesicles from the solution through the action between cholesterol modified on the Probe1 and the phospholipid bilayer of the extracellular vesicles. The existing extracellular vesicle capture method is mostly based on immune combination of antibodies and surface protein antigens or affinity of Tim4 protein and Phosphatidylserine (PS) protein, and the two methods have high price and are not favorable for wide application. The invention adopts DNA probe to replace antibody or Tim4 protein, and the cost is greatly reduced.

In the present invention, when the kit is used for extracellular vesicle quantitative analysis, the kit further comprises a second Probe (Probe 2); one end of the second probe is marked with cholesterol. In the present invention, the second probe is preferably a DNA sequence having a nucleotide sequence of more than 60nt in length, which does not interfere with the first probe. In the present invention, the nucleotide sequence of the second probe is preferably as shown in SEQ ID NO. 2: CTCGCTCCCGTGACACTAATGCTAATGGCAGCAAGTCAACAACTTGTT GCTAAAATACCCAACTACTTGGAATACCAAATTCATCCGCAAACAATTC TACTGATCC. Specifically, the structure of the second probe of the present invention is preferably CTCGCTCCCGTGACACTAATGCTAATGGCAGCAAGTCAACAACTTGTT GCTAAAATACCCAACTACTTGGAATACCAAATTCATCCGCAAACAATTC TACTGATCC-Chol (5 '-3'). The cholesterol molecules modified on the second probe can be combined with a phospholipid bilayer of the extracellular vesicles, and the phospholipid content on the surfaces of the extracellular vesicles can be quantified by adopting qPCR to amplify and detect the content of the second probe. The experimental results of the content detection of extracellular vesicles of several cell lines were simultaneously linearly fitted (fig. 12), and the fitted lines of the several cell-derived extracellular vesicles were found to be substantially coincident, indicating that the phospholipid content of the surface of the different cell-derived extracellular vesicles was close, i.e. the phospholipid content of the surface of the extracellular vesicles was independent of the type of extracellular vesicle-derived cells and related to the number of extracellular vesicles. To date, extracellular vesicle PCR detection does not have a suitable reference gene, and the effect of sample size differences cannot be subtracted when quantitative analysis is performed. The method detects the quantity of the extracellular vesicles by detecting the phospholipid content on the surface of the extracellular vesicles through the second probe, and can use the phospholipid as an internal reference of quantitative PCR analysis to characterize the quantity of the vesicles in different samples. Therefore, the invention is expected to provide an effective internal reference for the existing extracellular vesicle quantitative PCR technology.

In the present invention, the content of the extracellular vesicles includes miRNAs of the extracellular vesicles, mRNAs of the extracellular vesicles, or surface proteins of the extracellular vesicles.

In the present invention, when the kit is used for quantitative analysis of surface proteins of extracellular vesicles, the kit further comprises a third Probe (Probe 3); the third probe contains a nucleoside aptamer sequence designed for a protein to be tested. In the present invention, the third probe is preferably a DNA sequence having a nucleotide sequence of more than 60nt, and one end is preferably a nucleic acid aptamer sequence designed to a certain protein (surface protein of extracellular vesicles to be tested). In the embodiment of the invention, the third probe is designed for CD63 on the extracellular vesicle membrane, the third probe can specifically bind to CD63 protein, and the nucleotide sequence of the third probe is preferably shown as SEQ ID NO. 3: CACCCCACCTCGCTCCCGTGACACTAATGCTAATGGCAGCAAGTCAAC AACTTGTTGCTAAAATACCCAACTACTTGGAATACCAAATTCATCCGCA AACAATTCTACTGATCCTTCAAATAACATCGTC (5 '-3'). The third probe can be specifically combined with the specific protein of the extracellular vesicle, and the concentration of the third probe can be quantified by qPCR detection, so that the content of the specific protein on the surface of the extracellular vesicle is indirectly obtained. Most of the current methods for detecting extracellular vesicle surface proteins are realized based on labeled antibodies or nucleic acid aptamers, and have limited detection sensitivity. PCR is a powerful nucleic acid in vitro amplification technique, but has not been used for protein expression analysis of extracellular vesicles.

Taking the magnetic beads of the invention as streptavidin modified magnetic beads as an example, the kit of the technical scheme of the invention can quantitatively detect extracellular vesicles and the contents thereof by a PCR technology, and the specific principle is shown in figure 1. The streptavidin-coated magnetic beads are combined with the biotin-combined Probe1 through the action of streptavidin, and then the extracellular vesicles can be grabbed from the solution by using the magnetic beads through the action between cholesterol modified on the Probe1 and phospholipid bilayer of the extracellular vesicles. After the extracellular vesicles are bound to the magnetic beads, the relevant markers of the extracellular vesicles can be detected by four steps: (1) the extracellular vesicles are continuously combined with a Probe2 modified with cholesterol, and then the Probe2 is dissociated by heating and subjected to fluorescent quantitative PCR (qPCR) analysis, so that the phospholipid content on the surface of the extracellular vesicles can be detected; (2) the extracellular vesicles are continuously combined with the Probe3, wherein the Probe3 can be specifically combined with surface proteins of the extracellular vesicles, then the Probe3 is dissociated by heating and qPCR analysis is carried out on the dissociated Probe3, and the surface protein content of the extracellular vesicles can be detected; (3) directly heating and breaking the membrane, releasing mRNA wrapped in the phospholipid bilayer of the extracellular vesicles, and performing one-step reverse transcription and qPCR (RT-qPCR) analysis on the mRNA to detect the mRNA content of the extracellular vesicles; (4) and directly heating to rupture membranes, releasing miRNA wrapped in a phospholipid bilayer of the extracellular vesicles, reversely transcribing the miRNA into cDNA, and then carrying out qPCR analysis on the cDNA obtained by reverse transcription to detect the miRNA content of the extracellular vesicles. The extracellular vesicle detection technology provided by the invention can detect phospholipid, protein and internal RNA of extracellular vesicles, does not need an extraction step, is simple and convenient to operate in the use process, uses a probe with low price and short time, can detect markers of various extracellular vesicles simultaneously, and is a novel quantitative PCR method for analyzing the extracellular vesicles and the contents thereof.

The invention mixes the magnetic bead with the first probe to obtain the magnetic bead fixed with the first probe. The source of the magnetic beads is not particularly limited, and conventional commercially available magnetic beads well known to those skilled in the art may be used. The magnetic beads as used in the examples herein are preferably commercially available from the company Thermo Fisher Scientific, dynabeads, U.S. Pat. No. 5, ^TM MyOne Streptavidin T1. The invention is preferably applied to magnetic beadsAfter washing, the magnetic beads are mixed with the first probe, and the method for washing is not particularly limited, and the magnetic beads are washed by using the washing buffer recommended in the specification corresponding to the magnetic beads. After washing, the magnetic beads are preferably resuspended in washing buffer and a first probe solution is added, preferably in the same volume as the magnetic bead solution, the concentration of the first probe being preferably 20 to 80. Mu.M, more preferably 40. Mu.M (the solvent is water). After mixing, the mixture is incubated at room temperature for preferably 10 minutes or more, more preferably 15 minutes, and the room temperature according to the present invention is preferably 15 to 30℃unless otherwise specified. After incubation, the invention is preferably rinsed again with a wash buffer and finally with PBS.

Extracting extracellular vesicles from the sample to obtain extracellular vesicle solution. The method for extracting extracellular vesicles in the present invention is not particularly limited, and the extraction of vesicles may be performed by ultracentrifugation, which is well known to those skilled in the art.

The extracellular vesicle solution is mixed with the magnetic beads immobilized with the first probe, thereby capturing the extracellular vesicles. In the present invention, after the mixing, the incubation is preferably performed at 4℃for 1 to 8 hours, more preferably 2 hours. After incubation, it is preferably washed with PBS solution.

The invention mixes the magnetic bead with the first probe to obtain the magnetic bead fixed with the first probe. The sources of the magnetic beads and the mixing conditions are preferably as described above, and are not described in detail herein.

And mixing the extracellular vesicle solution with different concentrations and the extracellular vesicle solution to be detected with the magnetic beads fixed with the first probes respectively to obtain captured extracellular vesicles. The present invention incubates the extracellular vesicle solution with the magnetic beads immobilized with the first probe, preferably at 4℃for 1 to 8 hours, more preferably 2 hours, to bind the extracellular vesicles to the magnetic beads.

Mixing the captured extracellular vesicles with a second probe to obtain extracellular vesicles fixed with the second probe, mixing the extracellular vesicles fixed with the second probe with double distilled water, heating at 90-100 ℃ for 5-15 min, cooling, placing on a magnetic frame, taking a supernatant as a template, performing qPCR amplification by using primers designed for nucleotide sequences of the second probe, taking the concentrations of extracellular vesicles with different concentrations as horizontal coordinates, taking Ct values obtained by qPCR amplification as vertical coordinates, drawing a standard curve, and determining the concentration of extracellular vesicles to be detected according to the Ct values of the extracellular vesicles to be detected. The captured extracellular vesicles are mixed with the second probe and incubated for 30min, preferably at 4 ℃, after which washing, preferably with PBS, is performed, preferably 5 times. After washing, preferably double distilled water is added, heated at 90-100 ℃ for 5-15 min, more preferably at 95 ℃ for 5min, and the supernatant is taken as a template on a magnetic rack to carry out qPCR reaction. In the present invention, the sequence of the primer designed for the nucleotide sequence of the second probe is preferably as shown in SEQ ID NO.4 (CTCGCTCCCGTGACACTAAT, F1) and SEQ ID NO.5 (GGATCAGTAGAATTGTTTGCGGA, R1). In the present invention, the qPCR reaction mixture solution is preferably prepared according to the instructions of Takara RR091A kit, and the total volume of the solution is preferably 20. Mu.L, including 10. Mu.L of TB Green Premix DimerEraser (2X), 7.2. Mu.L of double distilled water, 0.4. Mu.L of 10. Mu.M primer F1, 0.4. Mu.L of 10. Mu.M primer R1 and 2. Mu.L of template. The invention preferably uses a fluorescence quantitative PCR system (Hangzhou Bori Co.) to perform qPCR detection on the prepared mixed solution, and the detection program is preferably as follows: denaturation: 95 ℃ for 30s; PCR process (40 cycles): dissociation is carried out at 95 ℃ for 5s, and annealing is carried out at 60 ℃ for 34 s.

After the magnetic beads fixed with the first probes are obtained, extracellular vesicle solutions with different concentrations are respectively mixed with the magnetic beads fixed with the first probes to obtain captured extracellular vesicles. The present invention incubates the extracellular vesicle solution with the magnetic beads immobilized with the first probe, preferably at 4℃for 1 to 8 hours, more preferably 2 hours, to bind the extracellular vesicles to the magnetic beads.

After the captured extracellular vesicles are obtained, the captured extracellular vesicles are mixed with DEPC water, heated for 5-15 min at 90-100 ℃, more preferably heated for 5min at 95 ℃, cooled and placed on a magnetic frame, the supernatant is taken as a template, RT-qPCR amplification is carried out by using a primer pair designed for mRNA to be detected, the concentration of the extracellular vesicles is taken as an abscissa, a Ct value is taken as an ordinate, a standard curve is drawn, and the relation between the concentration of the extracellular vesicles and the Ct value is obtained, wherein the Ct value represents the content of mRNA in the extracellular vesicles. In the present invention, the nucleotide sequences of the primer pair designed for the mRNA to be tested are preferably as shown in SEQ ID NO.6 (ACTGTGGCGTGATGGCC, F2) and SEQ ID NO.7 (AGTGGGTGTCGCTGTTG, R2). The present invention preferably prepares a RT-qPCR reaction mixture solution according to the instructions of Takara RR096A kit, the total volume of the solution is preferably 20. Mu.L, comprising 10. Mu.L of One Step TB Green RT-PCR Buffer (2X), 5.2. Mu.L of double distilled water, 1.2. Mu.L of TaKaRa Ex Taq HS Mix, 0.4. Mu.L of PrimeScript PLUS RTase Mix, 0.4. Mu.L of ROX Reference Dye II (50X), 0.4. Mu.L of 10. Mu.M primer F2, 0.4. Mu.L of 10. Mu.M primer R2 and 2. Mu.L of template RNA. The invention preferably uses a fluorescence quantitative PCR system (Hangzhou Bori Co.) to perform RT-qPCR detection on the prepared mixed solution, and the detection program is preferably as follows: reverse transcription: 42 ℃ for 5min; denaturation: 95 ℃ for 30s; PCR process (40 cycles): dissociation is carried out at 95 ℃ for 5s, and annealing is carried out at 60 ℃ for 34 s.

Mixing the magnetic beads with the first probes to obtain the magnetic beads immobilized with the first probes. The sources of the magnetic beads and the mixing conditions are preferably as described above, and are not described in detail herein.

After the magnetic beads with the first probes immobilized thereon are obtained, the extracellular vesicle solution is mixed with the magnetic beads with the first probes immobilized thereon to obtain captured extracellular vesicles. The present invention incubates the extracellular vesicle solution with the magnetic beads immobilized with the first probe, preferably at 4℃for 1 to 8 hours, more preferably 2 hours, to bind the extracellular vesicles to the magnetic beads.

After the captured extracellular vesicles are obtained, the captured extracellular vesicles are mixed with DEPC water, heated for 5-15 min at 90-100 ℃, more preferably heated for 5min at 95 ℃, cooled and placed on a magnetic frame, the supernatant is taken for reverse transcription to obtain cDNA, the cDNA is taken as a template, and the primer of the miRNA to be detected is utilized, and the expression level of the miRNA is detected by qPCR by using internal reference or external reference. In the present invention, the reverse transcription is preferably a tailing reverse transcription reaction, and the tailing method of the present invention preferably uses a kit of Takara 638313. In the present invention, the reverse transcription system is preferably 10. Mu.L, including 5. Mu.L of 2 XMRQ Buffer, 1.25. Mu.L of mRQ Enzyme and 3.75. Mu.L of a solution containing the miRNA to be reverse transcribed. The reverse transcription step is preferably incubated at 37℃for 1h and heated at 85℃for 5min to inactivate the enzyme. After the cDNA is obtained, the cDNA is preferably diluted and used as a template, and the dilution factor is preferably 10 times. In the present invention, the internal reference preferably includes U6. In the present invention, the external reference preferably comprises cel-miR-39 of the nematode. In the present invention, the kit used for qPCR is preferably Takara 638314. In the invention, the primer sequence of the miRNA to be detected is preferably shown as SEQ ID NO.8 (TGGAGTGTGACAATGGTGTTTG, primer F3). In the present invention, it is preferable to prepare qPCR reaction mixture solution according to the instructions of Takara638314 kit, the total volume is preferably 20. Mu.L, including 10. Mu.L of TB Green Advantage Premix (2X), 6.8. Mu.L of double distilled water, 0.4. Mu.L of ROX Dye (50X), 0.4. Mu.L of 10. Mu.M primer F3, 0.4. Mu.L of 10. Mu.M mRQ' primer and 2. Mu.L of cDNA. In the present invention, primer mRQ' Primer was present in the Takara 638313 kit. The present invention preferably uses a fluorescent quantitative PCR system (Hangzhou Bori Co.) for qPCR detection, preferably as follows: reverse transcription: denaturation: 95 ℃ for 10s; PCR process (40 cycles): dissociation was carried out at 95℃for 5s, annealing was carried out at 60℃for 20s, and fluorescence signals were detected during each cycle of annealing.

In the invention, the miR-122 is detected by taking U6 as an internal reference, the preparation of a mixed solution of qPCR reaction is preferably similar to that described in the previous section, and the primers are changed into a U6 Forward Primer (10 mu M) and a U6 Reverse Primer (10 mu M) of the specific Primer of the U6, which are in a Takara 638313 kit. The procedure for qPCR is also the same as described in the previous paragraph. The detection results of miR-122 and U6 are analyzed by a-delta Ct method.

After the captured extracellular vesicles are obtained, the captured extracellular vesicles are mixed with a third probe to obtain extracellular vesicles fixed with the third probe, the extracellular vesicles fixed with the third probe are mixed with double distilled water, heated for 5-15 min at 90-100 ℃, more preferably for 5min at 95 ℃, cooled and placed on a magnetic frame, the supernatant is taken as a template, qPCR amplification is carried out by using primers designed for the third probe, the concentration of the extracellular vesicles is taken as an abscissa, the Ct value is taken as an ordinate, and a standard curve is drawn to obtain the relation between the concentration of the extracellular vesicles and the Ct value, wherein the Ct value represents the content of surface proteins of the extracellular vesicles. In the present invention, the incubation is preferably performed for 30min at 4 ℃ after the mixing, and the washing is preferably performed with PBS for 5 times after the incubation. In the present invention, the nucleotide sequence of the primer designed for the third probe is preferably as shown in SEQ ID NO.4 (CTCGCTCCCGTGACACTAAT, F1) and SEQ ID NO.5 (GGATCAGTAGAATTGTTTGCGGA, R1). In the present invention, the qPCR is preferably performed using the TakaraRR091A kit. The present invention preferably prepares a qPCR reaction mixture solution according to the instructions of Takara RR091A kit, the total volume of the solution being 20. Mu.L, comprising 10. Mu.L of TB Green Premix DimerEraser (2X), 7.2. Mu.L of double distilled water, 0.4. Mu.L of 10. Mu.M primer F1, 0.4. Mu.L of 10. Mu.M primer R1 and 2. Mu.L of template DNA. The invention preferably uses a fluorescence quantitative PCR system (Hangzhou Bori Co.) to perform qPCR detection on the prepared mixed solution, and the detection program is preferably as follows: denaturation: 95 ℃ for 30s; PCR process (40 cycles): dissociation is carried out at 95 ℃ for 5s, and annealing is carried out at 60 ℃ for 34 s.

The following describes in further detail, with reference to specific examples, a kit and method for capturing extracellular vesicles or quantitatively analyzing extracellular vesicle contents according to the present invention, and the technical scheme of the present invention includes, but is not limited to, the following examples.

Example 1

Extracellular vesicle extraction and characterization

Extraction of extracellular vesicles: extracellular vesicles were extracted from the samples using ultracentrifugation. Centrifuging at 1000 Xg for 10min to remove living cells; centrifugation at 2000 Xg for 10min, dead cells were removed; cell debris was removed by centrifugation at 10,000Xg for 30 min. Filtering the supernatant obtained in the above steps on a 220nm filter, removing excessive large particles, centrifuging for 120min at 150,000Xg, discarding the supernatant, dispersing the obtained precipitate with 1 XPBS solution again, centrifuging for 120min at 150,000Xg again, and dispersing the obtained precipitate with a small amount of 1 XPBS solution to obtain the standard extracellular vesicle sample. To reduce losses, the centrifugation steps above were all carried out at 4 ℃. The purified extracellular vesicles were identified and characterized by Transmission Electron Microscopy (TEM) and Nanoparticle Tracking (NTA).

Magnetic bead modification process

And (3) cleaning magnetic beads: transfer 4 μl of streptavidin-coated magnetic beads to a 1.5mL protein low adsorption centrifuge tube, place on a magnetic rack for 1min, and remove the solution. Adding 200 μl of cleaning buffer, suspending magnetic beads, oscillating for 15s, centrifuging to remove water beads attached to the wall of the centrifuge tube, placing on a magnetic rack for 1min, and removing the solution. The washing step was repeated three times.

Immobilization Probe1: the washed magnetic beads were resuspended in 8. Mu.L of wash buffer and 8. Mu.L of 40. Mu.M Probe1 aqueous solution was added and incubated at room temperature for 15min. After completion of the reaction, the reaction mixture was washed three times with 200. Mu.L of the washing buffer and once with 200. Mu.L of PBS.

Extracellular vesicle capture

After binding the streptavidin-coated magnetic beads to Probe1, 20. Mu.L of extracellular vesicle solution was added to the system, and incubated at 4℃for 2 hours. After incubation, the cells were washed three times with 200. Mu.L of 1 XPBS solution.

Extracellular vesicle characterization

Test results:

TEM characterization: TEM characterization of several cell-derived extracellular vesicles obtained by ultracentrifugation is shown in FIG. 2 (TEM characterization of extracellular vesicles secreted by HepG2 (A), huh7 (B), A375 (C), hela (D) cells; scale: 200 nm), and vesicles are all cup-shaped structures.

NTA characterization: NTA characterization of several cell-derived extracellular vesicles obtained by ultracentrifugation is shown in FIG. 3 (NTA images of several cell-line-derived extracellular vesicles of FIG. 3 were (A) HepG2, (B) Huh7, (C) A375, (D) Hela), the extracellular vesicles were all between 0 and 400nm in diameter, and the concentration was 10 ¹¹ ～10 ¹² particles/mL. The average diameters and concentrations of several samples are shown in Table 1.

Table 1 NTA results for several cell line-derived extracellular vesicles: average particle size and concentration

Example 2

Verification test

Scheme for verifying binding of streptavidin-modified magnetic beads to Probe 1:

scheme 1: after taking 4. Mu.L of streptavidin-coated magnetic beads and washing three times with a washing buffer, resuspending in 8. Mu.L of the washing buffer, 8. Mu.L of a 40. Mu.M aqueous solution of Probe1 was added to the system, wherein the sequence (5 '-3') of Probe1 was Biotin-AAAAAAAAAATTGCTTATCTGACTGATGGC-Chol. The above solutions were mixed and incubated at room temperature for 15min, and the concentration of DNA (i.e., probe 1) in the solution before and after the reaction was detected using Nanodrop.

Test results: FIG. 5 is a graph showing comparison of DNA concentration in a solution before and after binding of probe1 to magnetic beads. As shown in FIG. 5, the concentration of Probe1 solution before the reaction was 26.1 ng/. Mu.L ^-1 After 15min of reaction at room temperature, the concentration of Probe1 in the solution was reduced to 4.4 ng. Mu.L ^-1 It was demonstrated that Probe1 was bound to a large amount of magnetic beads.

Scheme 2: after taking 4. Mu.L of streptavidin-coated magnetic beads and washing three times with a washing buffer, resuspending in 8. Mu.L of the washing buffer, then adding 8. Mu.L of an aqueous solution of Probe1-FAM with a concentration of 40. Mu.M, wherein the sequence (5 '-3') of Probe1-FAM is Biotin-AAAAAAAAAATTGCTTATCTGACTGATGGC-FAM. The above solutions were mixed and incubated at room temperature for 15min, and the fluorescence intensities of the magnetic bead solutions before and after the reaction were measured.

Test results: FIG. 6 is a fluorescent image of a magnetic bead solution before and after binding of Probe1-FAM to streptavidin-coated magnetic beads. As shown in FIG. 6, the magnetic beads after the reaction can be seen to have yellow-green bright fluorescence (left), while the magnetic beads themselves have no fluorescence (right), which can prove that biotinylated DNA molecules can be bound on the surfaces of streptavidin-modified magnetic beads.

Scheme for verifying extracellular vesicles captured by magnetic beads:

test protocol: after binding the streptavidin coated magnetic beads to Probe1, 20 μl of extracellular vesicle solution was added to the system, wherein the phospholipid bilayer of extracellular vesicles was stained with PKH67 kit. The reaction system was incubated at 4℃for 2h, after which it was washed three times with 200. Mu.L of 1 XPBS solution. The fluorescence intensity of the magnetic bead solution before and after the reaction was detected.

Test results: FIG. 7, schematic representation of fluorescence of magnetic bead solutions before and after PKH67 stained extracellular vesicles bind to magnetic beads. As shown in FIG. 7, PKH67 stained extracellular vesicles bound to the Probe1 molecule-modified magnetic beads, and no apparent fluorescence was observed before the binding, indicating that extracellular vesicles were bound to the magnetic bead surface.

Protocol for validation of extracellular vesicles binding to Probe2/Probe 3:

Test protocol: two probes, probe2 and Probe3, were designed and synthesized, wherein the sequence (5 '-3') of Probe2 was CTCGCTCCCGTGACACTAATGCTAATGGCAGCAAGTCAACAACTTGTT GCTAAAATACCCAACTACTTGGAATACCAAATTCATCCGCAAACAATTC TACTGATCC-Chol and the sequence (5 '-3') of Probe3 was CACCCCACCTCGCTCCCGTGACACTAATGCTAATGGCAGCAAGTCAAC AACTTGTTGCTAAAATACCCAACTACTTGGAATACCAAATTCATCCGCA AACAATTCTACTGATCCTTCAAATAACATCGTC. The cholesterol molecule modified on Probe2 can be combined with phospholipid bilayer of extracellular vesicle, and Probe3 can be specifically combined with CD63 protein on extracellular vesicle membrane.

Extracellular vesicles were verified for Probe2/Probe3 binding by agarose gel electrophoresis. mu.L of 1. Mu.M Probe2 or Probe3 solution was added to 10. Mu.L of extracellular vesicle solution and incubated at 4℃for 30min. 1% agarose gel (stained with SYBR GreenI dye) was prepared, and the incubated mixture was loaded, electrophoresed at 60V for 90min, observed with a gel imaging analyzer and photographed.

Test results: in FIG. 8, (A) gel electrophoresis verifies the binding of extracellular vesicles to Probe 2; (B) Gel electrophoresis confirmed the binding of extracellular vesicles to Probe 3. As shown in FIG. 8, (A) in FIG. 8 demonstrates the binding of extracellular vesicles to Probe2, where lane 1 is a mixture of extracellular vesicles and Probe2, lane 2 is a solution of Probe2, lane 1 has a fluorescent band near the loading port, indicating that there is also Probe2 at this location, and the electrophoresis speed is slower than that of pure Probe2, indicating that the band is extracellular vesicles to which Probe2 is bound. FIG. 8 (B) shows the binding of extracellular vesicles to aptamer Probe3, wherein lane 1 is a mixture of extracellular vesicles and Probe3, lane 2 is a solution of Probe3, lane 1 has a fluorescent band near the port, indicating that there is also Probe3 at this location, and the electrophoresis speed is slower than that of pure Probe3, indicating that the band is extracellular vesicles bound to Probe 3.

Example 3

Quantitative PCR determination of phospholipid content of extracellular vesicles

Test protocol:

extracellular vesicle samples of different concentrations were incubated with Probe 1-modified magnetic beads for 2h (20. Mu.L of reaction system) respectively to bind extracellular vesicles to the magnetic beads.

After extracellular vesicles were bound, they were incubated with 1 XPBS solution of Probe2 for 30min (20. Mu.L of reaction system), and then washed five times with 200. Mu.L of 1 XPBS solution.

After washing, 20. Mu.L of double distilled water was added to the centrifuge tube, then heated for 5min at 95℃and cooled, the beads were separated from the solution by placing on a magnetic rack for 1min, 2. Mu.L of the solution was taken as template DNA, and qPCR reaction mixture was prepared according to the instructions of Takara RR091A kit, the total volume of the solution was 20. Mu.L, including 10. Mu.L of TB Green Premix DimerEraser (2X), 7.2. Mu.L of double distilled water, 0.4. Mu.L of 10. Mu.M primer F1, 0.4. Mu.L of 10. Mu.M primer R1 and 2. Mu.L of template DNA. Wherein the sequence (5 '-3') of the primer F1 was CTCGCTCCCGTGACACTAAT and the sequence (5 '-3') of the primer R1 was GGATCAGTAGAATTGTTTGCGGA.

qPCR detection was performed on the prepared mixed solution using a fluorescent quantitative PCR system (Bo Corp., hangzhou) as follows: denaturation: 95 ℃ for 30s; PCR process (40 cycles): dissociation at 95℃for 5s, annealing at 60℃for 34s, and detection of fluorescence signal during each cycle of annealing.

Test results:

the relationship between the extracellular vesicle concentration and the Ct value was obtained by taking the concentrations of several cell-derived extracellular vesicles as the x-axis and the Ct value as the y-axis of the qPCR results, respectively, as shown in FIG. 9 (FIG. 9, fluorescence quantitative PCR assay (A) HepG2, (B) Huh7, (C) A375, (D) phospholipid content of HeLa cell-derived extracellular vesicles). The Ct value indicates the concentration of Probe2 under this condition, and cholesterol groups on Probe2 can bind to phospholipids on the surface of extracellular vesicles, so that the Ct value can be used to represent the phospholipid content of extracellular vesicles. The results show that the concentration of several cell-derived extracellular vesicles is semilogarithmic with respect to the Ct value (i.e. phospholipid content). The higher the extracellular vesicle concentration, the smaller the Ct value, i.e. the higher the phospholipid content.

Example 4

Quantitative PCR measurement of mRNA (GAPDH) content of extracellular vesicles

Test protocol:

extracellular vesicles of different concentrations were incubated with Probe 1-modified magnetic beads for 2h (20. Mu.L of reaction system) to bind extracellular vesicles to the magnetic beads.

After binding extracellular vesicles, 20. Mu.L DEPC water was added to the centrifuge tube and then heated in a metal bath at 95℃for 5min, cooled, placed on a magnetic rack for 1min to separate the magnetic beads from the solution, 2. Mu.L of the solution was used as a template, and RT-qPCR reaction mix solution was prepared according to the instructions of Takara RR096A kit, the total volume of the solution was 20. Mu.L, comprising 10. Mu.L One Step TB Green RT-PCR Buffer (2X), 5.2. Mu.L double distilled water, 1.2. Mu.L TaKaRa Ex Taq HS Mix, 0.4. Mu.L PrimeScript PLUS RTase Mix, 0.4. Mu.L ROX Reference Dye II (50X), 0.4. Mu.L 10. Mu.M primer F2, 0.4. Mu.L 10. Mu.M primer R2 and 2. Mu.L template RNA. Wherein F2 has a sequence (5 '-3') of ACTGTGGCGTGATGGCC and primer R2 has a sequence (5 '-3') of AGTGGGTGTCGCTGTTG.

The prepared mixed solution was subjected to RT-qPCR detection using a fluorescent quantitative PCR system (Bo Corp. Hangzhou) as follows: reverse transcription: 42 ℃ for 5min; denaturation: 95 ℃ for 30s; PCR process (40 cycles): dissociation at 95℃for 5s, annealing at 60℃for 34s, and detection of fluorescence signal during each cycle of annealing.

Test results:

the relationship between extracellular vesicle concentration and Ct value was obtained by taking the concentrations of several cell-derived extracellular vesicles as x-axis and the Ct value as y-axis of qPCR results, respectively, as shown in FIG. 10 (FIG. 10, fluorescence quantitative PCR assay (A) HepG2, (B) Huh7, (C) A375, (D) GAPDH gene content of HeLa cell-derived extracellular vesicles). The Ct value indicates the amount of GAPDH gene in the extracellular vesicles under the condition. The results show that the concentration of several cell-derived extracellular vesicles is semilogarithmic with respect to the Ct value (i.e.the content of the GAPDH gene). The higher the extracellular vesicle concentration, the smaller the Ct value, i.e., the higher the GAPDH gene content.

Example 5

Quantitative PCR (polymerase chain reaction) measurement of miR-122 content of extracellular vesicles

Test protocol:

(1) different types of extracellular vesicles were incubated with Probe 1-modified magnetic beads for 2h (20. Mu.L of reaction system) respectively to bind extracellular vesicles to the magnetic beads.

(2) After combining extracellular vesicles, adding 20 mu L of DEPC water into a centrifuge tube, then heating for 5min at 95 ℃ in a metal bath, cooling, placing on a magnetic rack for 1min to separate magnetic beads from a solution, taking 3.75 mu L of the solution for reverse transcription reaction by a tailing method, and carrying out reverse transcription on miRNA to obtain cDNA. Wherein the tailing method uses a kit of Takara 638313, and the reverse transcription system is 10. Mu.L, including 5. Mu.L of 2 XMRQ Buffer, 1.25. Mu.L of mRQ Enzyme and 3.75. Mu.L of a solution containing the miRNA to be reverse transcribed. The reverse transcription step was incubated at 37℃for 1h and heated at 85℃for 5min to inactivate the enzyme.

(3) The cDNA obtained by the reverse transcription was diluted 10-fold, 2. Mu.L of the template was used, and a qPCR reaction mixture solution was prepared according to the instructions of Takara 638314 kit, the total volume of the solution was 20. Mu.L, including 10. Mu.L of TB Green Advantage Premix (2X), 6.8. Mu.L of double distilled water, 0.4. Mu.L of ROX Dye (50X), 0.4. Mu.L of 10. Mu.M Primer F3, 0.4. Mu.L of 10. Mu.M mRQ' Primer and 2. Mu.L of cDNA. Wherein Primer F3 is a specific 5 'end Primer of miR-122, the sequence (5' -3 ') of which is TGGAGTGTGACAATGGTGTTTG, and Primer mRQ' Primer is present in the Takara 638313 kit.

(4) qPCR detection was performed on the prepared mixed solution using a fluorescent quantitative PCR system (Bo Corp., hangzhou) as follows: reverse transcription: denaturation: 95 ℃ for 10s; PCR process (40 cycles): dissociation was carried out at 95℃for 5s, annealing was carried out at 60℃for 20s, and fluorescence signals were detected during each cycle of annealing.

(5) The miR-122 is detected by taking U6 as an internal reference, the preparation of a mixed solution of qPCR reaction is similar to that shown in the step (3), and the primers are changed into a U6 Forward Primer (10 mu M) and a U6 Reverse Primer (10 mu M) of the specific Primer of the U6, which are in a Takara 638313 kit. The procedure for qPCR was the same as shown in step (4). The detection results of miR-122 and U6 are analyzed by a-delta Ct method.

Test results:

the expression levels of miR-122 in several cell line-derived extracellular vesicles are shown in Table 1, and the lower the dCT value, the higher the expression level of miR-122. As can be seen from Table 2, the expression level of miR-122 in extracellular vesicles derived from several cell lines was from high to low, hepG2 > Huh7 > A375. Apprxeq. Hela.

Table 2 qPCR detection results of miR-122 in several cell line derived extracellular vesicles.

Example 6

Quantitative PCR determination of CD63 content of extracellular vesicles

Test protocol:

After extracellular vesicles were bound, they were incubated with Probe3 in 1 XPBS for 30min (20. Mu.L of reaction system), and then washed five times with 200. Mu.L of 1 XPBS.

After washing, 20. Mu.L of double distilled water was added to the centrifuge tube, then heated for 5min at 95℃and cooled, the beads were separated from the solution by placing on a magnetic rack for 1min, 2. Mu.L of the solution was used as template DNA, and qPCR reaction mixture was prepared according to the instructions of Takara RR091A kit, the total volume of the solution was 20. Mu.L, including 10. Mu.L of TB Green Premix DimerEraser (2X), 7.2. Mu.L of double distilled water, 0.4. Mu.L of 10. Mu.M primer F1, 0.4. Mu.L of 10. Mu.M primer R1 and 2. Mu.L of template DNA.

Test results:

the relationship between the extracellular vesicle concentration and the Ct value was obtained by taking the concentrations of several cell-derived extracellular vesicles as the x-axis and the Ct value as the y-axis of the qPCR results, respectively, as shown in FIG. 11 (FIG. 11, fluorescence quantitative PCR assay (A) HepG2, (B) Huh7, (C) A375, and (D) the surface CD63 protein content of HeLa cell-derived extracellular vesicles). The Ct value indicates the concentration of Probe3 under this condition, and Probe3 can specifically bind to the CD63 protein on the surface of the extracellular vesicle, so that the Ct value can be used to represent the CD63 protein content of the extracellular vesicle. The results show that the concentration of several cell-derived extracellular vesicles is semilogarithmic with respect to the Ct value (i.e. surface CD63 protein content). The higher the extracellular vesicle concentration, the smaller the Ct value, i.e. the higher the surface CD63 protein content.

Comparative example 1

Comparison with NTA

Test results: the results of NTA measurement on the number of extracellular vesicles derived from several cells are shown as x-axis, and the Ct value of the phospholipid detection result is shown as y-axis, and the obtained results are shown in FIG. 12 (the result graph of FIG. 12, in which the NTA method is used for measuring the number of extracellular vesicles with the invention), and the slopes of the several curves are similar, which indicates that the surface phospholipid content of extracellular vesicles derived from different cell lines is similar, so that the number of extracellular vesicles can be detected by the method.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> university of Zhejiang

<120> a kit and method for extracellular vesicle capture or extracellular vesicle quantitative analysis or extracellular vesicle content quantitative analysis

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

aaaaaaaaaa ttgcttatct gactgatggc 30

<210> 2

<211> 106

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ctcgctcccg tgacactaat gctaatggca gcaagtcaac aacttgttgc taaaataccc 60

aactacttgg aataccaaat tcatccgcaa acaattctac tgatcc 106

<210> 3

<211> 130

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

caccccacct cgctcccgtg acactaatgc taatggcagc aagtcaacaa cttgttgcta 60

aaatacccaa ctacttggaa taccaaattc atccgcaaac aattctactg atccttcaaa 120

taacatcgtc 130

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ctcgctcccg tgacactaat 20

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ggatcagtag aattgtttgc gga 23

<210> 6

<211> 17

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

actgtggcgt gatggcc 17

<210> 7

<211> 17

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

agtgggtgtc gctgttg 17

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tggagtgtga caatggtgtt tg 22

Claims

1. A kit for quantitative analysis of the contents of extracellular vesicles, comprising magnetic beads and a first probe bound to the magnetic beads, the first probe being modified with a group bound to the magnetic beads and cholesterol; the length of the nucleotide sequence of the first probe is 5-50 nt; the nucleotide sequence of the first probe is shown as SEQ ID NO. 1;

the kit further comprises a second probe; one end of the second probe is marked with cholesterol; the length of the nucleotide sequence of the second probe is greater than 60nt; the nucleotide sequence of the second probe is shown as SEQ ID NO. 2;

the content of the extracellular vesicles comprises miRNA of the extracellular vesicles, mRNA of the extracellular vesicles or surface proteins of the extracellular vesicles; the kit further comprises a third probe; the third probe comprises a nucleoside aptamer sequence designed for a protein to be detected; the length of the nucleotide sequence of the third probe is greater than 60nt;

the nucleotide sequence of the first probe is not hybridized with the nucleotide sequence of the second probe and the nucleotide sequence of the third probe.

2. The kit according to claim 1, wherein one end of the first probe is labeled with cholesterol and the other end is labeled with a group that binds to a magnetic bead; the group bound to the magnetic beads includes biotin, amino, carboxyl or epoxy groups.

3. A method for quantitative analysis of extracellular vesicle contents based on the kit of claim 1 or 2, not used for disease diagnosis purposes, comprising the steps of:

1) Detecting extracellular vesicle concentration, comprising the steps of:

mixing the captured extracellular vesicles with a second probe, and cleaning to obtain extracellular vesicles immobilized with the second probe; mixing the extracellular vesicles fixed with the second probes with double distilled water, heating for 5-15 min at 90-100 ℃, cooling, placing on a magnetic frame, taking the supernatant as a template, performing qPCR (quantitative polymerase chain reaction) amplification by using primers designed for the nucleotide sequences of the second probes, taking the concentrations of the extracellular vesicles with different concentrations as horizontal coordinates, taking Ct values obtained by qPCR amplification as vertical coordinates, drawing a standard curve, and determining the concentrations of the extracellular vesicles to be detected according to the Ct values of the extracellular vesicles to be detected;

2) Also comprises the steps of quantifying mRNA of the extracellular vesicles: mixing the magnetic beads with the first probes to obtain magnetic beads fixed with the first probes;

4. The method of quantifying the extracellular vesicle content according to claim 3, further comprising quantifying the miRNA of the extracellular vesicle:

5. The method of quantifying the amount of extracellular vesicle content according to claim 3, further comprising quantitatively analyzing the surface protein of the extracellular vesicle: mixing the magnetic beads with the first probes to obtain magnetic beads fixed with the first probes;