CN113717984A - Nucleic acid pesticide for resisting tobacco mosaic virus and synthesis, purification and application thereof - Google Patents

Abstract

The invention provides a nucleic acid pesticide for resisting tobacco mosaic virus, and synthesis, purification and application thereof, TMV-cpBoth ends of the gene respectively contain a T7 promoter, the sequence is shown as SEQ ID NO.1, and the plasmid pT7B-TMV-EcoRI-cpAdopts TMV-cpGenes introduced on both sides of the T7 promoterEcoObtaining RI enzyme cutting sites; addingEndonucleasesEcoRI, obtaining a template of in vitro transcription by digestion, adding a nucleoside triphosphate mixture containing inosinic acid for in vitro transcription and purification to obtain TMV-cp(I) -a dsRNA; the invention synthesizes dsRNA modified by inosinic acid by a biological method for the first time, and the nucleic acid pesticide has stability under different temperatures and different ultraviolet conditions and has great potential for preventing and treating tobacco mosaic virus; the nucleic acid pesticide is non-toxic and harmless to the environment, has good effects in cost control and application, and is expected to become an excellent biological pesticide.

Description

Nucleic acid pesticide for resisting tobacco mosaic virus and synthesis, purification and application thereof

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to a tobacco mosaic virus resistant nucleic acid pesticide and synthesis, purification and application thereof.

Background

Tobacco is one of important economic crops in China and has a long planting history. The Tobacco virus disease is one of the most common, most extensive and most serious diseases on Tobacco in China, and is caused by Tobacco Mosaic Virus (TMV) infection. TMV is a single-stranded RNA virus, is very stable and has wide hosts, and is very easy to infect solanaceae crops such as tobacco and the like. In recent years, the occurrence of tobacco mosaic virus in China is on a trend of increasing year by year, the tobacco yield is reduced, the quality is reduced and even the tobacco is not harvested after being infected with the virus, and the safe production and development of the tobacco in China are seriously threatened. Therefore, the prevention and control of tobacco virus diseases and the treatment of the easily infected plants are very important.

RNA interference (RNAi) is one of the important biological findings in recent years, and two american scientists who discovered the mechanism of RNAi have thus acquired a nobel physiological or medical prize in 2006. RNAi is a highly conserved gene silencing phenomenon induced by double-stranded RNA (dsRNA) and efficiently and specifically degrading homologous mRNA in the evolution process, and the technology is widely applied to the agricultural field and the medical gene therapy fields such as malignant tumors, infectious diseases and the like. The application of RNAi in the agricultural field is mainly realized by 3 ways of host-induced gene silencing, virus-induced gene silencing and spray-induced gene silencing. The spray-induced gene silencing mode is similar to the application method of the traditional pesticide, dsRNA is directly sprayed or injected to an acting object, and the target gene silencing effect is achieved through pest feeding or pathogen infection, so that the application and popularization in agricultural activities are facilitated.

The dsRNA pesticide has the advantages of being applied to the prevention and control of plant diseases and insect pests: 1) because the dsRNA has high specificity and targeting property, the dsRNA is safe to non-target organisms; 2) RNA belongs to a substance naturally existing in the environment or in an organism, can be degraded through a natural way, and has no residual risk; 3) compared with the existing chemical pesticide, the dsRNA is more difficult to generate drug resistance; 4) the production mode is clean production, and the environment is not influenced; 5) the production route is a platform technology, and the product can be developed aiming at all kinds of pests. Therefore, compared with the traditional chemical pesticide control, the nucleic acid pesticide prepared based on the RNA interference technology has potential and good application prospect in controlling plant diseases and insect pests, and the RNA biological pesticide is considered as the third revolution of the pesticide field.

Nucleic acid is influenced by various complex factors such as nuclease, illumination, pH and the like in the interior and environment of a target organism, so that the stability of the nucleic acid is poor, and the silencing efficiency of a target gene is easily reduced. In order to improve the stability of nucleic acid, chemical modifications are mostly adopted to enhance the effective delivery of small nucleic acid siRNA drugs containing 21-22 base pairs, and the commonly used chemical modifications mainly include phosphate group modification, base modification, ribose modification and the like, such as 2' -methoxy (2 ' -OMe), 2' -methoxyethoxy (2 ' -MOE) and 2' -F, which are frequently used in ribose modification. Recent studies have shown that guanylic acid can be replaced by inosinic acid (also known as inosinic acid, abbreviated as I) in siRNA sense strand (ss) modifications, which have been shown to increase RNAi activity (haripriya addapalli, 2010). Compared with the chemical synthesis and modification of 21 base pair siRNA, the synthesis cost of long-chain dsRNA of hundreds of base pairs is high, the chemical synthesis is difficult to realize, the large-scale production is more difficult, and the stability modification research on the dsRNA is less at present.

Reference documents:

1.Haripriya Addepalli,Meena,Chang G.Peng,Gang Wang(2010).Modulation of thermal stability can enhance the potency of siRNA,Nucleic Acids Research.

disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide a tobacco mosaic virus resistant nucleic acid pesticide and synthesis, purification and application thereof. TMV-cp is a gene encoding coat protein (cp) of tobacco mosaic virus, and the coat protein generated by encoding can wrap TMV genome to form virus particles and protect nucleic acid of the virus particles from being damaged, and the gene plays an important role in virus pathogenicity and infection. In addition, TMV-cp also has the functions of determining the range of virus particles in a host, influencing host morbidity symptoms, assisting long-distance virus transportation in a host body and between leaves and the like, and is one of key genes of TMV. For the above reasons, the present invention selects the gene as a silent target gene.

The first purpose of the invention is to provide a TMV-cp gene, wherein both ends of the TMV-cp gene respectively contain a T7 promoter, and the corresponding nucleotide sequence is shown as SEQ ID NO. 1.

The second purpose of the invention is to provide an in vitro transcription template TMV-EcoRI-EcoRI-cp, namely, the in vitro transcription template TMV-EcoRI-EcoRI-cp is obtained by respectively introducing EcoRI enzyme cutting sites at two ends of a TMV-cp gene sequence, and the nucleotide sequence of the in vitro transcription template is shown as SEQ ID NO. 2.

The third purpose of the invention is to provide a plasmid pT7B-TMV-EcoRI-EcoRI-cp which is obtained by introducing EcoRI enzyme cutting sites on the left side and the right side of two T7 promoters by adopting the TMV-cp gene.

Preferably, a primer introducing an EcoRI cleavage site to the left of the T7 promoter: the sequence of the forward primer is shown as SEQ ID NO.4, and the sequence of the reverse primer is shown as SEQ ID NO. 5.

Preferably, a primer introducing an EcoRI cleavage site at the right side of the T7 promoter: the sequence of the forward primer is shown as SEQ ID NO.6, and the sequence of the reverse primer is shown as SEQ ID NO. 7.

The fourth purpose of the invention is to provide an engineering strain, which adopts the plasmid pT7B-TMV-EcoRI-EcoRI-cp to transform E.coli DH5 alpha competent cells to obtain the E.coli DH5 alpha/pT 7B-TMV-EcoRI-EcoRI-cp strain.

The fifth purpose of the invention is to provide a tobacco mosaic virus resistant nucleic acid pesticide TMV-cp (I) -dsRNA, the sequence of which is shown in SEQ ID NO. 3.

The sixth purpose of the invention is to provide a method for synthesizing tobacco mosaic virus resistant nucleic acid pesticide TMV-cp (I) -dsRNA, wherein the plasmid pT7B-TMV-EcoRI-EcoRI-cp is added with endonuclease EcoRI, and Nucleoside Triphosphate (NTP) mixture containing inosinic acid is added for in vitro transcription to obtain TMV-cp (I) -dsRNA.

The seventh purpose of the invention is to provide a purification method of TMV-cp (I) -dsRNA, DNaseI is added into a transcription system, and the temperature is kept at 37-40 ℃ for 0.5-1h to obtain a crude TMV-cp (I) -dsRNA; carrying out anion exchange chromatography on the TMV-cp (I) -dsRNA crude product, and then carrying out tangential flow ultrafiltration concentration to remove ions and unreacted nucleoside triphosphate in the system, thus obtaining the tobacco mosaic virus resistant nucleic acid pesticide TMV-cp (I) -dsRNA.

The eighth purpose of the invention is to provide the application of the tobacco mosaic virus resistant nucleic acid pesticide TMV-cp (I) -dsRNA in tobacco mosaic virus prevention and control.

Due to the adoption of the scheme, the invention has the beneficial effects that:

the invention synthesizes dsRNA modified by inosinic acid by a biological method for the first time, and the nucleic acid pesticide TMV-cp (I) -dsRNA has stability under different temperatures and different ultraviolet conditions, thus having great potential for preventing and treating tobacco mosaic virus; in addition, the biological pesticide is nontoxic and harmless to the environment, has good effects in cost control and application, and is expected to become an excellent biological pesticide.

Drawings

FIG. 1 is a schematic diagram of restriction enzyme EcoRI cleavage sites inserted at both ends of a TMV-cp sequence in example 1 of the present invention.

FIG. 2 is an electrophoresis diagram of a PCR product obtained by adding an EcoRI cleavage site to the left T7 promoter in example 1 of the present invention.

FIG. 3 is a diagram showing the restriction of EcoRI enzyme of pT7B-TMV-EcoRI-cp plasmid in example 1 of the present invention (M: 5000 Marker; lane 1: after restriction of plasmid pT 7B-TMV-EcoRI-cp; lane 2: before restriction of plasmid pT 7B-TMV-EcoRI-cp).

FIG. 4 is a photograph showing the restriction of EcoRI enzyme in pT7B-TMV-EcoRI-EcoRI-cp plasmid in example 1 of the present invention (M: 5000 Marker; lane 1: before restriction of plasmid pT 7B-TMV-EcoRI-EcoRI-cp; lane 2: after restriction of plasmid pT 7B-TMV-EcoRI-EcoRI-cp).

FIG. 5 is an in vitro transcription electrophoretic detection map of TMV-cp (I) -dsRNA in example 5 of the present invention.

FIG. 6 is a graph comparing the stability of TMV-cp (I) -dsRNA and TMV-cp-dsRNA of example 7 of the present invention at different temperatures (note: analysis of variance using IBM SPSS standards 19, significance analysis using Duncan's New double-offset method, data in the table are mean. + -. standard error, different lower case letters indicate significant difference at 0.05 level).

FIG. 7 is a graph of the stability of TMV-cp (I) -dsRNA versus TMV-cp-dsRNA of the present invention at different time UV exposure conditions (Note: analysis of variance using IBM SPSS standards 19, significance using Duncan's New double-offset method, data in the table are mean. + -. standard error, different lower case letters indicate significant difference at 0.05 level) in example 8.

FIG. 8 is a graph showing the stability of TMV-cp (I) -dsRNA measured under different temperature conditions in example 9 of the present invention.

FIG. 9 is a graph showing the change in the amount of TMV-cp (I) -dsRNA at different times of UV exposure in example 10 of the present invention (note: analysis of variance using IBM SPSS statistics 19, significance analysis using Duncan's New double-offset method, data in the table are mean. + -. standard error, different lower case letters indicate significant difference at the 0.05 level).

FIG. 10 is a graph showing the variation of the fragments of TMV-cp (I) -dsRNA of example 10 of the present invention at different times of UV exposure (note: lanes 1-8 represent samples irradiated by UV light for 0h, 0.5h, 2h, 4h, 28h, 3d, 5d, and 7d, respectively).

FIG. 11 shows the control of tobacco mosaic virus by TMV-cp (I) -dsRNA and TMV-cp-dsRNA in example 11 of the present invention (Note: 1 is TMV-cp (I) -dsRNA treatment group; 2 is TMV treatment group; and 3 is TMV-cp-dsRNA treatment group).

Detailed Description

The invention provides a tobacco mosaic virus resistant nucleic acid pesticide and synthesis, purification and application thereof.

Because dsRNA molecules are unstable in the environment and are easily degraded by factors such as microorganisms, illumination, environmental pH, nuclease and the like, the improvement of the stability of dsRNA has important significance for improving the gene silencing efficiency. The invention aims to improve the stability of small interfering RNA (siRNA, 21-23nt) by modifying or replacing the basic group of dsRNA so as to improve the stability of the dsRNA and make the dsRNA more suitable for field spraying. The base modification of nucleic acid is mainly siRNA, but the report and other data of base modification of long-chain dsRNA are less; and at present, the siRNA modification mainly adopts a chemical synthesis method, and for dsRNA, the synthesis cost is higher, so that the large-scale production is not facilitated. The dsRNA of the invention introduces inosine (I) to replace guanylic acid through an in vitro transcription mode, and the base modification and incorporation for reducing the double-strand pairing stability can improve the RNAi activity, and finally shows that the target sequence silencing efficiency is higher.

The synthesis of dsRNA in the invention adopts an extracorporal transcription technology of a cell-free method and combines purification operation to form a set of complete integrated technology. The process mainly comprises high-activity tool enzymes such as independently developed and produced T7RNA polymerase (or mutant thereof), DNaseI, proteinase K and the like. The specific process is as follows: 1) constructing a plasmid containing a target gene dsDNA, wherein both sides of the gene respectively contain a T7 promoter, and EcoRI restriction enzyme cutting sites are respectively introduced into the left side of a left T7 promoter and the right side of a right T7 promoter; 2) high-density fermentation of the recombinant strain; 3) large-scale extraction and purification of plasmids; 4) linearization treatment of the plasmid to obtain a template for in vitro transcription; 5) purifying an in vitro transcription template; 6) substrate NTP is added for in vitro transcription, where Guanosine Triphosphate (GTP) is replaced with Inosine Triphosphate (ITP): adding T7RNA polymerase (or mutant), NTP, reaction buffer solution and the like into a reaction kettle, and preserving the temperature for 4-6h at 37 ℃ to obtain dsRNA (I) transcription product containing IMP (inosine monophosphate); 7) purification of dsRNA: putting DNaseI elimination template, and obtaining a large amount of high-purity dsRNA (I) by anion exchange chromatography and tangential flow filtration.

The present invention will be further described with reference to the following examples.

Example 1: construction of recombinant engineered Strain E.coli DH5 alpha/pT 7B-TMV-EcoRI-EcoRI-cp

1. The construction idea is as follows: plasmid pT7B-TMV-cp preserved by the company is taken as a template (the cp gene sequence containing a T7 promoter is shown as SEQ ID NO.1), EcoRI restriction sites are respectively introduced to two sides of a T7 promoter at two ends of a target gene in a site-specific mutation mode (shown as figure 1), and after two mutations, sequencing verification is carried out to obtain the target plasmid pT 7B-TMV-EcoRI-EcoRI-cp. E.coli DH5 alpha competent cell was transformed with the plasmid to obtain recombinant engineered strain E.coli DH5 alpha/pT 7B-TMV-EcoRI-EcoRI-cp. The sequence of the cp gene of EcoRI is inserted into the two ends of the T7 promoter and is shown as SEQ ID NO. 2.

SEQ ID NO. 1: TMV-cp Gene sequence containing the T7 promoter (the T7 promoter is underlined in lower case)

SEQ ID NO. 2: the TMV-cp gene sequence of EcoRI is inserted at both ends of the T7 promoter (the upper underlined italics is EcoRI restriction enzyme cutting site)

2. Design and Synthesis of primers

(1) According to the company deposited plasmid pT7B-TMV-cp sequence, EcoRI recognition sequences (5 '. G ^ AATTC. 3') were inserted on the left and right sides of the left T7 promoter (LPT7) and the right side of the right T7 promoter (RPT7), respectively, and the TMV-cp target gene sequence was analyzed on-line using NEBcuter V2.0(http:// nc2.neb. com/NEBcuter 2 /).

(2) QuickMution according to Biyunshen^TMThe specification of the gene site-directed mutagenesis kit comprises the steps of respectively designing two pairs of primers by using primer premier 5.0 software, and evaluating the primers by using DNAMAN.

(3) The designed primer is synthesized by Beijing Liuhe Hua Dagenescience and technology Co., Ltd, and the sequence of the primer is shown in the following table 1:

TABLE 1 primers for EcoRI cleavage sites introduced on both sides of the T7 promoter

LPT7-F	CGGCCAGTGAGCGCGCGGAATTCTAATACGACTCACTATAG
		LPT7-R	TAGTGAGTCGTATTAGAATTCCGCGCGCTCACTGGCCGTCGT
RPT7-F	ACCCTATAGTGAGTCGTATTAGAATTCATTTCGATAAGCCAGGTTGC
		RPT7-R	ACCTGGCTTATCGAAATGAATTCTAATACGACTCACTATAGGGTC

3. Site-directed mutagenesis is inserted into the first EcoRI enzyme cutting site

pT7B-TMV-cp plasmid is used as a template, first amplification is carried out by using LPT7-F and LPT7-R primers in Table 1, and the reaction system and the amplification conditions are respectively shown in the following table 2:

TABLE 2 PCR amplification System (50. mu.l)

Components	Final concentration	Volume of
			BeyoFusionTM DNA Polymerase	1/50	1μl
Primer 1 (10. mu.M)	0.4μM	2μl
			Primer 2 (10. mu.M)	0.4μM	2μl
10*BeyoFusionTMBuffer(with Mg2+)	1*	5μl
			dNTP mix(2.5mM each)	0.25mM each	5μl
Plasmid template	200ng	2μl
			ddH2O	——	33μl
Total up to	——	50μl

Preparing a PCR reaction mixture according to the table above, uniformly mixing, and performing PCR amplification by adopting a two-step method according to the following conditions: pre-denaturation at 95 deg.C for 3min, denaturation at 98 deg.C for 10s, annealing at 68 deg.C, and extension for 4min for 20 cycles, extension at 72 deg.C for 10min, and storing at 8 deg.C.

After the PCR is finished, 2 μ l of the amplified product is subjected to electrophoresis detection in 1.0% agarose gel electrophoresis, and observed by a gel imager, and the target fragment is obtained by successful amplification, wherein the result is shown in FIG. 2.

Adding 1 mul of DpnI endonuclease into the obtained PCR product system, uniformly mixing, incubating for 15min at 37 ℃ to eliminate the template plasmid, and converting the product, wherein the specific operation is as follows:

(1) dissolving 1 E.coli DH5 alpha competent cell on ice, adding 10 μ l of the product into the competent cell, mixing, and standing on ice for 30 min;

(2) hot shocking in 42 deg.C water bath for 45-60s, and rapidly standing on ice for 5 min;

(3) adding 900 μ l LB culture medium (no antibody) into the centrifuge tube, mixing, culturing at 37 deg.C and 200rpm for 40-60 min;

(4) centrifuging the post-cultured bacterial liquid at low speed of 2000rpm for 1min, removing 850 μ l of culture medium supernatant, and mixing well by blowing and sucking;

(5) the bacterial liquid is evenly coated on Amp resistant LB solid culture medium and is inversely cultured overnight at 37 ℃. In order to increase the efficiency of obtaining positive clones, 2-3 competent clones can be transformed simultaneously.

(6) Several monoclonals are selected on a plate, liquid culture is carried out at the temperature of 37 ℃, extracted plasmids are cut and verified by EcoRI enzyme, and plasmid extraction refers to a plasmid small-amount extraction kit (upgrade version centrifugal column type) of Shanghai Czeri bioengineering GmbH, and the product number is GK 2004.

(7) Through preliminary verification, plasmids corresponding to the two obtained clones are sent to Beijing Liuhua Dagenescience and technology Limited for sequencing. Sequencing verification proves that both clones are positive, so far, EcoRI endonuclease sites are successfully introduced to the left side of the left T7 promoter, and the plasmid is named as pT 7B-TMV-EcoRI-cp. As shown in fig. 3.

4. Site-directed mutagenesis into the second EcoRI cleavage site

The positive plasmid pT7B-TMV-EcoRI-cp obtained above was used as a template, and the second amplification was carried out with the primers RPT7-F and RPT7-R in Table 1, and a plasmid with double insertion mutation, designated pT7B-TMV-EcoRI-EcoRI-cp, was obtained in the same procedure as shown in FIG. 4. The corresponding strain was E.coli DH5 α/pT 7B-TMV-EcoRI-EcoRI-cp.

Example 2: high-density fermentation of engineering strain E.coli DH5 alpha/pT 7B-TMV-EcoRI-EcoRI-cp

1. Strain activation: the glycerol tubes preserved at-80 ℃ were thawed on ice, streaked with an inoculating loop on Amp resistant plates, and cultured overnight in an incubator at 37 ℃ by inversion.

2. Preparing a seed solution: a loop of the activated strain was inoculated into LB liquid medium containing Amp antibiotic (final Amp concentration 100. mu.g/mL), and the volume of the seed solution was 200mL/500 mL. Culturing at 37 deg.C and 200rpm for 15-16h under shaking to make seed liquid OD₆₀₀≈3.0。

3. Inoculating in a fermentation tank: the fermenter used in this example was 50L, and the fermentation medium components and contents are shown in Table 4 below.

TABLE 4 fermentation Medium composition and content

Name (R)	Proportioning (g/L)
		KH2PO4	10.0
Citric acid monohydrate	3.55
		(NH4)2SO4	2.0
MgSO4·7H2O	2.5
		Glucose	30
Mother liquor of trace elements	1mL

Wherein the formula of the microelement mother solution is 0.1g/L CoCl₂·6H₂O, 0.1g/L CuSO₄·5H₂O, 5g/L FeSO₄·7H₂O, 0.33g/L MnSO₄·H₂O, 3.8g/L ZnSO₄·7H₂O, filtering, sterilizing and storing at 4 ℃ after preparation, and adding in each use.

The initial liquid loading of the fermenter was 60%, and the seed liquid was inoculated in an amount of 10%. In the fermentation process, the pressure of the tank is controlled to be 0.1MPa, the air volume is 1vvm, the pH is adjusted to 7.0 by ammonia water, and DO (dissolved oxygen) is controlled to be more than 20% by adjusting the fermentation rotating speed. The fermentation is started for 8h, and the sugar is fed in with the concentration of the bacteria (OD)₆₀₀) The sugar supplement rate is gradually improved, and the residual sugar concentration is controlled to be below 0.3g/L in the whole fermentation process. Detecting the OD of the thallus after about 24h of fermentation₆₀₀Placing the pot above 120 deg.C.

4. And (3) collecting and preserving thalli: and (3) centrifuging and collecting the thalli by using a Hitachi floor type high-speed centrifuge at room temperature, wherein the centrifugation condition is 8000rpm and 10min, and the thalli content is 18g/L through calculation. The obtained cells were frozen at-20 ℃.

Example 3: large Scale extraction (alkaline lysis) of plasmid pT7B-TMV-EcoRI-EcoRI-cp

1. And (3) resuspending the thallus: the cells collected in example 2 were thawed at room temperature, and 100L and 50mmol/L of Tris-HCl (10 mmol/L EDTA, pH 8.0) buffer was added to the stirred tank to resuspend the cells, and the mixture was stirred at 150rpm for about 1h until the cells were sufficiently resuspended and free of clumped cells.

2. And (3) cracking thalli: adding equal volume of 0.2mol/L NaOH and 1.0% SDS alkaline lysis solution, and slowly stirring for about 10min to fully lyse the thallus.

3. Neutralizing: 100L of a neutralizing solution of KAc (pH 5.2) was added to the above lysate in an amount of 3mol/L, and the mixture was gently stirred for 30 min.

4. Collecting supernatant: and centrifuging to collect the neutralized product, wherein the centrifugation conditions are RT, 10000rpm and 15min, and discarding the precipitate.

5. Further purification of the supernatant: and (4) filtering the supernatant obtained in the step (4) by membranes with the pore diameters of 10 mu m, 5 mu m and 0.45 mu m respectively, and collecting filtrate.

6. Concentration of plasmid-containing clear solution: reference patent CN202110478812.7 (a method and application suitable for large scale extraction of dsRNA) used tangential flow for concentration, with a filter pore size of 500kDa and a flow rate controlled at 60% of full rate, and concentrated the supernatant volume by a factor of about 10.

7. Cellulose adsorption and plasmid solution acquisition: refer to patent CN202110478812.7 to prepare cellulose filter cake in advance, the plasmid clear solution in the above steps and the incubated cellulose filter cake are fully stirred and mixed, centrifuged at 9000rpm for 20min at 4 ℃, and the supernatant is discarded to obtain cellulose precipitate adsorbing plasmid DNA. Drying, dissolving in buffer solution again, filtering under positive pressure, and collecting plasmid filtrate.

8. Reconcentration of plasmid-containing supernatant: further tangential flow concentration was performed, the membrane pore size was 300kDa, the flow rate was 80% of full rate, and the supernatant volume was concentrated by about 10 times.

9. And (3) filtering and sterilizing: the plasmid filtrate was filtered at 0.45 μm and 0.22 μm, respectively, to obtain plasmid pT7B-TMV-EcoRI-EcoRI-cp with a plasmid concentration of 1500 ng/. mu.l.

Example 4: linearization treatment of plasmids

According to the total amount of the plasmid pT7B-TMV-EcoRI-EcoRI-cp, m μ l of the high-activity restriction enzyme EcoRI which is independently developed and produced by company is added, and the mixture is incubated for 2h at 37 ℃, so that a TMV-cp double-stranded DNA fragment containing a T7 promoter at the 5 'end and the 3' end, namely an in vitro transcription template, is obtained.

And (3) tangential flow concentration is carried out on the in vitro transcription template, the aperture of a filter membrane is 100kDa, the flow speed is 80% of the full speed, and the volume of the supernatant is concentrated to obtain the template.

Example 5: preparation of TMV-cp (I) -dsRNA by In Vitro Transcription (IVT)

1. In vitro transcription system preparation (1L): referring to the system in the following Table 5, 10 × T7 Buffer, T7RNA polymerase, NTP (ATP/UTP/CTP/ITP), ddH were added in sequence₂O and the template obtained in example 4. Wherein the final concentration of the in vitro transcription template is controlled to be 50 ng/. mu.l.

TABLE 5 in vitro transcription System and transcription conditions

Components

template/TMV-cp

NTP

T7RNA polymerase

10*T7 BTffer

Water (W)

Final concentration

50ng/μl

Each at 3mM

0.05～0.1mg/mL

1*T7 BTffer

/

Concentration of

C1 (Unit ng/. mu.l)

100mM

C2(mg/mL)

/

/

volume/L

50/C

Each 0.03L

(0.05～0.1)/C2

0.1

up to 1L

Sequence of material feeding

5

3

2

1

4

2. In vitro transcription of TMV-cp (I) -dsRNA containing inosinic acid (I): after the system is prepared according to the above system, stirring is carried out evenly at 100rpm, and the dsRNA (shown as SEQ ID NO.3) containing I is obtained after heat preservation is carried out for 4.5h at 37 ℃, and the transcription product is named as TMV-cp (I) -dsRNA. The dsRNA concentration was sampled and detected by electrophoresis as shown in FIG. 5.

SEQ ID NO. 3: TMV-cp (I) -dsRNA single strand sequence (orientation 5 '-3'), together with its complementary partner strand, constitutes dsRNA:

UCUUACAIUAUCACUACUCCAUCUCAIUUCIUIUUCUUIUCAUCAICIUIIICCIACCCAAUAIAIUUAAUUAAUUUAUIUACUAAUICCUUAIIAAAUCAIUUUCAAACACAACAAICUCIAACUIUCIUUCAAAIACAIUUCAIUIAIIUIUIIAAACCUUCACCACAAIUAACUIUUAIIUUCCCUIACAIUIACUUUAAIIUIUAUAIIUAUAAUICIIUACUAIAUCCICUAIUCACAICAUUIUUAIIUICAUUUIACACUAIAAAUAIAAUAAUAIAAIUUIAAAAUCAIICIAACCCCACIACUICCIAAACIUUAIACICUACUCIUAIAIUAIACIACICAACIIUIICCAUAAIIAICICUAUAAAUAAUUUAIUAIUAIAAUUIAUCAIAIIAACCIIAUCUUAUAAUCIIAICUCUUUCIAIAICUCUUCUIIUUUIIUUUIIACCUCUIIUCCUICAACUUI。

example 6: purification and lyophilization of TMV-cp (I) -dsRNA

After the transcription of the above example 5 was completed, 1U of DNaseI was added to the transcription reaction system per 0.5. mu.g of template DNA, and a suitable amount of DNaseI developed and produced by the present company was added and the mixture was incubated at 37 ℃ for 1 hour to digest the template, thereby obtaining crude TMV-cp (I) -dsRNA.

The sample TMV-cp (I) -dsRNA was subjected to anion exchange chromatography using the Capto Q ImpRes strongly anionic filler of Cytiva. And then concentrating by tangential flow ultrafiltration, and removing ions, unreacted NTP and other substances in the system at the same time to obtain the pure TMV-cp (I) -dsRNA. Placing the obtained pure dsRNA in a clean stainless steel sample tray, wherein the liquid level height is not more than 1cm, and pre-freezing at-80 ℃ for 1.5 h. Putting the prefrozen sample into a low-temperature freeze dryer, vacuumizing and carrying out sectional freeze drying to obtain a TMV-cp (I) -dsRNA solid with the purity of more than 90%.

Example 7: stability comparison of TMV-cp (I) -dsRNA with TMV-cp-dsRNA at different temperatures

Preparing TMV-cp (I) -dsRNA modified by I and TMV-cp-dsRNA freeze-dried powder before modification by the same process, crushing the two samples, packaging into an ampere bottle, and respectively carrying out heat storage at 54 ℃ for 2 weeks and 35 ℃ for 12 weeks in a constant temperature incubator. After the heat storage is finished, accurately weighing 0.1g of sample by a ten-thousandth balance, fixing the volume to 100mL by pure water, and detecting the content (OD) of nucleic acid by a Nanodrop ultramicro spectrophotometer₂₆₀/OD₂₈₀1.9-2.1), 5 replicates per treatment were run, 3 replicates per replicate, averaged, and the stability of the two samples was compared at both temperatures. The initial content of TMV-cp (I) -dsRNA and TMV-cp-dsRNA was 64.35%, 63.13%, respectively.

FIG. 6 shows that the modified TMV-cp (I) -dsRNA freeze-dried powder has no obvious change in nucleic acid content and no obvious difference after being stored at 54 ℃ for 2 weeks and 35 ℃ for 12 weeks. The content of the unmodified TMV-cp-dsRNA freeze-dried powder is reduced after the TMV-cp-dsRNA freeze-dried powder is stored at 54 ℃ and 35 ℃, wherein the content of a treatment group at 54 ℃ is reduced by 6.4 percent compared with the initial value, and the content of a treatment group at 35 ℃ is reduced by 18.2 percent compared with the initial value. The TMV-cp (I) -dsRNA and the TMV-cp-dsRNA freeze-dried powder are prepared and stored without a ribozyme environment, so that the modified TMV-cp (I) -dsRNA freeze-dried powder is more stable than the unmodified TMV-cp-dsRNA freeze-dried powder under the experimental condition.

Example 8: stability of TMV-cp (I) -dsRNA and TMV-cp-dsRNA under different time ultraviolet exposure conditions

The method comprises the steps of crushing TMV-cp (I) -dsRNA and TMV-cp-dsRNA freeze-dried powder, flatly paving the crushed powder in a disposable plastic culture dish with the diameter of 35mm, placing the crushed powder at a position which is 30cm under an ultraviolet lamp in an open manner, respectively irradiating the crushed powder for 0h, 24h and 72h under the ultraviolet lamp, repeating the treatment for 3 times, measuring the content of nucleic acid subjected to different treatments by adopting a Nanodrop ultramicro spectrophotometer, and calculating the relative content of the nucleic acid subjected to ultraviolet irradiation at different time.

As can be seen from FIG. 7, the nucleic acid content of the TMV-cp (I) -dsRNA freeze-dried powder is not obviously changed after being irradiated for 24h and 72h by ultraviolet, and the difference between different treatments is not obvious. The content of the unmodified TMV-cp-dsRNA freeze-dried powder is reduced after 24h and 72h of ultraviolet irradiation, and the content ratio of the treatment groups after 24h and 72h of ultraviolet irradiation is reduced by 2.9 percent and 8.1 percent respectively. As the preparation and storage of the TMV-cp (I) -dsRNA and the TMV-cp-dsRNA freeze-dried powder are not carried out in a ribozyme-free environment, the modified TMV-cp (I) -dsRNA freeze-dried powder is more stable than unmodified TMV-cp-dsRNA freeze-dried powder under the experimental condition.

Example 9: TMV-cp (I) -dsRNA stability assay under different temperature conditions

Crushing a TMV-cp (I) -dsRNA freeze-dried powder sample, packaging into an ampere bottle, and respectively preserving at constant temperature under different temperature conditions, wherein the specific design is as follows:

(54 +/-2) DEG C for 2 weeks

(50 +/-2) DEG C, storing for 4 weeks

(45 +/-2) DEG C, storing for 6 weeks

(40 +/-2) DEG C for 8 weeks

5.(35 +/-2) DEG C, storing for 12 weeks

Each treatment is repeated for 5 times, 0.1000g of sample is accurately weighed by a ten-thousandth balance, pure water is used for fixing the volume to 100ml, and the content of nucleic acid is detected by a Nanodrop ultramicro spectrophotometer. The effective content of TMV-cp (I) -dsRNA sample is that the initial mass fraction of the TMV-cp (I) -dsRNA is 63.81%. In this embodiment, Excel software is used for data statistics, IBM SPSS statistics 19 is used for variance analysis, and Duncan's new repolarization method is used for significance analysis.

As can be seen from FIG. 8, in this example, the TMV-cp (I) -dsRNA was stable under different temperature conditions, and the content of TMV-cp (I) -dsRNA was hardly changed in the cases of storage at 54 ℃ for 2 weeks, storage at 50 ℃ for 4 weeks, storage at 45 ℃ for 6 weeks, storage at 40 ℃ for 8 weeks, and storage at 35 ℃ for 12 weeks, and the content of TMV-cp (I) -dsRNA was not significantly different from the initial content after statistical analysis, and the content was decreased by the maximum of only 2.5% after storage at 35 ℃ for 84d (12 weeks).

Example 10 determination of the stability of TMV-cp (I) -dsRNA under different time UV Exposure conditions

Paving TMV-cp (I) -dsRNA freeze-dried powder in a disposable plastic culture dish with the diameter of 35mm, placing the dish at a position 30cm below an ultraviolet lamp with an opening, respectively irradiating the dish for 0h, 0.5h, 2h, 4h, 28h, 3d, 5d and 7d under the ultraviolet lamp, repeating the treatment for 3 times, measuring the content change of nucleic acid in different treatments by adopting a Nanodrop ultramicro spectrophotometer, and calculating the content change of the TMV-cp (I) -dsRNA after the ultraviolet irradiation is carried out for different time by taking the content of the TMV-cp (I) -dsRNA before the ultraviolet lamp irradiation as 100%. The band of interest was detected by electrophoresis on agarose gel, and the sample was diluted 20-fold and loaded with 5. mu.L, as shown in FIG. 10.

As shown in FIG. 9, the effective content of TMV-cp (I) -dsRNA after TMV-cp (I) -dsRNA freeze-dried powder is irradiated under an ultraviolet lamp for 0h, 0.5h, 2h, 4h, 28h, 3d, 5d and 7d does not change greatly compared with that before the ultraviolet lamp is not irradiated, and the target band is clear through agarose electrophoresis detection (FIG. 10). Therefore, under the experimental condition, the TMV-cp (I) -dsRNA freeze-dried powder is stable under the ultraviolet irradiation condition, and the obvious degradation phenomenon does not occur.

Example 11: indoor bioassay effect of tobacco mosaic virus nucleic acid pesticide TMV-cp (I) -dsRNA

The experiment of the embodiment is completed in a phytotron of the company in 10-11 months in 2020. Soaking Yunyan 105 seeds in 65 ℃ warm water for 15min, soaking in 10% trisodium phosphate solution for 20min, sowing in a mixed matrix of Pinshi nutrient soil and vermiculite, transplanting the two true leaves into a nutrition pot with the same matrix after the two true leaves are unfolded, and selecting seedlings with the same growth vigor and size to start experimental treatment when the tobacco grows to 4-5 true leaves.

The experimental design was as follows: 1. clear water control CK; TMV: inoculation of tobacco mosaic virus only; 3. a tobacco mosaic virus nucleic acid pesticide TMV-cp-dsRNA 4.47 mu g/mu l aqueous solution is uniformly sprayed on the leaf surfaces of the treatment groups; 4. a tobacco mosaic virus nucleic acid pesticide TMV-cp (I) -dsRNA 4.47 mu g/mu l aqueous solution is evenly sprayed on the leaf surfaces of the treatment groups; 5. a tobacco mosaic virus nucleic acid pesticide TMV-cp (I) -dsRNA 2.24 mu g/mu l aqueous solution is evenly sprayed on the leaf surfaces of the treatment groups; 6. a tobacco mosaic virus nucleic acid pesticide TMV-cp (I) -dsRNA 1.12 mu g/mu l aqueous solution is evenly sprayed on the leaf surfaces of the treatment groups; 7. a tobacco mosaic virus nucleic acid pesticide TMV-cp (I) -dsRNA 0.56 mu g/mu l aqueous solution is evenly sprayed on the leaf surfaces of the treatment groups; 8. a tobacco mosaic virus nucleic acid pesticide TMV-cp (I) -dsRNA 0.28 mu g/mu l aqueous solution is evenly sprayed on the leaf surfaces of the treatment groups; 9. tobacco mosaic virus nucleic acid pesticide TMV-cp (I) -dsRNA 0.14 mu g/mu l aqueous solution is evenly sprayed on the leaf surfaces of the treatment groups.

The consistency of other water, fertilizer and agricultural management among different treatments is kept, and each treatment is 32 plants and is repeated for four times. After the experiment is carried out for 24 hours, TMV virus is inoculated by adopting an artificial juice rubbing method. The clear water control was not inoculated. One leaf per tobacco was inoculated.

Preparing a TMV virus inoculation liquid: young leaves with significant disease on virus host K326 were cut, and 4 uTMV-infected leaves were placed in a sterilized mortar, 100mL of 0.01mol/L phosphate buffer (pH 7.0) was added, and ground to prepare an inoculum with w 4%.

The disease level is investigated by taking the plant as a unit and the prevention and treatment effect is counted by adopting the requirements of UB23222-2008 'tobacco pest grading and investigation method'. The specific requirements are as follows:

grading the severity of diseases:

level 0: the whole plant is disease-free;

level 1: the heart and leaves have bright or mild veins, and diseased plants are not obviously dwarfed;

and 3, level: one third leaf flower and leaf without deformation or dwarfing of diseased plant to more than three quarters of normal plant height;

and 5, stage: one third to one half leaf, or a few leaves deformed, or the main pulse blackened, or the diseased plant dwarfed to three-thirds of the value of the normal plant height;

and 7, stage: one half to two thirds of leaf mosaic, or deformation or major side vein necrosis, or dwarfing of diseased plants to one half to two thirds of normal plant height;

and 9, stage: the leaves of the whole plant are severely deformed or necrosed, or the diseased plant is shortened to more than one half of the normal plant height.

The calculation method comprises the following steps:

incidence (%) is (number of diseased plants/total number of investigated plants) × 100%

Disease index (%) - [ Σ (number of diseased plants or leaves at each stage × disease level value)/total number of investigated plants or leaves × highest level value) ] × 100%

Relative control effect (%) ═ contrast disease index-treatment disease index/contrast disease index ] X100%

The growth was observed during growth, the experiment was conducted for 14 days to investigate disease grade, Excel software was used for data statistics, IBM SPSS statistics 19 was used for variance analysis, and Duncan's new repolarization method was used for significance analysis.

In the embodiment, the Yunyan 105 seeds are purchased from Yuxi tobacco seeds Limited liability company, the Pinshi nutrient soil and the vermiculite are purchased from Shanghai Yingyu gardening Limited company, and the trisodium phosphate, the sodium dihydrogen phosphate and the disodium hydrogen phosphate are reagent grade and are purchased from Tantake technology exploration platform. TMV virus strain: purchased from american type culture collection center (ATTC), ATCC accession no: PVAS-822^TM. In the experiment, K326 tobacco mosaic virus system hosts are adopted for living parasitic seed reproduction.

TABLE 6 tobacco mosaic virus nucleic acid pesticide TMV-cp-dsRNA indoor bioassay effect

Note: the analysis of variance was performed using IBM SPSS statistics 19, and the significance analysis was performed using Duncan's New Complex Pole Difference method, where the data in the table are mean. + -. standard error, with different lower case letters indicating significant differences at the 0.05 level.

As can be seen from the table above, the tobacco mosaic virus nucleic acid pesticides TMV-cp-dsRNA and TMV-cp (I) -dsRNA both have obvious control effect on TMV. TMV-cp-dsRNA and TMV-cp (I) -dsRNA freeze-dried powder are diluted to the same concentration (4.47 mu g/mu l) and sprayed on the leaf surfaces of tobacco, the prevention and treatment effect of the TMV-cp-dsRNA on tobacco mosaic virus is 67.25 percent and is slightly worse than 80.39 percent of the prevention and treatment effect of the TMV-cp (I) -dsRNA treatment group, and the reason that the stability of the modified TMV-cp (I) -dsRNA in the environment is improved is possible. In the embodiment, the application concentration of the tobacco mosaic virus nucleic acid pesticide TMV-cp (I) -dsRNA from 0.14 mu g/mu l to 4.47 mu g/mu l shows obvious control effect on tobacco mosaic virus diseases, the control effect is enhanced along with the increase of the application concentration, and the highest relative control effect reaches 80.39%. As can be seen from the table, the clear water control group had no disease symptoms, indicating that the tobacco seeds were disinfected to eliminate the effect of the seed belt toxicity. In addition, in the experiment, the growth vigor of the TMV-cp (I) -dsRNA and TMV-cp-dsRNA leaf spraying group tobacco is better than that of the group only subjected to virus treatment (figure 11), and the TMV-cp (I) -dsRNA and TMV-cp-dsRNA can interfere TMV, improve the immunity of the tobacco and promote the growth and the nutrition.

From the above results, it is known that the tobacco mosaic virus nucleic acid pesticide TMV-cp (I) -dsRNA has a great potential for preventing and treating TMV, and in addition, the tobacco mosaic virus nucleic acid pesticide TMV-cp (I) -dsRNA is non-toxic and harmless to the environment and is expected to become an excellent biological pesticide.

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art will understand that various changes, modifications and substitutions can be made without departing from the spirit and scope of the invention as defined by the appended claims. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Si Yi technology (Shanghai) Ltd

<120> nucleic acid pesticide for resisting tobacco mosaic virus, and synthesis, purification and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 516

<212> DNA

<213> Artificial Sequence (Artficial Sequence)

<400> 1

taatacgact cactataggg caagttgcag gaccagaggt ccaaaccaaa ccagaagagc 60

tctcgaaaga gctccgatta taagatccgg ttcctctgat caattctact attaaattat 120

ttatcgcgct ccttatggcc accgttgcgt cgtctactct acgagtagca tctaacgttt 180

cggcagtcgt ggggttcgcc tgattttcaa cttctattat tctatttcta gtgtcgaatg 240

cacctaacag tgctgtgact agcgggtcta ataccgcatt gtacctgtac accttaaagt 300

cactgtcagg gaacctaaca gttacttgtg gtgaaggttt ccacacctca ctgaattgtc 360

tttgaacgac agttcgagct tgttgtgttt gaaactgatt tcctaaggca ttagtacata 420

aattaattaa ctctattggg tcggcccacg ctgatgacaa gaacacgaac tgagatggag 480

tagtgatact gtaagaccct atagtgagtc gtatta 516

<210> 2

<211> 528

<212> DNA

<213> Artificial Sequence (Artficial Sequence)

<400> 2

gaattctaat acgactcact atagggcaag ttgcaggacc agaggtccaa accaaaccag 60

aagagctctc gaaagagctc cgattataag atccggttcc tctgatcaat tctactatta 120

aattatttat cgcgctcctt atggccaccg ttgcgtcgtc tactctacga gtagcatcta 180

acgtttcggc agtcgtgggg ttcgcctgat tttcaacttc tattattcta tttctagtgt 240

cgaatgcacc taacagtgct gtgactagcg ggtctaatac cgcattgtac ctgtacacct 300

taaagtcact gtcagggaac ctaacagtta cttgtggtga aggtttccac acctcactga 360

attgtctttg aacgacagtt cgagcttgtt gtgtttgaaa ctgatttcct aaggcattag 420

tacataaatt aattaactct attgggtcgg cccacgctga tgacaagaac acgaactgag 480

atggagtagt gatactgtaa gaccctatag tgagtcgtat tagaattc 528

<210> 3

<211> 368

<212> RNA

<213> Artificial Sequence (Artficial Sequence)

<400> 3

ucuuacauau cacuacucca ucucauucuu ucuuucauca cuccacccaa uaauuaauua 60

auuuauuacu aauccuuaaa aucauuucaa acacaacaac ucaacuucuu caaaacauuc 120

auauuaaacc uucaccacaa uaacuuuauu cccuacauac uuuaauuaua uauaaucuac 180

uaaucccuau cacacauuuu aucauuuaca cuaaaauaaa uaauaaauua aaaucacaac 240

cccacacucc aaacuuaacc uacucuaaua acaccaacuc cauaaaccua uaaauaauuu 300

auauaaauua ucaaaaccau cuuauaauca cucuuucaac ucuucuuuuu uuaccucuuc 360

cucaacuu 368

<210> 4

<211> 41

<212> DNA

<213> Artificial Sequence (Artficial Sequence)

<400> 4

cggccagtga gcgcgcggaa ttctaatacg actcactata g 41

<210> 5

<211> 42

<212> DNA

<213> Artificial Sequence (Artficial Sequence)

<400> 5

tagtgagtcg tattagaatt ccgcgcgctc actggccgtc gt 42

<210> 6

<211> 47

<212> DNA

<213> Artificial Sequence (Artficial Sequence)

<400> 6

accctatagt gagtcgtatt agaattcatt tcgataagcc aggttgc 47

<210> 7

<211> 45

<212> DNA

<213> Artificial Sequence (Artficial Sequence)

<400> 7

acctggctta tcgaaatgaa ttctaatacg actcactata gggtc 45

Claims (10)

1. TMV-cpA gene characterized by: the TMV-cpBoth ends of the gene respectively contain a T7 promoter, and the corresponding nucleotide sequence is shown in SEQ ID NO. 1.

2. In TMV-cpOne is introduced at each end of the gene sequenceEcoRI enzyme cutting sites to obtain an in vitro transcription template TMV-EcoRI-cpThe method is characterized in that: the nucleotide sequence is shown in SEQ ID NO. 2.

3. Plasmid pT7B-TMV-EcoRI-cpThe method is characterized in that: which adopts TMV-cpGenes introduced on the left and right sides of the two T7 promotersEcoRI enzyme cutting sites are obtained.

4. The plasmid pT7B-TMV-EcoRI-cpThe method is characterized in that: introduction to the left of the T7 promoterEcoPrimers for RI cleavage site: the sequence of the forward primer is shown as SEQ ID NO.4, and the sequence of the reverse primer is shown as SEQ ID NO. 5.

5. The plasmid pT7B-TMV-EcoRI-cpThe method is characterized in that: introduction to the right of the T7 promoterEcoPrimers for RI cleavage site: the sequence of the forward primer is shown as SEQ ID NO.6, and the reverse primerThe sequence is shown as SEQ ID NO. 7.

6. An engineered strain, characterized by: which uses the plasmid pT7B-TMV-EcoRI-cpTransformation ofE.coliDH5 alpha competent cell to obtainE.coliDH5α/pT7B-TMV-EcoRI-EcoRI-cpAnd (3) strain.

7. Tobacco mosaic virus resistant nucleic acid pesticide TMV-cp(I) -dsRNA characterized by: the sequence is shown in SEQ ID NO. 3.

8. Tobacco mosaic virus resistant nucleic acid pesticide TMV-cp(I) -method for the synthesis of dsRNA characterized by: the plasmid pT7B-TMV-EcoRI-cpAdding endonuclease into the mixtureEcoRI, adding inosinic acid-containing nucleoside triphosphate mixture for in vitro transcription to obtain TMV-cp(I)-dsRNA。

9. Tobacco mosaic virus resistant nucleic acid pesticide TMV-cp(I) -method for purification of dsRNA characterized by: adding into transcription systemDNaseI, keeping the temperature at 37-40 ℃ for 0.5-1h to obtain TMV-cp(I) -crude dsRNA; for the TMV-cp(I) Performing anion exchange chromatography on the dsRNA crude product, and then performing tangential flow ultrafiltration concentration to remove ions and unreacted nucleoside triphosphate in the system to obtain the tobacco mosaic virus resistant nucleic acid pesticide TMV-cp(I)-dsRNA。

10. The tobacco mosaic virus resistant nucleic acid pesticide TMV-cp(I) Application of dsRNA in preventing and controlling tobacco mosaic virus.

Images