CN113713109B - Medicine for treating acute radiation enteritis - Google Patents

Medicine for treating acute radiation enteritis Download PDF

Info

Publication number
CN113713109B
CN113713109B CN202111058398.0A CN202111058398A CN113713109B CN 113713109 B CN113713109 B CN 113713109B CN 202111058398 A CN202111058398 A CN 202111058398A CN 113713109 B CN113713109 B CN 113713109B
Authority
CN
China
Prior art keywords
p2rx1
acute radiation
radiation enteritis
mice
radiotherapy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111058398.0A
Other languages
Chinese (zh)
Other versions
CN113713109A (en
Inventor
王旭
陈飞
胡静
李荣坤
苏玉婷
丁延
姬倩
戴春华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Affiliated Hospital of Jiangsu University
Original Assignee
Affiliated Hospital of Jiangsu University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Affiliated Hospital of Jiangsu University filed Critical Affiliated Hospital of Jiangsu University
Priority to CN202111058398.0A priority Critical patent/CN113713109B/en
Publication of CN113713109A publication Critical patent/CN113713109A/en
Application granted granted Critical
Publication of CN113713109B publication Critical patent/CN113713109B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/17—Amides, e.g. hydroxamic acids having the group >N—C(O)—N< or >N—C(S)—N<, e.g. urea, thiourea, carmustine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention discloses a medicine for acute radiation enteritis, which contains one or more of P2RX1 receptor inhibitor, P2RX1 protein inhibitor or P2RX1 coding gene expression inhibitor. The invention provides an effective treatment method for acute radiation enteritis, which reduces the expression increase of TNF-alpha and IL-6 in internal inflammatory factors and the infiltration increase of neutrophils caused by the acute radiation enteritis by inhibiting P2RX1, so that the acute radiation enteritis is effectively treated. The method can be widely used for treating clinical acute radiation enteritis, has good application prospect, and is worthy of protection and popularization.

Description

Medicine for treating acute radiation enteritis
Technical Field
The invention relates to the technical field of acute radiation enteritis, in particular to a medicine for treating acute radiation enteritis.
Background
Radiotherapy is one of the important tools in the modern integration of malignant tumors, and about half of malignant tumor patients need to receive radiotherapy according to epidemiological statistics. In recent years, with the improvement of radiotherapy technology, the precision of tumor tissue irradiation in radiotherapy process has been greatly improved, but the radiation damage of normal tissues is still the most main reason of dose limitation. Patients with abdominal cavity and pelvic cavity tumor are usually treated by radiation therapy and are accompanied by radioactive enteritis, which is clinically manifested by abdominal distension, abdominal pain, diarrhea and bloody stool, and intestinal perforation or intestinal obstruction can be caused in severe cases.
The radiation enteritis can be divided into acute radiation enteritis and chronic radiation enteritis according to the occurrence time of the radiation enteritis, and the acute radiation enteritis is mainly characterized by local intestinal inflammation and commonly occurs in the radiation treatment process of colorectal cancer, prostate cancer and gynecological tumor. The occurrence of acute radiation enteritis seriously affects the progress and the quality of life of the radiotherapy of patients, and is closely related to the long-term survival of the patients, and how to effectively avoid the occurrence of the acute radiation enteritis is the focus of attention in the research field of tumor radiotherapy in recent years.
The P1 purinergic signal receptor is a transmembrane receptor using extracellular ATP as a signal molecule and can be divided into two major receptor families, namely P2Rxs and P2 RYs. The P2RX1 receptor belongs to the P2RXs family, and is an ATP-dependent cation channel receptor. During acute inflammation, extracellular elevated ATP may promote inflammatory responses by activating P2RX1 receptors. The neutrophil is an immune cell which mainly plays a role in acute inflammation, and the previous research results show that the mechanism of amplifying an inflammation signal by a P2RX1 receptor is related to promoting the activation of the neutrophil, and the targeting of the P2RX1 receptor can inhibit the activation of the neutrophil in acute inflammation. Targeting the P2RX1 receptor may become a potential treatment scheme for acute radiation enteritis, but no relevant report is found at present.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provide a medicament for treating acute radiation enteritis.
The first object of the present invention is to provide the use of a P2RX1 receptor inhibitor for the preparation of a medicament for the treatment of acute radiation enteritis, for reducing the expression of inflammatory factors, and/or for reducing neutrophil infiltration.
The second purpose of the invention is to provide the application of the gene expression inhibitor of the coding gene of the P2RX1 in preparing the medicines for treating acute radiation enteritis, reducing the expression of inflammatory factors and/or reducing neutrophil infiltration.
The third purpose of the invention is to provide the application of the inhibitor of P2RX1 protein in preparing the medicine for treating acute radiation enteritis, reducing the expression of inflammatory factors and/or reducing neutrophil infiltration.
The fourth purpose of the invention is to provide a medicine for treating acute radiation enteritis.
In order to achieve the purpose, the invention is realized by the following scheme:
the inventor researches and discovers that the expression of the P2RX1 in the intestinal tract of a mouse is up-regulated after radiotherapy; p2RX1 Gene knockout (P2 RX 1) -/- ) After the radiotherapy, the survival rate of the mice is improved, the intestinal tissue damage is light, the inflammatory cell infiltration is less, and the expression of TNF-alpha and IL-6 is lower; p2rx1 -/- MPO activity is reduced after the mice are irradiated by radiation, and TNF-alpha and IL-6 are expressed less; p2RX1 receptor inhibitors NF279 and NF449 improve survival rate of mice after radiotherapy, and inhibit intestinal TNF-alpha and IL-6 expression and intestinal MPO activity.
The invention therefore claims the following:
use of a P2RX1 receptor inhibitor for the manufacture of a medicament for the treatment of acute radiation enteritis, for reducing the expression of inflammatory factors, and/or for reducing neutrophil infiltration.
Preferably, the P2RX1 receptor inhibitor is NF279 or NF449.
More preferably, the P2RX1 receptor inhibitor is NF279.
Application of a gene expression inhibitor of a coding gene of P2RX1 in preparing a medicament for treating acute radiation enteritis, reducing expression of inflammatory factors and/or reducing infiltration of neutrophils.
Use of an inhibitor of P2RX1 protein for the manufacture of a medicament for the treatment of acute radiation enteritis, for reducing the expression of inflammatory factors, and/or for reducing neutrophil infiltration.
Preferably, the expression of intestinal inflammatory factors is reduced.
Preferably, the intestinal neutrophil infiltration is reduced.
Preferably, the medicament for the treatment of acute radiation enteritis reduces the expression of inflammatory factors.
More preferably, the medicament for treating acute radiation enteritis reduces the expression of intestinal inflammatory factors.
More preferably, the inflammatory factor is at least one of TNF- α and IL-6.
Preferably, the medicament for the treatment of acute radiation enteritis reduces neutrophil infiltration.
Further preferably, the medicament for treating acute radiation enteritis reduces intestinal neutrophil infiltration.
The invention also claims a medicine for treating acute radiation enteritis, which contains one or more of P2RX1 receptor inhibitor, P2RX1 protein inhibitor or P2RX1 coding gene expression inhibitor.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides an effective treatment method for acute radiation enteritis, which can reduce the expression of inflammatory factors including TNF-alpha and IL-6 caused by the acute radiation enteritis and the infiltration of neutrophilic granulocyte by inhibiting P2RX1, so that the acute radiation enteritis can be effectively treated. The method can be widely used for treating clinical acute radiation enteritis, has good application prospect, and is worthy of protection and popularization.
Drawings
FIG. 1: effect of radiotherapy on expression of P2RXs and P2RYs purinergic signal receptors in the mouse gut. (A) RNA sequencing results show that the expression of the mouse intestinal tract P2RX1 receptor is obviously up-regulated after radiotherapy. (B) PCR results confirmed upregulation of P2RX1 expression after radiotherapy. (C) immunohistochemistry results confirmed the upregulation of P2RX1 expression following radiotherapy. *** P≤0.001
FIG. 2 is a drawing: the P2RX1 gene knockout increases mouse survival after radiotherapy and inhibits acute radiation enteritis. (A) Survival analysis results showed that the P2RX1 gene was knocked out (P2 RX 1) compared to Wild Type (WT) mice -/- ) Survival rate of mice after radiotherapy is improved. (B) HE staining results showed P2rx1 compared to WT mice -/- After the radiotherapy of the mice, the intestinal tissues are slightly damaged, and inflammatory cells are less infiltrated. (C) The ELISA results showed that P2rx1 showed comparable to WT mice -/- Mouse TNF-alpha and IL-6 expression is low. ** P≤0.01， *** P≤0.001
FIG. 3: the P2RX1 gene knockout inhibits neutrophil inflammatory activation following radiation therapy in mice. (A) MPO detection result shows that P2rx1 -/- MPO activity decreased following radiation therapy in mice. (B) The PCR results showed P2rx1 compared to WT mice -/- The expression of mRNA of neutrophil TNF-alpha and IL-6 is low after the radiotherapy of the mice. (C) ELISA results showed P2rx1 compared to WT mice -/- After the radiotherapy of the mice, the expressions of the proteins of the neutrophilic granulocyte TNF-alpha and the IL-6 are lower. *** P≤0.001
FIG. 4 is a drawing: effects of P2RX1 receptor inhibitors NF279 and NF449 on acute radiation enteritis. (A) Survival analysis results showed that NF279 and NF449 increased survival after radiation therapy in mice. (B) ELISA results showed that NF279 and NF449 inhibited intestinal TNF-. Alpha.and IL-6 expression. (C) The MPO assay results showed that NF279 and NF449 inhibited intestinal MPO activity. ** P≤0.01， *** P≤0.001
Detailed Description
The present invention will be described in further detail with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
EXAMPLE first Effect of radiation therapy on expression of P2Rxs and P2Rys purinergic Signal receptors in the mouse gut
1. Experimental methods
(1) Animals and groups
SPF grade C57BL/C male mice 12, each weighing 24-26g, were divided into 2 groups by a random number method, a blank control group and a radiotherapy group, respectively (n = 6). And (5) carrying out X-ray whole-body one-time irradiation on the mice in the radiotherapy group, wherein the total dose is 10Gy, and establishing an acute radiation injury model. The blank control group did not receive X-ray irradiation, and the rest of the experimental conditions were the same as those of the radiotherapy group.
(2) RNA sample preparation and detection
2 days after radiotherapy mice were treated with CO 2 The asphyxiation procedure was performed by euthanasia, taking small intestinal tissue, carefully squeezing out the intestinal contents and placing in Trizol. The small intestine tissue was minced, ground, and RNA was extracted according to Trizol reagent instructions. RNA concentration and purity were measured using a Nanodrop2000 instrument and RNA integrity was assessed by measuring RIN values using an Agilent2100 instrument. The OD260/280 is between 1.8 and 2.2, and the RIN value is more than 7, so that the RNA sample is qualified. Blank control group and radiotherapy group (n = 1) RNA are taken for RNA sequencing, and blank control group and radiotherapy group (n = 5) R are takenNA RT-qPCR detected P2RX1, TNF-a, IL6 and GAPDH.
The following primers were used:
P2RX1-F：GGATGGTGCTGGTACGAAACA，
P2RX1-R：CACTGACACACTGCTGATAAGG；
TNF-a-F:GACGTGGAACTGGCAGAAGAG，
TNF-a-R:TTGGTGGTTTGTGAGTGTGAG；
IL6-F:TAGTCCTTCCTACCCCAATTTCC,
IL6-R:TTGGTCCTTAGCCACTCCTTC；
GAPDH-F:AGGTCGGTGTGAACGGATTTG，
GAPDH-R:TGTAGACCATGTAGTTGAGGTCA。
(3) Immunohistochemical detection
Taking small intestine tissue 2 days after radiotherapy, carefully extruding out intestinal contents, fixing the tissue by formalin fixing liquid, and embedding the tissue by paraffin. Sections were deparaffinized, antigen repaired, blocked and incubated with primary antibody (Anti-P2 RX1, alomone, APR-022, 1.
2. Results of the experiment
Differences in P2RXs and P2RYs purinergic receptor expression following radiation therapy were observed in RNA sequencing results, with significant up-regulation of P2RX1 receptor expression (fig. 1A), and RT-qPCR (fig. 1B) and immunohistochemistry (fig. 1C) results also confirmed up-regulation of P2RX1 expression in small intestine tissue following radiation therapy. These results suggest that the P2RX1 receptor may play an important role in acute radiation enteritis.
Example two P2RX1 Gene knock-outs increase survival of mice after radiation therapy and inhibit acute radiation enteritis
1. Experimental method
(1) Animals and groups
SPF-grade wild-type (WT) mice and P2RX1 gene knockout (P2 RX 1) -/- ) The weight of each male mouse (Jiangsu Ji Jing Yao kang) is 15, and each male mouse weighs 24-26g. The mice are irradiated by X-ray all over the body once, the total dose is 10Gy, and an acute radiation injury model is established.
(2) Survival rate analysis
Survival of mice was observed continuously for 30 days after radiotherapy and mice survival was recorded (n = 10).
(3) HE staining
2 days after radiotherapy mice were treated with CO 2 The asphyxiation procedure was performed by euthanasia, and the small intestine tissue was removed and the intestinal contents carefully expressed. The tissue was fixed with formalin and embedded in paraffin. Sections were HE stained (n = 5).
(4)ELISA
2 days after radiotherapy mice were treated with CO 2 Asphyxiation was performed by euthanasia, small intestinal tissue was removed and the intestinal contents carefully expressed. After tissue cutting, RIPA lysate was added, ground on ice, centrifuged at 800g for 5 min and the supernatant was removed and TNF- α (Abcam, ab 222503) and IL-6 (Abcam, ab 208348) expression (n = 5) were measured according to the ELISA kit instructions.
2. Results of the experiment
The survival analysis results showed that P2rx1 was compared to WT mice -/- Survival rate after radiotherapy was significantly improved in mice (fig. 2A). HE staining results showed P2rx1 compared to WT mice -/- Mice had less intestinal injury and less inflammatory cell infiltration (fig. 2B). ELISA results showed P2rx1 compared to WT mice -/- Mouse intestinal inflammatory factors TNF-. Alpha.and IL-6 were expressed less (FIG. 2C).
Example three P2RX1 Gene knockouts inhibit neutrophil inflammatory activation following radiation therapy in mice
1. Experimental methods
(1) Animals and groups
SPF-grade wild-type (WT) mice and P2RX1 gene knockout (P2 RX 1) -/- ) The mice are 5 males each, each weighing 24-26g. The mice are irradiated by X-ray all over the body once, the total dose is 10Gy, and an acute radiation injury model is established.
(2) Intestinal MPO (myeloperoxidase) Activity assay
2 days after radiotherapy mice were treated with CO 2 Asphyxiation was performed by euthanasia, small intestinal tissue was removed and the intestinal contents carefully expressed. MPO activity in small intestine tissues was measured according to the MPO kit (Abcam, ab 105136).
(3) Neutrophil inflammatory factor detection
2 days after radiotherapy mice were treated with CO 2 The asphyxiation method is used for euthanasia, peripheral blood is taken, neutrophils are sorted by flow, and the expression of the neutrophils TNF-alpha and IL-6 is detected by ELISA.
2. Results of the experiment
The MPO activity detection result of the intestinal tract shows that compared with WT mice, P2rx1 -/- MPO activity decreased following radiation treatment in mice (fig. 3A), indicating decreased intestinal neutrophil infiltration. The result of the neutrophilic granulocyte inflammatory factor test shows that compared with WT mice, P2rx1 -/- Mouse neutrophilic granulocyte inflammatory factors TNF-alpha and IL-6 expression is low (FIG. 3B)
Example four P2RX1 Gene knockouts inhibit neutrophil inflammatory activation following radiation therapy in mice
1. Experimental methods
(1) Animals and groups
SPF grade C57BL/C male mice 45, each weighing 24-26g, were divided into 3 groups by the random number method, radiotherapy, NF279 and NF449 groups, respectively (n = 15). And (5) carrying out X-ray whole-body one-time irradiation on the mice in the radiotherapy group, wherein the total dose is 10Gy, and establishing an acute radiation injury model. After the NF279 group and the NF449 group are treated with radiotherapy, the intraperitoneal injection is carried out by using NF279 (Tocris, no.1199, 20 mg/kg) and NF449 (Tocris, no.1391/10, 20 mg/kg), respectively.
(2) Survival Rate analysis
Survival was continuously observed for 30 days after radiotherapy, NF279, and NF449 mice, and mice survival was recorded (n = 10).
(3)ELISA
2 days after radiotherapy mice were treated with CO 2 Asphyxiation was performed by euthanasia, small intestinal tissue was removed and the intestinal contents carefully expressed. After tissue mincing RIPA lysate was added, ground on ice, centrifuged at 800g for 5 min and the supernatant was removed and TNF- α and IL-6 expression was detected according to the ELISA kit instructions (n = 5).
(4) Intestinal MPO Activity detection
2 days after radiotherapy mice were treated with CO 2 The asphyxiation procedure was performed by euthanasia, and the small intestine tissue was removed and the intestinal contents carefully expressed. MPO activity in small intestine tissues was measured according to the MPO kit (Abcam, ab 105136).
2. Results of the experiment
Survival analysis results showed that both NF279 and NF449 significantly improved mouse survival after radiotherapy and better effect of NF279 compared to control mice (fig. 4A). The ELISA results showed that both NF279 and NF449 significantly inhibited the expression of the intestinal inflammatory factors TNF- α and IL-6 following radiotherapy (fig. 4B), and that NF279 was more significant compared to control mice. The MPO activity assay results showed that NF279 and NF449 reduced MPO activity in mouse intestine after radiation therapy (fig. 4C), indicating that P2RX1 inhibitors reduced neutrophil infiltration in intestine after radiation therapy.
It should be finally noted that the above examples are only intended to illustrate the technical solutions of the present invention, and not to limit the scope of the present invention, and that other variations and modifications based on the above description and thought may be made by those skilled in the art, and that all embodiments need not be exhaustive. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.

Claims (4)

  1. The application of a P2RX1 receptor inhibitor in preparing a medicament for treating acute radiation enteritis, wherein the P2RX1 receptor inhibitor is NF279.
  2. 2. The use of claim 1, wherein the medicament for the treatment of acute radiation enteritis reduces the expression of inflammatory factors.
  3. 3. The use according to claim 2, wherein the inflammatory factor is at least one of TNF-a and IL-6.
  4. 4. The use of claim 1, wherein the medicament for the treatment of acute radiation enteritis reduces neutrophil infiltration.
CN202111058398.0A 2021-09-10 2021-09-10 Medicine for treating acute radiation enteritis Active CN113713109B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111058398.0A CN113713109B (en) 2021-09-10 2021-09-10 Medicine for treating acute radiation enteritis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111058398.0A CN113713109B (en) 2021-09-10 2021-09-10 Medicine for treating acute radiation enteritis

Publications (2)

Publication Number Publication Date
CN113713109A CN113713109A (en) 2021-11-30
CN113713109B true CN113713109B (en) 2023-04-07

Family

ID=78683053

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111058398.0A Active CN113713109B (en) 2021-09-10 2021-09-10 Medicine for treating acute radiation enteritis

Country Status (1)

Country Link
CN (1) CN113713109B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070004680A1 (en) * 2004-03-30 2007-01-04 Painceptor Pharma Corporation Compositions and methods for modulating gated ion channels

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070004680A1 (en) * 2004-03-30 2007-01-04 Painceptor Pharma Corporation Compositions and methods for modulating gated ion channels

Also Published As

Publication number Publication date
CN113713109A (en) 2021-11-30

Similar Documents

Publication Publication Date Title
Bouchekioua et al. JAK3 deregulation by activating mutations confers invasive growth advantage in extranodal nasal-type natural killer cell lymphoma
Salazar et al. Loss of Tribbles pseudokinase-3 promotes Akt-driven tumorigenesis via FOXO inactivation
Li et al. Brief Report: Amelioration of collagen‐induced arthritis in mice by lentivirus‐mediated silencing of microRNA‐223
Zhan et al. α‐enolase promotes tumorigenesis and metastasis via regulating AMPK/mTOR pathway in colorectal cancer
Sun et al. Clinicopathological significance and prognostic value of lactate dehydrogenase A expression in gastric cancer patients
Wang et al. Sunitinib facilitates metastatic breast cancer spreading by inducing endothelial cell senescence
Ming et al. Naringin targets Zeb1 to suppress osteosarcoma cell proliferation and metastasis
Li et al. Sensitizing leukemia stem cells to NF-κB inhibitor treatment in vivo by inactivation of both TNF and IL-1 signaling
Lin et al. Thyroid hormone negatively regulates tumorigenesis through suppression of BC200
Cheng et al. IL-1α and colorectal cancer pathogenesis: enthralling candidate for anti-cancer therapy
KR101539138B1 (en) Combination therapy and method for assessing resistance to treatment
Xu et al. DLEU2: a meaningful long noncoding RNA in oncogenesis
Fang et al. Cancer-associated fibroblast-like fibroblasts in vocal fold leukoplakia suppress CD8+ T cell functions by inducing IL-6 autocrine loop and interacting with Th17 cells
Chung et al. 12-lipoxygenase is a critical mediator of type II pneumocyte senescence, macrophage polarization and pulmonary fibrosis after irradiation
Ahmed et al. Dexamethasone‐mediated inhibition of Notch signalling blocks the interaction of leukaemia and mesenchymal stromal cells
CN113713109B (en) Medicine for treating acute radiation enteritis
Zhang et al. MicroRNA-378a-3p downregulation as a novel biomarker with poor clinical outcomes in cervical cancer
Zhang et al. Retracted article: miR-148-3p inhibits gastric cancer cell malignant phenotypes and chemotherapy resistance by targeting Bcl2
CN112114143A (en) Application of liver cancer diagnosis and cancer-causing kinase treatment marker
Jia et al. CD2+ T-helper 17-like cells differentiated from a CD133+ subpopulation of non-small cell lung carcinoma cells promote the growth of lung carcinoma
Liu et al. WDR3 promotes stem cell‐like properties in prostate cancer by inhibiting USF2‐mediated transcription of RASSF1A
Yu et al. PFKFB3 increases IL-1β and TNF-α in intestinal epithelial cells to promote tumorigenesis in colitis-associated colorectal cancer
CN108653291A (en) Purposes of the THZ1 in treating oophoroma
Gil da Costa et al. Pharmacological NF‐κB inhibition decreases cisplatin chemoresistance in muscle‐invasive bladder cancer and reduces cisplatin‐induced toxicities.
Ma et al. TRIM52 knockdown inhibits proliferation, inflammatory responses and oxidative stress in IL‐1β‐induced synovial fibroblasts to alleviate temporomandibular joint osteoarthritis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant