CN113564252B

CN113564252B - New use of methylase METTL3

Info

Publication number: CN113564252B
Application number: CN202110832368.4A
Authority: CN
Inventors: 常梦琪; 王任直; 包新杰; 王子豪; 冯铭; 陈亦豪; 姜燊种
Original assignee: Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Current assignee: Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Priority date: 2021-07-22
Filing date: 2021-07-22
Publication date: 2022-09-02
Anticipated expiration: 2041-07-22
Also published as: CN113564252A

Abstract

The invention discloses a pituitary growth hormone adenoma diagnostic reagent, which comprises a reagent for detecting the expression level of METTL 3; and/or, an agent that detects METTL 3-regulated levels of methylation of a target gene. The invention discloses that the expression of METTL3 in pituitary growth hormone adenoma is obviously increased, and the methylation of a target gene GNAS in pituitary adenoma cells is increased, so that the METTL3 and the target gene GNAS can be used for preparing products for diagnosing or treating pituitary growth hormone adenoma, and a new direction is provided for searching a novel tumor marker related to diagnosis of the pituitary growth hormone adenoma or a new treatment strategy for controlling the pituitary growth hormone adenoma.

Description

New use of methylase METTL3

Technical Field

The invention relates to the field of biomedicine, in particular to a new application of methylase METTL 3.

Background

Pituitary GH adenomas cause acromegaly, a common hormone-secreting anterior pituitary cell tumor. The clinical manifestations are that the space-occupying effect of the tumor and high level of hormone cause the patients to develop the systemic multisystem complications, seriously reduce the life quality of the patients and increase the death rate of the patients. At present, the clinical treatment mainly adopts surgery as a first treatment scheme, but as a plurality of invasive pituitary adenomas invade cavernous sinus or skull base structures, the cavernous sinus or skull base structures cannot be completely removed, other treatment means have side effects and drug resistance, and an additional treatment strategy is needed. Therefore, there is an urgent need to develop new therapeutic targets for more accurate and comprehensive understanding of the molecular biological characteristics associated with pituitary GH adenomatous development.

The methylation modification of RNA m6A is reversible chemical modification, and the methylation regulation is performed by the synergy of methyltransferase complex (METTL3, METTL14, WTAP, etc.) and demethylase (FTO and ALKBH5), and simultaneously the combination of binding protein (YTHDF1-3 and YTHDC1-2, etc.) to perform biological function. The RNA m6A has the functions of regulating the shearing, translation, stability, nuclear transport and the like of RNA, and participates in a plurality of biological processes such as adipogenesis, spermatogenesis, stem cell fate, immune regulation and the like. Based on the importance of m6A in the above diverse vital functions, dysregulation of m6A modifications and their related proteins led to the development of disease. Expression of m6A regulatory protein and m6A modification level are found to be changed in tumor stem cells or cell lines by a plurality of research teams, so that lung cancer, liver cancer, breast cancer, leukemia, glioma, bladder cancer and the like are caused. These findings suggest that the study of oncology with m6A as the entry point helps to promote the study of tumor pathogenesis in a comprehensive manner, and thus a new tumor-targeted therapeutic approach is sought in the pathway regulated by m 6A. Under the condition, apparent transcriptomics represented by RNA m6A methylation are expected to open new prospects for the research of pituitary GH adenomas.

Disclosure of Invention

In order to make up for the deficiencies of the prior art, the invention aims to provide a target METTL3 related to pituitary growth hormone adenoma and a corresponding target gene thereof, and provides a product and a means for diagnosis and treatment of pituitary growth hormone adenoma.

In order to achieve the purpose, the specific technical scheme of the invention is as follows:

the invention provides a pituitary growth hormone adenoma diagnostic reagent in a first aspect, which comprises a reagent for detecting the expression level of METTL 3; and/or, an agent that detects METTL 3-regulated target gene expression levels or methylation levels.

Further, the METTL3 regulated target gene is GNAS.

Further, the METTL3 expression and its catalyzed GNAS methylation levels were significantly elevated in pituitary somatotroph adenoma samples compared to normal controls.

Further, the reagent comprises a primer and an antibody for quantitatively detecting the expression quantity of METTL3 and/or GNAS.

Further, the nucleotide sequence of the primer includes:

upstream primer METTL 3-F: CCCTATGGGACCCTGACAGA, SEQ ID NO: 3;

downstream primer METTL 3-R: TGACACCAACCAAGCAGTGT, SEQ ID NO: 4.

An upstream primer GNAS-F: GCAGAAGGACAAGCAGGTCT, SEQ ID NO: 1;

an upstream primer GNAS-R: TTCTCACCATCGCTGTTGCT, SEQ ID NO: 2.

Further, the METTL3 antibody can be a rabbite-anti METTL3 antibody, available from Abcam, cat # ab 195352.

In a second aspect, the invention provides the use of a reagent as defined in any one of the preceding claims for the manufacture of a pituitary growth hormone adenoma diagnostic product.

Further, the products include diagnostic reagents, diagnostic kits and diagnostic tools.

In one embodiment, the method of using or aiding diagnosis of the product comprises: 1) determining the expression level of METTL3 in a sample from the subject by the reagent for quantitatively detecting the expression amount of METTL 3; 2) determining whether the subject has pituitary somatotropin adenoma based on the difference in expression levels of METTL3 from normal pituitary cells.

Determining that the subject has pituitary somatotropin adenoma if the expression level of METTL3 is significantly increased as compared to a control.

In another embodiment, the method of using or aiding diagnosis of the product comprises: 1) determining the level of GNAS RNA m6A methylation modification in a sample from the subject by the agent that quantitatively detects the level of GNAS RNA m6A methylation modification; 2) determining whether the subject has pituitary somatotropin adenoma based on the difference between the subject GNAS RNA m6A methylation modification level and normal pituitary cells.

Determining that the subject has pituitary somatotropin adenoma if the level of methylation modification of GNAS RNA m6A is significantly increased compared to a control.

The third aspect of the invention provides an application of a reagent for detecting the methylation modification level of GNAS RNA m6A in the preparation of pituitary growth hormone adenoma diagnostic products.

Further, the reagent detects the methylation modification level of the GNAS RNA m6A by a m6A methylation sequencing and co-immunoprecipitation tandem real-time quantitative PCR method.

A fourth aspect of the invention provides the use of METTL3 in any one of,

(1) the METTL3 inhibitor is used for preparing a pharmaceutical composition for preventing or treating pituitary growth hormone adenoma;

(2) use of a METTL3 inhibitor for the manufacture of a medicament for reducing the level of GNAS expression or methylation in a cell;

(3) the application of METTL3 in screening candidate drugs for treating pituitary growth hormone adenoma.

Further, the inhibitor reduces expression of METTL3 gene or protein;

preferably, the inhibitor is selected from nucleic acid inhibitors targeting METTL3 or a transcript thereof and capable of inhibiting METTL3 gene transcription or protein expression of interfering molecules comprising: shRNA, siRNA, dsRNA, microrna, antisense nucleic acid, or a construct or host cell capable of expressing or forming said shRNA, siRNA, dsRNA, microrna, antisense nucleic acid.

Preferably, the inhibitor comprises siRNA and shRNA.

In a fifth aspect, the present invention provides a pharmaceutical composition for preventing or treating pituitary growth hormone adenoma, comprising a METTL3 inhibitor and/or a GNAS inhibitor.

The METTL3 inhibitor can inhibit expression of METTL3, GNAS expression and m6A methylation modification level, and further regulate and control the tumorigenic capacity and hormone level in vivo of pituitary growth hormone adenoma.

Further, the pharmaceutical composition may further comprise other agents for the treatment of pituitary somatotropin adenomas.

In a sixth aspect, the present invention provides a method for screening a candidate drug for the treatment of pituitary somatotroph adenoma, the method comprising:

treating the culture system expressing or containing the METTL3 gene with a substance to be screened; and detecting the level of METTL3 gene transcription in said system; wherein, when the substance to be screened inhibits the transcription level of METTL3 gene, the substance to be screened is a candidate drug for treating pituitary growth hormone adenoma.

Further, the system is selected from: a cell system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

The candidate substances include (but are not limited to): interfering molecules such as nucleic acid inhibitors, small molecule compounds and the like designed against the METTL3 gene or its upstream or downstream genes.

Based on the technical scheme, the invention has the following beneficial effects:

experiments show that the expression of METTL3 in pituitary growth hormone adenoma is obviously increased, and the methylation of the target gene GNAS in pituitary adenoma cells is increased, so that the METTL3 and the target gene GNAS can be used for preparing products for diagnosing or treating pituitary growth hormone adenoma. The METTL3 and the corresponding target gene thereof can help a student to deeply understand the role of m6A in pituitary adenoma pathology, help theoretically research the pituitary adenoma, and hopefully develop a novel targeted drug, thereby providing a new direction for searching a novel tumor marker related to diagnosis of the pituitary growth hormone adenoma or a novel treatment strategy and controlling the pituitary growth hormone adenoma.

Drawings

FIG. 1(a) analysis of the methylation profile of m6A shows that the level of methylation of RNA m6A of pituitary growth hormone adenoma (GH) is significantly increased compared to normal pituitary. (b) The first 30 methylated RNAs of pituitary somatotroph adenoma that differ most from normal pituitary. (c) RNA methylation schematic of GNAS gene.

Fig. 2 enlarges the sample size to verify that GNAS has increased RNA methylation in GH.

Figure 3METTL3 shows a significant increase in RNA expression and protein expression in pituitary GH adenomas. (a) RT-qPCR analysis revealed that METTL3 expression was elevated in pituitary GH adenomas. (b) Immunohistochemistry showed that protein expression of METTL3 was elevated in pituitary GH adenomas.

Figure 4METTL3 knockdown resulted in inhibition of cell growth and hormone secretion in the rat GH3 cell line. (a) MTT showed GH3 cellular activity following METTL3 knock-down. (b) GH ELISA analysis showed decreased GH hormone secretion following METTL3 knockdown. (c-f) tumor growth after GH3 cell line nodulation following METTL3 knockdown (c), tumor weight at time of harvest (d), tumor panel (e), and level of GH hormone in serum (f).

Figure 5METTL3 knockdown resulted in decreased GNAS methylation levels and expression. (a) qPCR and western results showed low efficiency validation of METTL3 knockdown. (b) The m6A-IP-qPCR results revealed a change in the methylation level of GNAS after METTL3 knockdown. (c) qPCR results showed changes in RNA expression levels of GNAS following METTL3 knockdown. (d) western and gray scale analysis showed changes in protein levels of GNAS following METTL3 knockdown.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

All materials, reagents and the like in the following examples are commercially available unless otherwise specified.

In the present invention, the term "METTL 3(NCBI database gene ID: 56339)" refers to METTL3 having the original sequence shown by the METTL3 gene in the current International consensus nucleic acid database GeneBank, which includes METTL3 and its analogs, whether of natural or synthetic origin. The METTL3 analog refers to a derivative or variant form thereof which is substituted, deleted or added with one or more nucleotides, or is biologically modified and still has biological activity.

Example 1 extraction of Total RNA from cells and quality monitoring

Pituitary somatotropin adenoma tissue and healthy pituitary tissue were collected. Pituitary somatotroph adenoma tissues were taken from the concordant and hospital specimen banks in 2019, month 10, healthy pituitary tissues were taken from the hospital brain banks in medical, 2019, month 10. The pituitary growth hormone adenoma tissue and the normal pituitary tissue are put into a 1.5mL Ep tube, 1mL of Trizol is added, the mixture is repeatedly blown and evenly mixed, and the mixture is kept stand for 5min at room temperature. Add 200. mu.L chloroform, shake vigorously for 30s, incubate at room temperature for 3 min. 10000 Xg, centrifugation at 4 ℃ for 15 min. The sample was divided into three layers, the upper colorless aqueous phase, the middle layer, and the lower pink organic phase. RNA in colorless aqueous phase, so the colorless aqueous phase was transferred to a new centrifuge tube, added with an equal volume of anhydrous ethanol, and mixed by gentle inversion. Transferring to a centrifugal column, centrifuging at 12000 Xg for 30s at room temperature, and discarding the effluent. Then 500. mu.L of clean buffer, 12000 Xg, was centrifuged at room temperature for 30s, washed twice, and the washing solution was removed. Then 500. mu.L of wash buffer was added thereto, and the mixture was centrifuged at 12000 Xg for 30 seconds at room temperature, and the washing solution was discarded. Then 500. mu.L of wash buffer was added and centrifuged at 12000 Xg for 2min at room temperature to completely remove the residual ethanol. Placing the column in RNase-free Tube, adding 20 μ L RNase-free Water, and standing at room temperature for 1 min. The mixture was centrifuged at 12000 Xg for 1min at room temperature to elute the RNA. The RNA was stored at-80 ℃ until use.

RNA extraction standard: RNA concentration and 260nm/280nm ratio. The purity requirement of the total RNA is that the OD260/OD280 value should be 1.8-2.2; detection of RNA integrity: the integrity of the RNA was checked by electrophoresis on a 1% agarose gel.

Example 2 Gene sequencing and data analysis

Sequencing: the m6A co-immunoprecipitation tandem Illumina Nova3 technology is adopted to detect the RNA enriched in m6A of pituitary growth hormone adenoma and healthy pituitary tissue at high flux. M6A differential methylation spectra were acquired and processed for analysis of m6A data.

RNA m6Apeak is detected by exome Peak analysis software, t-test is carried out to obtain a P value, then the P value is combined by using Fisher test, and differential RNA m6A and RNA expression are screened by taking FDR <0.05 as a standard.

The experimental results are as follows: compared with healthy pituitary, there are 5598 RNA m6A with obvious difference (FDR < 0.05), 4747 RNAs (fold change is more than or equal to 0) modified by m6A and 851 RNA (fold change is less than or equal to 0) with reduced methylation.

As shown in FIG. 1, m6A methylation modification of GNAS was upregulated in the first 30 RNAs with the most significant methylation differences between 3 pituitary somatotroph adenomas compared to 3 healthy pituitary glands (FIG. 1b), suggesting that GNAS RNA may be closely related to pituitary somatotroph adenomas.

Example 3m 6A Co-immunoprecipitation tandem real-time quantitative PCR validation of upregulation of the pituitary somatotroph adenoma and GNAS RNA m6A of healthy pituitary

RNA extraction: 8 pituitary somatotropin adenoma samples and 7 healthy pituitary tissues were collected. 1mL of Trizol was added and extracted according to the procedure of example 1.

The inventors used m6A IP-qPCR to detect the level of GNAS methylation, setting up 3 parallel channel reactions each time with GAPDH as an internal control.

The IP method comprises the following steps: total RNA fragments were broken into around 300nt (for m6A IP-qPCR) using RNA fragment reagent (Thermo Fisher, AM 8740). Mu.g of total RNA fragments were incubated with 2. mu.g of anti-m 6A antibody for 4h at 4 ℃ and Dynabeads were added ^TM Protein A was cross-linked to the antibody (Thermo Fisher, 10002D). After incubation for 2h at 4 ℃ the cells were washed 3 times with IPP buffer (150mM NaCl, 0.1% NP-40,10mM Tris-HCl, pH 7.4). Subsequently, the demethylated RNA fragments were washed with m6A nucleotide solution and then subjected to ethanol precipitation: adding glycogen, 0.1 time volume of 5M ammonium acetate and 2.5 times volume of absolute ethyl alcohol, uniformly mixing, standing at-80 ℃ for more than 1 hour, centrifuging at 13,300rpm for 40 minutes, and removing a supernatant; the resulting mixture was washed with 1ml of 70% ethanol, centrifuged at 13,300rpm for 10 minutes, the supernatant was removed, and dissolved in water to obtain immunoprecipitated RNA.

Reverse transcription of mRNA: mu.g of total RNA was used as template RNA, and ReverTra was used

qPCR RT Master Mix (TOYOBO, FSQ-301) was used for reverse transcription.

The RT-PCR reaction was performed according to TaKaRa Premix Ex TaqTM II instructions.

An upstream primer GNAS-F: GCAGAAGGACAAGCAGGTCT, SEQ ID NO: 1;

an upstream primer GNAS-R: TTCTCACCATCGCTGTTGCT, SEQ ID NO: 2.

RT-qPCR amplification procedure of mRNA: 30s at 95 ℃; circulating for 40 times at 95 ℃ for 15s and 60 ℃ for 20 s.

The results are shown in fig. 2, the methylation content of GNAS m6A in pituitary somatotroph adenoma is significantly higher than that of healthy pituitary (P < 0.05), and consistent with the sequencing result of m6A, the methylation modification of GNAS RNA m6A can be used as a marker for detecting pituitary somatotroph adenoma.

Secondly, RT-qPCR is used for detecting the RNA expression of m6A upstream regulatory genes METTL3, METTL14, WTAP, FTO and ALKBH5 in two groups of samples.

Reverse transcription of mRNA: 1. mu.g of total RNA was used as template RNA, and ReverTra was used

qPCR RT Master Mix (TOYOBO, FSQ-301) was used for reverse transcription.

The fluorescent quantitative PCR (RT-qPCR) reaction system is as follows:

sterilizing distilled water: x mu l; qPCR mix 5 μ l; an upstream primer: 3 pmol; a downstream primer: 3 pmol; ROX reference dye: 0.2 μ l; the total amount of the system was 10. mu.l.

Upstream primer METTL 3-F: CCCTATGGGACCCTGACAGA, SEQ ID NO: 3;

downstream primer METTL 3-R: TGACACCAACCAAGCAGTGT, SEQ ID NO: 4;

RT-PCR amplification procedure for METTL 3: 10m at 95 ℃; 10s at 95 ℃; 31s at 60 ℃; 10s at 70 ℃; the cycle is repeated 40 times.

Expression assay of METTL3 parallel tube reactions were set up 3 at a time with the universal GAPDH as an internal control.

The results are shown in FIG. 3a, where the expression of METTL3 is most significantly elevated in pituitary somatotroph adenomas compared to fresh specimens of normal pituitary glands.

And then detecting the in-situ protein expression condition of METTL3 by using pituitary growth hormone adenoma and paraffin sections of healthy pituitary. As shown in fig. 3b, METTL3 protein was localized in the nucleus and protein expression levels were significantly elevated in pituitary somatotroph adenomas compared to healthy pituitary.

Example 4 cellular and animal levels validation of the effects of METTL3 and m6A methylation on pituitary growth hormone adenomas

The effect of cell proliferation and hormone secretion was examined using a METTL 3-knockdown cell line. In pituitary rat growth hormone adenoma cell line GH3, siRNA METTL3 knockdown, MTT assay for cell activity and ELISA for hormone secretion; at the same time, at animal level, firstly, the METTL3 is knocked down in GH3 cells by using lentivirus, a GH3 cell line infected by the lentivirus is transplanted to the subcutaneous part of a rat of a corresponding variety, an in vivo tumor formation model is established, and the tumor growth and the hormone level in the rat are detected.

siRNA knockdown METTL 3: 50nM of small interfering (si) RNA was transfected into cells at 40-50% density. At the time of transfection: first, siRNA-RFect mixture is prepared. Take a 24-well plate as an example. The siRNA was first diluted in 50. mu.l serum-free Opti-MEM medium. Mu.l RFect was diluted with 50. mu.l serum-free Opti-MEM medium and mixed gently, and incubated at room temperature for 5 min. The siRNA dilution and RFect dilution were mixed together, 100. mu.l, gently mixed and incubated at room temperature for 20 min. The mixture was added to the cells, mixed by gentle shaking, and cultured at 37 ℃ for 72 hours.

siRNA sequence:

si-Mettl3-1 forward sequence 5'-UCAGUAUCUUGGGCAAGUUTT-3', SEQ ID NO: 5; reverse sequence 5'-AACUUGCCCAAGAUACUGACG-3', SEQ ID NO: 6;

si-Mettl3-2 forward sequence 5'-CAAGGAACAAUCCAUUGUUTT-3', SEQ ID NO 7; reverse sequence 5'-AACAAUGGAUUGUUCCUUGGC-3', SEQ ID NO: 8.

MTT detection procedure: METTL3 knockdown cells were trypsinized, counted and resuspended in complete medium to 1X 10 ⁴ Cells/100. mu.l were added to a 96-well plate at 100. mu.l per well, and cultured in a 37 ℃ incubator for about 48 hours; preparing a culture medium and MTT mixed solution according to the proportion of 10: 1; sucking out the old culture medium, adding the prepared mixed solution of MTT (methanol to toluene) with each hole being 100ul, and continuously culturing for 4h in an incubator; absorbing the mixed solution, adding 110 mul of Formazan dissolving solution into each hole, wrapping a 96-hole plate by tinfoil paper, and placing on a shaking bed to shake at low speed for 10 min; the absorbance of each well was measured at 490nm of an enzyme linked immunosorbent assay.

3, detecting GH content by ELISA: for the detection of GH content in cell line supernatants and rat serum, the detection was carried out using Millipore kit (EZRMGH-45K), and the detection protocol was strictly in accordance with the kit instructions. Namely, the method of antigen-antibody combination and secondary antibody and enzyme-linked reaction coloration is utilized to measure the light absorption value at 450nm of an enzyme-linked immunosorbent assay detector.

4. The lentivirus infection process: in a 10cm culture dish, 50moi lentivirus is added when the cells are 70-80% confluent to infect; these cells were subsequently used in xenograft experiments.

metttl3 shRNA sequence 5'-CGTCAGTATCTTGGGCAAGTT-3', SEQ ID NO 9;

the negative control (scrambles) shRNA was 5'-TTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTT-3', SEQ ID NO: 10.

5. The process of rat tumorigenesis: the Wistar Furth rat is adopted to establish a GH3 xenograft model. Female rats of 4 weeks old were injected subcutaneously with virus-infected GH3 cells at the left lumbar region. After 14 days, a volume of about 100mm is formed ³ The tumor of (2). The tumor size was measured every 3 days with a caliper and the tumor volume was calculated as (length x width) ² )/2. 25 days after cell inoculation, animals were euthanized and tumors were excised and weighed. Blood samples were collected for serum growth hormone assessment prior to drawing. The groups were divided into scramble group and METTL3 knockdown group (shMettl3), and biological replicates were performed using 8 mice per group, representative results are shown.

The results are shown in fig. 4, where cellular activity was reduced following METTL3 knockdown (fig. 4a) and hormone secretion was inhibited (fig. 4 b). In vivo experiments showed that after knockdown of METTL3 in the cell xenograft model, tumors formed were significantly smaller than the control group (fig. 4c-e), and the tumorigenic capacity of the cells was reduced. The hormone levels in serum were suppressed (fig. 4 f).

Example 5 validation of mRNA levels METTL3 and GNAS RNA m6A and validation of targeting relationships

The Scr and si-METTL3 transfected successful cells prepared in example 4 were collected.

GNAS expression levels and m6A methylation levels were measured using the method of example 3. The results are shown in fig. 5, where mRNA m6A methylation of GNAS was reduced (fig. 5b) and expression was down-regulated (fig. 5c) in the knockdown METTL3 group (simetll 3) compared to the negative control group (Scr).

Example 6 protein level validation of GNAS methylation and METTL3 targeting relationship validation

The Scr and si-METTL3 cells successfully transfected by the plasmid prepared in example 4 were collected.

1. Protein extraction and concentration determination

Total cellular proteins were extracted separately according to the kit instructions (Shanghai Biyuntian Biotech Co., Ltd., batch No.: P0013B). Each histone concentration was measured by BCA protein assay (Thermo, USA, batch No.: RD 232685). Each histone was diluted to an equal concentration using a cell lysate, mixed with 5 Xloading buffer at a volume ratio of 4:1, and denatured at 98 ℃ for 5 min.

2.Western Blot

Negative control group (Scr) and knockdown METTL3 group (si-METTL3), extracting total protein 40 μ g each, 12% SDS-PAGE gel electrophoresis (100V, 100min), transferring membrane to PVDF membrane at constant current 320mA for 100 min; blocking with 5% BSA in a shaker at room temperature for 1h, incubating the GNAS primary antibody (1:1000) overnight at 4 deg.C (batch No. 4842S from CST), washing with TBST 3 times for 10min each time, diluting the secondary antibody (1:5000) with blocking solution, and incubating at room temperature for 1 h. TBST was washed 3 times for 10min, and an ECL luminescence kit (Santa Cruz, USA, lot sc-2048) was exposed to light in an exposure apparatus, and gray-scale analysis was performed using Image J software with internal reference GAPDH as a control.

The results are shown in fig. 5, where the expression of GNAS protein was down-regulated in the case of the knockdown METTL3 group (simetll 3) compared to the negative control group (scr) (fig. 5d), and the expression of METTL3 protein was down-regulated in the case of the knockdown METTL3 group (simetll 3) compared to the negative control group (scr) (fig. 5 a).

The above results demonstrate that by knocking down METTL3 expression in cells and in vivo, RNA methylation levels of GNAS, as well as transcription and protein expression levels of GNAS, can be reduced, thereby inhibiting the tumorigenic capacity and in vivo hormone levels of pituitary growth hormone adenomas.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

SEQUENCE LISTING

<110> Beijing coordination hospital of Chinese academy of medical sciences

New use of <120> methylase METTL3

<130> P210057

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

gcagaaggac aagcaggtct 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

ttctcaccat cgctgttgct 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

ccctatggga ccctgacaga 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

tgacaccaac caagcagtgt 20

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

ucaguaucuu gggcaaguut t 21

<210> 6

<211> 21

<212> RNA

<213> Artificial sequence (Artificial sequence)

<400> 6

aacuugccca agauacugac g 21

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

caaggaacaa uccauuguut t 21

<210> 8

<211> 21

<212> RNA

<213> Artificial sequence (Artificial sequence)

<400> 8

aacaauggau uguuccuugg c 21

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

cgtcagtatc ttgggcaagt t 21

<210> 10

<211> 53

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

ttctccgaac gtgtcacgtt tcaagagaac gtgacacgtt cggagaattt ttt 53

Claims

1. Use of a reagent for the detection of the level of GNAS methylation, which is significantly elevated in a patient suffering from pituitary somatotropin adenoma, for the preparation of a diagnostic product for pituitary somatotropin adenomas.

2. The use according to claim 1, wherein the reagents comprise primers and antibodies for quantitatively detecting the expression level of GNAS.

Use of an inhibitor of METTL3 for the preparation of a pharmaceutical composition for the prevention or treatment of pituitary somatotropin adenomas; the inhibitor of METTL3 is an interfering RNA; the METTL3 inhibitor can regulate the tumorigenicity ability and the hormone level in vivo of pituitary growth hormone adenoma by inhibiting METTL3 expression, GNAS expression and m6A methylation modification level.

4. The use of claim 3, wherein the interfering RNA comprises siRNA and shRNA.

5. The use of claim 4, wherein the siRNA sequence is represented by SEQ ID NO 5-6 and/or SEQ ID NO 7-8; the shRNA sequence is shown as SEQ ID NO. 9.