CN113549605B

CN113549605B - Compositions and vector systems for inhibiting SARS-CoV-2

Info

Publication number: CN113549605B
Application number: CN202110448000.8A
Authority: CN
Inventors: 鲍习琛; 赵文学; 熊志; 殷超; 张玉琪; 潘蔚绮; 林莹莹; 王茜玮; 何俊
Original assignee: Guangzhou Institute of Biomedicine and Health of CAS; Bioisland Laboratory
Current assignee: Guangzhou Institute of Biomedicine and Health of CAS; Bioisland Laboratory
Priority date: 2020-04-26
Filing date: 2021-04-25
Publication date: 2023-03-31
Anticipated expiration: 2041-04-25
Also published as: CN113549605A

Abstract

The invention relates to the field of biological medicine, in particular to a composition and a carrier system for inhibiting SARS-CoV-2. The composition comprises: i) A Cas nuclease, and ii) a crRNA; wherein the crRNA comprises in its sequence a) a guide sequence capable of hybridizing to the target RNA sequence, and b) a framework nucleic acid fragment that interacts with the Cas nuclease. The composition and system provided by the invention can be used for treating and preventing SARS-CoV-2 related diseases, and have good application prospect.

Description

Compositions and vector systems for inhibiting SARS-CoV-2

RELATED APPLICATIONS

The priority of the chinese patent application having application number 202010339149.8 entitled "composition and vector system for inhibiting SARS-CoV-2", filed on 26.04/2020, is hereby incorporated by reference in its entirety.

Technical Field

The invention relates to the field of biological medicine, in particular to a composition and a carrier system for inhibiting SARS-CoV-2.

Background

The novel coronavirus pneumonia (COVID-19) has a big outbreak in multiple countries of the world at present, and brings great challenges to the treatment and prevention and control of the global epidemic disease. Currently, the most effective method for controlling the disease is only isolation and medical care, so that the research on how to effectively prevent and treat the new coronary pneumonia is of great significance.

AAV virus has been shown to be a very safe gene delivery vector, and related drugs have been approved by the FDA in the united states for marketing (e.g., zolgensma, novartis, aveXis); in 2017, the Massachusetts Institute of Technology (MIT) Zhang Feng subject group found that Cas13 can target degraded RNA, and subsequently found that many family members of Cas13 protein have the capability of targeted cleavage of RNA, and the method can specifically degrade RNA and has relatively low off-target effect. By 2019, parsis c.sabei et al found that this method can be used to inhibit infection of influenza a, meningitis and vesicular stomatitis viruses at the cellular level in vitro. However, the new coronavirus (SARS-CoV-2) is a new virus, and its life cycle and infection pathway etc. are poorly understood, and it is not known whether the strategies at the cellular level or at the organism level (Cas 13 and crRNA) can inhibit the activity of the virus.

Disclosure of Invention

The present invention relates to a composition comprising: i) A Cas nuclease capable of targeted cleavage of RNA, and ii) crRNA;

wherein the crRNA comprises in its sequence a) a guide sequence capable of hybridizing to the target RNA sequence, and b) a framework nucleic acid fragment that interacts with the Cas nuclease;

preferably, the leader sequence is selected from at least two or three sequences of SEQ ID NOs 1-7, which target RNAs of different proteins;

more preferably, the leader sequence is selected from two or three of SEQ ID NO 2, SEQ ID NO 4, SEQ ID NO 5.

The Cas nuclease is selected from at least one of Cas13a, cas13b, cas13c and Cas13 d.

In addition, variant forms of the above composition may further comprise: i) An mRNA encoding a Cas nuclease as defined above, and ii) a crRNA as defined above.

According to a further aspect of the invention, the invention also relates to a Cas vector system for providing a composition as described above, comprising one or more vectors comprising: a first regulatory element operably linked to a nucleotide fragment encoding the Cas nuclease and a second regulatory element operably linked to a nucleotide fragment encoding the crRNA.

The invention also relates to an isolated nucleic acid selected from at least one of SEQ ID NO 1-7.

The invention also relates to a delivery system and a pharmaceutical composition of the product.

The invention also relates to a method of altering expression of a gene product comprising cleaving a target RNA using a CRISPR-Cas nuclease system to alter expression of the gene product;

the CRISPR-Cas nuclease system comprises a composition as described above, and/or a Cas vector system as described above, and/or an isolated nucleic acid as described above, and/or a delivery system as described above, and/or a pharmaceutical composition as described above.

The invention has the beneficial effects that:

can effectively inhibit SARS-CoV-2 related protein with high inhibition rate;

the off-target effect is not obvious, and the treated cells can still normally survive and differentiate without causing obvious cytotoxicity;

these effects show that the composition, system and medicine provided by the invention can be used for treating and preventing SARS-CoV-2 related diseases, and have good application prospects.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a schematic representation of a Cas13b AAV virus design in one embodiment of the invention;

FIG. 2 is a schematic diagram of a crRNA AAV virus design according to one embodiment of the invention;

FIG. 3 shows the screening results of the target protein mRNA degradation effect of different crRNAs when transfected according to one embodiment of the present invention;

FIG. 4 is a partial structural diagram of a Cas13B and NSP5-crRNA2 construction vector in one embodiment of the invention (A) and the degradation effect of target protein mRNA (B);

FIG. 5 shows the effect of the packaged AAV virus in the expression of crRNA and Cas13b in Vero-E6 cells according to one embodiment of the present invention;

fig. 6 shows the inhibitory effect of Cas13b and fusion plasmids against different target genes crRNA in one embodiment of the present invention; A. the fusion plasmid is Cas13b-NSP5crRNA2-S crRNA8; B. the fusion plasmid is Cas13b-S crRNA8-NSP12 crRNA3; C. the fusion plasmid is Cas13b-NSP5crRNA2-NSP12 crRNA3; D. the fusion plasmid is Cas13b-NSP5crRNA2-S crRNA8-NSP12 crRNA3; control group is the corresponding Control.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

It is therefore intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present invention are disclosed in or are apparent from the following detailed description. It is to be understood by one of ordinary skill in the art that the present discussion is a description of exemplary embodiments only, and is not intended as limiting the broader aspects of the present invention.

wherein the crRNA comprises in its sequence a) a guide sequence capable of hybridizing to the target RNA sequence, and b) a framework nucleic acid fragment that interacts with the Cas nuclease.

In some embodiments, the leader sequence is selected from any one or more leader sequences listed in tables 1 to 5, preferably SEQ ID NO:1 to 7.

The composition may further comprise at least one crRNA different from the crRNA provided by the present invention.

As is apparent to one skilled in the art, the sequences shown in SEQ ID NOs: 1-7 are also within the scope of the present application. By "substantially identical nucleic acid fragment" is meant a nucleic acid fragment that is capable of hybridizing to SEQ ID NO:1 to 7, respectively, and a nucleic acid fragment to which the target sequence of each of the above-mentioned nucleic acid fragments hybridizes. Such nucleic acid fragments may be compared to SEQ ID NO:1 to 7 substitutions, additions or deletions of 1, 2, 3 or more nucleobases or base analogues [ e.g.4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5- (carboxyhydroxymethyl) uracil, 5-fluorouracil, 5-bromouracil, qnucleoside etc. ] or partial bases with certain modifications (usually such modifications are not critical for directing the hybridization of the sequence to the target nucleic acid) can be controlled in length from 18bp to 35bp, preferably above 23 bp. "stringent conditions" used in the present invention are known, and include, for example, hybridization at 65 ℃ for 12 to 16 hours in a hybridization solution containing 400mM NaCl, 40mM PIPES (pH 6.4) and 1mM EDTA, followed by washing at 65 ℃ for 15 to 60 minutes with a washing solution containing 0.1% SDS, and 0.1% SSC. This is familiar to the person skilled in the art.

In some specific embodiments, the Cas nuclease is selected from Cas13.

In some specific embodiments, the Cas nuclease is selected from at least one of Cas13a, cas13b, cas13c, and Cas13d, preferably Cas13b.

In some specific embodiments, the Cas nuclease is Cas13b, and the framework nucleic acid fragment that interacts with the Cas nuclease is now a Direct Repeat (DR). The direct repeat sequence may include one or more stem loops or preferred secondary structures. In some embodiments, the forward repeat may be short DR or long DR (dual DR). In some embodiments, the forward repeat may be modified.

In some embodiments, the direct repeat sequence is set forth in SEQ ID NO 8.

In some embodiments, the Cas nuclease comprises at least one nuclear export signal.

Since the site of replication and transcription of SARS-CoV-2 occurs mainly at the replication-transcription Complex, in some preferred embodiments, the Cas nuclease is fused to a targeting functional fragment; the localization functional fragment is used to localize the Cas nuclease to or near a replication-transformation Complex. Such localisation function fragments may be some transmembrane proteins or domains, such as the hydrophobic transmembrane domains of NSP3, NSP4, NSP6 etc.

In some embodiments, the leader sequence of the composition is selected from at least two or three sequences of SEQ ID NOs 1-7, preferably the two or three sequences are RNAs targeting different proteins.

In some embodiments, the composition leader sequence is selected from two or three of SEQ ID NO 2, SEQ ID NO 4, and SEQ ID NO 5.

When the composition comprises a plurality of leader sequences, it is preferred that each leader sequence is linked to a direct repeat sequence.

In some embodiments, the leader sequence in the composition comprises at least one of the following combinations:

SEQ ID NO, 3,5 and 7, SEQ ID NOs.

In some embodiments, the composition further comprises an accessory protein that enhances the Cas nuclease activity.

In some embodiments, the accessory protein is a csx28 protein.

In some embodiments, the composition further comprises an accessory protein that inhibits the Cas nuclease activity.

In some embodiments, the accessory protein is a csx27 protein.

The Cas nuclease may be from the same or different organism as the helper protein described above.

The present invention relates to a composition comprising: i) An mRNA encoding a Cas nuclease as defined in the above summary, and ii) a crRNA as defined in the above summary.

The present invention also relates to a Cas vector system for providing a composition as described above, comprising one or more vectors comprising: a first regulatory element operably linked to a nucleotide fragment encoding the Cas nuclease and a second regulatory element operably linked to a nucleotide fragment encoding the crRNA.

When the composition comprises a plurality of leader sequences, the different leader sequences may be linked in tandem on the same vector or located separately on different vectors.

The Cas nuclease may be on the same or different vector as the crRNA.

In some embodiments, the vector system comprises one or more of the following fusion plasmids:

a. a fusion plasmid with a nucleotide fragment of Cas nuclease, a guide sequence as shown in SEQ ID NO 2 and 4;

b. a fusion plasmid with a nucleotide fragment of Cas nuclease, a guide sequence as shown in

SEQ ID NO

2 and 5;

c. a fusion plasmid with a nucleotide fragment of Cas nuclease, a guide sequence as shown in SEQ ID NO 4 and 5;

d. a nucleotide fragment with Cas nuclease, and fusion plasmids of guide sequences shown in

SEQ ID NO

2, 4 and 5.

The term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector is capable of expressing a protein encoded by an inserted polynucleotide, the vector is referred to as an expression vector. The vector may be introduced into a host cell by transformation, transduction, or transfection, and the genetic material elements carried thereby are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: a plasmid; phagemid; a cosmid; artificial chromosomes such as Yeast Artificial Chromosomes (YACs), bacterial Artificial Chromosomes (BACs), or artificial chromosomes of P1 origin (PACs); bacteriophage such as lambda phage or M13 phage, animal virus, etc. Animal viruses that may be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papilloma viruses, papilloma polyoma vacuolatum viruses (e.g., SV 40).

In some embodiments, regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals, or polyadenylation signals and poly-U sequences, etc.) are included in the vectors of the present invention.

In some embodiments, the vector, transcript of the present invention may further comprise a gene used for screening (e.g., an antibiotic resistance gene), a nucleic acid for producing a fluorescent protein, or other fragments. The fluorescent protein can be selected from green fluorescent protein, blue fluorescent protein, yellow fluorescent protein, orange fluorescent protein or red fluorescent protein. The green fluorescent protein can adopt common GFP, and can also adopt modified GFP genes, such as enhanced GFP gene EGFP and the like; the blue fluorescent protein can be selected from EBFP, azuritc, tagBFP and the like; the yellow fluorescent protein can be selected from EYFP, ypct, phiYFP, etc.; the orange fluorescent protein can be selected from mKO, mOrange, mBanana and the like; the red fluorescent protein can be selected from TagRFP, mRuby, mCherry, mKatc.

In some preferred embodiments, the system is packaged in a single or multiple adeno-associated virus particles.

The invention verifies the adeno-associated virus vector, can effectively package a CRISPR/Cas system, and has good safety.

In some embodiments, the nucleotide fragment encoding the Cas nuclease is codon optimized for expression in a eukaryotic cell.

In some embodiments, wherein the nucleotide fragment encoding the Cas nuclease is codon optimized for expression in a human cell.

Codon optimization can be manipulated according to the codon preference of the host, which is easy for those skilled in the art.

The promoters used in the present invention allow expression in a wide variety of cell and tissue types; or may be a cell-free specific promoter, or may be a "cell-specific", "cell type-specific", "cell lineage-specific" or "tissue-specific" promoter, which allows expression in a limited variety of cell and tissue types, respectively. Preferred promoters are capable of high expression in human cells, particularly cells of respiratory origin.

In some embodiments, the first regulatory element has a CAG or other eukaryotic promoter.

In some specific embodiments, the second regulatory element has a U6 promoter.

The invention also relates to a cell comprising a composition as described above and/or a Cas vector system as described above.

In some embodiments, the cell is a eukaryotic cell.

In some embodiments, the cell is a mammalian cell.

In some embodiments, the cells include, without limitation, cattle, horses, dairy cows, pigs, sheep, goats, rats, mice, dogs, cats, rabbits, camels, donkeys, deer, mink, chickens, ducks, geese, turkeys, bangs, and the like.

In some embodiments, the cell is a primate cell.

In some embodiments, the cell is a human cell. For certain countries, it may be necessary to specifically exclude certain topics from this aspect, such as human totipotent stem cells, fertilized eggs fertilized for more than 14 days, and the like.

Such cells are preferably cells of respiratory origin.

In the present invention, the term "respiratory tract" may include the following three parts:

upper respiratory tract: nose, nasal passages, sinuses, larynx and pharynx.

The trachea: laryngeal prominences, trachea, bronchi, and secondary bronchi.

Lung: bronchioles, alveolar ducts and alveoli.

The invention also relates to an isolated nucleic acid selected from at least one of SEQ ID NOs 1 to 7.

According to yet another aspect of the invention, the invention also relates to a delivery system comprising a) a composition as described above and/or a Cas vector system as described above, and b) a delivery vehicle.

In some embodiments, the delivery vehicle comprises one or more liposomes, one or more exosomes, one or more microvesicles, a gene gun, or one or more viral vectors.

According to a further aspect of the invention, the invention also relates to a pharmaceutical composition comprising a delivery system as described above and a pharmaceutically acceptable carrier.

The gene product is preferably SARS-CoV-2 related protein.

In some embodiments, the method is performed in vitro.

In some embodiments, the method does not comprise diagnostic purposes.

In some embodiments, the method does not comprise a therapeutic purpose.

The product provided by the invention can be used for inhibiting the amplification of SARS-CoV-2, and further can be used for treating/preventing related diseases caused by SARS-CoV-2.

Thus, in particular, the present invention also relates to a method for the treatment/prevention of SARS-CoV-2 infection, or new coronavirus disease (COVID-19), in a subject in need thereof, said method comprising:

administering to the subject a therapeutically effective amount of the composition, the delivery system, or the pharmaceutical composition.

The term "effective amount" as used herein refers to an amount of a component to which the term corresponds that achieves treatment, prevention, alleviation and/or amelioration of a disease or disorder described herein in a subject.

In the present invention, the subject may be a mammal, preferably a human.

Embodiments of the present invention will be described in detail with reference to examples.

Examples

1. Design and construction of vectors

The first step of the present invention is to clone the sequence of the most important gene of the new coronavirus into a heterologous expression vector as a tool for screening crRNA. These genes include N-protein, S-protein, NSP3,5, 12 for a total of 5 genes, where N-protein is the most important protein for virus capsid formation, aiding in viral genome packaging; the S-protein is responsible for binding to the cellular receptor ACE2, thereby infecting the cell; NSP3 is papain-like protease, and is responsible for processing and maturation of peptide segment in protein translation process; NSP5 is chymotrypsin-like protease, and is also responsible for processing and maturation of peptide fragments; NSP12 is an RNA-dependent RNA polymerase. These 5 genes are important in the life cycle of the virus. Of course, it is worth mentioning that NSP3,5, 12 are in the form of PP1ab in a transcript during the viral life, and theoretically degrading any one site may cause degradation of that transcript; whereas the N and S proteins are separate and independent transcripts. The invention adopts an in vitro cloning mode to construct each protein gene on a plasmid with mCherry (K202 ssaVAV.CAG.mCH erry.WPREs.SV40pA, packGene company) so as to evaluate the degradation efficiency of crRNA by using the fluorescence intensity of mCherry; in addition, we can also use fluorescence quantitative PCR to observe the cleavage efficiency of Cas13 and crRNA.

CRISPR-Cas13 can be divided into four subtypes (a, B, C, and D) according to phylogeny, and Cas13B has multiple Space regions, can specifically degrade endogenous transcripts in mammalian cells, and has a lower off-target effect than other subtypes. Cas13b is 3270bp in length, CAG promoter is 812bp, transcription enhancing element WRPE and transcription termination signal SV40pA are 429bp in length, and the total length is 4511bp which is smaller than the maximum DNA length (4.7 kb) of AAV virus package. During the construction of the vector, cas13b is subcloned, and is inserted into the K2 vector after being recovered by EcoRI/HindIII endonuclease enzyme digestion glue, and is successfully packaged into AAV. Cas13b AAV virus design is shown in figure 1.

The virus packaging method comprises the following steps:

1) And (3) plasmid amplification:

the constructed AAV expression vector, AAVDJ cap packaging plasmid and a large amount of extract after removing endotoxin, the concentration is more than 1ug/ul, A260/280 is between 1.7 and 1.8, and the virus can be encapsulated.

2) Packaging AAV virus:

HEK293T cells with confluence above 90% were treated according to 1:3 ratio passage, changing DMEM medium containing 10% FBS into serum-free medium 1-2h before transfection, transferring target gene plasmid, cap plasmid and pHelper plasmid into HEK293T cell with transfection reagent, changing fresh medium 24h after transfection, and collecting virus liquid 72h after transfection.

3) Concentrating and purifying viruses:

purifying the virus mixed solution by using a iodixanol density gradient centrifugation method, and then concentrating by using an ultrafiltration tube;

4) Virus titer test (qPCR):

treating a certain amount of AAVDJ virus with proteinase K to remove AAV virus coat, incubating at 37 deg.C for 30min, and heating at 95 deg.C for 5min to inactivate enzyme; then centrifuging at 12000rpm for 2min; collecting the supernatant; preparing a standard substance; configuring a PCR reaction system, and detecting the titer (GC/ml) of AAV by using a SYBR Green qPCR method;

5) And (3) virus preservation: after virus liquid is received, AAV is used for experiment in a short time, and the virus can be temporarily stored at 4 ℃; if long-term storage is required, the sample is placed at-80 ℃.

Design and screening of crRNA

In the CRISPR/Cas13b system, crrnas play a role in recruiting Cas13b protein and targeting target genes for 5 viral gene sequences, we designed 28 crrnas in total, and also included a control of crRNA with disrupted sequence for each gene (as shown in fig. 2), and expressed with U6 promoter, and embedded GFP tag on the vector (PackGene company), and when the vector entered into cells, the crRNA was expressed and GFP was also expressed, and GFP could be used as an indicator tag of the expression efficiency of crRNA. The 5' end of the crRNA comprises a DR sequence (5 ' GTTGTGGAAGGTCCAGTTTTGAGGGCTATTACAA C-3', SEQ ID NO: 8) which can promote the binding of the crRNA and the Cas13b so as to complete the effective cutting of the target. In the construction process, a frame vector M6 scAAV.CAG.maxGFP.U6 (Sp) sgRNA (PackGene company) is used, a Gibson assembly method is used for amplification, a target fragment is inserted, and ligation transformation is carried out by using an Exnase Multis ligase. The size of the co-insert fragment of the vector is 2068bp (as shown in FIG. 2), which is smaller than the maximum DNA length of AAV virus package.

TABLE 1S proteins

TABLE 2N proteins

TABLE 3 Nsp5

TABLE 4 Nsp3

TABLE 5 Nsp12

3. In vitro screening I

By taking HEK293T as a cell model, 1ng and 0.02ng 2 concentrations of five target plasmids of N, S, NSP3, NSP5 and NSP12 are respectively set; three plasmids, cas13b (0.6 ug), crRNA (0.9 ug) and the target plasmid, were then co-transfected into 293T cells by PEI (polyethyleneimine). The specific scheme is as follows:

1) Culturing HEK293T cells in a 10cm cell culture dish, and paving the cells in a 12-well plate according to a ratio of 1; 2) And carrying out cell transfection when the cell density reaches 60-85%. Sequentially adding three plasmids of Cas13b, a target gene (with mCherry fluorescence) and crRNA and PEI into an Opti-M culture medium, fully mixing uniformly, incubating at room temperature for 15min, and adding the mixture into a 12-hole plate;

3) At 37 ℃ C. And 5% CO ₂ After continuously culturing for 12-16h under the condition (1), replacing the culture medium; continuously culturing for 24-36h, observing under a fluorescence microscope and collecting data;

4) And then extracting total RNA by using a Trizol method, performing reverse transcription on the total RNA to form cDNA, and detecting the mRNA level of the target protein by using an RT-qPCR experiment.

Wherein the cell culture medium is 10% FBS +90% DMEM (high sugar); cell transfection reagent formula: PEI (ug): total plasmid (ug) = 3-4

The screening results are shown in FIG. 3, and the RT-qPCR technology is used to find that under the condition of transfecting target plasmids of 1ng and 0.02 ng: the crRNA-1, crRNA-2 and crRNA-3 of NSP5 show obvious inhibition effects (the inhibition efficiency of the crRNA-1, crRNA-2 and crRNA-3 at 1ng and 0.02ng of the target plasmid is respectively 11% and 16%, 4% and 7%, 8% and 11%); the crRNA-3 and crRNA-4 of NSP12 show obvious inhibition effects (the inhibition efficiency of the crRNA-3 and the crRNA-4 is respectively 26 percent and 20 percent, 32 percent and 9 percent when the target plasmids are 1ng and 0.02 ng); the crRNA7 and the crRNA8 of the S protein show obvious inhibition effects (the inhibition efficiency of the crRNA-7 and the crRNA-8 is 49 percent and 63 percent, 30 percent and 23 percent respectively at 1ng and 0.02ng of target plasmids); in addition, the data of 1ng and 0.02ng of the target plasmid shows that crRNA1, crRNA2, crRNA3, crRNA4 and crRNA6 of the S protein have no significant inhibitory effect on the S protein compared with the control, indicating that they are not suitable as guide RNA for inhibiting SARS-CoV-2.

4. In vitro screening II

Cas13B and NSP5-crRNA2 are constructed on one vector (shown as A in figure 4), and are co-transfected into HEK293T cells together with a target plasmid to detect the degradation effect on target protein mRNA (shown as B in figure 4), and figure 4 shows that the expression of NSP5 protein in the cells is obviously inhibited after the vector containing Cas13B and NSP5-crRNA2 is transfected.

We packaged the crRNA with obvious degradation effect (Nsp 5-crRNA1/crRNA2, nsp12-crRNA3/crRNA4, S-crRNA7/crRNA 8) into AAV virus, and demonstrated that it has better infection effect in Vero-E6 (as shown in FIG. 5).

5. In vitro screening III

We also constructed Cas13B and fusion plasmids for different target genes crRNA (Cas 13B-NSP5crRNA2-S crRNA8, cas13B-S crRNA8-NSP12 crRNA3, cas13B-NSP5crRNA2-S crRNA8-NSP12 crRNA 3), and verified the inhibition effect on the target genes, fig. 6 a shows that the fusion plasmid transfected Cas13B-NSP5crRNA2-S crRNA8 can inhibit the levels of cell NSP5 and S protein mRMA, fig. 6B shows that the fusion plasmid transfected Cas13B-ScrRNA8-NSP12 crRNA3 can inhibit the levels of cell S protein and NSP5 mRNA, fig. 6C shows that the fusion plasmid transfected Cas13B-NSP5crRNA2-NSP12 can inhibit the levels of cell NSP5 and NSP12crRNA, and the expression of the target genes crRNA 90-crRNA.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is specific and detailed, but not to be understood as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> biosamping laboratory

Guangzhou Institute of biomedicine and health, Chinese Academy of Sciences

<120> composition and carrier system for inhibiting SARS-CoV-2

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> artificial sequence

<400> 1

agaaagtact actactctgt atggttggta 30

<210> 2

<211> 30

<212> DNA

<213> artificial sequence

<400> 2

ttggcaatca atttttggtt ctcatagaga 30

<210> 3

<211> 30

<212> DNA

<213> artificial sequence

<400> 3

gttaaaacca acactaccac atgaaccatt 30

<210> 4

<211> 30

<212> DNA

<213> artificial sequence

<400> 4

gtacttcata gccacaaggt taaagtcatt 30

<210> 5

<211> 30

<212> DNA

<213> artificial sequence

<400> 5

gacatcagca tactcctgat taggatgttt 30

<210> 6

<211> 30

<212> DNA

<213> artificial sequence

<400> 6

gaggtccttt agtaaggtca gtctcagtcc 30

<210> 7

<211> 30

<212> DNA

<213> artificial sequence

<400> 7

gtttgagcag aaagaggtcc tagtatgtca 30

<210> 8

<211> 36

<212> DNA

<213> artificial sequence

<400> 8

gttgtggaag gtccagtttt gaggggctat tacaac 36

Claims

1. A composition for inhibiting SARS-CoV-2, comprising: i) A Cas13b nuclease capable of targeted cleavage of RNA, and ii) crRNA;

wherein the sequence of the crRNA comprises a) one or two of guide sequences shown as SEQ ID NO 2, 4 and 5, which can be hybridized to a target RNA sequence, and b) a nucleic acid fragment shown as SEQ ID NO 8 in a framework interacting with the Cas nuclease.

2. A composition for inhibiting SARS-CoV-2, comprising: i) An mRNA encoding a Cas13b nuclease as defined in claim 1, and ii) a crRNA as defined in claim 1.

3. A Cas vector system for providing a composition as claimed in any one of claims 1 to 2, comprising one or more vectors comprising: a first regulatory element operably linked to a nucleotide fragment encoding the Cas nuclease and a second regulatory element operably linked to a nucleotide fragment encoding the crRNA.

4. A Cas vector system as claimed in claim 3, packaged in a single or multiple adeno-associated virus particles.

5. A Cas vector system as claimed in claim 4, wherein the nucleotide fragment encoding the Cas nuclease is codon optimized for expression in eukaryotic cells.

6. The Cas vector system of claim 5, wherein the nucleotide fragment encoding the Cas nuclease is codon optimized for expression in human cells.

7. A cell comprising a composition of any one of claims 1-2 and/or a Cas vector system of any one of claims 3-6.

8. A delivery system comprising a) a composition according to any one of claims 1 to 2 and/or a Cas vector system according to any one of claims 3 to 6, and b) a delivery vehicle.

9. The delivery system of claim 8, the delivery vehicle comprising one or more viral vectors.

10. A pharmaceutical composition for inhibiting SARS-CoV-2 comprising the delivery system of claim 9 and a pharmaceutically acceptable carrier.