CN113493835A

CN113493835A - Method and kit for screening large intestine tumor by detecting methylation state of BCAN gene region

Info

Publication number: CN113493835A
Application number: CN202010761076.1A
Authority: CN
Inventors: 刘蕊; 王辉
Original assignee: Shanghai Wuyuan Health Technology Co ltd
Current assignee: Shanghai Wuyuan Health Technology Co ltd
Priority date: 2020-03-20
Filing date: 2020-07-31
Publication date: 2021-10-12

Abstract

The present application discloses a method and kit for diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to formation, or monitoring large intestine tumor progression or prognosis in an individual. In particular, the present application diagnoses large intestine tumors, screens for a predisposition to or a predisposition to develop large intestine tumors, or monitors the progression or prognosis of large intestine tumors by detecting the methylation status of the BCAN gene region in a biological sample.

Description

Method and kit for screening large intestine tumor by detecting methylation state of BCAN gene region

Technical Field

The application relates to the field of tumor screening, in particular to a method and a kit for screening large intestine tumor by detecting methylation state of target genes in biological samples.

Background

Colorectal cancer is the third common malignant tumor in the world and is also a common malignant tumor in China. Colorectal cancer is classified into stages I-IV according to the stage of development of the disease. For stage IV colorectal cancer patients, overall survival is very low, with a 5-year survival rate of less than 10%. While the survival rate of the patients in the stage I can reach more than 90 percent. Therefore, early diagnosis and treatment are important to improve the overall prognosis of intestinal cancer.

At present, the screening technology of colorectal cancer in China mainly comprises fecal occult blood test, tumor marker detection and enteroscopy. While colonoscopy remains the fundamental method for the definitive diagnosis of intestinal cancer, its high cost, poor compliance and possible traumatism make it difficult to apply colonoscopy on a large scale for screening of asymptomatic populations. While readily acceptable for fecal occult blood tests and detection of tumor markers (e.g., peripheral blood carcinoembryonic antigen), their poor sensitivity and specificity also present challenges to early diagnosis and treatment of intestinal cancer.

In recent years, it has been discovered that epigenetic and genetic alterations in intestinal epithelial cells may contribute to the diagnosis of colorectal cancer. Currently, Septin9 gene methylation has possessed some commercial kits. Kits for the combined detection of methylation of BMP3 and NDRG4 genes and mutations in KRAS and β -actin genes are also available in the United states. However, some existing kits have a problem that the detection efficiency of colorectal cancer needs to be further improved. Researchers are also searching for other detected genes, but the obtained tumor diagnosis sensitivity and specificity are greatly different, and the use requirements of large-scale screening are difficult to achieve.

There is therefore a need for a method and kit for screening for colorectal tumours that has improved sensitivity and specificity.

Brief description of the invention

In one aspect, the present application provides a method of diagnosing a colorectal neoplasm, screening for a predisposition to develop or monitoring the progression or prognosis of a colorectal neoplasm in an individual, the method comprising detecting the methylation state of a BCAN gene region in a biological sample from the individual, and comparing the detected methylation state of the BCAN gene region to a normal methylation state of the BCAN gene region, wherein a detected change in the methylation state of the BCAN gene region in the biological sample from the individual relative to the normal methylation state of the BCAN gene region is indicative of the individual having a colorectal neoplasm, or the individual having a predisposition to develop or develop, or the individual having a predisposition to poor prognosis or prognosis of a colorectal neoplasm.

In some embodiments, a higher methylation state of the BCAN gene region detected in the biological sample from the individual relative to the normal methylation state of the BCAN gene region is indicative of the individual having a large intestine tumor, or the individual having a predisposition to form or develop a large intestine tumor, or the individual having a predisposition to develop or develop a large intestine tumor, or the individual having a predisposition to poor prognosis or poor prognosis of a large intestine tumor.

In another aspect, the present application provides a method of monitoring an individual's response to treatment for a colorectal tumor, the method comprising detecting the methylation state of a region of a BCAN gene in a biological sample from the individual before and after the individual receives treatment for a colorectal tumor, respectively, wherein a change in the methylation state of the region of the BCAN gene after the individual receives treatment for a colorectal tumor relative to the methylation state of the region of the BCAN gene before receiving treatment for a colorectal tumor is indicative of the individual's response to treatment for a colorectal tumor.

In some embodiments, a lower methylation state of the BCAN gene region of the individual after receiving treatment for a colorectal tumor relative to the methylation state of the BCAN gene region prior to receiving treatment for a colorectal tumor is indicative of the individual responding to treatment for a colorectal tumor.

In some embodiments, the BCAN gene region comprises: a) hg19 coordinates chr1:156611182-156629324 and its upstream 5kb and downstream 5kb limited regions; or b) the corresponding regions listed under a) above after bisulfite conversion; or c) the corresponding region of the region listed under a) above after treatment with a Methylation Sensitive Restriction Enzyme (MSRE).

In some embodiments, the BCAN gene region is selected from the group consisting of: a) hg19 coordinates chr1:156611182-156629324 and its upstream 5kb and downstream 5kb limited regions; or b) the corresponding regions listed under a) above after bisulfite conversion; or c) the corresponding region of the region listed under a) above after treatment with a Methylation Sensitive Restriction Enzyme (MSRE).

In some embodiments, said detecting the methylation state of the BCAN gene region comprises determining the methylation state of cytosine residues in one or more CpG sites of the BCAN gene region in a biological sample from said individual. In some embodiments, the methylation state of the BCAN gene region comprises the methylation state of a target DNA region comprising a sequence with Hg19 coordinates selected from the group consisting of: chr1:156611399-156612667, chr1:156616348-156617162, chr1:156626037-156630544 and chr1:156611866-156611966, and 200bp upstream and 200bp downstream of the regions, and any combination thereof.

In some embodiments, the biological sample is selected from the group consisting of a histological section, a tissue biopsy, a paraffin-embedded tissue, a surgically excised specimen, an isolated cell, a bodily fluid, a colonic effluent, and any combination thereof. In some embodiments, the body fluid is selected from the group consisting of: whole blood, serum, plasma, urine, saliva, mucus, peritoneal fluid, pleural effusion, synovial fluid, cerebrospinal fluid, pleural effusion, peritoneal effusion, and any combination thereof. In some embodiments, the colonic effluent is selected from stool and enema wash samples.

In some embodiments, prior to detecting the methylation state of the BCAN gene region in the biological sample from the individual, further comprising the steps of:

(a) obtaining a biological sample containing DNA from the individual;

(b) treating the DNA in said biological sample obtained in step (a) with a reagent capable of distinguishing between methylated and unmethylated CpG sites in said DNA, thereby obtaining treated DNA.

In some embodiments, the DNA comprises genomic DNA or extracellular free DNA. In some embodiments, the extracellular free DNA comprises circulating tumor DNA.

In some embodiments, the reagent in step (b) is a bisulfite reagent or a Methylation Sensitive Restriction Enzyme (MSRE). In some embodiments, the bisulfite reagent is selected from the group consisting of: ammonium bisulfite, sodium bisulfite, potassium bisulfite, calcium bisulfite, magnesium bisulfite, aluminum bisulfite, bisulfite ions, and any combination thereof. In some embodiments, the MSRE is selected from the group consisting of: HpaII enzyme, SalI enzyme,

Enzymes, ScrFI enzymes, Bbei enzymes, NotI enzymes, SmaI enzymes, XmaI enzymes, MboI enzymes, BstBI enzymes, ClaI enzymes, MluI enzymes, NaeI enzymes, NarI enzymes, PvuI enzymes, SacII enzymes, HhaI enzymes, and any combination thereof.

In some embodiments, the detecting uses an amplification-based method, a hybridization-based method, a sequencing-based method, or a restriction enzyme cleavage-based method.

In some embodiments, said detecting the methylation state of the BCAN gene region comprises amplifying said treated DNA using an amplification enzyme and one or more sets of primers to produce at least one amplification product or said treated DNA is not amplified, optionally said treated DNA comprises the nucleotide sequence set forth in SEQ ID NOs:4-9, 11-12, and any combination thereof, or a nucleotide sequence selected from the group consisting of SEQ ID NOs:4-9, 11-12. In some embodiments, the amplification enzyme comprises a thermostable DNA polymerase or a polymerase lacking 5 '-3' exonuclease activity.

In some embodiments, the amplification is performed in the presence of a detection reagent or a blocking reagent. In some embodiments, the detection reagent comprises an oligonucleotide probe labeled with a detectable label, and/or the blocking reagent comprises a blocking oligonucleotide that is not extendable by a polymerase. In some embodiments, the oligonucleotide probe comprises a sequence that is capable of hybridizing to the amplification product, and/or the blocking oligonucleotide comprises a sequence that is capable of hybridizing to the amplification product in a methylation specific manner.

In some embodiments, the primer is a methylation specific primer. In some embodiments, the primer comprises a sequence that is substantially complementary or substantially identical to a sequence of at least 9 consecutive nucleotides corresponding to a sequence of a region of a BCAN gene in the treated DNA, wherein the consecutive nucleotides comprise at least one CpG, TpG, or CpA dinucleotide, or wherein the amplification product comprises at least one CpG, TpG, or CpA dinucleotide. In some embodiments, the primer comprises a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-12. In some embodiments, the primer is selected from the group consisting of:

GGGAAGAAAGGGGGTTTTGT(SEQ ID NO:13)	BCAN upstream primer sequence
		TACGACGAAAACTACGCGAA(SEQ ID NO:14)	BCAN downstream primer sequence

And/or, the oligonucleotide probe is selected from the group consisting of:

CGTCGGGAGGGTCGG(SEQ ID NO:15)

BCAN probe sequence

In some embodiments, the methylation state of the BCAN gene region is determined based on the presence and nature of the amplification product. In some embodiments, the detecting or determining the methylation state of the BCAN gene region comprises using polymerase chain reaction (e.g., real-time polymerase chain reaction, digital polymerase chain reaction), nucleic acid sequencing, mass-based separation (e.g., electrophoresis, mass spectrometry), or target capture (e.g., microarray). In some embodiments, the determining comprises sequencing the amplification product.

In some embodiments, the normal methylation state of the BCAN gene region represents the methylation state of the BCAN gene region in an individual from whom no colorectal neoplasm has developed or is predisposed to develop, or from whom a prognosis for a good or favorable prognosis for a colorectal neoplasm has developed.

In some embodiments, the large intestine tumor is a colorectal tumor. In some embodiments, the colorectal neoplasm is colorectal cancer, colorectal adenoma, or sessile serrated polyps. In some embodiments, the colon tumor is precancerous.

In some embodiments, the individual is a human.

In another aspect, the present application provides an oligonucleotide comprising or consisting of at least 9 consecutive nucleotides of a BCAN gene region or its complement, for use as a detection tool.

In another aspect, the present application provides an oligonucleotide for use as a detection tool comprising or consisting of at least 9 contiguous nucleotides of a treated DNA sequence of a BCAN gene region, or a complement thereof, said treatment being adapted to convert at least one unmethylated cytosine residue in the BCAN gene region to a uracil residue, a thymine residue, or another residue detectably different from cytosine in hybridization.

In another aspect, the present application provides a kit for diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to formation, or monitoring large intestine tumor progression or prognosis, comprising a first reagent comprising one or more oligonucleotides as described herein. In some embodiments, the oligonucleotide comprises a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-12. In some embodiments, the oligonucleotide is selected from the group consisting of:

GGGAAGAAAGGGGGTTTTGT(SEQ ID NO:13)	BCAN upstream primer sequence
		TACGACGAAAACTACGCGAA(SEQ ID NO:14)	BCAN downstream primer sequence
CGTCGGGAGGGTCGG(SEQ ID NO:15)	BCAN probe sequence

In some embodiments, the kits described herein further comprise a second agent capable of distinguishing between methylated and unmethylated CpG sites in DNA. In some embodiments, the second reagent is a bisulfite reagent or a Methylation Sensitive Restriction Enzyme (MSRE). In some embodiments, the bisulfite reagent is selected from the group consisting of: ammonium bisulfite, sodium bisulfite, potassium bisulfite, calcium bisulfite, magnesium bisulfite, aluminum bisulfite, bisulfite ions, and any combination thereof. In some embodiments, the MSRE is selected from the group consisting of: HpaII enzyme, SalI enzyme,

Enzymes, ScrFI enzymes, Bbei enzymes, NotI enzymes,SmaI enzyme, XmaI enzyme, MboI enzyme, BstBI enzyme, ClaI enzyme, MluI enzyme, NaeI enzyme, NarI enzyme, PvuI enzyme, SacII enzyme, HhaI enzyme, and any combination thereof.

In some embodiments, the first and second reagents are packaged in a single container or separately packaged in separate containers. In some embodiments, the kits described herein further comprise a container suitable for holding a biological sample from the individual. In some embodiments, the kits described herein further comprise instructions for use and/or interpretation of the results of the test of the kit.

In another aspect, the application provides the use of a reagent for detecting the methylation state of a BCAN gene region in the manufacture of a kit for use in a method of diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to develop, or monitoring large intestine tumor progression or prognosis in an individual, wherein the method comprises detecting the methylation status of a BCAN gene region in a biological sample from the individual, and comparing the detected methylation state of the BCAN gene region with a normal methylation state of the BCAN gene region, wherein an alteration in the methylation state of the BCAN gene region detected in the biological sample from the individual relative to the normal methylation state of the BCAN gene region is indicative of the individual having a large intestine tumor, or the individual has a predisposition to form or develop a colon tumor, or the individual has a predisposition to develop or develop a colon tumor, or the individual has a predisposition to a poor prognosis or a poor prognosis of a colon tumor.

In another aspect, the present application provides use of an agent for detecting the methylation state of a BCAN gene region in the manufacture of a kit for use in a method of monitoring the response of an individual to treatment of a colorectal tumor in the individual, wherein the method comprises detecting the methylation state of a BCAN gene region in a biological sample from the individual, wherein an alteration in the methylation state of the BCAN gene region of the individual after treatment for a colorectal tumor relative to the methylation state of the BCAN gene region prior to treatment for a colorectal tumor is indicative of the individual responding to treatment for a colorectal tumor.

In some embodiments, the agent for detecting the methylation state of a region of a BCAN gene comprises one or more sets of oligonucleotides comprising a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-12. In some embodiments, the oligonucleotide is selected from the group consisting of: 13, 14 and 15 SEQ ID NOs.

In another aspect, the application provides the use of at least one reagent that distinguishes between methylated and unmethylated CpG sites of a target DNA region in the manufacture of a kit for use in a method of diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to form, or monitoring large intestine tumor progression or prognosis in an individual, wherein the method comprises contacting DNA isolated from a biological sample of the individual with the at least one reagent and one or more oligonucleotides that hybridize under stringent, moderately stringent, or highly stringent conditions to the target DNA region, wherein the target DNA region comprises at least 9 contiguous nucleotides of a BCAN gene region or its complement, wherein the contiguous nucleotides comprise at least one CpG site.

In another aspect, the application provides use of at least one agent that distinguishes between methylated and unmethylated CpG sites of a target DNA region in the preparation of a kit for use in a method of monitoring the response of an individual to a treatment for a large intestine tumor in the individual, wherein the method comprises contacting DNA isolated from a biological sample of the individual with the at least one agent and one or more oligonucleotides that hybridize under stringent, moderately stringent, or highly stringent conditions to the target DNA region, wherein the target DNA region comprises at least 9 contiguous nucleotides of a BCAN gene region or a complement thereof, wherein the contiguous nucleotides comprise at least one CpG site. In some embodiments, the reagent is a bisulfite reagent or a Methylation Sensitive Restriction Enzyme (MSRE).

In some embodiments, the kits described herein comprise (a) a bisulfite reagent; (b) one or more sets of primers comprising a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence of a region of the BCAN gene in bisulfite-treated DNA.

In another aspect, the present application provides a kit suitable for performing the methods described herein, comprising (a) a methylation sensitive restriction enzyme; (b) one or more sets of primers comprising a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence of a region of the BCAN gene in DNA treated with a methylation sensitive restriction enzyme. In some embodiments, the kit further comprises a DNA polymerase, optionally a thermostable DNA polymerase or a polymerase lacking 5 '-3' exonuclease activity.

In another aspect, the present application provides a method of diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to formation, or monitoring large intestine tumor progression or prognosis in an individual, comprising:

(a) obtaining a biological sample containing DNA from the individual;

(b) treating the DNA in the biological sample obtained in step (a) with a reagent capable of distinguishing between methylated CpG sites and unmethylated CpG sites in the DNA, thereby obtaining treated DNA;

(c) contacting the treated DNA of step (b) with an amplification enzyme and one or more sets of primers suitable for amplifying a target DNA region comprising at least 9 contiguous nucleotides of a BCAN gene region or its complement, wherein the contiguous nucleotides comprise at least one CpG site;

(d) determining the methylation state of the target DNA region based on the presence or absence and nature of the amplification product;

(e) comparing the methylation state of the target DNA region determined in step (d) with the normal methylation state of the target DNA region,

wherein an alteration in the methylation state of the DNA region of interest as determined in step (d) relative to the normal methylation state of the DNA region of interest is indicative of the individual having a large intestine tumour, or the individual having a predisposition to the formation or predisposition to the formation of a large intestine tumour, or the individual having a predisposition to the development or predisposition to the development of a large intestine tumour, or the individual having a predisposition to a poor prognosis or poor prognosis of a large intestine tumour.

In some embodiments, a higher methylation state of the DNA region of interest as determined in step (d) relative to the normal methylation state of the DNA region of interest is indicative of the individual having a colorectal neoplasm, or the individual being predisposed to the formation or predisposition to the formation of a colorectal neoplasm, or the individual being predisposed to the development or predisposition to the development of a colorectal neoplasm, or the individual being predisposed to having a poor prognosis or predisposition to a poor prognosis of a colorectal neoplasm.

In another aspect, the present application provides a kit suitable for performing the methods described herein, comprising:

(a) a bisulfite reagent;

(b) a container adapted to contain the reagent and a biological sample from the individual;

(c) one or more sets of primers comprising a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence of a region of the BCAN gene in bisulfite-treated DNA; and optionally also (c) a second set of one or more of,

(d) instructions for use and/or interpretation of the results of the test kit.

(a) a methylation sensitive restriction enzyme reagent;

(c) one or more sets of primers comprising a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence of a region of the BCAN gene in the DNA treated with a methylation sensitive restriction enzyme; and optionally also (c) a second set of one or more of,

(d) instructions for use and/or interpretation of the results of the test kit.

Drawings

FIG. 1 shows validation of methylation specific primers for the target DNA region (FIG. 1A) and the reference gene ACTB (FIG. 1B) within the BCAN gene region. The ordinate represents the value Δ Rn, which is obtained by subtracting the baseline value of the fluorescence intensity from the value of the fluorescence intensity detected at a specific number of cycles. The abscissa indicates the number of cycles. As shown in fig. 1A, the Ct value decreases with increasing percentage of converted methylated DNA in the DNA mixture, indicating that the primers used to amplify the target of the BCAN gene region are methylation specific. As shown in fig. 1B, the curves for each DNA mixture coincide, indicating that the Ct values remain unchanged despite the increased percentage of converted methylated DNA in the DNA mixture, which is also consistent with the fact that the primers used to amplify the reference gene ACTB are non-methylation specific primers.

FIG. 2A shows a comparison of methylation abundance of target targets of BCAN gene region in blood cells and different tissue samples (paracarcinoma tissue, high-grade adenoma tissue, colorectal cancer tissue). Using the reference gene ACTB as a control, fig. 2B shows a comparison of methylation abundance of the reference gene ACTB in blood cells and different tissue samples (paracarcinoma tissue, high-grade adenoma tissue, colorectal cancer tissue). The ordinate represents the Ct value and the abscissa represents various samples (blood cells, paracarcinoma tissue, high-grade adenoma tissue, colorectal cancer tissue). The Ct value is inversely related to the methylation abundance, i.e., the higher the Ct value, the lower the methylation abundance. Thus, as can be seen from fig. 2A, the methylation abundance of the BCAN gene region in blood cells is much lower than that of tissue samples, and lower than that of high-grade adenoma and colorectal cancer tissues in paracarcinoma tissues, and has the potential for blood screening.

Fig. 3 shows a comparison of methylation abundance of target sites of the BCAN gene region in plasma samples of enteroscope-negative individuals and plasma samples of colorectal cancer individuals, with the ordinate representing the Ct value and the abscissa representing plasma samples of enteroscope-negative individuals and plasma samples of colorectal cancer individuals. The Ct value correlates inversely with the methylation level, i.e. the lower the Ct value, the higher the methylation level. As can be seen from fig. 3, the methylation level of the BCAN gene region in the plasma sample of the colorectal cancer individual was significantly higher than that of the BCAN gene region in the plasma sample of the enteroscope-negative individual.

Fig. 4 shows the sequences of exemplary target DNA regions within the BCAN gene region, primer sequences, and probe sequences.

Detailed Description

While various aspects and embodiments of the present application have been disclosed, those skilled in the art may make various equivalent changes or modifications without departing from the spirit and scope of the present application. The various aspects and embodiments disclosed herein are exemplary and are not intended to limit the scope of the present application, which is to be determined by the claims appended hereto. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All references, patents, and patent applications cited in this application are hereby incorporated by reference.

1.Basic terms

Throughout the description and claims of this application, unless otherwise indicated, the terms "comprises" and "comprising" are intended to mean that the recited values, steps or components are included, but not to exclude other values, steps or components.

In this application, the term "subject" includes both human and non-human animals. Non-human animals include all vertebrates, such as mammals and non-mammals. An "individual" may also be a livestock animal, such as cattle, pigs, sheep, poultry, and horses; or rodents, e.g., rats, mice; or primates, e.g., apes, monkeys; or domestic animals such as dogs and cats. In some embodiments, the individual is a human.

In the present application, the term "large intestine" refers to the terminal region, starting from the ileum, and includes the following anatomical regions of the viscera: cecum, ascending colon, transverse colon, descending colon, sigmoid colon, rectum, splenic flexure, and hepatic flexure.

In the present application, the term "neoplasm" or "tumor" refers to a disease characterized by abnormal proliferation of cells. Tumors can be benign (e.g., adenomas), potentially malignant, or malignant (also commonly referred to as carcinomas), wherein a malignant tumor is characterized by malignant proliferation of tumor cells, i.e., growth of tumor cells is unregulated and lacks differentiation, and has the potential or ability to invade local tissues and metastasize. As used herein, a large intestine tumor refers to a tumor of the large intestine region.

In this application, the term "diagnosis" refers to making a medical judgment on the health status of an individual. As used herein, diagnosing a large bowel tumor in an individual refers to determining whether the individual has a large bowel tumor (including a large bowel tumor at any stage of progression).

In this application, the term "screening" refers to the determination of whether an individual has a particular disease and/or the stage of its progression by analysis of one or more biological samples from the individual. Screening is an important tool for the discovery of early stage cancers and precancerous lesions, and is commonly used to identify individuals from an apparently healthy population who have or may have a particular tumor (e.g., a large bowel tumor).

In the present application, the term "formation" as used in describing a large intestine neoplasm refers to the occurrence of abnormal proliferation of one or more cells of the large intestine of an individual, which may refer to a very early stage of large intestine neoplasm with a low number of large intestine cells undergoing abnormal proliferation, or may refer to a large intestine neoplasm that has progressed to form clumps containing abnormally proliferating cells.

In this application, the term "predisposition" means that an individual has not yet developed a certain condition, but that the condition is likely to occur in the future.

In the present application, the term "monitoring the progression of a large intestine tumor" refers to monitoring the stage of progression of a large intestine tumor in an individual diagnosed with a large intestine tumor.

In this application, the term "prognosis" refers to the prediction or prediction of the future course or outcome of a disease or disorder. The term also refers to a prediction of the likelihood of clinical benefit from treatment. In some embodiments, the individual is provided with a prognosis of the disease using a statistical algorithm. For example, prognosis may be surgery, the progression of a clinical subtype of cancer, the progression of one or more clinical factors, or the recovery from disease. The prognosis may be poor (e.g., likely to relapse or develop resistance) or good.

In the present application, the term "biological sample" refers to any sample containing biological material obtained from an individual including human and non-human animals. The biological sample may be a sample obtained directly from an individual source or a processed sample, and may be a freshly harvested or stored (e.g., cryopreserved) sample. Biological samples include, but are not limited to, bodily fluids (e.g., whole blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine, sweat, semen, stool, sputum, saliva, tears, mucus, amniotic fluid, effusion, bone marrow sample, ascites, pleural fluid, spinal fluid, lymph fluid, ocular fluid), samples introduced into an individual and subsequently removed (e.g., pelvic wash fluid, enema wash sample), extracts of nasal, laryngeal or genital swabs, tissue and organ samples, and processed samples derived from such samples (e.g., cell suspensions from digested tissue, stool extracts).

In the present application, the term "BCAN gene region" refers to a specific region of genomic DNA that contains all of the deoxynucleotide sequences necessary for the production of all transcripts of the BCAN gene, including transcriptional regulatory elements and promoter sequences that regulate transcription of the BCAN gene. The DNA region may be determined by the name of the gene or a set of chromosomal coordinates. The human BCAN gene is also known as the Brevican gene. The BCAN gene region that can be used in the method described in the present application includes the region of Hg19 coordinates chr1:156611182-156629324 and its upstream 5kb and downstream 5kb, or is selected from the region consisting of Hg19 coordinates chr1:156611182-156629324 and its upstream 5kb and downstream 5 kb. The specific sequences of Hg19 coordinates chr1: 156611182-. It is known that there may be many variants of a gene between individuals, such as allelic variations or single nucleotide polymorphisms (SNPs, including insertions and deletions of varying sizes and simple sequence repeats, such as di-and trinucleotide repeats), and thus the term "BCAN gene region" should also be understood to include the regions of the BCAN gene corresponding to all variant sequences of the BCAN gene. According to the Ensembl note, the BCAN gene has 8 transcript variants. Furthermore, the term "BCAN gene region" should also be understood to include the sequences of the sense and antisense strands within the gene region.

Furthermore, the term "BCAN gene region" also broadly includes: (1) the original BCAN gene region (particularly the original BCAN gene region with a specific methylation state) found in a biological sample or genomic DNA; (2) and treated sequences thereof (e.g., bisulfite converted or Methylation Sensitive Restriction Enzyme (MSRE) treated sequences). The bisulfite converted sequence differs from its original sequence in the gene sequence in that one or more unmethylated cytosine residues of the original BCAN gene region are converted to uracil bases, thymine bases, or other bases that are dissimilar in hybridization pattern to cytosine. The MSRE-treated sequence differs from its original sequence in the gene sequence in that the sequence is cleaved at one or more MSRE cleavage sites.

In the present application, the term "methylation state" refers to the state of methylation or unmethylated of one or more cytosine bases within a DNA sequence. In mammals, DNA methylation typically occurs at cytosines in CpG dinucleotides. CpG can be present in clusters in the form of CpG islands, which are present in the 5' regulatory region of many genes, the methylation state of which can affect transcription of the gene. Methylated cytosines can take different forms, for example, 5-methylcytosine (5mC), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxycytosine (5caC), among others. Methylation status of CpG sites within a DNA sequence includes unmethylated (CpG on both DNA single strands are unmethylated), permethylated (CpG on both DNA single strands are methylated), and hemimethylated (CpG methylation on only one DNA single strand). Various methods are known to those skilled in the art for determining the methylation state or level of DNA. In the present application, a quantitative assay may be used to determine the methylation level (e.g., percentage, fraction, ratio or degree) of one or more methylation sites (e.g., CpG dinucleotides) when analyzing the DNA methylation status in a biological sample. Accordingly, the term "methylation status" should also be taken to mean a value reflecting the degree of methylation of one or more cytosines in the DNA of a biological sample.

In the present application, the term "methylation state of a BCAN gene region" refers to the state of methylation or unmethylated of one or more cytosine bases in a BCAN gene region. The methylation state of one or more sequences within the region of the BCAN gene can represent the methylation state within the region of the BCAN gene. For example, the methylation state of a BCAN gene region can be known by detecting the methylation state of one or several target DNA regions within the BCAN gene region.

In the present application, the term "target DNA region" refers to a DNA sequence within a BCAN gene region that comprises at least 9 contiguous nucleotides of the BCAN gene region and comprises at least one methylation site (e.g., a CpG dinucleotide site). In the present application, analysis of the methylation status of a DNA region of interest is particularly useful for diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to form or monitoring large intestine tumor progression or prognosis, or monitoring an individual's response to treatment of a large intestine tumor in an individual. In some embodiments, the DNA region of interest comprises at least 9, 10, 12, 15, 18, 20, 22, 25, 28, 30, 32, 35, 50, 100, 150, 200, 250, or 500 consecutive nucleotides of the BCAN gene region. In some embodiments, the target DNA region may comprise one or more CpG dinucleotide sites, for example at least 1 or at least 2, 3, 4, 5, 8 or 10 CpG dinucleotide sites, which may depend on the length of the target DNA region.

In some embodiments, the DNA region of interest contains a high density of CpG dinucleotides (or TpG dinucleotides or CpA dinucleotides derived therefrom). The degree of methylation of these CpG dinucleotides in genomic sequences was found to be associated with large intestine neoplasias, such as colorectal cancer. Without being limited by theory, it is believed that diagnostic results can be obtained by analyzing the methylation state of these shorter, more clearly defined regions of the target DNA, and that the regions of the target DNA in the region of the BCAN gene are particularly useful for the methods provided by the present invention if the analysis of these regions of the target DNA will provide more accurate diagnostic results than the analysis of the methylation state across the entire region of the BCAN gene. In some embodiments, the target DNA region comprises a sequence with Hg19 coordinates selected from the group consisting of: chr1:156611399-156612667, chr1:156616348-156617162, chr1:156626037-156630544 and chr1:156611866-156611966, and 200bp upstream and 200bp downstream of the regions, and any combination thereof. In some embodiments, the target DNA region comprises the nucleotide sequence set forth in any one of SEQ ID NOs:1-3 or 10. In some embodiments, the target DNA region comprises a treated sequence (e.g., bisulfite or MSRE treated sequence) of the genomic sequences described above. In some embodiments, the target DNA region comprises a sequence selected from the group consisting of: 4-9 and 11-12 of SEQ ID NOs. FIG. 4 shows specific sequences of SEQ ID NOs: 1-12.

In the present application, the term "normal methylation state" refers to a threshold level that represents the methylation state of the BCAN gene region or target region in an individual from whom no colorectal neoplasm is present, or from whom there is no predisposition for the formation or development of a colorectal neoplasm, or from whom there is no predisposition for the development or development of a colorectal neoplasm, or from whom there is a predisposition for a good or good prognosis for a colorectal neoplasm. The normal methylation state can be obtained by any suitable means that will be well known to those skilled in the art. For example, a set of biological samples from a healthy population can be obtained and the methylation status of the BCAN gene region can be assessed to establish a standard value or range for comparison to methylation status of future biological samples. It is understood that the methylation state of a region of the BCAN gene can be influenced by a variety of characteristics, such as age, gender, race, and the like, and thus, in some embodiments, a plurality of standard values or ranges for a corresponding plurality of normal methylation states can be established for a plurality of populations in a particular cohort, respectively.

In the present application, the term "higher methylation state" refers to the presence of a higher level of methylated cytosine than in the normal methylation state, e.g., a higher proportion of DNA molecules methylated at one or more CpG sites, or the presence of more methylated CpG sites.

In the present application, the term "less methylated state" means that there is a lower level of methylated cytosines compared to the normal methylation state, e.g. a lower proportion of DNA molecules methylated at one or more CpG sites, or that there are fewer methylated CpG sites.

In the present application, the term "hybridization" refers to the process by which a base on one nucleic acid strand binds to a complementary base on another nucleic acid strand through base pairing. The hybridization reaction may be selective, such that a particular sequence of interest is also selected from the sample when it is present in low concentrations. The stringency of hybridization conditions (e.g., high stringency, moderate stringency, stringency) can be adjusted by, for example, the concentration of salt or formamide in the prehybridization and hybridization solutions, or the hybridization temperature, and the like, e.g., stringency can be increased by decreasing the salt concentration, increasing the formamide concentration, or increasing the hybridization temperature. Generally, stringent conditions include hybridization in at least about 0% to at least about 15% v/v formamide and at least about 1M to at least about 2M salt, and washing in at least about 1M to at least about 2M salt at a temperature of about 25 ℃ to about 42 ℃; moderately stringent conditions comprise hybridization in at least about 16% to at least about 30% v/v formamide and at least about 0.5M salt to at least about 0.9M salt, and a wash in at least about 0.5M to at least about 0.9M salt at a temperature of about 25 ℃ to about 65 ℃; high stringency conditions comprise hybridization in at least about 31% to at least about 50% v/v formamide and at least about 0.01M to at least about 0.15M salt, and washing in at least about 0.01M to at least about 0.15M salt at a temperature of about at least 65 ℃; formamide is optional in these hybridization conditions. Other suitable hybridization buffers and conditions are well known to those skilled in the art and are described, for example, in Sambrook et al, Molecular Cloning: A Laboratory Manual,2^nded.Cold Spring Harbor Press, Plainview, N.Y. (1989); and Autosubel et al, Short Protocols in Molecular Biology,4^th ed.,John Wiley&Sons(1999)。

In the present application, the term "methylation specific" refers to the action of certain behaviors or properties only on molecules with a specific methylation state or without a specific methylation state. For example, an oligonucleotide that hybridizes in a methylation-specific manner can only hybridize to a nucleic acid having an unmethylated state or can only hybridize to a nucleic acid having a methylated state under highly stringent hybridization conditions, but does not hybridize to both a nucleic acid having an unmethylated state and a nucleic acid having a methylated state.

In the present application, the term "responsive" refers to a beneficial response of an individual to a treatment. The beneficial response may be manifested clinically in various forms, such as disappearance of the tumor, reduction in tumor size, arrest of tumor growth, reduction of one or more symptoms associated with the tumor, increased survival time after treatment, and the like.

2.Screening and monitoring methods

In one aspect, the present application provides a method of diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to formation, or monitoring large intestine tumor progression or prognosis in an individual, the method comprising detecting the methylation state of a region of the BCAN gene in a biological sample from the individual, and comparing the detected methylation state of the BCAN gene region with a normal methylation state of the BCAN gene region, wherein a detected change in methylation state of the BCAN gene region (e.g., having a higher methylation state) in the biological sample from the individual relative to the normal methylation state of the BCAN gene region indicates that the individual has a large intestine tumor, or the individual has a predisposition to form or develop a colon tumor, or the individual has a predisposition to develop or develop a colon tumor, or the individual has a predisposition to a poor prognosis or a poor prognosis of a colon tumor.

In one aspect, the present application provides a method of monitoring an individual's response to treatment for a colorectal tumor, the method comprising detecting the methylation state of a region of a BCAN gene in a biological sample from the individual before and after the individual receives treatment for a colorectal tumor, respectively, wherein a change in the methylation state of the region of the BCAN gene after the individual receives treatment for a colorectal tumor (e.g., has a lower methylation state after treatment) relative to the methylation state of the region of the BCAN gene before receiving treatment for a colorectal tumor is indicative of the individual's response to treatment for a colorectal tumor.

In some embodiments, the large intestine tumor is a colorectal tumor. Colorectal tumours are the most common type of large bowel tumours, occurring in the colon, rectum and cecum and can be classified by their nature as sessile serrated polyps, colorectal adenomas and colorectal cancers. Without being bound by any theory, polyps and adenomas are generally benign hyperplasias of epithelial origin (derived from epithelial tissue or having well-defined epithelial structural features) that, as they progress, may show malignant proliferation of tumor cells within, transitioning to malignancy. In some embodiments, the colon tumor is colorectal cancer.

In some embodiments, the colon tumor is precancerous. The term "precancerous" refers to an abnormally proliferating cell being transformed into a malignantly proliferating tumor cell. For colorectal tumours, the following categories are included: grade 1: the penetration of malignant glands from the muscularis mucosa into the submucosa within the head of the polyp; grade 2: the same submucosal invasion, but present at the junction of the head to the shaft; grade 3: invasion of the stem; and a level 4: invade the base of the stem at the junction with the colon wall (this grade corresponds to Dukes stage a).

In some embodiments, said detecting the methylation state of the BCAN gene region comprises determining the methylation state of cytosine residues in one or more methylation sites (e.g., CpG sites) of the BCAN gene region in a biological sample from said individual. For example, one can choose to determine the methylation status of the entire BCAN gene region, or a portion thereof, such as the methylation status of the target DNA region described above.

3.Preparation of biological samples

The methods provided herein can be used with any suitable biological sample containing DNA obtained from an individual. In some embodiments, the biological sample is selected from the group consisting of histological sections, tissue biopsies, paraffin-embedded tissues, surgically excised specimens, isolated cells, bodily fluids (e.g., whole blood, serum, plasma, urine, saliva, mucus, peritoneal fluid, pleural fluid, synovial fluid, cerebrospinal fluid, thoracentesis fluid, or peritoneal fluid), colonic effluent (e.g., stool and enema wash samples), and any combination thereof. Where the biological sample comprises a plurality of cell populations, it may be desirable to isolate a particular cell population by purification or enrichment procedures. In some embodiments, the biological sample is a blood sample (e.g., whole blood, serum, plasma) or a tissue biopsy.

The biological sample may be used directly in the methods provided herein, or the DNA may be obtained or isolated from the biological sample and then used in the methods provided herein. The DNA obtained from the biological sample may be, for example, genomic DNA, intracellular DNA, or extracellular free DNA. Extracellular free DNA, also known as free circulating DNA (cfdna), is a degraded DNA fragment that is released into body fluids (e.g., plasma). The source of extracellular free DNA is diverse, and common species include, for example, circulating tumor DNA (ctdna). Elevated levels of free circulating DNA have been observed in cancer patients.

The DNA in the sample can be isolated by any standard means known in the art, and the choice of method can be influenced by a number of factors, including time, expense and the amount of DNA required. When the DNA is encapsulated in a cell membrane, the general steps of isolating the DNA include: disrupting the biological sample and lysing the cells by enzymatic, chemical or mechanical means; subsequent removal of proteins and other contaminants by digestion with, for example, protein kinase K; the DNA is then recovered from the solution by methods including salting out, organic extraction, or binding of the DNA to a solid support. When the DNA is not encapsulated in the cell membrane (e.g., extracellular free DNA from a blood sample), standard methods of isolating and/or purifying DNA in the prior art can be used. Including the use of proteolytic agents, ethanol precipitation or propanol precipitation, and the like. Devices such as filters such as ultrafiltration, silicon surfaces or membranes, magnetic particles, positively charged surfaces, and the like may also be utilized.

In some embodiments, the extracellular free DNA comprises circulating tumor DNA. Circulating tumor DNA is a DNA fragment derived from tumor cells in body fluids (e.g., blood, urine, saliva, sputum, etc.). The cause of the formation of circulating tumor DNA is not clear, presumably being released by apoptotic or necrotic tumor cells or actively released by tumor cells.

In some embodiments, the methods provided herein further comprise treating the DNA obtained from the biological sample with an agent capable of distinguishing between methylated and unmethylated CpG sites in the DNA, thereby obtaining treated DNA.

It is known in the art that certain agents can act selectively on unmethylated cytosine bases, but not significantly on methylated cytosine residues; or selectively on methylated cytosine bases but not significantly on unmethylated cytosine residues. For example, certain agents are capable of selectively converting an unmethylated cytosine base to uracil, thymine, or another base that differs from cytosine in hybridization behavior. It is known in the art that methylcytosine has the same base pairing behavior as cytosine with guanine, and therefore, the treatment can convert methylated DNA into DNA that differs in hybridization behavior depending on the state in which cytosine is methylated. In this application, DNA treated with an agent capable of converting unmethylated cytosine bases to uracil is also referred to as converted DNA, or pre-converted DNA. As another example, certain agents are capable of selectively cleaving a site that has methylated DNA, or alternatively, a site that does not have methylated DNA.

In some embodiments, the agent is bisulfite. Specific reactions of bisulfite with unmethylated cytosine, which is converted to uracil, are known in the art. Methylated cytosines do not change. Commonly used bisulfite reagents include: ammonium bisulfite, sodium bisulfite, potassium bisulfite, calcium bisulfite, magnesium bisulfite, aluminum bisulfite, bisulfite ions, and any combination thereof.

The bisulfite treatment is typically carried out in the presence of denaturing solvents including, for example, n-alkanediol, diethylene glycol dimethyl ether (DME), dioxane or dioxane derivatives, preferably used at concentrations of 1% to 35% (v/v). Preferably, the bisulfite treatment is carried out in the presence of scavengers including, for example, chromane derivatives, trihydroxybenzoic acid and derivatives thereof. Also preferably, the bisulfite treatment is carried out at a reaction temperature of 30 ℃ to 70 ℃, during which the temperature may be increased to over 85 ℃ for a short time.

In some embodiments, the agent is a Methylation Sensitive Restriction Enzyme (MSRE). Methylation sensitive restriction enzymes selectively digest nucleic acid based on the methylation state of their recognition sites, thereby distinguishing (e.g., at CpG sites) DNA containing methylated and unmethylated cytosines. A portion of the methylation sensitive restriction enzyme cleaves only unmethylated recognition sites, and when the recognition site is methylated, no cleavage occurs or cleavage with significantly reduced efficiency; a portion of the methylation sensitive restriction enzyme cleaves only methylated recognition sites, and when the recognition sites are unmethylated, cleavage does not occur or cleaves with significantly reduced efficiency. Preferred are methylation sensitive restriction enzymes that cleave only recognition sites in which cytosine is not methylated in the recognition site. Methylation sensitive restriction enzymes useful herein include HpaII enzyme, SalI enzyme, and,

Enzymes, ScrFI enzymes, BbeI enzymes, NotI enzymes, SmaI enzymes, XmaI enzymes, MboI enzymes, BstBI enzymes, ClaI enzymes, MluI enzymes, NaeI enzymes, NarI enzymes, PvuI enzymes, SacII enzymes, HhaI enzymes, and any combination thereof. In one embodiment, the DNA is treated with a methylation sensitive restriction endonuclease under conditions sufficient to digest nucleic acid, resulting in treated DNA, which is then used for detection of the methylation state of the nucleic acid.

4.Detection of nucleic acid methylation status

The DNA treated with the reagent can be used to identify the methylation state or level of a methylation site (e.g., a CpG site) in DNA obtained from a sample by conventional techniques based on base-specific pairing, such as amplification and hybridization. Any method suitable for detecting DNA methylation can be used in the methods described herein. Numerous methods are known in the art for detecting methylated DNA at specific sites in the genome in a biological sample (e.g., blood, urine, feces, or saliva) (see Kristensen and Hansen, Clin chem.55:1471-83, 2009; Ammerpohl et al, Biochim Biophys acta.1790:847-62, 2009; Shames et al, Cancer Lett.251:187-98, 2007; Clark et al, Nat Protoc.1:2353-64, 2006). In some embodiments, the detection of the methylation state can use methods including, but not limited to, amplification-based methods, hybridization-based methods, sequencing-based methods, or restriction enzyme-based methods, among others. Exemplary methods include polymerase chain reaction (e.g., real-time polymerase chain reaction, digital polymerase chain reaction), nucleic acid sequencing, mass-based separation (e.g., electrophoresis, mass spectrometry), or target capture (e.g., microarray).

A.Amplification-based methods

In some embodiments, detecting the methylation state of the BCAN gene region comprises amplifying the treated DNA using an amplification enzyme and one or more sets of primers to produce at least one amplification product or the treated DNA is not amplified. In certain embodiments, the treated (e.g., bisulfite treated) DNA includes the nucleotide sequence set forth in SEQ ID NOs:4-9, 11-12, and any combination thereof, or a nucleotide sequence selected from the group consisting of SEQ ID NOs:4-9, 11-12. In certain embodiments, the amplification product comprises the nucleotide sequence set forth in SEQ ID NOs:4-9, 11-12, and any combination thereof, or is selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs:4-9, 11-12. In certain embodiments, the treated (e.g., MSRE treated) DNA comprises the nucleotide sequence set forth in SEQ ID NOs:1-3 or 10, and any combination thereof, or is selected from the group consisting of SEQ ID NOs:1-3 or 10.

A variety of nucleic acid amplification means known in the art can be used, and exemplary nucleic acid amplification methods include, but are not limited to, the use of Polymerase Chain Reaction (PCR), allele specific PCR (aspcr), Single Base Extension (SBE), Allele Specific Primer Extension (ASPE), Strand Displacement Amplification (SDA), Transcription Mediated Amplification (TMA), Ligase Chain Reaction (LCR), Nucleic Acid Sequence Based Amplification (NASBA), primer extension, Rolling Circle Amplification (RCA), autonomous sequence replication (3SR), the use of Q β replicase, nick translation or loop mediated isothermal amplification (LAMP), or any combination thereof, and the like.

PCR methods are known in the art (see CR Primer: A Laboratory Manual, Cold Spring harbor Laboratories, NY, 1995). Generally, in a PCR reaction, a template DNA (DNA to be amplified) double strand is denatured and melted into single strands at a high temperature; at the hybridization/annealing temperature, two oligonucleotide primers are respectively combined with the template DNA single strand according to the base complementary pairing principle; at a suitable temperature, the DNA polymerase extends the primer in the 5 '-3' direction to synthesize a complementary strand of the single strand of the template DNA. By repeating the temperature cycle for a plurality of times, the template DNA is exponentially amplified to obtain an amplification product.

In the present application, the term "DNA polymerase" refers to an enzyme that catalyzes the synthesis of polydeoxyribonucleotides from monodeoxyribonucleoside triphosphates (dNTPs), and DNA replication and repair are both achieved by the DNA polymerase. In addition to having activity in catalyzing DNA synthesis, a DNA polymerase may also have exonuclease activity (e.g., 5 '-3' exonuclease activity or 3 '-5' exonuclease activity), i.e., the removal of a single nucleotide from the 5 'end or the 3' end of a polynucleotide strand.

In some embodiments, the DNA polymerase is a thermostable DNA polymerase or a polymerase lacking 5 '-3' exonuclease activity. The thermostable DNA polymerase can tolerate a high temperature for denaturing and melting a DNA double strand without inactivation, and examples of the thermostable DNA polymerase include Taq DNA polymerase,

High fidelity DNA polymerase or

A polymerase. The DNA polymerase lacking 5 '-3' exonuclease activity is not capable of removing a single nucleotide from the 5 'end to the 3' end of the polynucleotide strand, and examples of the DNA polymerase lacking 5 '-3' exonuclease activity include

High fidelity DNA polymerase,

A polymerase,

DNA polymerase,

(exo-) DNA polymerase, Deep

DNA polymerase, T4 DNA polymerase and T7 DNA polymerase.

In some embodiments, the primer comprises a sequence that is substantially complementary or substantially identical to a sequence of at least 9 consecutive nucleotides of the treated DNA corresponding to a sequence of a region of a BCAN gene, wherein said consecutive nucleotides comprise at least one CpG site, or wherein said amplification product comprises at least one CpG site. In some embodiments, the treated DNA comprises the nucleotide sequences set forth in SEQ ID NOs:4-9, 11-12, and any combination thereof. In some embodiments, the treated DNA is selected from the group consisting of the nucleotide sequences of SEQ ID NOs:4-9, 11-12. In some embodiments, the treated DNA comprises the MSRE cleavage product of the nucleotide sequence set forth in SEQ ID NOs:1-3 or 10.

In the present application, the term "complementary" or "complementarity" refers to the pairing by base between nucleotides or nucleic acids, for example, the base pairing between the two strands of a double-stranded DNA molecule or between an oligonucleotide primer and the binding site of a primer on a single-stranded nucleic acid to be sequenced or amplified. The complementary or paired bases are typically: a and T (or A and U) pairs, or C and G pairs. Percent (%) complementarity indicates the percentage of nucleotide residues on one nucleic acid that can be paired with residues on the other nucleic acid, and can be obtained by dividing the number of paired residues by the total number of residues on the shorter of the two nucleic acid strands. Two nucleic acid strands may be considered substantially complementary when they are at least 80% complementary ((typically at least about 90% to 95%, more preferably about 98% to 100% complementary.) in some embodiments, two substantially complementary nucleic acid strands may be at least 80% complementary, at least 85% complementary, at least 90% complementary, at least 95% complementary, or 100% complementary.

In the context of describing two or more nucleic acid sequences, the term "identical" or "percent (%) identity" refers to the degree of identity of nucleotide residues after alignment of two or more nucleic acid molecules, gaps may be introduced when aligning to achieve the greatest degree of identity or greatest degree of pairing of the nucleotide residues. Two nucleic acid strands are considered substantially identical when they are at least 80% identical (typically at least about 90% to 95%, more preferably about 98% to 100% identical). In some embodiments, two nucleotide strands that are substantially identical may be at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, or 100% identical.

Percent (%) identity or percent (%) complementarity can be obtained by dividing the number of identical nucleotide residues obtained in the alignment by the total number of nucleotide residues of the shorter nucleic acid sequence in the alignment. One skilled in the art can use, for example, publicly available tools (e.g., BLASTN, available on the website of the National Center for Biotechnology Information (NCBI)), to perform Nucleic acid sequence alignments to obtain percent identities (see, e.g., Altschul SF et al, J.mol.biol., 215: 403-.

In some embodiments, the primer comprises a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-12. In some embodiments, the primer comprises a sequence that is at least 85% complementary, at least 90% complementary, at least 95% complementary, or 100% complementary, or a sequence that is at least 85% identical, at least 90% identical, at least 95% identical, or 100% identical to a sequence of at least 9 contiguous nucleotides of a sequence selected from SEQ ID NOs 1-12.

In some embodiments, the primer is methylation specific. As used herein, methylation specific primers refer to primers that are capable of amplifying a particular target on treated DNA in a methylation specific manner. The primers can specifically amplify DNA molecules with a particular methylation state without amplifying DNA molecules without a particular methylation state. For example, the primer may specifically hybridize to a methylated specific CpG site under moderate stringency, stringent or high stringency conditions, but not to unmethylated that specific CpG site, and thus will specifically amplify a target that is methylated at that specific CpG site. As another example, the primer may be one that specifically hybridizes to an unmethylated specific CpG site but not to a methylated specific CpG site under moderate stringency, stringent, or high stringency conditions, and will therefore specifically amplify a target that is unmethylated at that specific CpG site.

Methylation specific primers can be used in the present application to amplify the treated DNA, thereby distinguishing methylated from unmethylated DNA. Methylation specific primers comprise at least one primer that hybridizes to a bisulfite-treated CpG dinucleotide, i.e., comprises at least one CpG dinucleotide for amplifying bisulfite-treated methylated DNA, or comprises at least one TpG or CpA dinucleotide for amplifying bisulfite-treated unmethylated DNA.

In some embodiments, the primer comprises or consists of a sequence selected from the group consisting of seq id no:

Methods for designing primers, such as those used in PCR, are known in the art (see PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratories, NY, 1995). Several software packages are also publicly available for designing optimal primers for a variety of assays, such as Primer3 available from the Center for Genome Research, Cambridge, mass, USA. Of course, the possible use of the primers should also be taken into account during the design of the primers. For example, a primer sequence designed for the purposes of this application may contain at least one CpG site, or the amplification product from the primer may contain at least one CpG site. Primer design tools that are involved in the detection of DNA methylation status are known in the art, such as MethPrimer (see Li LC and Dahiya R. MethPrimer: design primers for methylation PCRs. bioinformatics.2002Nov; 18(11): 1427-31).

Methods for preparing Oligonucleotide primers are known in the art (see Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford, 1984). For example, primers may be obtained by biological synthesis (e.g., by digesting nucleic acids with restriction endonucleases) or by chemical synthesis. For short sequences (up to about 100 nucleotides), chemical synthesis is preferred. For longer sequences, standard replication Methods used in molecular biology are preferred, e.g., M13 is used to obtain single-stranded DNA (see Messing, Methods enzymol., 101, 20-78, 1983).

In some embodiments, the amplification is performed in the presence of a blocking reagent. Methylation specific amplification can also be achieved by using blocking reagents. The use of such examples is known in the art (see Yu et al, BioTechniques 23:714-720, 1997).

In some embodiments, the blocking reagent comprises a blocking oligonucleotide that is not extendable by and/or degradable by a DNA polymerase. For PCR methods using blocking oligonucleotides, it is desirable that the blocking oligonucleotide is not extendable by the polymerase to effectively disrupt amplification of nucleic acids to which the blocking oligonucleotide specifically binds. In some embodiments, the blocking oligonucleotide does not contain a free hydroxyl group at the 3' end, e.g., 3' deoxy or is substituted with a group other than a hydroxyl group (e.g., 3' -O-acetyl), and thus cannot be extended by a polymerase. In addition, there is a need to prevent DNA polymerase mediated degradation of the blocking oligonucleotide. In some embodiments, the blocking oligonucleotide has a thioester bridge at the 5' end to prevent degradation by a polymerase having 5' -3 ' exonuclease activity. In some embodiments, the binding sequence of the primer is designed to overlap with the binding sequence of the blocking oligonucleotide, thereby preventing degradation of the blocking oligonucleotide by a polymerase having 5 '-3' exonuclease activity. In other embodiments, a polymerase lacking 5 '-3' exonuclease activity is used. Peptide Nucleic Acid (PNA) oligomers may also be used as blocking oligonucleotides. PNAs are ideally blocked oligonucleotides that are neither cleaved nor extended by DNA polymerases.

In some embodiments, the blocking oligonucleotide is capable of hybridizing to a CpG site on the treated DNA in a methylation specific manner. For example, to detect methylated nucleic acid in the context of unmethylated nucleic acid, for bisulfite treated DNA, blocking oligonucleotides comprising "CpA" or "TpG" at the corresponding sites can be used to inhibit amplification of nucleic acid that is unmethylated at that location; correspondingly, blocking oligonucleotides comprising a "CpG" at the corresponding site may be used if it is desired to inhibit amplification of methylated nucleic acid.

In some embodiments, the amplification is performed in the presence of a detection reagent.

In some embodiments, the detection reagent comprises a detectable label-labeled primer, a detectable label-labeled oligonucleotide detection probe, or a DNA double strand insertion dye. Examples of detectable labels include, for example, fluorescent molecules, chromogenic molecules, biotin, radioisotopes, and the like. In some embodiments, the detection reagent is capable of reporting information about the amplification product in real time.

In some embodiments, wherein the oligonucleotide probe comprises a sequence capable of hybridizing to the amplification products under stringent, medium stringent, or high stringent conditions. In some embodiments, the oligonucleotide probe comprises or consists of a sequence selected from the group consisting of SEQ ID NOs,

CGTCGGGAGGGTCGG(SEQ ID NO:15)

BCAN probe sequence

In some embodiments, the oligonucleotide probe comprises a label of a fluorescent dye (e.g., FAM, HEX/VIC, TAMRA, texas red, or Cy5) at the 5 'end and a label of a quencher (e.g., BHQ1, BHQ2, BHQ3, DABCYL, or TAMRA) at the 3' end.

Probes can be prepared using methods similar or identical to those used for primers. Labeling of the probe with a detectable label may be accomplished by direct or indirect methods. Direct labeling involves coupling a label directly (covalently or non-covalently) to an oligonucleotide probe. Indirect labeling involves coupling of a label to an oligonucleotide probe via an intermediate reagent that can specifically bind (covalently or non-covalently) to the label. The intermediate reagent may be a plurality (e.g., 2, 3 intermediate reagents that bind sequentially in a specific manner), with a plurality of intermediate reagents typically used to amplify the detectable signal. Detectable labels suitable for attachment in an indirect format include antibodies, streptavidin-biotin systems.

Nucleic acid amplification based methods can also be used to analyze DNA digested with Methylation Sensitive Restriction Enzyme (MSRE). For example, primers are designed such that their binding sites flank or are adjacent to a particular methylation sensitive restriction enzyme recognition site in a region of target DNA, such that an amplification product is produced only when the restriction recognition site is not cleaved, i.e., the presence or amount of the amplification product is indicative of the methylation state of a cytosine in the particular methylation sensitive restriction enzyme recognition site in the region of target DNA. In some embodiments, when the MSRE cleaves unmethylated DNA, the presence of the amplification product will indicate that the MSRE recognition site has methylation; in other embodiments, when the MSRE cleaves methylated DNA, the presence of the amplification product will indicate that the MSRE recognition site is not methylated. The amplification products can be analyzed using real-time quantitative PCR, the amount of amplification product indicating the level of methylation.

In some embodiments, the methylation state of the BCAN gene region is determined based on the presence and nature of the amplification product. The amplified nucleic acid products can be analyzed by methods commonly used in the art, such as fluorescence detection, native agarose gel electrophoresis, native polyacrylamide gel electrophoresis, mass spectrometry, liquid chromatography (e.g., HPLC), or capillary electrophoresis. High throughput detection methods are also useful in this application, such as matrix assisted laser desorption/ionization time of flight (MALDI-TOF), electrospray ionization (ESI), tandem mass spectrometry (e.g., LC MS/MS), biosensor technology, and the like.

In some embodiments, methylation status is detected by a method of amplifying treated DNA using methylation-specific PCR (MSP) (see Herman et al, Proc. Natl. Acad. Sci. USA 93:9821-9826, 1992). For example, the amplification system comprises one or more primers that specifically hybridize to an unmutated sequence under moderate and/or high stringency conditions, resulting in amplification products from only the template comprising methylated cytosines. Similarly, methods for selective amplification and detection of methylated or unmethylated fractions from mixtures of Bisulfite-treated DNA are described in Cottrell et al, Nucl. acids Res.32: e10, 2003(Heavy Methyl PCR), Rand et al, Nucl. acids Res.33: e127, 2005(Headloop PCR), Rand et al, Epigenetics1:94-100, 2006 (Bisulite Differential Designation PCR) and PCT/AU07/000389(End-specific PCR).

In some embodiments, the DNA methylation status is detected by a method of amplifying treated DNA using real-time quantitative PCR (see Holland et al, Proc. Natl. Acad. Sci. USA, 88: 7276-. For example, MethyLight method uses a modified TaqMan assay to detect cytosine methylation of CpG dinucleotides (see EAds et al, Nucl. acids Res.28: E32, 2000). Briefly, this method performs nucleic acid amplification after bisulfite treatment of a sample containing nucleic acids, the amplification reaction comprising a DNA polymerase having 5 'to 3' exonuclease activity (e.g., Taq DNA polymerase) and three oligonucleotides. The three oligonucleotides are a forward primer and a reverse primer, respectively, that anneal alongside the region of interest of amplification, and a probe that hybridizes between the two primers to one or more sites of methylated CpG dinucleotides. The 5 'and 3' segments of the probe oligonucleotide are labeled with a fluorescent reporter and a quencher, respectively, when the probe is intact, the quencher is in proximity to the fluorescent reporter and quenches the fluorescence, and when the probe oligonucleotide anneals to the amplification product, the 5 'to 3' exonuclease activity of the DNA polymerase cleaves the probe such that the quencher releases the fluorescent reporter and the fluorescence is enhanced. The methylation level of the initial nucleic acid template can be estimated by the increase in the fluorescent signal. In the above method, Molecular beacons (Molecular Beacon) can be used as detectably labeled probes, which are independent of the 5 'to 3' exonuclease activity of DNA polymerase (see Mhlanga and Malmberg, Methods 25:463-471, 2001).

Another method for detecting the methylation status of DNA using real-time quantitative PCR amplification of bisulfite-treated DNA is the Heavymethyl assay (see Cottrell et al, Nucl. acids Res.32: e10, 2003). The nucleic acid amplification system of the method further comprises one or more non-extendable blocking reagents (e.g., blocking oligonucleotides) that specifically bind to bisulfite-treated unmethylated DNA in a methylation-specific manner under moderate to high stringency conditions. Performing amplification using one or more pairs of primers flanking or partially or completely covering the binding sequence of the blocking reagent(s), the blocking reagent(s) binding(s) when unmethylated nucleic acid is present and the nucleic acid is not amplified; when methylated nucleic acid is present, the blocking reagent does not bind and the nucleic acid is amplified. In a particular application, the methylation level of a nucleic acid in a sample can be determined using an assay using TaqMan or a molecular beacon substantially as described above. In other embodiments, the blocking reagent specifically binds to bisulfite-treated methylated DNA in a methylation-specific manner under moderate to high stringency conditions, i.e., the blocking reagent binds and the nucleic acid is not amplified when methylated nucleic acid is present.

B.Hybridization-based methods

In some embodiments, the presence or level of pre-conversion methylated cytosine is determined by a hybridization method after treatment of a nucleic acid with an agent (e.g., bisulfite) results in conversion of unmethylated cytosine to another base that is behaving differently from cytosine by cytosine. The method can be used for the amplified treated DNA or directly used for the treated DNA.

Any nucleic acid hybridization means known in the art may be used for detection, such as southern blot, dot blot, slot blot or others (Kawai et al, mol.cell.biol.14: 7421-. In certain embodiments, the probe nucleic acid used in the hybridization assay is detectably labeled. In certain embodiments, the probe of the probe nucleic acid used in the hybridization assay is unlabeled, and the unlabeled probe is immobilized on a solid support, such as a microarray, and can hybridize to a detectably labeled target nucleic acid molecule.

Hybridization conditions can be determined based on the melting temperature (Tm) of the nucleic acid duplex containing the probe. Generally, for shorter oligonucleotide probes, low to moderately stringent hybridization and/or wash conditions are used; for GC-rich or longer probes, highly stringent hybridization and/or wash conditions are used. Those skilled in the art will appreciate that the optimal hybridization reaction conditions for each probe should also be determined empirically based on the general rules.

In one embodiment, Methylation specific Microarrays (MSOs) are used to distinguish between mutated and non-mutated sequences (see Adorjan et al, Nucl. acids Res., 30: e21, 2002). Nucleic acid amplification is performed using detectably labeled (e.g., fluorophore) primers using a reagent (e.g., bisulfite) to treat the nucleic acid to selectively convert unmethylated cytosine, and the treated nucleic acid as a template, such that both converted and unconverted nucleic acid are amplified. The labeled amplification products are then hybridized to oligonucleotides on the microarray under conditions that allow for detection of single nucleotide differences, and after washing to remove unbound amplification products, hybridization is detected using, for example, a microarray scanner. This method allows the methylation status of a large number of methylatable sites to be determined semi-quantitatively.

Hybridization-based assays can also be used for methylation sensitive restriction enzyme-treated nucleic acids, e.g., probes designed to selectively hybridize to undigested nucleic acids. In other embodiments, digested and undigested nucleic acids are separated by electrophoresis and detected using probes that hybridize to both digested and undigested nucleic acids. Similarly, the method can be used for amplified treated DNA, as well as directly for treated DNA.

C.Methods based on nucleic acid sequencing

In one embodiment, after treatment of the nucleic acid with a reagent (e.g., bisulfite) results in mutation of unmethylated cytosine to uracil (and thus to thymine after the amplification process), the presence or absence of methylcytosine or the number of methylcytosines is determined by DNA sequencing (see Frommer et al Proc. Natl. Acad. Sci. USA 89: 1827-. For example, the identity of methylcytosine in the DNA sequence can be determined by comparing the sequencing results obtained for samples not treated with bisulfite or the known nucleotide sequence of the region of interest with the sequencing results for samples treated with bisulfite: any thymine detected in the bisulfite-treated sample at a position corresponding to a cytosine in the control sample can be considered a mutation caused by bisulfite treatment, i.e., the presence of a methylated cytosine at that position. The method can be used for the amplified treated DNA or directly used for the treated DNA.

A variety of methods for DNA sequencing are known in the art, such as the dideoxy chain termination method or the Maxam-Gilbert method (see Sambrook et al, Molecular Cloning, A Laboratory Manual (2 nd edition), CSHP, New York 1989), pyrosequencing (e.g., Uhlmann et al, Electrophoresis, 23:4072-4079, 2002), solid phase pyrosequencing (see Landegren et al, Genome Res., 8(8):769-776, 1998), solid phase microsequencing (see e.g., Southern et al, genoms, 13:1008-1017, 199), microsequencing using FRET (see e.g., Chen and Kok, Nucleic Acids Res.25:347-353, 1997), sequencing by deep ligation, or by ultra-deep ligation (see Margum-376, 7080).

One method for determining the bisulfite-treated DNA sequence may be methylation-sensitive single nucleotide primer extension (Me-SnaPE) or SNaPset (see Gonzalgo and Jones, nucleic acids Res., 25: 2529-2531). An oligonucleotide is used to hybridize to a region of nucleic acid adjacent to a site of methylated cytosine followed by a primer extension reaction using a polymerase and a detectably labeled (e.g., fluorophore-labeled) free nucleotide diphosphate or dideoxynucleotide triphosphate corresponding to one of the two bases that may be present at that site after bisulfite treatment (i.e., thymine or cytosine). After primer extension, unbound free nucleotide diphosphate or dideoxynucleotide triphosphate is removed and the incorporated labeled nucleotide is detected, revealing the base at that site.

D.Restriction enzyme based method

In some embodiments, the presence of methylated cytosines in a DNA sequence is detected by a Combined Bisulfite Restriction Analysis (COBRA) (see (Xiong and Laird, Nucl. acids Res., 25: 2532-.

Briefly, after bisulfite treatment introduces methylation dependent sequence differences into genomic DNA, a region of target DNA containing methylation sites is amplified using specific primers, and the amplified product is then digested with a restriction enzyme, which can be selected to indicate the presence or absence of methylation. For example, the restriction endonuclease Taq1 cleaves the sequence TCGA, which would be TTGA after bisulfite treatment if the cytosine in the recognition sequence were unmethylated, and would therefore not be cleaved. The products of restriction enzyme digestion can be detected using detection means known in the art, such as electrophoresis and/or mass spectrometry.

In other embodiments, nucleic acid differences in the amplification product are detected using different techniques, such as methylation single-strand conformation analysis (MS-SSCA) (Bianco et al, hum. Mutat., 14:289-293, 1999), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE) (Abrams and Stanton, Methods enzymol., 212:71-74, 1992), and methylation-specific denaturing high performance liquid chromatography (MS-DHPLC) (Deng et al, Chin.J. cancer Res., 12:171-191, 2000), based on differences in nucleotide sequence and/or secondary structure following treatment with reagents that selectively mutate unmethylated cytosine residues.

In one aspect, the present application provides a method of diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to formation, or monitoring large intestine tumor progression or prognosis in an individual, comprising:

(a) obtaining a biological sample containing DNA from the individual;

In some embodiments, the reagent (e.g., bisulfite) converts a cytosine base that is not methylated at the 5' end to uracil, thymine, or another base that is different in hybridization behavior from cytosine. In other embodiments, the reagent is a methylation sensitive restriction enzyme.

In some embodiments, the method of amplifying the target DNA region and determining the methylation state of the target DNA region based on the presence or absence of the amplification product and its nature may be selected from any suitable method known in the art.

In some embodiments, the normal methylation state of a BCAN gene region or target region represents the methylation state of the BCAN gene region or target region in an individual from whom no colorectal neoplasm has developed or is predisposed to develop, or from whom there is no predisposition for development or development of a colorectal neoplasm, or from whom there is a predisposition for good or good prognosis of a colorectal neoplasm.

Comparison to normal methylation status can be performed manually or computer-assisted. For computer-assisted means, the detected methylation state of the biological sample can be compared by a computer program to normal methylation states stored in a database. The computer program may further evaluate the result of the comparison and automatically provide the desired evaluation in a suitable output format.

In some embodiments, the methods provided herein have a sensitivity of at least 40%, and a specificity of at least 80% identifies individuals having, having a large intestine tumor, having a predisposition to form or develop a large intestine tumor, having a predisposition to develop or develop a large intestine tumor, having a poor prognosis or a poor prognosis of a large intestine tumor.

The sensitivity was calculated as: sensitivity TP/(TP + FN); the specificity was calculated as: specificity TN/(FP + TN), where a True Positive (TP) result is a positive test and the disease state is present, and a False Positive (FP) result is a positive test but the disease state is absent. A True Negative (TN) result is a condition where the test is negative and the disease state is absent. A False Negative (FN) result is a condition where the test is negative but the disease state exists. The sensitivity can be measured by testing the testing capability of correctly detecting the target disease or state in the tested individual, and the method provided by the application has higher sensitivity and is beneficial to reducing the occurrence of delaying the disease treatment due to missed diagnosis.

5.Detection tool and application thereof

In one aspect, the present application provides an oligonucleotide comprising or consisting of at least 9 consecutive nucleotides of a BCAN gene region or its complement, for use as a detection tool.

In one aspect, the present application provides an oligonucleotide for use as a detection tool comprising or consisting of at least 9 consecutive nucleotides of a treated DNA sequence of a BCAN gene region or a complement thereof. In some embodiments, the treatment is adapted to convert at least one unmethylated cytosine residue in the BCAN gene region to a uracil residue, a thymine residue, or another residue that is detectably different from cytosine in the hybridization. In some embodiments, the treated DNA comprises the nucleotide sequences set forth in SEQ ID NOs:4-9, 11-12, and any combination thereof. In some embodiments, the treated DNA is selected from the group consisting of the nucleotide sequences of SEQ ID NOs:4-9, 11-12. In some embodiments, the treated DNA comprises the MSRE cleavage product of the nucleotide sequence set forth in SEQ ID NOs:1-3 or 10.

In some embodiments, the oligonucleotide comprises one or more CpG, TpG, or CpA dinucleotides.

In some embodiments, the oligonucleotide may be modified by chemically linking it to one or more conjugates to increase the activity, stability, or detectability, etc., of the oligonucleotide. Suitable conjugates include chromophores, fluorophores, cholesterol, cholic acids, thioethers, aliphatic chains, phospholipids, polyamines, polyethylene glycol, palmityl, peptides, hybridization-triggered cross-linkers, transport agents, hybridization-triggered cleavage agents, and the like. The sugar and/or base of the oligonucleotide may comprise at least one known modification, and the backbone of the oligonucleotide may also be modified, for example, to comprise non-natural internucleoside linkages. In some embodiments, the oligonucleotide may take the form of a peptide nucleic acid molecule (PNA) or a locked nucleic acid molecule (LNA) for better pairing.

In some embodiments, the oligonucleotide may be used as a primer (e.g., a PCR primer), a detection probe, or a blocking oligonucleotide, preferably, the hybridization of the oligonucleotide to DNA in a sample is performed under high stringency conditions.

In some embodiments, a plurality of the oligonucleotides can be bound to a solid surface in an array (e.g., a rectangular or hexagonal lattice). The material of the solid phase surface can be silicon, glass, polystyrene, metal, nitrocellulose, nylon, etc. Oligomer array preparation can be found in Nature Genetics Supplement, Volume21, January 1999.

In some embodiments, the oligonucleotide comprises a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-12. In some embodiments, the oligonucleotide comprises a sequence that is at least 80% complementary, at least 85% complementary, at least 90% complementary, at least 95% complementary, or 100% complementary, or a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, or 100% identical to a sequence of at least 9 contiguous nucleotides of a sequence selected from SEQ ID NOs 1-12. In some embodiments, the oligonucleotide contains, or consists of, a sequence selected from the group consisting of seq id no:13, 14 and 15 SEQ ID NOs.

In some embodiments, the oligonucleotides may be used in methods of diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to develop, monitoring large intestine tumor progression or prognosis, or monitoring response to treatment of a large intestine tumor in an individual. In other embodiments, the oligonucleotides may be used to prepare kits for use in methods of diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to develop, monitoring large intestine tumor progression or prognosis, or monitoring response to treatment of a large intestine tumor in an individual.

In another aspect, the present application provides a reagent (e.g., bisulfite reagent or Methylation Sensitive Restriction Enzyme (MSRE)) that distinguishes methylated and unmethylated CpG sites of a target DNA region, which can be used to prepare a kit for a method of diagnosing a large intestine tumor, screening for a predisposition to large intestine neoplasia or formation, monitoring large intestine tumor progression or prognosis, or monitoring response to treatment for a large intestine tumor in an individual, wherein the method comprises contacting DNA isolated in a biological sample of the individual with the at least one reagent and one or more oligonucleotides that hybridize to the target DNA region under stringent, moderately stringent, or highly stringent conditions. In some embodiments, the reagent is a bisulfite reagent or a Methylation Sensitive Restriction Enzyme (MSRE).

In another aspect, the present application provides a kit for diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to formation, or monitoring large intestine tumor progression or prognosis, comprising a first reagent comprising one or more oligonucleotides for use as detection tools as provided herein.

In some embodiments, the kit further comprises a second reagent comprising one or more reagents that distinguish methylated and unmethylated CpG sites of a region of DNA of interest as provided herein.

In some embodiments, the first and second agents are packaged in a single container or separately packaged in separate containers. In some embodiments, the kit further comprises a container suitable for holding a biological sample from the individual. In some embodiments, the kit further comprises instructions for use and/or interpretation of the results of the test of the kit.

In certain embodiments, the kit may further comprise a computer program product stored on a computer readable medium. When the computer program product is executed by a computer, it identifies an individual having a predisposition to develop or develop a colorectal neoplasm, or having a predisposition to poor prognosis or poor prognosis of a colorectal neoplasm, based on: a higher methylation state of the BCAN gene region detected in a biological sample from the individual relative to a normal methylation state of the BCAN gene region. The present application contemplates any medium that can store and communicate such computer-executable instructions to an end user. Such media include, but are not limited to, electronic storage media (e.g., magnetic disks, magnetic tape, magnetic cassettes (cartridges), chips), optical media (e.g., CD ROMs), and the like. Such media may include the web address of an internet website that provides such instructional material.

Computer programs may also be encoded and transmitted using carrier wave signals adapted for transmission over wired, optical, and/or wireless networks conforming to various protocols including the internet. Thus, such program-encoded data signals may be used to create a computer-readable medium according to embodiments of the present application. The computer readable medium encoded with the program code may be packaged with a compatible device or provided separately from other devices (e.g., via internet download). Any such computer-readable media may reside on or within a single computer product (e.g., a hard drive, a CD, or an entire computer system), and may exist on or within different computer products within a system or network.

In some embodiments, the kit may comprise a natural or synthetic control DNA sequence representing a methylated or unmethylated version of a target DNA region. In some embodiments, the kit may further comprise a detectable label, optionally linked to the first reagent. In some embodiments, other materials useful in performing the methods provided herein are included in the kit, such as test tubes, pipettes, and the like.

In some embodiments, the kit includes,

(a) a bisulfite reagent or a methylation sensitive restriction enzyme reagent;

(c) one or more sets of primers comprising a sequence complementary to or identical to a sequence of at least 9 consecutive nucleotides of a sequence of a region of the BCAN gene in bisulfite or methylation sensitive restriction enzyme treated DNA; and optionally also (c) a second set of one or more of,

(d) instructions for use and/or interpretation of the results of the test kit.

Detailed Description

Example 1 verification of methylation specific primers, probes

Bisulfite treated reference DNA was selected to verify primer specificity. First, primers and probes were designed for a target DNA region in the BCAN gene region and an internal reference gene ACTB, respectively. The gradient was then applied to methylated DNA (Qiagen 59655) to unmethylated DNA (Qiagen 59665) at ratios of 100%, 50%, 25%, 10%, and the total amount of DNA was 4 ng. Finally, the designed primers were used to amplify the DNA in the DNA mixture of each gradient, repeated twice. The sequences of primers and probes used to detect BCAN, and methylation-free specific primers and probes used to detect the reference gene ACTB are shown in Table 1. In the PCR reaction system, the final concentration of the primer was 500nM and the final concentration of the probe was 100 nM.

TABLE 1 primer sequences and Probe sequences of the target DNA region and the reference Gene ACTB within the BCAN Gene region

The PCR reaction system is as follows: 4ng DNA mixture of different methylation ratio 10 ul; 2.5ul of the primer and probe premix shown in Table 1; PCR reagents (EpiTect MethyLight PCR kit, Qiagen)12.5 ul.

The PCR reaction conditions were as follows: 5 minutes at 95 ℃; 95 ℃ for 15 seconds, 56 ℃ for 40 seconds (fluorescence acquisition), 50 cycles. Aiming at the modification of fluorescence by different gene probes, selecting corresponding detection fluorescence channels, and detecting by using an ABI 7500Real-Time PCR instrument.

Results

Ct values were calculated for each PCR reaction and analyzed for each gene in each DNA mixture. The results show that the Ct value decreases with increasing percentage of converted methylated DNA in the DNA mixture for BCAN (as shown in fig. 1A), indicating that the primers used to amplify the target of the BCAN gene region are methylation specific primers. While the curves for each DNA mixture for the reference gene ACTB coincided (as shown in fig. 1B), this indicates that the Ct values remained unchanged despite the increased percentage of methylated DNA converted in the DNA mixture, indicating that the primers used to amplify the reference gene ACTB were non-methylation specific primers.

Example 2 comparison of methylation abundance of BCAN in different tissues

The methylation abundance of the target BCAN gene region is detected by using blood cells from an enteroscope negative individual, paracarcinoma tissues and colorectal carcinoma tissues from a colorectal carcinoma individual and DNA samples of high-grade adenoma tissues from an adenoma individual to explore the potential of the target in colorectal carcinoma blood screening.

The detection comprises the following steps:

1. 10 DNA samples (i.e., 40 samples in total) were taken from each of blood cells, paracarcinoma tissue, high-grade adenoma tissue, and colorectal cancer tissue, respectively. Extracting blood cell DNA by adopting a commercial Kit QIAamp DNA Mini Kit according to the instruction; for paracarcinoma tissues, high-grade adenoma tissues and colorectal cancer tissues, DNA was extracted using a commercial Kit QIAamp DNA FFPE Tissue Kit according to the instruction.

2. Using a commercial bisulfite conversion reagent, Methylcode^TMThe bisufite Conversion Kit was used to perform sulfite Conversion treatment on the DNA sample obtained in step 1 to obtain a converted DNA.

3. The transformed DNA was subjected to fluorescent PCR detection using the primer and probe sequences shown in Table 1, and the reference gene ACTB was simultaneously detected as a control.

The final concentration of the primer was 500nM, the final concentration of the probe was 100nM, and the probe was labeled with a fluorophore VIC and a quencher BHQ 1.

The PCR reaction system is as follows: 10ul of DNA after transformation; 2.5ul of the primer and probe premix shown in Table 1; PCR reagent (PCR mix)

Universal Probe qPCR Master Mix(NEB))12.5ul。

The PCR reaction conditions were as follows: 3 minutes at 95 ℃; 30 seconds at 95 ℃ and 60 seconds at 56 ℃ (fluorescence collected), 15 cycles. Aiming at the modification of fluorescence by different gene probes, selecting corresponding detection fluorescence channels, and detecting by using an ABI 7500Real-Time PCR instrument.

4. And calculating and summarizing the Ct value of each detection, and comparing the Ct value distribution of blood cells, paracarcinoma tissues, high-grade adenoma tissues and colorectal cancer tissue samples.

Results

The results show that the methylation abundance of the BCAN gene region in blood cells is far lower than that of tissue samples, and lower than that of high-grade adenoma tissues and colorectal cancer tissues in paracarcinoma tissues (see FIG. 2A), and the potential for blood screening is realized. The reference gene ACTB of fig. 2B served as a control.

Example 3 detection of BCAN methylation Using extracellular free DNA

Plasma samples from 130 colorectal cancer individuals and plasma samples from 116 enteroscope negative individuals were tested using the fluorescent PCR assay. Of the plasma samples of 130 colorectal cancer subjects, there were 25 stage I samples, 33 stage II samples, 40 stage III samples, 22 stage IV samples, and 10 stage information.

The detection comprises the following steps:

1. extracellular free DNA from the plasma samples was extracted using the commercial Qiagen QIAamp Circulating Nucleic Acid Kit.

2. Using a commercial bisulfite conversion reagent, Methylcode^TMThe bisufite Conversion Kit was used to perform sulfite Conversion treatment on the extracted extracellular free DNA to obtain a converted DNA.

3. The DNA after the transformation is diluted by 10 times and used for fluorescent PCR detection. Primers, detection probe sequences as shown in table 1 were used, and the reference gene ACTB was simultaneously detected as a control. The final concentration of the primers was 500nM and the final concentration of the probes was 200 nM. Selection of commercial PCR mix reagents, NEB

Universal Probe qPCR Master Mix (NEB) was used as the PCR reagent.

The PCR reaction system was the same as in example 2. The PCR reaction conditions were as follows: 5 minutes at 95 ℃; 95 ℃ for 15 seconds, 56 ℃ for 40 seconds (fluorescence acquisition), 50 cycles. And aiming at the modified fluorescence of different gene probes, selecting corresponding detection fluorescence channels.

5. Ct values for each colorectal cancer plasma sample and enteroscopy negative plasma sample were calculated and summarized, and the results are shown in fig. 3. Where the Ct value of the sample without any amplified signal was set to 50.

6. Interpretation criteria: positive results are obtained when the Ct value of the BCAN is less than or equal to 27 and the Ct value of the ACTB is less than or equal to 25; the Ct value of BCAN is greater than 27, and the Ct value of ACTB is less than or equal to 25, which is negative; and the ACTB Ct value is more than 25, and the detection fails and needs to be detected again.

Results

As can be seen from fig. 3, the methylation level of the BCAN gene region in the plasma sample of the colorectal cancer individual was significantly higher than that of the BCAN gene region in the plasma sample of the enteroscope-negative individual. By SPSS independent sample equal variance T test, the p value is 3.32E-13, which is far less than the common statistical significance threshold of 0.05.

The number of positive and negative samples of colorectal cancer detected by the method described herein are shown in table 2 and compared to the results of enteroscopy, respectively. The results show that 66 of the 130 colorectal cancer samples were detected by the method described in the application (the sensitivity is up to 50.7%); of the 116 enteroscopy negative samples, 99 were detected by the method described in this application (specificity up to 84.6%). Therefore, the method has higher sensitivity and specificity for colorectal cancer screening. In contrast, Septin9 currently accepted for plasma detection has a detection rate of 48.2% of intestinal cancer in clinical test samples (see, T.R. Church et al, Gut.; 63: 317-325 (2014)).

TABLE 2 comparison of the results of the test with the results of the enteroscopy according to the methods of the present application

Sequence listing

<110> Shanghai Kun Yuansheng science & technology Limited

<120> method and kit for screening large intestine tumor by detecting methylation state of BCAN gene region

<130> 071918-8009CN02

<160> 18

<170> PatentIn version 3.5

<210> 1

<211> 1269

<212> DNA

<213> Intelligent people

<400> 1

catagctgcc tccagggagg tagctacggt cctttgcacc ccattctgcc tccagaaaag 60

agttttccat tttttttatt agaaagggtg tctcttttca ggagcaaagc ccccattctc 120

ccttcatcca cttcttacag tctaattgac tccctcctcc ttcttctttg aacaacgaga 180

agactctcca gttgtccaac ttccacccct ccagctgcaa catcgtcatc ctttagctca 240

gcgaacgctg ggcgaacgct ccctccccgc ccctcctgcc cctcctccct actccaagcc 300

ctcggcttct catccgctga acgatgtcct acttcgctcg tccttgctct cgccgctgct 360

gccggagccg aagcagagaa ggcagcgggt cccgtgaccg tcccgagagc cccgcgctcc 420

cgaccagggg gcgggggcgg ccccggggag ggcggggcag gggcgggggg aagaaagggg 480

gttttgtgct gcgccgggag ggccggcgcc ctcttccgaa tgtcctgcgg ccccagcctc 540

tcctcacgct cgcgcagtct ccgccgcagt ctcagctgca gctgcaggac tgagccgtgc 600

acccggagga gacccccgga ggaggcgaca aacttcgcag tgccgcgacc caaccccagc 660

cctgggtagg tgagtgcctc cgcagccccg ccgcccgccg tggggtcggg gacagggaga 720

agggagtgcc tgcctggtct gcgccccccg cctgtcagcc cttgcctcga ggctctgggg 780

cacccaactc gtcgactcct gacaccgcag cggggtaggc tgctggacag ccccgagcgc 840

ctgcagctgc tgctgccatc tctgatctac atgcttccag ctctgccagt ggcagccccc 900

ctgctgctcg cagtctgatc agcaacccct cgggtcctcg catcttccct gctgcgcgct 960

cctgtcccag cgcggccgcc gagatttccg accttgtccc aggcagggcg gtagcgttcc 1020

ggatcagtcc ttgcctccgt gcccccacgc acaggcagct ccaggagcag cggccagcaa 1080

cccttctggg gacaccttac tgtagtccgg caggacagcc gatcagagcc gctctagggg 1140

gtggtcggag tgcccatttc ggctggaatc ccaactcggc tccttgctct gtgaccttgg 1200

ggtagttagt tgacttctct gaacctcggg ttcctcatcg gtgtaatgag caaaacataa 1260

acaatcttt 1269

<210> 2

<211> 815

<212> DNA

<213> Intelligent people

<400> 2

ggaatcctgg gggctgaatt gactgggaga ctttggggga tgggtctgga gaccgtcggg 60

gtggtcctgg aggacctaga ggtagggctg caggaccctg gcccctggcc cctggcccct 120

ggtcctaggg gggccgggga atcctggggc cggaaggagg gatcctggag cggggcttgg 180

aggccaccgg gtgggactct gagggtcgac agcgttaagt tccagccggc tccacccgtt 240

cacagaggac cgcgcttttc gcgtgcgcat cgcgggcgac gcgccactgc agggcgtgct 300

cggcggcgcc ctcaccatcc cttgccacgt ccactacctg cggccaccgc cgagccgccg 360

ggctgtgctg ggctctccgc gggtcaagtg gactttcctg tcccggggcc gggaggcaga 420

ggtgctggtg gcgcggggag tgcgcgtcaa ggtgaacgag gcctaccggt tccgcgtggc 480

actgcctgcg tacccagcgt cgctcaccga cgtctccctg gcgctgagcg agctgcgccc 540

caacgactca ggtatctatc gctgtgaggt ccagcacggc atcgatgaca gcagcgacgc 600

tgtggaggtc aaggtcaaag gtgagagggc agggaggttc cagagggagg gagggaggga 660

gggaagggag gactcttgcc ttcggggatc ccacagtgtg agagggaagc aaaggtagct 720

ggaaggcgca gcctgggttg gaaaaagagt gaggagacac gggcctttgt tgtctccttt 780

ctctcttcag gtggaggaca ttctacccac aatct 815

<210> 3

<211> 4508

<212> DNA

<213> Intelligent people

<400> 3

cctcgctccc cccgcctcac ttctttcccc ctctcaggtg actgtgtccc cagcccctgc 60

cacaatggtg ggacatgctt ggaggaggag gaaggggtcc gctgcctatg tctgcctggc 120

tatggggggg acctgtgcga tgttggtgag tgttgaggga cggggggcag gtttgaagcc 180

tggaccctgc cacaacgtgc tacttctgga ggggggaggg agaacattgg ttttggcctt 240

gtcattaatg agtccctgtt ttaggcaagt tgcataactt ctttgagtcc taccctcaat 300

tttcttatct aagtgaaacc acaatgcctc tcataggggg tccatttgag accagtgcaa 360

agcatactcc tggcatttaa tcggtggtca atacatgaca ggctccattc tcctggagag 420

gagagccact gctcgttagg atggagaccc aggccggaac tccatccctc accctggttc 480

ctgtctctta gaaaaggcac cagcgcccct gcccaagagc ccctccaggc tcctgctacc 540

ccctcattct ctactagctc ttttgcaccg ccctcctgtc ccccttagtc ccgcccctct 600

cggcctgcgg tagtggaagg agaccagccc cttccagggg acctggccct ctgggttttg 660

gggccctaag atgcccgccc ttatgtgccg caggcctccg cttctgcaac cccggctggg 720

acgccttcca gggcgcctgc tacaagcact tttccacacg aaggagctgg gaggaggcag 780

agacccagtg ccggatgtac ggcgcgcatc tggccagcat cagcacaccc gaggaacagg 840

acttcatcaa cagtgggctg ggagacaggg cgggaggggc ccctgccata tgctctcact 900

ctctctcact cgcctaaccg ccttcctcat taacccatgc acttattcct tggttttctc 960

aagcgtgcat tccctcactc attcgttcac tccccttctc attctctctc ccttcccacc 1020

ctacgcttag gcagtggcct tcgggaacgg agagtggagg ttcgcgcagt agagtgcgcc 1080

tgtgtgggcc gggccgccgt gcagggggcc gcctccaatc cctccaacct ccctgctctc 1140

cgacctccgt cggcctcctc caactccaac tccaatcttg ttgaaagttt tgactctttt 1200

tccaaaactc cccttttcta gcctgggttg atatcttcct tattctccca cccccattcc 1260

cctgctttcc atctggccct tgagcagagg ctggggtaga agaacccgac aagggcgggt 1320

gctggatcgc ggggaagggt ttccaaggca gtcaccgcag accgcccggg agcggggaac 1380

ggccgccatc tgctggcggc tgcgctcact gcacgccttc gtctccctag accggtaccg 1440

ggagtaccag tggatcggac tcaacgacag gaccatcgaa ggcgacttct tgtggtcgga 1500

tggcgtcccc ctggtgagag gccccagtcg aaccccgccg tctagctcac ttcctctaag 1560

cacttctgtt ccctaccacc cccacccctc ccgaccctgt ccccttcttt ttccggcctc 1620

cttccctttc tcgtgccctg tgcctcttct ccctgggctc tcctcccttc gttgtgtcct 1680

ctttcttccc ttctggctcc cattctccct cccctaaagt ccctgccctc tcctttcccc 1740

ttccccggga gatcccctac cccctagccc taaccttccc tctcctgggg ccccgctcac 1800

cagccctcct ccccagatcc tctaggccct ctcccggtgc tcctggtgta ggagctcctc 1860

accacctcct ccgttccccc agctctatga gaactggaac cctgggcagc ctgacagcta 1920

cttcctgtct ggagagaact gcgtggtcat ggtgtggcat gatcagggac aatggagtga 1980

cgtgccctgc aactaccacc tgtcctacac ctgcaagatg gggctgggtg agggcaggca 2040

aaggagggtc ccagcaagga agtggagggg tgggctaggg gaccagaggg actgatgttt 2100

gtagacagag agtgcaaagc aacatagagg agtcagaacg tgttccagac catgggagag 2160

ctaacaagtt acgtgggtcc actcggaatc cctgatcttt ttttgtcatg ttgtggccca 2220

tttttctctt ccccatggag attctgggaa ctgtcaccca cagagccagg ctcagttcct 2280

aactgtcttc ctttgcagtg tcctgtgggc cgccaccgga gctgcccctg gctcaagtgt 2340

tcggccgccc acggctgcgc tatgaggtgg acactgtgct tcgctaccgg tgccgggaag 2400

gactggccca gcgcaatctg ccgctgatcc gatgccaaga gaacggtcgt tgggaggccc 2460

cccagatctc ctgtgtgccc agaagacctg tgagtgccag gaagaggcag gtgggagtgg 2520

gagacagtag ccaacagtag ccttggactc cacttaaagt cctgcctgtc actggccatg 2580

tgaccttgga gccatcactg cccctctctg aggcaaaggg gaagaggtgg gctggaggct 2640

ctggggttcc ttcagtgctg atgtctgata acatgcagcc ccattctggg ctcttacggg 2700

ctgagcaaga acatcagagg gcaggctctg aggagaggag aaggaagagc cagggtggag 2760

ggtgagtgtg tgtcttcccc aggcccgagc tctgcaccca gaggaggacc cagaaggacg 2820

tcaggggagg ctactgggac gctggaaggc gctgttgatc cccccttcca gccccatgcc 2880

aggtccctag ggggcaaggc cttgaacact gccggccaca gcactgccct gtcacccaaa 2940

ttttccctca caccctgcgc tcccgccacc acaggaagtg acaacatgac gaggggtggt 3000

actggagtcc aggtgacagt tcctgaaggg gcttctggga aatacctagg aggctccagc 3060

ccagcccagg ccctctcccc ctaccctggg caccagatct tccatcaggg ccggagtaaa 3120

tccctaagtg cctcaactgc cctctccctg gcagccatct tgtcccctct attcctctag 3180

ggagcactgt gcccactctt tctgggtttt ccaagggaat gggcttgcag gatggagtgt 3240

ctgtaaaatc aacaggaaat aaaactgtgt atgagcccag gcaagttgga tgcttctgtg 3300

tgtatgtccg tgacagacag agagaggtgt ggttgggcag ggcatcatag gatatataga 3360

gcttcggggt ttattcgctt ccaaaggtca gagacgtccc caagatgtca gcaagtagaa 3420

cagtgccaga atagctgcca ggaagtactt atggaatgaa ggaaggcaca ggggttgggg 3480

gacagctgga gtgatgcagc atgtttgcaa agagatggag tgccctgagt gcctaagagt 3540

caagtgaacg tcaatgagtt ctgtcctggg agggagaagg gctggggtcc cagagaggaa 3600

ggcagaggtt ggtgccttgg tgtcccagtt ctgagcttcc ggaagggccg gccttccctc 3660

atgggggtgt gagagtgagg gtgatgggag agctccgctg gcactgcagc atgtctgggg 3720

gttaggccgc aggaaggttt acgtccagca gaggaggcag agatgcaaga aatagggaaa 3780

caaactaagg gccaagggga ggttcccagc cctgcggtgg actgggcttc ggggaacgaa 3840

ctgggggccc gcacaggcag cggccagcag agggcgccgc ggacccagca cggtgctctg 3900

agagtgccgt gtacgcgtgc gccggtggag acgggcagag gggtgcgagg agccccagga 3960

tcccgctagg gggcgccgcg gacttgcgtc ctgaggaggc gggaggggaa ggggggtggc 4020

tggctatgtg ggggggttag acttccggcc aggctgatct ggccctgggg gctgtgagtc 4080

agcggaggtt gagaggatga ggtcactcag agaactggag agtgacccag cgcccgcgtg 4140

tgcctgtgtg tgtgtgtgtg tgtacgcgtg cgtgtgtgta cgcgcatgcg tgtgtgtgag 4200

tgtgcaccct tctcccagtg cacagaattg ttggtgaagt gcatgtcagg atgcagtctg 4260

tcctcatgat gaggatgaat cattgctgca gatcctcagg cacacacggt cacacatagg 4320

cacacacgtg cacactgtcg tgtgtacaca ctcctgcatg tgcccactta gttacagcac 4380

atcacccaca tgggcaatac ttattccttc tctgaagcca gtaaaatcca gagacaggga 4440

gacagatccg gaggagcaaa ggctgatagt aatacgggga gacccagaga tagtgggcaa 4500

gacaggca 4508

<210> 4

<211> 1269

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 4

tatagttgtt tttagggagg tagttacggt tttttgtatt ttattttgtt tttagaaaag 60

agttttttat tttttttatt agaaagggtg ttttttttta ggagtaaagt ttttattttt 120

tttttattta ttttttatag tttaattgat tttttttttt tttttttttg aataacgaga 180

agatttttta gttgtttaat ttttattttt ttagttgtaa tatcgttatt ttttagttta 240

gcgaacgttg ggcgaacgtt tttttttcgt tttttttgtt tttttttttt attttaagtt 300

ttcggttttt tattcgttga acgatgtttt atttcgttcg tttttgtttt cgtcgttgtt 360

gtcggagtcg aagtagagaa ggtagcgggt ttcgtgatcg tttcgagagt ttcgcgtttt 420

cgattagggg gcgggggcgg tttcggggag ggcggggtag gggcgggggg aagaaagggg 480

gttttgtgtt gcgtcgggag ggtcggcgtt ttttttcgaa tgttttgcgg ttttagtttt 540

tttttacgtt cgcgtagttt tcgtcgtagt tttagttgta gttgtaggat tgagtcgtgt 600

attcggagga gattttcgga ggaggcgata aatttcgtag tgtcgcgatt taattttagt 660

tttgggtagg tgagtgtttt cgtagtttcg tcgttcgtcg tggggtcggg gatagggaga 720

agggagtgtt tgtttggttt gcgtttttcg tttgttagtt tttgtttcga ggttttgggg 780

tatttaattc gtcgattttt gatatcgtag cggggtaggt tgttggatag tttcgagcgt 840

ttgtagttgt tgttgttatt tttgatttat atgtttttag ttttgttagt ggtagttttt 900

ttgttgttcg tagtttgatt agtaattttt cgggttttcg tatttttttt gttgcgcgtt 960

tttgttttag cgcggtcgtc gagattttcg attttgtttt aggtagggcg gtagcgtttc 1020

ggattagttt ttgttttcgt gtttttacgt ataggtagtt ttaggagtag cggttagtaa 1080

tttttttggg gatattttat tgtagttcgg taggatagtc gattagagtc gttttagggg 1140

gtggtcggag tgtttatttc ggttggaatt ttaattcggt tttttgtttt gtgattttgg 1200

ggtagttagt tgattttttt gaatttcggg ttttttatcg gtgtaatgag taaaatataa 1260

ataattttt 1269

<210> 5

<211> 815

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 5

ggaattttgg gggttgaatt gattgggaga ttttggggga tgggtttgga gatcgtcggg 60

gtggttttgg aggatttaga ggtagggttg taggattttg gtttttggtt tttggttttt 120

ggttttaggg gggtcgggga attttggggt cggaaggagg gattttggag cggggtttgg 180

aggttatcgg gtgggatttt gagggtcgat agcgttaagt tttagtcggt tttattcgtt 240

tatagaggat cgcgtttttc gcgtgcgtat cgcgggcgac gcgttattgt agggcgtgtt 300

cggcggcgtt tttattattt tttgttacgt ttattatttg cggttatcgt cgagtcgtcg 360

ggttgtgttg ggtttttcgc gggttaagtg gatttttttg tttcggggtc gggaggtaga 420

ggtgttggtg gcgcggggag tgcgcgttaa ggtgaacgag gtttatcggt ttcgcgtggt 480

attgtttgcg tatttagcgt cgtttatcga cgtttttttg gcgttgagcg agttgcgttt 540

taacgattta ggtatttatc gttgtgaggt ttagtacggt atcgatgata gtagcgacgt 600

tgtggaggtt aaggttaaag gtgagagggt agggaggttt tagagggagg gagggaggga 660

gggaagggag gatttttgtt ttcggggatt ttatagtgtg agagggaagt aaaggtagtt 720

ggaaggcgta gtttgggttg gaaaaagagt gaggagatac gggtttttgt tgtttttttt 780

ttttttttag gtggaggata ttttatttat aattt 815

<210> 6

<211> 4508

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 6

tttcgttttt ttcgttttat tttttttttt tttttaggtg attgtgtttt tagtttttgt 60

tataatggtg ggatatgttt ggaggaggag gaaggggttc gttgtttatg tttgtttggt 120

tatggggggg atttgtgcga tgttggtgag tgttgaggga cggggggtag gtttgaagtt 180

tggattttgt tataacgtgt tatttttgga ggggggaggg agaatattgg ttttggtttt 240

gttattaatg agtttttgtt ttaggtaagt tgtataattt ttttgagttt tatttttaat 300

ttttttattt aagtgaaatt ataatgtttt ttataggggg tttatttgag attagtgtaa 360

agtatatttt tggtatttaa tcggtggtta atatatgata ggttttattt ttttggagag 420

gagagttatt gttcgttagg atggagattt aggtcggaat tttatttttt attttggttt 480

ttgtttttta gaaaaggtat tagcgttttt gtttaagagt ttttttaggt ttttgttatt 540

tttttatttt ttattagttt ttttgtatcg tttttttgtt ttttttagtt tcgttttttt 600

cggtttgcgg tagtggaagg agattagttt tttttagggg atttggtttt ttgggttttg 660

gggttttaag atgttcgttt ttatgtgtcg taggttttcg tttttgtaat ttcggttggg 720

acgtttttta gggcgtttgt tataagtatt tttttatacg aaggagttgg gaggaggtag 780

agatttagtg tcggatgtac ggcgcgtatt tggttagtat tagtatattc gaggaatagg 840

attttattaa tagtgggttg ggagataggg cgggaggggt ttttgttata tgtttttatt 900

tttttttatt cgtttaatcg ttttttttat taatttatgt atttattttt tggttttttt 960

aagcgtgtat ttttttattt attcgtttat tttttttttt attttttttt tttttttatt 1020

ttacgtttag gtagtggttt tcgggaacgg agagtggagg ttcgcgtagt agagtgcgtt 1080

tgtgtgggtc gggtcgtcgt gtagggggtc gtttttaatt tttttaattt ttttgttttt 1140

cgattttcgt cggttttttt taattttaat tttaattttg ttgaaagttt tgattttttt 1200

tttaaaattt ttttttttta gtttgggttg atattttttt tattttttta tttttatttt 1260

tttgtttttt atttggtttt tgagtagagg ttggggtaga agaattcgat aagggcgggt 1320

gttggatcgc ggggaagggt ttttaaggta gttatcgtag atcgttcggg agcggggaac 1380

ggtcgttatt tgttggcggt tgcgtttatt gtacgttttc gtttttttag atcggtatcg 1440

ggagtattag tggatcggat ttaacgatag gattatcgaa ggcgattttt tgtggtcgga 1500

tggcgttttt ttggtgagag gttttagtcg aatttcgtcg tttagtttat tttttttaag 1560

tatttttgtt ttttattatt tttatttttt tcgattttgt tttttttttt tttcggtttt 1620

tttttttttt tcgtgttttg tgtttttttt ttttgggttt tttttttttc gttgtgtttt 1680

tttttttttt ttttggtttt tatttttttt tttttaaagt ttttgttttt tttttttttt 1740

tttttcggga gattttttat tttttagttt taattttttt ttttttgggg tttcgtttat 1800

tagttttttt ttttagattt tttaggtttt ttttcggtgt ttttggtgta ggagtttttt 1860

attatttttt tcgttttttt agttttatga gaattggaat tttgggtagt ttgatagtta 1920

ttttttgttt ggagagaatt gcgtggttat ggtgtggtat gattagggat aatggagtga 1980

cgtgttttgt aattattatt tgttttatat ttgtaagatg gggttgggtg agggtaggta 2040

aaggagggtt ttagtaagga agtggagggg tgggttaggg gattagaggg attgatgttt 2100

gtagatagag agtgtaaagt aatatagagg agttagaacg tgttttagat tatgggagag 2160

ttaataagtt acgtgggttt attcggaatt tttgattttt ttttgttatg ttgtggttta 2220

tttttttttt ttttatggag attttgggaa ttgttattta tagagttagg tttagttttt 2280

aattgttttt ttttgtagtg ttttgtgggt cgttatcgga gttgtttttg gtttaagtgt 2340

tcggtcgttt acggttgcgt tatgaggtgg atattgtgtt tcgttatcgg tgtcgggaag 2400

gattggttta gcgtaatttg tcgttgattc gatgttaaga gaacggtcgt tgggaggttt 2460

tttagatttt ttgtgtgttt agaagatttg tgagtgttag gaagaggtag gtgggagtgg 2520

gagatagtag ttaatagtag ttttggattt tatttaaagt tttgtttgtt attggttatg 2580

tgattttgga gttattattg tttttttttg aggtaaaggg gaagaggtgg gttggaggtt 2640

ttggggtttt tttagtgttg atgtttgata atatgtagtt ttattttggg tttttacggg 2700

ttgagtaaga atattagagg gtaggttttg aggagaggag aaggaagagt tagggtggag 2760

ggtgagtgtg tgtttttttt aggttcgagt tttgtattta gaggaggatt tagaaggacg 2820

ttaggggagg ttattgggac gttggaaggc gttgttgatt ttttttttta gttttatgtt 2880

aggtttttag ggggtaaggt tttgaatatt gtcggttata gtattgtttt gttatttaaa 2940

ttttttttta tattttgcgt tttcgttatt ataggaagtg ataatatgac gaggggtggt 3000

attggagttt aggtgatagt ttttgaaggg gtttttggga aatatttagg aggttttagt 3060

ttagtttagg tttttttttt ttattttggg tattagattt tttattaggg tcggagtaaa 3120

tttttaagtg ttttaattgt tttttttttg gtagttattt tgtttttttt atttttttag 3180

ggagtattgt gtttattttt tttgggtttt ttaagggaat gggtttgtag gatggagtgt 3240

ttgtaaaatt aataggaaat aaaattgtgt atgagtttag gtaagttgga tgtttttgtg 3300

tgtatgttcg tgatagatag agagaggtgt ggttgggtag ggtattatag gatatataga 3360

gtttcggggt ttattcgttt ttaaaggtta gagacgtttt taagatgtta gtaagtagaa 3420

tagtgttaga atagttgtta ggaagtattt atggaatgaa ggaaggtata ggggttgggg 3480

gatagttgga gtgatgtagt atgtttgtaa agagatggag tgttttgagt gtttaagagt 3540

taagtgaacg ttaatgagtt ttgttttggg agggagaagg gttggggttt tagagaggaa 3600

ggtagaggtt ggtgttttgg tgttttagtt ttgagttttc ggaagggtcg gttttttttt 3660

atgggggtgt gagagtgagg gtgatgggag agtttcgttg gtattgtagt atgtttgggg 3720

gttaggtcgt aggaaggttt acgtttagta gaggaggtag agatgtaaga aatagggaaa 3780

taaattaagg gttaagggga ggtttttagt tttgcggtgg attgggtttc ggggaacgaa 3840

ttgggggttc gtataggtag cggttagtag agggcgtcgc ggatttagta cggtgttttg 3900

agagtgtcgt gtacgcgtgc gtcggtggag acgggtagag gggtgcgagg agttttagga 3960

tttcgttagg gggcgtcgcg gatttgcgtt ttgaggaggc gggaggggaa ggggggtggt 4020

tggttatgtg ggggggttag attttcggtt aggttgattt ggttttgggg gttgtgagtt 4080

agcggaggtt gagaggatga ggttatttag agaattggag agtgatttag cgttcgcgtg 4140

tgtttgtgtg tgtgtgtgtg tgtacgcgtg cgtgtgtgta cgcgtatgcg tgtgtgtgag 4200

tgtgtatttt ttttttagtg tatagaattg ttggtgaagt gtatgttagg atgtagtttg 4260

tttttatgat gaggatgaat tattgttgta gatttttagg tatatacggt tatatatagg 4320

tatatacgtg tatattgtcg tgtgtatata tttttgtatg tgtttattta gttatagtat 4380

attatttata tgggtaatat ttattttttt tttgaagtta gtaaaattta gagataggga 4440

gatagattcg gaggagtaaa ggttgatagt aatacgggga gatttagaga tagtgggtaa 4500

gataggta 4508

<210> 7

<211> 1269

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 7

cataactacc tccaaaaaaa taactacgat cctttacacc ccattctacc tccaaaaaaa 60

aattttccat tttttttatt aaaaaaaata tctcttttca aaaacaaaac ccccattctc 120

ccttcatcca cttcttacaa tctaattaac tccctcctcc ttcttcttta aacaacgaaa 180

aaactctcca attatccaac ttccacccct ccaactacaa catcgtcatc ctttaactca 240

acgaacgcta aacgaacgct ccctccccgc ccctcctacc cctcctccct actccaaacc 300

ctcgacttct catccgctaa acgatatcct acttcgctcg tccttactct cgccgctact 360

accgaaaccg aaacaaaaaa aacaacgaat cccgtaaccg tcccgaaaac cccgcgctcc 420

cgaccaaaaa acgaaaacga ccccgaaaaa aacgaaacaa aaacgaaaaa aaaaaaaaaa 480

attttatact acgccgaaaa aaccgacgcc ctcttccgaa tatcctacga ccccaacctc 540

tcctcacgct cgcgcaatct ccgccgcaat ctcaactaca actacaaaac taaaccgtac 600

acccgaaaaa aacccccgaa aaaaacgaca aacttcgcaa taccgcgacc caaccccaac 660

cctaaataaa taaatacctc cgcaaccccg ccgcccgccg taaaatcgaa aacaaaaaaa 720

aaaaaatacc tacctaatct acgccccccg cctatcaacc cttacctcga aactctaaaa 780

cacccaactc gtcgactcct aacaccgcaa cgaaataaac tactaaacaa ccccgaacgc 840

ctacaactac tactaccatc tctaatctac atacttccaa ctctaccaat aacaaccccc 900

ctactactcg caatctaatc aacaacccct cgaatcctcg catcttccct actacgcgct 960

cctatcccaa cgcgaccgcc gaaatttccg accttatccc aaacaaaacg ataacgttcc 1020

gaatcaatcc ttacctccgt acccccacgc acaaacaact ccaaaaacaa cgaccaacaa 1080

cccttctaaa aacaccttac tataatccga caaaacaacc gatcaaaacc gctctaaaaa 1140

ataatcgaaa tacccatttc gactaaaatc ccaactcgac tccttactct ataaccttaa 1200

aataattaat taacttctct aaacctcgaa ttcctcatcg atataataaa caaaacataa 1260

acaatcttt 1269

<210> 8

<211> 815

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 8

aaaatcctaa aaactaaatt aactaaaaaa ctttaaaaaa taaatctaaa aaccgtcgaa 60

ataatcctaa aaaacctaaa aataaaacta caaaacccta acccctaacc cctaacccct 120

aatcctaaaa aaaccgaaaa atcctaaaac cgaaaaaaaa aatcctaaaa cgaaacttaa 180

aaaccaccga ataaaactct aaaaatcgac aacgttaaat tccaaccgac tccacccgtt 240

cacaaaaaac cgcgcttttc gcgtacgcat cgcgaacgac gcgccactac aaaacgtact 300

cgacgacgcc ctcaccatcc cttaccacgt ccactaccta cgaccaccgc cgaaccgccg 360

aactatacta aactctccgc gaatcaaata aactttccta tcccgaaacc gaaaaacaaa 420

aatactaata acgcgaaaaa tacgcgtcaa aataaacgaa acctaccgat tccgcgtaac 480

actacctacg tacccaacgt cgctcaccga cgtctcccta acgctaaacg aactacgccc 540

caacgactca aatatctatc gctataaaat ccaacacgac atcgataaca acaacgacgc 600

tataaaaatc aaaatcaaaa ataaaaaaac aaaaaaattc caaaaaaaaa aaaaaaaaaa 660

aaaaaaaaaa aactcttacc ttcgaaaatc ccacaatata aaaaaaaaac aaaaataact 720

aaaaaacgca acctaaatta aaaaaaaaat aaaaaaacac gaacctttat tatctccttt 780

ctctcttcaa ataaaaaaca ttctacccac aatct 815

<210> 9

<211> 4508

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 9

cctcgctccc cccgcctcac ttctttcccc ctctcaaata actatatccc caacccctac 60

cacaataata aaacatactt aaaaaaaaaa aaaaaaatcc gctacctata tctacctaac 120

tataaaaaaa acctatacga tattaataaa tattaaaaaa cgaaaaacaa atttaaaacc 180

taaaccctac cacaacgtac tacttctaaa aaaaaaaaaa aaaacattaa ttttaacctt 240

atcattaata aatccctatt ttaaacaaat tacataactt ctttaaatcc taccctcaat 300

tttcttatct aaataaaacc acaatacctc tcataaaaaa tccatttaaa accaatacaa 360

aacatactcc taacatttaa tcgataatca atacataaca aactccattc tcctaaaaaa 420

aaaaaccact actcgttaaa ataaaaaccc aaaccgaaac tccatccctc accctaattc 480

ctatctctta aaaaaaacac caacgcccct acccaaaaac ccctccaaac tcctactacc 540

ccctcattct ctactaactc ttttacaccg ccctcctatc ccccttaatc ccgcccctct 600

cgacctacga taataaaaaa aaaccaaccc cttccaaaaa acctaaccct ctaaatttta 660

aaaccctaaa atacccgccc ttatataccg caaacctccg cttctacaac cccgactaaa 720

acgccttcca aaacgcctac tacaaacact tttccacacg aaaaaactaa aaaaaaacaa 780

aaacccaata ccgaatatac gacgcgcatc taaccaacat caacacaccc gaaaaacaaa 840

acttcatcaa caataaacta aaaaacaaaa cgaaaaaaac ccctaccata tactctcact 900

ctctctcact cgcctaaccg ccttcctcat taacccatac acttattcct taattttctc 960

aaacgtacat tccctcactc attcgttcac tccccttctc attctctctc ccttcccacc 1020

ctacgcttaa acaataacct tcgaaaacga aaaataaaaa ttcgcgcaat aaaatacgcc 1080

tatataaacc gaaccgccgt acaaaaaacc gcctccaatc cctccaacct ccctactctc 1140

cgacctccgt cgacctcctc caactccaac tccaatctta ttaaaaattt taactctttt 1200

tccaaaactc cccttttcta acctaaatta atatcttcct tattctccca cccccattcc 1260

cctactttcc atctaaccct taaacaaaaa ctaaaataaa aaaacccgac aaaaacgaat 1320

actaaatcgc gaaaaaaaat ttccaaaaca atcaccgcaa accgcccgaa aacgaaaaac 1380

gaccgccatc tactaacgac tacgctcact acacgccttc gtctccctaa accgataccg 1440

aaaataccaa taaatcgaac tcaacgacaa aaccatcgaa aacgacttct tataatcgaa 1500

taacgtcccc ctaataaaaa accccaatcg aaccccgccg tctaactcac ttcctctaaa 1560

cacttctatt ccctaccacc cccacccctc ccgaccctat ccccttcttt ttccgacctc 1620

cttccctttc tcgtacccta tacctcttct ccctaaactc tcctcccttc gttatatcct 1680

ctttcttccc ttctaactcc cattctccct cccctaaaat ccctaccctc tcctttcccc 1740

ttccccgaaa aatcccctac cccctaaccc taaccttccc tctcctaaaa ccccgctcac 1800

caaccctcct ccccaaatcc tctaaaccct ctcccgatac tcctaatata aaaactcctc 1860

accacctcct ccgttccccc aactctataa aaactaaaac cctaaacaac ctaacaacta 1920

cttcctatct aaaaaaaact acgtaatcat aatataacat aatcaaaaac aataaaataa 1980

cgtaccctac aactaccacc tatcctacac ctacaaaata aaactaaata aaaacaaaca 2040

aaaaaaaatc ccaacaaaaa aataaaaaaa taaactaaaa aaccaaaaaa actaatattt 2100

ataaacaaaa aatacaaaac aacataaaaa aatcaaaacg tattccaaac cataaaaaaa 2160

ctaacaaatt acgtaaatcc actcgaaatc cctaatcttt ttttatcata ttataaccca 2220

tttttctctt ccccataaaa attctaaaaa ctatcaccca caaaaccaaa ctcaattcct 2280

aactatcttc ctttacaata tcctataaac cgccaccgaa actaccccta actcaaatat 2340

tcgaccgccc acgactacgc tataaaataa acactatact tcgctaccga taccgaaaaa 2400

aactaaccca acgcaatcta ccgctaatcc gataccaaaa aaacgatcgt taaaaaaccc 2460

cccaaatctc ctatataccc aaaaaaccta taaataccaa aaaaaaacaa ataaaaataa 2520

aaaacaataa ccaacaataa ccttaaactc cacttaaaat cctacctatc actaaccata 2580

taaccttaaa accatcacta cccctctcta aaacaaaaaa aaaaaaataa actaaaaact 2640

ctaaaattcc ttcaatacta atatctaata acatacaacc ccattctaaa ctcttacgaa 2700

ctaaacaaaa acatcaaaaa acaaactcta aaaaaaaaaa aaaaaaaaac caaaataaaa 2760

aataaatata tatcttcccc aaacccgaac tctacaccca aaaaaaaacc caaaaaaacg 2820

tcaaaaaaaa ctactaaaac gctaaaaaac gctattaatc cccccttcca accccatacc 2880

aaatccctaa aaaacaaaac cttaaacact accgaccaca acactaccct atcacccaaa 2940

ttttccctca caccctacgc tcccgccacc acaaaaaata acaacataac gaaaaataat 3000

actaaaatcc aaataacaat tcctaaaaaa acttctaaaa aatacctaaa aaactccaac 3060

ccaacccaaa ccctctcccc ctaccctaaa caccaaatct tccatcaaaa ccgaaataaa 3120

tccctaaata cctcaactac cctctcccta acaaccatct tatcccctct attcctctaa 3180

aaaacactat acccactctt tctaaatttt ccaaaaaaat aaacttacaa aataaaatat 3240

ctataaaatc aacaaaaaat aaaactatat ataaacccaa acaaattaaa tacttctata 3300

tatatatccg taacaaacaa aaaaaaatat aattaaacaa aacatcataa aatatataaa 3360

acttcgaaat ttattcgctt ccaaaaatca aaaacgtccc caaaatatca acaaataaaa 3420

caataccaaa ataactacca aaaaatactt ataaaataaa aaaaaacaca aaaattaaaa 3480

aacaactaaa ataatacaac atatttacaa aaaaataaaa taccctaaat acctaaaaat 3540

caaataaacg tcaataaatt ctatcctaaa aaaaaaaaaa actaaaatcc caaaaaaaaa 3600

aacaaaaatt aataccttaa tatcccaatt ctaaacttcc gaaaaaaccg accttccctc 3660

ataaaaatat aaaaataaaa ataataaaaa aactccgcta acactacaac atatctaaaa 3720

attaaaccgc aaaaaaattt acgtccaaca aaaaaaacaa aaatacaaaa aataaaaaaa 3780

caaactaaaa accaaaaaaa aattcccaac cctacgataa actaaacttc gaaaaacgaa 3840

ctaaaaaccc gcacaaacaa cgaccaacaa aaaacgccgc gaacccaaca cgatactcta 3900

aaaataccgt atacgcgtac gccgataaaa acgaacaaaa aaatacgaaa aaccccaaaa 3960

tcccgctaaa aaacgccgcg aacttacgtc ctaaaaaaac gaaaaaaaaa aaaaaataac 4020

taactatata aaaaaattaa acttccgacc aaactaatct aaccctaaaa actataaatc 4080

aacgaaaatt aaaaaaataa aatcactcaa aaaactaaaa aataacccaa cgcccgcgta 4140

tacctatata tatatatata tatacgcgta cgtatatata cgcgcatacg tatatataaa 4200

tatacaccct tctcccaata cacaaaatta ttaataaaat acatatcaaa atacaatcta 4260

tcctcataat aaaaataaat cattactaca aatcctcaaa cacacacgat cacacataaa 4320

cacacacgta cacactatcg tatatacaca ctcctacata tacccactta attacaacac 4380

atcacccaca taaacaatac ttattccttc tctaaaacca ataaaatcca aaaacaaaaa 4440

aacaaatccg aaaaaacaaa aactaataat aatacgaaaa aacccaaaaa taataaacaa 4500

aacaaaca 4508

<210> 10

<211> 501

<212> DNA

<213> Intelligent people

<400> 10

cgcccctcct gcccctcctc cctactccaa gccctcggct tctcatccgc tgaacgatgt 60

cctacttcgc tcgtccttgc tctcgccgct gctgccggag ccgaagcaga gaaggcagcg 120

ggtcccgtga ccgtcccgag agccccgcgc tcccgaccag ggggcggggg cggccccggg 180

gagggcgggg caggggcggg gggaagaaag ggggttttgt gctgcgccgg gagggccggc 240

gccctcttcc gaatgtcctg cggccccagc ctctcctcac gctcgcgcag tctccgccgc 300

agtctcagct gcagctgcag gactgagccg tgcacccgga ggagaccccc ggaggaggcg 360

acaaacttcg cagtgccgcg acccaacccc agccctgggt aggtgagtgc ctccgcagcc 420

ccgccgcccg ccgtggggtc ggggacaggg agaagggagt gcctgcctgg tctgcgcccc 480

ccgcctgtca gcccttgcct c 501

<210> 11

<211> 501

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 11

cgtttttttt gttttttttt tttattttaa gttttcggtt ttttattcgt tgaacgatgt 60

tttatttcgt tcgtttttgt tttcgtcgtt gttgtcggag tcgaagtaga gaaggtagcg 120

ggtttcgtga tcgtttcgag agtttcgcgt tttcgattag ggggcggggg cggtttcggg 180

gagggcgggg taggggcggg gggaagaaag ggggttttgt gttgcgtcgg gagggtcggc 240

gttttttttc gaatgttttg cggttttagt ttttttttac gttcgcgtag ttttcgtcgt 300

agttttagtt gtagttgtag gattgagtcg tgtattcgga ggagattttc ggaggaggcg 360

ataaatttcg tagtgtcgcg atttaatttt agttttgggt aggtgagtgt tttcgtagtt 420

tcgtcgttcg tcgtggggtc ggggataggg agaagggagt gtttgtttgg tttgcgtttt 480

tcgtttgtta gtttttgttt c 501

<210> 12

<211> 501

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 12

cgcccctcct acccctcctc cctactccaa accctcgact tctcatccgc taaacgatat 60

cctacttcgc tcgtccttac tctcgccgct actaccgaaa ccgaaacaaa aaaaacaacg 120

aatcccgtaa ccgtcccgaa aaccccgcgc tcccgaccaa aaaacgaaaa cgaccccgaa 180

aaaaacgaaa caaaaacgaa aaaaaaaaaa aaaattttat actacgccga aaaaaccgac 240

gccctcttcc gaatatccta cgaccccaac ctctcctcac gctcgcgcaa tctccgccgc 300

aatctcaact acaactacaa aactaaaccg tacacccgaa aaaaaccccc gaaaaaaacg 360

acaaacttcg caataccgcg acccaacccc aaccctaaat aaataaatac ctccgcaacc 420

ccgccgcccg ccgtaaaatc gaaaacaaaa aaaaaaaaat acctacctaa tctacgcccc 480

ccgcctatca acccttacct c 501

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 13

gggaagaaag ggggttttgt 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 14

tacgacgaaa actacgcgaa 20

<210> 15

<211> 15

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 15

cgtcgggagg gtcgg 15

<210> 16

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 16

gtgatggagg aggtttagta agtt 24

<210> 17

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 17

ccaataaaac ctactcctcc cttaa 25

<210> 18

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 18

accaccaccc aacacacaat aacaaacaca 30

Claims

1. A method of diagnosing a large intestine tumor, screening for large intestine tumor formation or predisposition to formation or monitoring large intestine tumor progression or prognosis in an individual, said method comprising detecting the methylation state of the BCAN gene region in a biological sample from said individual and comparing the detected methylation state of the BCAN gene region with the normal methylation state of the BCAN gene region,

wherein an alteration in the methylation state of the BCAN gene region detected in the biological sample from the individual relative to the normal methylation state of the BCAN gene region is indicative of the individual having a colorectal neoplasm, or the individual having a predisposition to develop or develop a colorectal neoplasm, or the individual having a predisposition to poor prognosis or prognosis of a colorectal neoplasm.

2. The method of claim 1, wherein a higher methylation state of the BCAN gene region detected in the biological sample from the individual relative to the normal methylation state of the BCAN gene region is indicative of the individual having a large intestine tumor, or the individual having a predisposition to form or develop a large intestine tumor, or the individual having a predisposition to develop or develop a large intestine tumor, or the individual having a predisposition to poor prognosis or prognosis of a large intestine tumor.

3. A method of monitoring an individual's response to treatment for a colorectal tumor, the method comprising detecting the methylation state of a region of a BCAN gene in a biological sample from the individual before and after the individual receives treatment for a colorectal tumor, respectively, wherein an alteration in the methylation state of the region of the BCAN gene of the individual after receiving treatment for a colorectal tumor relative to the methylation state of the region of the BCAN gene before receiving treatment for a colorectal tumor is indicative of the individual's response to treatment for a colorectal tumor.

4. The method of claim 3, wherein a lower methylation state of the BCAN gene region of the individual after receiving treatment for a colorectal tumor relative to the methylation state of the BCAN gene region prior to receiving treatment for a colorectal tumor is indicative of the individual responding to treatment for a colorectal tumor.

5. The method of any one of the preceding claims, wherein the BCAN gene region comprises: a) hg19 coordinates chr1:156611182-156629324 and its upstream 5kb and downstream 5kb limited regions; or b) the corresponding regions listed under a) above after bisulfite conversion; or c) the corresponding region of the region listed under a) above after treatment with a Methylation Sensitive Restriction Enzyme (MSRE).

6. The method of any one of the preceding claims, wherein said detecting the methylation state of the BCAN gene region comprises determining the methylation state of cytosine residues in one or more CpG sites of the BCAN gene region in a biological sample from said individual, optionally said methylation state of the BCAN gene region comprises the methylation state of a target DNA region comprising a sequence having Hg19 coordinates selected from the group consisting of: chr1:156611399-156612667, chr1:156616348-156617162, chr1:156626037-156630544 and chr1:156611866-156611966, and 200bp upstream and 200bp downstream of the regions, and any combination thereof.

7. The method of any one of the preceding claims, wherein the biological sample is selected from the group consisting of histological sections, tissue biopsies, paraffin-embedded tissues, surgically excised specimens, isolated cells, body fluids, colonic effluent, and any combination thereof.

8. The method of claim 7, wherein the bodily fluid is selected from the group consisting of: whole blood, serum, plasma, urine, saliva, mucus, peritoneal fluid, pleural effusion, synovial fluid, cerebrospinal fluid, pleural effusion, peritoneal effusion, and any combination thereof.

9. The method of claim 7, wherein the colonic effluent is selected from the group consisting of stool and enema wash samples.

10. The method according to any of the preceding claims, wherein prior to detecting the methylation state of a BCAN gene region in a biological sample from the individual, further comprising the steps of:

(a) obtaining a biological sample containing DNA from the individual;

11. The method of claim 10, wherein the DNA comprises genomic DNA or extracellular free DNA.

12. The method of claim 11, wherein the extracellular free DNA comprises circulating tumor DNA.

13. The method of any one of claims 10-12, wherein the reagent in step (b) is a bisulfite reagent or a Methylation Sensitive Restriction Enzyme (MSRE).

14. The method of claim 13, wherein the bisulfite reagent is selected from the group consisting of: ammonium bisulfite, sodium bisulfite, potassium bisulfite, calcium bisulfite, magnesium bisulfite, aluminum bisulfite, bisulfite ions, and any combination thereof.

15. The method of claim 13, wherein the MSRE is selected from the group consisting of: HpaII enzyme, SalI enzyme,

16. The method of any one of claims 1-15, wherein the detecting uses an amplification-based method, a hybridization-based method, a sequencing-based method, or a restriction enzyme cleavage-based method.

17. The method of any one of claims 10-16, wherein the detecting the methylation state of a BCAN gene region comprises amplifying the treated DNA using an amplification enzyme and one or more sets of primers to produce at least one amplification product or the treated DNA is not amplified, optionally the treated DNA comprises the nucleotide sequence set forth in SEQ ID NOs 4-9, 11-12, and any combination thereof, or a nucleotide sequence selected from the group consisting of SEQ ID NOs 4-9, 11-12.

18. The method of claim 17, wherein the amplification enzyme comprises a thermostable DNA polymerase or a polymerase lacking 5 '-3' exonuclease activity.

19. The method of claim 17 or 18, wherein the amplification is performed in the presence of a detection reagent or a blocking reagent.

20. The method of claim 19, wherein the detection reagent comprises an oligonucleotide probe labeled with a detectable label and/or the blocking reagent comprises a blocking oligonucleotide that is not extendable by a polymerase.

21. The method of claim 20, wherein the oligonucleotide probe comprises a sequence capable of hybridizing to the amplification product and/or the blocking oligonucleotide comprises a sequence capable of hybridizing to the amplification product in a methylation specific manner.

22. The method of any one of claims 17-21, wherein the primer is a methylation specific primer.

23. The method of claim 22, wherein the primer comprises a sequence that is substantially complementary or substantially identical to a sequence of at least 9 consecutive nucleotides corresponding to a sequence of a region of a BCAN gene in the treated DNA, wherein the consecutive nucleotides comprise at least one CpG, TpG, or CpA dinucleotide, or wherein the amplification product comprises at least one CpG, TpG, or CpA dinucleotide.

24. The method of any one of claims 17-23, wherein the primer comprises a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence selected from SEQ ID NOs 1-12.

25. The method of any one of claims 17-24, wherein the primer is selected from the group consisting of:

And/or, the oligonucleotide probe is selected from the group consisting of:

CGTCGGGAGGGTCGG(SEQ ID NO:15) BCAN probe sequence

26. The method according to any of claims 17-25, wherein the methylation status of said BCAN gene region is determined based on the presence and nature of said amplification product.

27. The method of any one of the preceding claims, wherein the detecting or determining the methylation state of a BCAN gene region comprises using polymerase chain reaction (e.g., real-time polymerase chain reaction, digital polymerase chain reaction), nucleic acid sequencing, mass-based separation (e.g., electrophoresis, mass spectrometry), or target capture (e.g., microarray).

28. The method of claim 26, wherein the determining comprises sequencing the amplification products.

29. The method according to any of the preceding claims, wherein the normal methylation state of the BCAN gene region represents the methylation state of the BCAN gene region in an individual from whom no colorectal neoplasm has occurred, or from whom there is no predisposition for the formation or development of a colorectal neoplasm, or from whom there is no predisposition for the development or development of a colorectal neoplasm, or from whom there is a predisposition for a good or good prognosis for a colorectal neoplasm.

30. The method of any one of the preceding claims, wherein the large intestine tumor is a colorectal tumor.

31. The method of claim 30, wherein the colorectal neoplasm is colorectal cancer, colorectal adenoma, or sessile serrated polyps.

32. The method of any one of the preceding claims, wherein the large intestine tumor is precancerous.

33. The method of any one of the preceding claims, wherein the individual is a human.

34. An oligonucleotide for use as a detection means comprising or consisting of at least 9 contiguous nucleotides of a region of a BCAN gene or the complement thereof.

35. An oligonucleotide for use as a detection means comprising or consisting of at least 9 contiguous nucleotides of a treated DNA sequence of a BCAN gene region or a complement thereof, said treatment being adapted to convert at least one unmethylated cytosine residue in the BCAN gene region to a uracil residue, a thymine residue or another residue detectably different from cytosine on hybridization.

36. A kit for diagnosing a large intestine tumour, screening for large intestine tumour formation or predisposition to formation or monitoring large intestine tumour progression or prognosis, comprising a first reagent comprising one or more oligonucleotides as claimed in claim 34 or 35.

37. The kit of claim 36, wherein the oligonucleotide comprises a sequence that is substantially complementary or substantially identical to a sequence of at least 9 consecutive nucleotides of a sequence selected from SEQ ID NOs: 1-12.

38. The kit of claim 36, wherein the oligonucleotides are selected from the group consisting of:

39. The kit of any one of claims 36-38, further comprising a second agent capable of distinguishing between methylated and unmethylated CpG sites in DNA.

40. The kit of claim 39, wherein the second reagent is a bisulfite reagent or a Methylation Sensitive Restriction Enzyme (MSRE).

41. The kit of claim 40, wherein the bisulfite reagent is selected from the group consisting of: ammonium bisulfite, sodium bisulfite, potassium bisulfite, calcium bisulfite, magnesium bisulfite, aluminum bisulfite, bisulfite ions, and any combination thereof.

42. The kit of claim 40, wherein the MSRE is selected from the group consisting of: HpaII enzyme, SalI enzyme,

43. The kit of any one of claims 39-42, wherein the first and second reagents are packaged in a single container or separately packaged in separate containers.

44. The kit of any one of claims 36-43, further comprising a container adapted to hold a biological sample from the individual.

45. The kit of any one of claims 36-44, further comprising instructions for use and/or interpretation of the results of the test of the kit.

46. Use of a reagent for detecting the methylation state of a BCAN gene region in the manufacture of a kit for use in a method of diagnosing a large intestine neoplasm, screening for large intestine neoplasia or predisposition to develop, or monitoring large intestine neoplasia progression or prognosis in an individual,

wherein the method comprises detecting the methylation state of the BCAN gene region in a biological sample from the individual, and comparing the detected methylation state of the BCAN gene region to a normal methylation state of the BCAN gene region,

47. The use of claim 46, wherein a higher methylation state of the BCAN gene region detected in the biological sample from the individual relative to the normal methylation state of the BCAN gene region is indicative of the individual having a large intestine tumor, or the individual having a predisposition to form or develop a large intestine tumor, or the individual having a predisposition to develop or develop a large intestine tumor, or the individual having a predisposition to a poor prognosis or prognosis of a large intestine tumor.

48. Use of an agent for detecting the methylation state of a BCAN gene region in the manufacture of a kit for use in a method of monitoring the response of an individual to treatment of a colorectal tumor in said individual, wherein the method comprises detecting the methylation state of a BCAN gene region in a biological sample from said individual, wherein an alteration in the methylation state of a BCAN gene region of said individual after treatment for a colorectal tumor, relative to the methylation state of a BCAN gene region prior to treatment for a colorectal tumor, is indicative of the response of said individual to treatment for a colorectal tumor.

49. The use of claim 48, wherein a lower methylation state of the BCAN gene region of the individual after receiving treatment for a colorectal tumor relative to the methylation state of the BCAN gene region prior to receiving treatment for a colorectal tumor is indicative of the individual responding to treatment for a colorectal tumor.

50. The use of any one of claims 46-48, wherein the reagents for detecting the methylation state of a BCAN gene region comprise one or more sets of oligonucleotides comprising a sequence that is substantially complementary or substantially identical to a sequence of at least 9 consecutive nucleotides of a sequence selected from SEQ ID NOs: 1-12.

51. The use of claim 50, wherein the oligonucleotide is selected from the group consisting of: 13, 14 and 15 SEQ ID NOs.

52. Use of at least one reagent that distinguishes methylated and unmethylated CpG sites of a target DNA region in the manufacture of a kit for a method of diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to form, or monitoring large intestine tumor progression or prognosis in an individual, wherein the method comprises contacting DNA isolated from a biological sample of the individual with the at least one reagent and one or more oligonucleotides that hybridize under stringent, moderately stringent, or highly stringent conditions to the target DNA region,

wherein the target DNA region comprises at least 9 contiguous nucleotides of the BCAN gene region or its complement, wherein the contiguous nucleotides comprise at least one CpG site.

53. Use of at least one agent that distinguishes methylated and unmethylated CpG sites of a target DNA region in the preparation of a kit for use in a method of monitoring the response of a subject to treatment of a large intestine tumor in the subject, wherein the method comprises contacting DNA isolated from a biological sample of the subject with the at least one agent and one or more oligonucleotides that hybridize under stringent, moderately stringent, or highly stringent conditions to the target DNA region,

54. The use of claim 52 or 53, wherein the agent is a bisulfite agent or a Methylation Sensitive Restriction Enzyme (MSRE).

55. A kit suitable for carrying out the method of any one of claims 1 to 33 comprising (a) a bisulphite reagent; (b) one or more sets of primers comprising a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence of a region of the BCAN gene in bisulfite-treated DNA.

56. A kit suitable for carrying out the method of any one of claims 1 to 33 comprising (a) a methylation sensitive restriction enzyme; (b) one or more sets of primers comprising a sequence that is substantially complementary or substantially identical to a sequence of at least 9 contiguous nucleotides of a sequence of a region of the BCAN gene in DNA treated with a methylation sensitive restriction enzyme.

57. The kit of claim 55 or 56, further comprising a DNA polymerase, optionally a thermostable DNA polymerase or a polymerase lacking 5 '-3' exonuclease activity.

58. A method of diagnosing a large intestine tumor, screening for large intestine neoplasia or predisposition to formation, or monitoring large intestine tumor progression or prognosis in an individual comprising:

(a) obtaining a biological sample containing DNA from the individual;

59. The method of claim 58, wherein a higher methylation state of the DNA region of interest as determined in step (d) relative to the normal methylation state of the DNA region of interest indicates that the individual has a large intestine tumor, or that the individual is predisposed to having a large intestine tumor or a predisposition for the formation or development of a large intestine tumor, or that the individual is predisposed to having a poor prognosis or a poor prognosis of a large intestine tumor.

60. A kit suitable for carrying out the method of claim 58 or 59, comprising:

(a) a bisulfite reagent;

(d) instructions for use and/or interpretation of the results of the test kit.

61. A kit suitable for carrying out the method of claim 58 or 59, comprising:

(a) a methylation sensitive restriction enzyme reagent;

(d) instructions for use and/or interpretation of the results of the test kit.