CN113493795B - Preparation method of ginsenoside Rh2 - Google Patents

Abstract

The invention discloses a method for preparing ginsenoside Rh2, which is to use genesDSAnd transcription factor genePnWRKYSimultaneously transferring into tobacco to obtain transgenic tobacco for synthesizing ginsenoside Rh2, wherein the geneDSThe nucleotide sequence of (A) is shown as SEQ ID NO. 1, and the transcription factor genePnWRKYThe nucleotide sequence of (A) is shown as SEQ ID NO. 2; the transgenic plant obtained by the method can synthesize ginsenoside Rh2; the method is simple, easy to operate and suitable for large-scale production and market popularization and application, and provides a new way for obtaining the ginsenoside Rh2.

Description

Preparation method of ginsenoside Rh2

Technical Field

The invention relates to a method for preparing ginsenoside Rh2, and belongs to the technical field of biological medicine preparation.

Background

Ginsenoside Rh2 is a rare ginsenoside, and ginsenoside Rh2 has effects of regulating immune system, central nervous system, endocrine system, cardiovascular system, etc., and has effects of resisting tumor, anaphylaxis, depression, aging and myocardial ischemia. In the aspect of tumor resistance, rh2 can inhibit the development of various tumors by promoting the apoptosis of tumor cells, retarding the tumor cell cycle and other mechanisms, and can also enhance the anti-tumor immune response of organisms and improve the immunosuppressive effect of chemotherapeutic drugs. Rh2 has significant anti-inflammatory effect, can inhibit inflammatory reaction induced by Lipopolysaccharide (LPS), and has potential therapeutic effect on Alzheimer's disease, allergic asthma, allergic dermatitis, etc.

Rh2 was first discovered in Ginseng radix Rubri, and was later isolated from radix Panacis Quinquefolii, notoginseng radix, etc., and ginsenoside Rh2 content in Ginseng radix extract was minimal. At present, ginsenoside Rh2 is mainly generated by deglycosylation of PPD type ginsenoside; however, the ginseng medicinal material has long cultivation time (3-10 years), the PPD type ginsenoside content in the medicinal material is low, the enzymolysis efficiency of the biotransformation method is not high, and the like, so that the ginsenoside Rh2 has high price, and the application of the ginsenoside Rh2 in the medicine and health care industry is limited to a certain extent.

The transcription factor in the plant can positively or negatively regulate a plurality of key enzyme genes in the synthesis pathway of the secondary metabolite, and the regulation of the transcription factor gene is easier to promote the biosynthesis of the target secondary metabolite compared with the polygene operation. The transcription factor in the plant can simultaneously regulate the expression of a plurality of functional genes, so that the introduction of a key transcription factor can control the simultaneous action of a plurality of functional genes, thereby changing the synthesis of plant secondary metabolites. With the knowledge of plant secondary metabolic pathway and regulation mechanism, based on the function of the transcription factor to coordinately control the transcription of a plurality of function-related genes in the biosynthesis pathway of the secondary metabolite, the transcription factor can be manipulated to realize the 'multi-point regulation' of key enzyme genes, thereby influencing the biosynthesis of the secondary metabolite.

The biosynthetic pathway of ginsenoside Rh2 is basically clear. 2, 3-oxidosqualene generates dammarenediol under the action of Dammarenediol Synthetase (DS), the dammarenediol is hydroxylated to generate protopanoxadiol at C-6 position under the action of CYP450, and then glycosylation is carried out on hydroxyl at C-3 position by glycosyltransferase to generate ginsenoside Rh2. However, glycosylation of PPD-type saponins with a complicated structure by a chemical method is temporarily difficult to achieve.

Tobacco is a commercial crop with mature cultivation technology, has abundant enzyme modification systems in vivo, and has a mature transgenic technology system. Although tobacco may have the potential of synthesizing natural compounds, reports of synthesizing ginsenoside Rh2 in tobacco are not yet seen, and the complete pathway for synthesizing dammarane type tetracyclic triterpene saponins including ginsenoside Rh2 in the tobacco genome is not available, and the tobacco itself does not have the synthetic capacity of the saponins.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a method for preparing ginsenoside Rh2, namely a geneDSAnd transcription factor genePnWRKYSimultaneously transferring into tobacco to obtain transgenic tobacco for synthesizing ginsenoside Rh2, wherein the geneDSThe nucleotide sequence of (A) is shown as SEQ ID NO:1, a transcription factor genePnWRKYThe nucleotide sequence of (A) is shown as SEQ ID NO. 2; the method constructs a way for synthesizing the ginsenoside Rh2 in the tobacco, thereby adopting the tobacco to generate the ginsenoside Rh2.

The purpose of the invention is realized by the following technical scheme:

(1) From notoginseng (Notoginseng)Panax notoginseng) Extracting total RNA from root, reverse transcription synthesizing notoginseng cDNA, PCR amplifying notoginseng gene with the synthesized first strand cDNA as templateDSAnd transcription factor genePnWRKYThe amplification primers were as follows:

DSthe upstream primer of (2) is tacgaattcgagctcggtaccatgtggaagctgaaaggttgctc, and the downstream primer of (3) is gccaagcttgcatgcctgcagtcggatctcggatctctctctctcggcctg;

PnWRKYthe upstream primer is tacgaattcgactcggtacctcagttgaactttgttaggttgtttctga, and the downstream primer is caggttcgacttaggatccttgagtctcatttcaatgaatgaatgacatgacatgtttga;

(2) The target fragments are respectively connected to pCAMBIA2300s plant expression vectors and transformed into agrobacterium. Screening out positive monoclonal by PCR;

(3) Infecting tobacco leaf with positive agrobacterium containing target gene to obtain the geneDSAndPnWRKYa transgenic tobacco plant of two genes;

(4) Extracting total RNA from positive transgenic tobacco, performing reverse transcription to obtain cDNA, and performing RT-PCR to determine whether two genes are expressed;

(5) Drying and grinding the leaves of the transgenic tobacco, soaking the leaves in methanol for 24 hours, then carrying out ultrasonic extraction on saponin, and detecting the types and the content of the ginsenoside in the transgenic tobacco by using HPLC.

The invention is based on the characteristics of easy planting and quick growth of tobacco, and separates the gene from notoginsengDSAnd transcription factor genePnWRKYSimultaneously transferring the gene into tobacco to obtain the expressible geneDSAnd transcription factor genePnWRKYThe experimental result of the transgenic tobacco shows that the obtained transgenic plant can synthesize the ginsenoside Rh2, so that the ginsenoside Rh2 can be more efficiently and conveniently obtained.

Drawings

FIG. 1 shows genes PnWRKYAndDSthe electrophoresis detection result of the PCR product is shown in the figure, wherein M is a DNA Marker;

FIG. 2 isDSA schematic diagram of a PCR detection result of the gene transferred agrobacterium liquid, wherein M is a DNA Marker;1-10 are positive agrobacterium strains; "-" is ddH ₂ O is a template; "+" is cDNA as template;

FIG. 3 is a schematic diagram showing the PCR detection result of the PnWRKY transcription factor gene transferred into the Agrobacterium liquid, wherein M is DNA Marker;1-8 are positive agrobacterium strains; "-" is ddH ₂ O is a template; "+" is cDNA as template;

FIG. 4 is a schematic diagram showing the results of DNA level detection in transgenic tobacco, in which WT is a wild-type tobacco and T1-T4 are transgenic tobacco lines;

FIG. 5 is a schematic diagram showing the results of detection of RNA level in transgenic tobacco, wherein WT is wild-type tobacco; T1-T4 are transgenic tobacco strains;

FIG. 6 shows the results of the saponin content assay in transgenic tobacco, wherein WT is wild type tobacco; T1-T4 is a transgenic tobacco strain, DD is dammarenediol, and PPD is protopanaxadiol.

Detailed Description

The present invention is further illustrated by the following examples, which are not intended to limit the scope of the present invention, and the methods used in the examples are all conventional methods unless otherwise specified, and reagents used therein are all conventional commercially available reagents or reagents prepared by conventional methods.

Example 1 GeneDSAnd transcription factor genePnWRKYObtaining of

The method comprises the following steps of grinding pseudo-ginseng roots serving as a material by using liquid nitrogen, transferring the powder into a centrifugal tube, extracting total RNA by using a guanidinium isothiocyanate method, and synthesizing a first cDNA chain by using reverse transcriptase M-MLV (promega) and total RNA as a template, wherein a reaction system and an operation process are as follows: mu.g of Total RNA was taken and added with 50 ng oligo (dT), 2. Mu.L dNTP (2.5 mM each) and DEPC water in sequence to a reaction volume of 14.5. Mu.L; after mixing, heating to denature for 5min at 70 ℃, rapidly cooling for 5min on ice, then sequentially adding 4 mu L of 5 XFirst-stand buffer, 0.5 mu L of RNase (200U) and 1 mu L of M-MLV (200U), mixing uniformly, centrifuging for a short time, carrying out warm bath for 1.5 h at 42 ℃, taking out, heating for 10min at 70 ℃, and stopping reaction; the first strand cDNA is synthesized and stored at-20 deg.C for further use.

Using the synthesized first strand cDNA as template, referring to that in the genome of Panax notoginsengDSAndPnWRKYgene sequence, designing positive and negative primers at both ends respectively, cloningDSAndPnWRKYgenes, amplification primers were as follows:

DS FP：ATGTGGAAGCTGAAGGTTGCTC；

DS RP：TCGGATCTCTCTCGGCCTG；

PnWRKY FP: TCAGTTGACCTTGTTAGGTT；

PnWRKY RP: TTAGTCTCAATGAATGAATGACATCTTT；

amplifying a target gene by adopting AdvantageTM 2 PCR Enzyme (Clontech); and (3) PCR reaction conditions: 5min at 94 ℃;30 s at 94 ℃, 30s at 60 ℃, 1min at 72 ℃ and 32 cycles; 7min at 72 ℃; the reaction system (20. Mu.L) was 0.5. Mu.L of cDNA, 2. Mu.L of 10 × Advantage 2 PCR Buffer, 0.4. Mu.L of 50 × dNTP Mix (10 mM each), 0.4. Mu.L of forward primer (10. Mu.M), and 0.4. Mu.L of reverse primer (20. Mu.L)10. μ M), 0.4 μ L of Advantage 2 PCR Polymerase Mix, 15.9 μ L of PCR-Grade water; after the PCR is finished, 10 mu L of the product is taken for agarose gel electrophoresis to detect the specificity and the size of the amplified product; the results are shown in figure 1 of the drawings,PnWRKYthe size of the fragment was 1183bp,DSthe fragment of (3) has a size of 2310bp.

Example 2: geneDSAndPnWRKYconstruction of overexpression vectors

Based on genes in pseudo-ginsengDS、PnWRKYThe nucleotide sequence of (2) is combined with the insertion positions of the two genes in a plant expression vector pCAMBIA2300s at the same time, and a primer with a homology arm is designed by using CE Design software;

DSthe upstream primer is tacgaattcgactcggttacgatgtggaagctgaagggttgctc, and the downstream primer is gccaagcttgcatgcctgcagtcggatctctctctctcggcctg;

PnWRKYthe upstream primer is tacgaattcgactcggtacctcagttgaactttgttaggttgtttctga, and the downstream primer is caggttcgacttaggatccttgagtctcatttcaatgaatgaatgacatgacatgtttga;

by using high fidelity enzymesDS、PnWRKYGene cloning, the PCR reaction is 50 μ L overall, including: prime STAR MAX Premix 25. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu.L, cDNA 1. Mu.L, ddH ₂ O22 mu L; the PCR reaction conditions were: 3 min at 98 ℃; 10 s at 98 ℃, 15 s at 60 ℃, 15 s at 72 ℃,35 cycles; 5min at 72 ℃. After PCR, running the gel, and recovering the target band after confirming that the amplification is successful, wherein a SanPrep column type DNA gel recovery kit (Shanghai Biotech) is used; taking 1 microliter of the recovered product, detecting the size and concentration of the recovered fragment by agarose gel electrophoresis, and storing at-20 ℃ for later use.

The plant expression vector pCAMBIA2300s is linearized by using restriction endonuclease, and the restriction endonuclease is 15 muL of pCAMBIA2300s plasmid, 5 muL of 10 xM buffer and 2.5 muL of pCAMBIA2300s plasmidKpnI、2.5μL PstI、25μL ddH ₂ O, mixing uniformly, centrifuging for a short time, and placing at 37 ℃ for enzyme digestion for 3.5h; dropping the enzyme digestion product in agarose gel for electrophoresis, then carrying out gel recovery on the pCAMBIA2300s carrier large fragment, and using a SanPrep column type DNA gel recovery kit (Shanghai production) in the whole process; collecting 1 μ LThe size and concentration of the recovered fragment were detected by agarose gel electrophoresis of the product, and stored at-20 ℃ for further use. Assembling by using a Clonexpressing Multi One Step Cloning Kit during homologous recombination, and then calculating the using amount of each component according to the operating instructions of a homologous recombinase during homologous recombination and the concentrations of an insert and a vector and the recombination instructions; finally, adding the components into a PCR reaction tube on ice, placing the reaction tube at 37 ℃ for 0.5h, and transforming the recombinant expression plasmid into host strain DH5 alpha competent cells after assembly; coating a plate, wherein the plate is an LB solid culture medium added with kanamycin, culturing for 12-15h in a dark condition in an incubator at 37 ℃, then selecting a single colony on the plate, carrying out PCR amplification on a bacterial liquid, detecting positive clones, and detecting by a sequencing company for further final confirmation; after the assembly is successful, the seed is preserved to obtain the product containingDSAndPnWRKYescherichia coli which is a gene.

Example 3 transformation of Agrobacterium cells

Extracting and purifying pCAMBIA2300S-PnWRKYAnd pCAMBIA2300S-PnDSA plasmid; competent cells of the Agrobacterium LBA4404 strain were prepared and distributed into 1.5mL centrifuge tubes, 150. Mu.L per tube, frozen with liquid nitrogen and stored at-80 ℃ for further use. The plant expression vector pCAMBIA2300S-PnWRKYAnd pCAMBIA2300S-PnDSThe plasmid is transferred into the prepared agrobacterium LBA4404 competent cell; the operation steps are as follows: respectively taking 3 mu g of pCAMBIA2300S-PnWRKYAnd pCAMBIA2300S-PnDSAdding the plasmid into a centrifuge tube containing 150 μ L of competent cells, gently mixing, performing ice bath for 30min, transferring into liquid nitrogen, rapidly freezing for 5min, rapidly placing in 37 deg.C water bath for 5min, and immediately performing ice bath for 2min; the transformed Agrobacterium-infected competent cells were transferred to LB liquid medium (without any antibiotic), cultured with shaking at 200rpm at 28 ℃ for 4 hours to resuscitate the cells, plated on LB solid medium containing 50mg/L kanamycin and 25mg/L rifampicin, and cultured in an inverted state in a 28 ℃ incubator for about 48 hours. Selecting single clone, shaking bacteria, detecting the PCR of bacteria liquid, screening the recombinant vector pCAMBIA2300S-PnWRKYAnd pCAMBIA2300S-PnDSAgrobacterium LBA4404 invasion of plasmidThe PCR results of the tobacco leaf staining are shown in FIG. 2 and FIG. 3, and 10 transgenic pCAMBIA2300S-PnDSPositive Agrobacterium strain of plasmid and 8-strain pCAMBIA2300S-PnWRKYPositive agrobacterium strain of plasmid, and the sequence is identical to the original sequence through sequencing verification, and the strain glycerol is preserved at-80 ℃ for standby.

Example 4: agrobacterium-mediated genetic transformation of tobacco

The transgenic recipient in this experiment was tobacco, tobacco seeds were soaked in 75% alcohol for 30s, washed with sterile water and then washed with 0.1% HgCl ₂ Soaking for 8min, washing with sterile water for several times, sowing on 1/2MS culture medium, dark culturing at 28 deg.C for 6d, transferring to light incubator (25 deg.C, 16 h/d light), and subculturing with 1/2MS culture medium once per month.

Taking out the preserved material containing pCAMBIA2300S from a-80 ℃ refrigeratorPnWRKYAnd pCAMBIA2300S-PnDSAgrobacterium LBA4404 strain of plasmid, inoculating Agrobacterium containing target gene in 5mL LB liquid medium containing 50mg/L kanamycin and 20mg/L rifampicin, culturing at 28 deg.C until the medium is turbid; sucking 1mL of turbid bacterial liquid to an LB solid culture medium containing 50mg/L of kanamycin, and culturing for 48h at 28 ℃; then, the agrobacterium on the LB solid medium is scraped to be inoculated into MGL liquid medium added with 20mg/L acetosyringone in a proper amount, and the agrobacterium is activated by shaking culture at 28 ℃ for 2-3 h.

Cutting sterile tobacco seedling leaf into 1cm ² And completely soaking the left and right leaf discs in the MGL liquid culture medium containing the activated agrobacterium, wherein the dip dyeing time is 15min, sucking bacterial liquid on the surfaces of the leaves by using sterile filter paper, placing the leaf discs on a co-culture medium for room temperature culture, wherein the co-culture medium for tobacco transformation is MS +0.02 mg/L6-BA +2.1mg/L NAA +30g/L sucrose +6g/L agar, co-culturing for 2 days at 22 ℃ in the absence of light, and simultaneously infecting the tobacco leaves by using agrobacterium transformed pCAMBIA2300S empty vector as a blank control.

Transferring the co-cultured leaf disc to an MS screening culture medium added with antibiotics to be divided into seedlings, and screening transgenic plants; the tobacco screening culture medium is MS +0.5 mg/L6-BA +0.1mg/L NAA +30g/L sucrose +6g/L agar +50mg/L kanamycin +200mg/L cephamycin (cefixime sodium salt, cef); during screening culture, transferring the culture bottle to a light incubator for culture (25 ℃,16 h/d light and 8 h/d dark), subculturing by using an MS culture medium containing 50mg/L kanamycin and 200mg/L Cef after the tobacco grows out of buds, wherein the regeneration plant needs to be further screened because the callus differentiation rate of the tobacco is higher, transferring the tobacco regeneration seedling to the MS culture medium containing 50mg/L kanamycin to root the tobacco regeneration seedling, and finally selecting the regeneration seedling with better rooting for further detection;

detecting DNA level, extracting DNA of transgenic tobacco leaf by CTAB method, taking genome DNA of transgenic plant as template, and amplifying geneDS、PnWRKYCarrying out PCR by using the specific primer; the PCR reaction system was 2. Mu.L DNA, 0.4. Mu.L forward primer (10. Mu.M), 0.4. Mu.L reverse primer (10. Mu.M), 10. Mu.L PCR Mix, 7.2. Mu.L ddH ₂ O; and (3) PCR reaction conditions: 5min at 94 ℃; 30s at 94 ℃, 90s at 60 ℃, 1min at 72 ℃ and 32 cycles; 7min at 72 ℃; after the PCR is finished, 10 μ L of the product is used for agarose gel electrophoresis to detect positive transgenic plants, the amplification result of part of tobacco transgenic plants is shown in FIG. 4, and 4 positive plants are obtained by detection on the DNA level.

Detecting RNA level, taking positive transgenic single plant on DNA level and tender leaf of non-transgenic tobacco (wild type) to extract total RNA, reverse transcribing to generate cDNA first chain, and using the cDNA first chain as template to amplifyDS、PnWRKYCarrying out PCR on specific primers of the two genes; the PCR reaction system was 1.5. Mu.L of cDNA, 0.4. Mu.L of forward primer (10. Mu.M), 0.4. Mu.L of reverse primer (10. Mu.M), 10. Mu.L of PCR Mix, 7.7. Mu.L of ddH ₂ O; and (3) PCR reaction conditions: 5min at 94 ℃; 30s at 94 ℃, 30s at 60 ℃, 90s at 72 ℃ and 32 cycles; 7min at 72 ℃; after the PCR was completed, 10. Mu.L of the resulting mixture was subjected to agarose gel electrophoresis, and each transgenic individual was analyzed based on the PCR resultsDS、PnWRKYExpression of two Gene transcript levels, total RNA extraction method was the same as in example 1, after PCR was completed, 10. Mu.L of the DNA was subjected to agarose gel electrophoresis, and the results of detection of a part of individuals were shown in FIG. 5, and were detected in 4 transgenic individualsDS、PnWRKYBoth genes are expressed in large amounts at the transcriptional level.

Example 5:DS、PnWRKYinfluence of gene expression on synthesis of ginsenoside Rh2 from tobacco

Drying and grinding the leaves of the transgenic tobacco, weighing 1.0g of tobacco powder, soaking the tobacco powder in 50mL of methanol for 24 hours, carrying out ultrasonic extraction for 60min, extracting saponin in the transgenic tobacco, and detecting the types and the content of the ginsenoside in the transgenic tobacco by using HPLC (high performance liquid chromatography); the HPLC detection conditions were as follows: the chromatographic column is Waters-XTerra-MS-C18 (5 μm,250 mm. Times.4.6 mm, USA), and the mobile phase is water and acetonitrile; gradient elution: 0-20min,20% acetonitrile; 20-30min, 20-35% acetonitrile; 30-40min,35% acetonitrile; 40-50min,35-40% acetonitrile; 50-60min,40-100% acetonitrile. The flow rate is 1.0mL/min, the column temperature is 30 ℃, and the detection wavelength is set to be 203nm; ginsenoside Rh2, protopanaxadiol and dammarenediol were detected in 4 transgenic tobacco plants, wherein the content of ginsenoside Rh2 in T4 plants was the highest and reached 11.60. Mu.g/gDW (dry tobacco weight).

Sequence listing

<110> university of Kunming science

<120> preparation method of ginsenoside Rh2

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2310

<212> DNA

<213> pseudo-ginseng (Panax notogeng)

<400> 1

atgtggaagc tgaaggttgc tcaaggaaat gatccatatt tgtatagcac taacaacttt 60

gttggcagac aatattggga gtttcagccc gatgctggta ctccagaaga gagggaagag 120

gttgaaaatg cacgcaagga ttatgtaaac aataaaaagc tacatggagt tcatccatgc 180

agtgatatgc tgatgcgcag gcagcttatt aaagaaagtg gaatcgatct cctaagcata 240

ccgccggtga gattagatga aaacgaacaa gtgaactacg atgcagttac aaccgctgtg 300

aagaaagctc ttcgattgaa ccgggcaatt caagcacacg atggtcactg gccagctgaa 360

aatgcaggct ctttacttta tacacctccc cttatcattg ccctatatat cagcggaacg 420

attgacacta ttctgacaaa acaacacaag aaggaactga ttcgcttcgt ttacaaccat 480

caaaatgagg atggtggatg gggatcctat attgaggggc acagcacgat gattgggtca 540

gtacttagct tcgtgatgtt acgtttgcta ggagaaggat tagctgaatc tgatgatgga 600

aatggtgcag ttgagagagg ccggaagtgg atacttgatc atggaggtgc agccagcata 660

ccctcttggg gaaagactta tctagcggtg cttggagtat atgagtggga agggtgcaac 720

ccgctgcccc cagaattctg gcttttccct tcaagttttc cttttcatcc agcaaaaatg 780

tggatctact gccggtgtac ctacatgcca atgtcgtatt tgtatgggaa gagatatcat 840

ggaccaataa ccgatcttgt tttatctttg agacaagaaa tttacaacat tccttatgag 900

cagataaagt ggaatcaaca gcgccataac tgttgcaagg aggatctcta ctaccctcat 960

tcccttgtac aagacctggt ttgggatggt cttcactact ttagtgaacc attcctcaaa 1020

cgttggccct tcaacaaact gcgaaaaaga ggtctaaaaa gagtggttga actaatgcgc 1080

tatggtgcca ccgagaccag attcataacc acaggaaatg gggaaaaagc tttacaaata 1140

atgagttggt gggcagaaga tcccaatggt gatgagttta aacatcacct tgctagaatt 1200

cctgatttct tatggattgc tgaggatgga atgacagtac agagttttgg tagtcaacta 1260

tgggactgta ttcttgctac tcaagcaatt atcgccacca atatggttga agaatacgga 1320

gattctctta agaaggcgca tttcttcatc aaagaatcgc agataaaaga aaatccaaga 1380

ggagacttct taaaaatgtg tcgacagttt actaaaggtg cgtggacttt ctctgatcaa 1440

gatcatggtt gcgttgtctc ggactgcaca gctgaagcac taaagtgcct tctgttactt 1500

tcacaaatgc cacaggacat tgtcggagaa aaacctaagg ttgagcgatt atatgaggct 1560

gtgaatgttc ttctctattt gcagagtcgt gtaagtggtg gcttcgcagt ttgggagcct 1620

ccagttccaa aaccatattt ggagatgttg aatccttcag aaatttttgc agacattgtt 1680

gttgagagag agcacattga atgcactgca tctgtaatca aaggtctgat ggcatttaaa 1740

tgcttgcatc ctgggcatcg tcagaaagag atagaggatt ctgtggcgaa agccatccgt 1800

tatcttgaaa gaaaccaaat gcctgatggt tcatggtatg gcttttgggg aatttgtttc 1860

ctctatggga cattttttac cctatcaggg tttgcttctg ctgggaggac ttatgacaac 1920

agtgaagcag ttcgtaaggg tgttaaattt ttcctttcaa cacaaaatga agaaggtggt 1980

tggggggaga gtcttgaatc atgcccaagc gagaaattta caccactcaa gggaaacagg 2040

acaaatctag tacaaacatc atgggctatg ctaggtctta tgtttggtgg acaggccgag 2100

agagatccga cacctctgca tagagcagcg aagttgttga tcaatgcgca aatggataat 2160

ggagatttcc ctcaacagga aattactgga gtatactgta aaaatagtat gttacattat 2220

gcggagtaca gaaatatatt tcctctttgg gcactcggag aatatcggaa acgtgtttgg 2280

ttgccaaagc accagcagct caaaatttaa 2310

<210> 2

<211> 1183

<212> DNA

<213> Panax notoginseng (Panax notogeng)

<400> 2

tcagttgacc ttgttaggtt tctgaagatg gaaaatcatg ttgggattca tgaatctgca 60

gcagcagctg agatgaagac tattgaacaa cagctttttc gcatattaca atctcaccat 120

caacaaattc aacttgattt ctccaaaaaa gccgtgaatc gaaccggcca cgcccggttc 180

cgccgtcgac catcagatcc gtctacttct tctcagtctg aaccatttac accgattcag 240

ctcaaaccaa tccctaaacc gtgcgactca aaaatatctg aagaatgtaa aaccaaaaat 300

actccgatat cgtccgggag ctcgtcgatc accggagagg aagggaccgt ttccaatggt 360

aagcgaggat tattaaacac cgcagcagca ccggcaccgc gggtttattc gtccagaaag 420

ccccctcttc cgtcatctca caggaaaaga tgccgtgacc ttgagcccac cgacggaatt 480

tctggcaaac gttcaatttc acgcggctgc cactgttgca agagaaggaa aacagtggag 540

attagaagag taacaacaac aaaaggaggt tcgtcatcca ttcctgcgga tgagtattca 600

tggaggaagt actatcaaaa gttaatcccg ggcactctct tcccaagagg atattacaaa 660

tgcagtagcg taaagggatg cccggcgagg aagcacgcgg tgagatccca agatgatcca 720

acggtgctag tcgtgacata cgaaggagag caccgtcata accgttggat tctaccggga 780

aggctaaata ggagtggtag tgttgttggt atactagtag agtcgaaatg atgaaatcat 840

ttttgtattt atgttttgtg agagaaggat cagatggatg acaggagcag aacatcatct 900

tgcgacttga aagggagcca aggggagctg gtctggtcga gctaaatctc acgactttgc 960

ttgattaatg caaagggagg gctccaggag aataaatgaa tacattcatc catccatcat 1020

atgcatcctt cttgagcaca tacatgaaag gatgtaatta attttatgat gtagtagtaa 1080

ttttctttaa ttagtggatt acaaaagcaa gtgcaagcaa ttcactttta ttacacttca 1140

tctgctggtt gaatcaaaga tgtcattcat tcattgagac taa 1183

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

atgtggaagc tgaaggttgc tc 22

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

tcggatctct ctcggcctg 19

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial)

<400> 5

tcagttgacc ttgttaggtt 20

<210> 6

<211> 28

<212> DNA

<213> Artificial sequence (Artificial)

<400> 6

ttagtctcaa tgaatgaatg acatcttt 28

<210> 7

<211> 43

<212> DNA

<213> Artificial sequence (Artificial)

<400> 7

tacgaattcg agctcggtac catgtggaag ctgaaggttg ctc 43

<210> 8

<211> 40

<212> DNA

<213> Artificial sequence (Artificial)

<400> 8

gccaagcttg catgcctgca gtcggatctc tctcggcctg 40

<210> 9

<211> 46

<212> DNA

<213> Artificial sequence (Artificial)

<400> 9

tacgaattcg agctcggtac ctcagttgac cttgttaggt ttctga 46

<210> 10

<211> 49

<212> DNA

<213> Artificial sequence (Artificial)

<400> 10

caggtcgact ctagaggatc cttagtctca atgaatgaat gacatcttt 49

Claims (1)

1. A method for preparing ginsenoside Rh2 is characterized by comprising the following steps: radix Notoginseng geneDSAnd transcription factor genePnWRKYSimultaneously transferring into tobacco to obtain transgenic tobacco for synthesizing ginsenoside Rh2, wherein the geneDSThe nucleotide sequence of (A) is shown as SEQ ID NO. 1, and the transcription factor genePnWRKYThe nucleotide sequence of (A) is shown as SEQ ID NO. 2.

Images