CN113444830A - Kit for detecting SARS-CoV-2 coronavirus and its special primer and probe - Google Patents
Kit for detecting SARS-CoV-2 coronavirus and its special primer and probe Download PDFInfo
- Publication number
- CN113444830A CN113444830A CN202010227826.7A CN202010227826A CN113444830A CN 113444830 A CN113444830 A CN 113444830A CN 202010227826 A CN202010227826 A CN 202010227826A CN 113444830 A CN113444830 A CN 113444830A
- Authority
- CN
- China
- Prior art keywords
- cov
- coronavirus
- sars
- sample
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a reagent box for detecting SARS-CoV-2 coronavirus and its special primer and probe, belonging to the field of biotechnology. The provided kit and the special primer and probe thereof can be used for quickly detecting SARS-COV-2 coronavirus, realize the quick qualitative and quantitative detection of a sample to be detected, and play an important role in the detection of SARS-COV-2 coronavirus and the production process of vaccines.
Description
Technical Field
The invention belongs to the field of biotechnology, and particularly relates to a kit for detecting SARS-CoV-2 coronavirus, and a special primer and a probe thereof.
Background
The study showed that SARS-COV-2 belongs to the genus beta coronavirus, as well as SARS coronavirus (SARS-CoV) and MERS coronavirus (MERS-CoV) of SARS and respiratory syndrome in the middle east of 2003. By gene sequence alignment, SARS-COV-2 has about 80% similarity to SARS-CoV and 40% similarity to MERS-CoV.
SARS-COV-2 coronavirus is more than hundreds of thousands of people infected in a plurality of countries all over the world at present, and is in a tendency of outbreak, although each country is actively controlled, the SARS-COV-2 coronavirus is still a great potential threat to human health due to strong infectivity, so that a method and a tool for quickly, accurately and specifically detecting the virus are established, and the method and the tool have great significance for spreading control of epidemic situations.
Disclosure of Invention
In view of one or more of the problems in the prior art, one aspect of the present invention provides a primer and a probe for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus, wherein the primer comprises an upstream primer SA-F1 and a downstream primer SA-R1, wherein the nucleotide sequence of SA-F1 is shown as SEQ ID NO.2, and the nucleotide sequence of SA-R1 is shown as SEQ ID NO. 3; the nucleotide sequence of the probe is shown as SEQ ID NO. 4.
The 5 'end of the probe is marked with a fluorescence reporter group, and the 3' end of the probe is marked with a fluorescence quenching group.
The fluorescence reporter group is any one selected from FAM, ROX, CY5 and HEX, and the fluorescence quencher group is any one selected from TAMRA, BHQ and Eclipse.
The invention also provides a reagent box for real-time fluorescence quantitative PCR detection of SARS-COV-2 coronavirus, which comprises the primer and the probe; when the kit is used, the dosage of the primer and the probe in a 20-microliter real-time fluorescent quantitative PCR detection system is as follows: the final use concentration of each primer is 0.1-1.0 mu M, and the final use concentration of the probe is 0.1-0.5 mu M.
The kit also comprises a positive control substance and a negative control substance, wherein the positive control substance is a SARS-COV-2 coronavirus positive control substance, and the negative control substance is a reaction system without SARS-COV-2 coronavirus.
The application of the above-mentioned kit in the detection of SARS-COV-2 coronavirus for non-disease diagnosis also belongs to the content of the invention.
The application is a qualitative and quantitative detection method for SARS-COV-2 coronavirus non-disease diagnosis by real-time fluorescent quantitative PCR technology, comprising the following steps:
1) establishing a standard curve: diluting SARS-COV-2 coronavirus positive quality control product to 1 × 10 by gradient of 10 times7copies/μL、1×106copies/μL、1×105copies/μL、1×104copies/μL、1×103copies/μL、1×102copies/μL、 1×101copies/. mu.L as standard; taking standard substances with different concentrations as templates, performing real-time fluorescence quantitative PCR detection under the guide of the primers and the probes, and after the detection is finished, drawing a corresponding Ct value (Y axis) by using a concentration Log value (X axis) of each standard substance to draw a standard curve;
2) extracting the genome RNA of a sample to be detected, performing real-time fluorescent quantitative PCR detection under the guide of the primer and the probe by taking the extracted genome RNA as a template, and synchronously detecting a positive reference substance and a negative reference substance;
3) and (3) realizing qualitative detection of SARS-COV-2 coronavirus by using the obtained Ct value and the change of the fluorescence signal, and obtaining the copy number of SARS-COV-2 coronavirus contained in the sample to be detected according to the Ct value and the standard curve in the step 1) to realize quantitative detection.
The sample to be tested in the step 2) comprises raw materials for vaccine production, vaccine semi-finished products and finished products.
The 20 mu L real-time fluorescent quantitative PCR detection system in the step 1) and the step 2) comprises: 2 μ L of template, 2 Xone Step RT-PCR Buffer III 10 μ L of real-time fluorescence quantitative One-Step PCR reaction solution, 0.4 μ L of PrimeScript RT Enzyme Mix II, 0.4 μ L of 5U/μ L TaKaRa Ex Taq HS, 0.4 μ L of upstream primer, 0.4 μ L of downstream primer, 0.8 μ L of probe, RNase Free ddH2O 5.6μL。
The real-time fluorescent quantitative PCR detection conditions in the step 1) and the step 2) are as follows: reverse transcription reaction procedure: 5min at 42 ℃; 10sec at 95 ℃; 1 cycle; PCR reaction procedure: 5sec at 95 ℃; 20sec at 60 ℃; 40 cycles.
The determination method in the step 3) is as follows:
if the positive control has an S-shaped amplification curve in a channel corresponding to a fluorescence reporter group (such as an FAM fluorescence reporter group), and the negative control has no amplification curve in a channel corresponding to the fluorescence reporter group, judging that the experiment is established; otherwise, the experimental result is invalid;
when the experiment is established, the following judgment is made:
if the sample to be detected has an S-type amplification curve in the channel corresponding to the fluorescence reporter group and the Ct value is less than or equal to 38, determining that the sample to be detected contains SARS-COV-2 coronavirus;
if the sample to be detected has an S-shaped amplification curve in the channel corresponding to the fluorescence reporter group and the Ct value is greater than 38, judging that the sample to be detected is an undetermined sample, and detecting after extracting RNA again; if the rechecking results are the same, judging the sample to be weakly positive;
if the sample to be detected has no obvious S-type amplification curve in the channel corresponding to the fluorescence reporter group, the sample is judged to be negative, namely the sample does not contain SARS-COV-2 coronavirus.
The primer and the probe for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus based on the above technical scheme can be used for quickly detecting SARS-COV-2 coronavirus, realize quick qualitative and quantitative detection of a sample to be detected, provide a favorable basis for quality monitoring and reasonable vaccine preparation in the production process of SARS-COV-2 coronavirus vaccine, and ensure the safety and the rationality of vaccination. The kit and the detection method provided by the invention have simple and convenient operation and high detection sensitivity, can realize accurate qualitative and quantitative detection of SARS-COV-2 coronavirus, play an important role in the detection of SARS-COV-2 coronavirus (including accurate detection of SARS-COV-2 coronavirus in clinical pathological materials or cultures in clinical diagnosis) and the vaccine production process, and have wide application prospect.
Drawings
FIG. 1 is a PCR amplification curve of primers and probes of group 1 and group 2 in example 1 against a positive quality control of SARS-COV-2 coronavirus at a gradient concentration;
FIG. 2 is a PCR amplification curve of primers and probes of group 1 in example 1 against a gradient concentration of SARS-COV-2 coronavirus standard;
FIG. 3 is a Log of the PCR amplification curve according to FIG. 2CopyCt standard curve.
Detailed Description
The present invention aims at providing special primer and probe for detecting SARS-COV-2 coronavirus, providing reagent kit for detecting SARS-COV-2 coronavirus and establishing one fast SARS-COV-2 coronavirus detecting method based on fluorescent quantitative polymerase amplification technology.
The invention is further illustrated by the following examples. It should be understood that the specific examples are only for further illustrating the present invention and are not intended to limit the content of the present invention.
The methods used in the following examples are conventional unless otherwise specified, and specific procedures can be found in: a Molecular Cloning Laboratory Manual (Molecular Cloning: A Laboratory Manual, Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).
The access routes described in the examples are only for the purpose of providing an experimental access for the purpose of specific disclosure and should not be construed as limiting the source of the biomaterial of the invention. In fact, the sources of the biological materials used are wide and any biological material that can be obtained without violating laws and ethics can be used instead as suggested in the examples.
The primers used were synthesized by general Biotechnology GmbH; the probes used were synthesized by the general bio-gene company.
Example 1: primer and probe design
This example is intended to confirm that primers and probes for SARS-COV-2 coronavirus can be rapidly detected by a fluorescent quantitative polymerase amplification technique, and the inventors designed a plurality of primer and probe combinations in total using the surface protein S gene (SEQ ID NO:1) of SARS-COV-2 coronavirus according to the primer and probe design principles, and selected the following group 1 and group 2 from the plurality of combinations, the sequence information of which is shown below:
group 1:
SA-F1：5’-TGCCTTGGTGATATTGCTGC-3’(SEQ ID NO:2)；
SA-R1：5’-GTACCCGCTAACAGTGCAGAA-3’(SEQ ID NO:3)；
SA-probe1：5’-FAM-CGGCCTTACTGTTTTGCCACCTTTGC-BHQ-3’(SEQ ID NO:4)；
the amplification sequences of the primers SA-F1 and SA-R1 are:
5’-TGCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGC CTTACTGTTTTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTG TTAGCGGGTAC-3’(SEQ ID NO:5)；
group 2:
SA-F2：5’-CAATGGTTTAACAGGCACAGG-3’(SEQ ID NO:6)；
SA-R2：5’-CTCAAGTGTCTGTGGATCACG-3’(SEQ ID NO:7)；
SA-probe2：5’-FAM-GGCAGAGACATTGCTGACACTACTGATGC-BHQ-3’(SEQ ID NO:8)；
the amplification sequences of the primers SA-F2 and SA-R2 are:
5’-CAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCC TTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGA CACTTGAG-3’(SEQ ID NO:9)；
the 5 '-end labeled luminescent groups of SA-probe1 and SA-probe2 in groups 1 and 2 are not limited to FAM, but may be HXE, ROX, etc., and the 3' -end labeled quencher groups are not limited to BHQ, TAMRA, etc., which are included in the present invention.
The primers and probes of the above group 1 and group 2 are used to construct gradient diluent (1.0 × 10) of SARS-COV-2 coronavirus positive quality control product (surface protein S gene (SEQ ID NO:1) of artificially synthesized SARS-COV-2 coronavirus is constructed on the vector pcDNA3.1, and plasmid is extracted as positive quality control product after amplification of Escherichia coli)6copies/μl、1.0×105copies/μl、1.0×104copies/μl、1.0×103copies/μl、1.0×102copies/μl、1.0×101copies/. mu.l) of the primers and probes obtained in the same manner as described in FIG. 1, wherein the panel (A) shows the amplification curves obtained using the primers and probes of group 1, and the S-shaped amplification curves of the six standard groups from left to right represent 1.0X 10, respectively6copies/μl、1.0×105copies/μl、1.0×104copies/μl、 1.0×103copies/μl、1.0×102copies/μl、1.0×101copies/. mu.l dilution, panel (B) shows the amplification curve obtained with the primers and probes of group 2, which did not show a standard sigmoidal amplification curve. From the results of FIG. 1, it can be seen that the detection limit of the primers and probes of group 1 can be as low as 1.0X 101copies/mu l, and has higher relative fluorescence intensity; while the primers and probes of group 2 could not be used at all for the detection of SARS-COV-2 coronavirus. Therefore, the primers and probes of preferred group 1 of the present invention are used below for detecting SARS-COV-2 coronavirus.
Example 2: method for establishing rapid detection of SARS-COV-2
In this embodiment, the primer and probe of group 1 obtained in the above embodiment 1 are used to establish a method for rapidly detecting SARS-COV-2 coronavirus, which specifically comprises the following steps:
2.1, establishing a standard curve: the positive quality control product obtained in the above example 1 was diluted by 10-fold gradient to obtain the following gradient concentration solution as SARS-COV-2 standard: 1X 107copies/μL、1×106copies/μL、1×105copies/μL、 1×104copies/μL、1×103copies/μL、1×102copies/μL、1×101copies/. mu.L, using different concentrations of standards as templates, and performing fluorescent quantitative PCR detection under the guidance of the primers and probes shown in group 1 (example 1), wherein the PCR detection system uses One Step PrimeScript from TAKARATMRT-PCR Kit, as shown in Table 1 below. And (3) carrying out PCR detection by using a LightCycler Real Time PCR amplification instrument for amplification reaction, wherein the amplification procedure is as follows: reverse transcription reaction: 5min at 42 ℃; 10sec at 95 ℃; 1 cycle; PCR reaction procedure: 5sec at 95 ℃; 20sec at 60 ℃; 40 cycles.
Table 1: PCR detection system
| Name of the component | Amount of the composition used | Final concentration |
| 2X One Step RT-PCR BufferⅢ | 10μL | 1× |
| SA-F1 | 0.4μL | Final concentration 0.2. mu.M*1 |
| SA-R1 | 0.4μL | Final concentration 0.2. mu.M*1 |
| SA-probe | 0.8μL*2 | |
| PrimeScript RT Enzyme MixⅡ | 0.4μL | |
| TaKaRa Ex Taq HS(5U/μL) | 0.4μL | |
| Form panel | 2μL*3 | |
| RNase Free ddH2O | 5.6μL | |
| In total | 20μL |
Better results are obtained with a final primer concentration of 0.2. mu.M. When the reaction performance is poor, the concentration of the primer can be adjusted within the range of 0.1-1.0 mu M.
The concentration of the probe2 is related to the Real Time PCR amplification instrument, the type of the probe and the type of the fluorescent labeling substance, and the practical application refers to the specification of the instrument and the specific application requirements of the fluorescent probe.
3 suggested using 10pg to 100ng Total RNA as template.
The real-time fluorescence quantitative PCR amplification curve of each standard is shown in FIG. 2, the amplification curve of the standard is a smooth "S" shaped curve (positive), and the concentrations of the seven groups of curves in FIG. 2 from left to right are respectively: 1X 107copies/μL、1×106copies/μL、 1×105copies/μL、1×104copies/μL、1×103copies/μL、1×102copies/μL、1×101copies/μL。
After the detection, the Log value of the concentration of each standard was plotted as the X-axis and the cycle number (Ct value) as the Y-axis to obtain a standard curve, which is shown in FIG. 3 and has a correlation coefficient R20.9951, therefore, the error is small, the obtained standard curve can be used for real-time fluorescence quantitative PCR detection of SARS-COV-2, and the linear equation obtained from the standard curve is: y-3.345X + 38.25.
2.2 real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus
The method comprises the step of carrying out real-time fluorescence quantitative PCR detection on SARS-COV-2 coronavirus by using the primer and probe of group 1 obtained in example 1, wherein a SARS-COV-2 coronavirus positive quality control product is used as a positive control, deionized water is used as a negative control, and qualitative judgment is carried out on whether the SARS-COV-2 coronavirus is contained in a sample to be detected according to a real-time fluorescence quantitative PCR detection result. And quantifying the copy number of the virus contained in the positive sample according to a standard curve. The method specifically comprises the following steps:
1) extracting total RNA of a sample to be detected;
2) using the total RNA as a template, and using the primer and the probe of the group 1 in the embodiment 1 to perform real-time fluorescent quantitative PCR detection; the detection lines are as shown in table 1 above, and the PCR amplification procedure is as described in step 2.1 above; detecting a fluorescent signal at the end of each cycle of annealing;
3) the qualitative detection of SARS-COV-2 is realized by the obtained Ct value and the change of the fluorescence signal, and the result judgment is as follows:
if the positive quality control product has an S-shaped amplification curve in the FAM fluorescence channel and the negative control deionized water has no amplification curve in the FAM fluorescence channel, judging that the experiment is established; otherwise, the experimental result is invalid.
When the experiment was established, the following determinations were made:
if the sample to be detected has an S-type amplification curve in the FAM fluorescence channel and the Ct value is less than or equal to 38, determining the sample to be detected as a positive sample, namely the sample to be detected contains SARS-COV-2 coronavirus;
if the sample to be detected has an S-shaped amplification curve in the FAM fluorescent channel and the Ct value is greater than 38, judging that the sample to be detected is an undetermined sample, and detecting after re-extracting RNA; if the rechecking results are the same, judging the sample to be weakly positive;
if the sample to be detected has no obvious S-type amplification curve in the FAM fluorescence channel, the sample is judged to be a negative sample, namely the sample to be detected does not contain SARS-COV-2 coronavirus.
4) And (3) for the sample to be detected determined to be positive for the SARS-COV-2 coronavirus in the step 3), obtaining the copy number of the virus contained in the sample to be detected according to the Ct value and the previously determined standard curve, and realizing the quantitative detection of the virus.
Example 3 sensitivity of real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus
FIG. 1A and FIG. 2 both show the sensitivity of the real-time fluorescence quantitative PCR detection method for SARS-COV-2 coronavirus according to the present invention, and it can be seen that the real-time fluorescence quantitative PCR detection method for SARS-COV-2 coronavirus according to the present invention can detect to 1 × 101The primers and the probes of the invention are combined with SARS-COV-2 coronavirus RNA properly and have higher sensitivity.
EXAMPLE 4 real-time fluorescent quantitative PCR detection kit for SARS-COV-2 coronavirus
The real-time fluorescence quantitative PCR detection kit for SARS-COV-2 coronavirus provided by the invention comprises:
primers (upstream primer SA-F1 and downstream primer SA-R1) and probe (SA-probe1) for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus shown in group 1 in example 1.
Specifically, the real-time fluorescence quantitative PCR detection kit for SARS-COV-2 coronavirus provided by the invention comprises the following reagents for 20 muL real-time fluorescence quantitative PCR detection system: real-time fluorescent quantitative One-Step PCR reaction solution 2 Xone Step RT-PCR Buffer III (TAKARA) 10. mu.L, PrimeScript RT Enzyme Mix II (TAKARA) 0.4. mu.L, 5U/. mu.L TaKaRa Ex Taq HS (TAKARA) 0.4. mu. L, SA-F10.4. mu.L (final concentration 0.1-1.0. mu.M), SA-R10.4. mu.L (final concentration 0.1-1.0. mu.M), SA-probe 10.8. mu.L, RNase Free ddH2O5.6. mu.L. When used, the amount of template RNA (10pg to 100ng) used was 2. mu.L.
For convenient detection, the kit may further comprise a positive control and a negative control, wherein the positive control is SARS-COV-2 coronavirus positive quality control obtained in example 1, and the negative control is a reaction system without SARS-COV-2 coronavirus, such as H2O (double distilled water, sterile deionized water, etc.).
For convenient detection, the kit may further comprise the standard curve obtained in example 2 and instructions including PCR reaction conditions: reverse transcription reaction: 5min at 42 ℃; 10sec at 95 ℃; 1 cycle; PCR reaction procedure: 5sec at 95 ℃; 20sec at 60 ℃; 40 cycles; and the determination of the detection result in example 2.
Example 5 clinical sample testing
In this example, genomic RNA extracted from 8 clinical throat swab samples (each numbered No.1, No.2, No.3, No.4, No.5, No.6, No.7 and No.8) collected from Anhui provincial center was detected using the detection kit (this kit) provided in example 4, and qualitative determination was made as to whether or not SARS-COV-2 coronavirus was contained in the clinical sample and quantitative determination was made as to SARS-COV-2 coronavirus contained in the positive sample, based on the detection results and the instructions provided in the kit, using a SARS-COV-2 coronavirus positive quality control as a positive control, deionized water as a negative control, and a commercial kit (purchased from Nanjing GmbH) for detecting SARS-COV-2 coronavirus as a reference.
As shown in Table 2 below, it can be seen that the clinical samples No.1-6 have positive detection results, i.e., the clinical samples No.1-6 contain SARS-COV-2 coronavirus; the detection results of the other two clinical samples No.7 and No.8 are negative, namely the other two clinical samples are not infected with SARS-COV-2 coronavirus; this is consistent with the results of the commercial kits, demonstrating the reliability of the detection kit provided in example 4 above for the detection of SARS-COV-2 coronavirus. Meanwhile, the detection result shows that the Ct value measured by the kit is smaller than the detection Ct value of the commercial kit aiming at all positive clinical samples, and therefore, the kit has higher sensitivity compared with the commercial kit. In addition, for the clinical sample with positive detection result, the copy number of SARS-COV-2 coronavirus in the positive clinical sample can be calculated according to the cycle number Ct value and the standard curve provided in the kit, and the method can play an important role in the preparation of SARS-COV-2 coronavirus vaccine.
Table 2: real-time fluorescent quantitative PCR detection result of 8 clinical samples
Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> institute of science of fertilizer combination and substance science of Chinese academy of sciences
Anhui Center for Disease Control and Prevention
PRECEDO PHARMACEUTICALS Co.,Ltd.
<120> kit for detecting SARS-CoV-2 coronavirus and its special primer and probe
<130> CGCNL200477W
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 9179
<212> DNA
<213> SARS-CoV-2 coronavirus (SARS-CoV-2 coronavirus)
<400> 1
gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900
gccaccatgt ttgtttttct tgttttattg ccactagtct ctagtcagtg tgttaatctt 960
acaaccagaa ctcaattacc ccctgcatac actaattctt tcacacgtgg tgtttattac 1020
cctgacaaag ttttcagatc ctcagtttta cattcaactc aggacttgtt cttacctttc 1080
ttttccaatg ttacttggtt ccatgctata catgtctctg ggaccaatgg tactaagagg 1140
tttgataacc ctgtcctacc atttaatgat ggtgtttatt ttgcttccac tgagaagtct 1200
aacataataa gaggctggat ttttggtact actttagatt cgaagaccca gtccctactt 1260
attgttaata acgctactaa tgttgttatt aaagtctgtg aatttcaatt ttgtaatgat 1320
ccatttttgg gtgtttatta ccacaaaaac aacaaaagtt ggatggaaag tgagttcaga 1380
gtttattcta gtgcgaataa ttgcactttt gaatatgtct ctcagccttt tcttatggac 1440
cttgaaggaa aacagggtaa tttcaaaaat cttagggaat ttgtgtttaa gaatattgat 1500
ggttatttta aaatatattc taagcacacg cctattaatt tagtgcgtga tctccctcag 1560
ggtttttcgg ctttagaacc attggtagat ttgccaatag gtattaacat cactaggttt 1620
caaactttac ttgctttaca tagaagttat ttgactcctg gtgattcttc ttcaggttgg 1680
acagctggtg ctgcagctta ttatgtgggt tatcttcaac ctaggacttt tctattaaaa 1740
tataatgaaa atggaaccat tacagatgct gtagactgtg cacttgaccc tctctcagaa 1800
acaaagtgta cgttgaaatc cttcactgta gaaaaaggaa tctatcaaac ttctaacttt 1860
agagtccaac caacagaatc tattgttaga tttcctaata ttacaaactt gtgccctttt 1920
ggtgaagttt ttaacgccac cagatttgca tctgtttatg cttggaacag gaagagaatc 1980
agcaactgtg ttgctgatta ttctgtccta tataattccg catcattttc cacttttaag 2040
tgttatggag tgtctcctac taaattaaat gatctctgct ttactaatgt ctatgcagat 2100
tcatttgtaa ttagaggtga tgaagtcaga caaatcgctc cagggcaaac tggaaagatt 2160
gctgattata attataaatt accagatgat tttacaggct gcgttatagc ttggaattct 2220
aacaatcttg attctaaggt tggtggtaat tataattacc tgtatagatt gtttaggaag 2280
tctaatctca aaccttttga gagagatatt tcaactgaaa tctatcaggc cggtagcaca 2340
ccttgtaatg gtgttgaagg ttttaattgt tactttcctt tacaatcata tggtttccaa 2400
cccactaatg gtgttggtta ccaaccatac agagtagtag tactttcttt tgaacttcta 2460
catgcaccag caactgtttg tggacctaaa aagtctacta atttggttaa aaacaaatgt 2520
gtcaatttca acttcaatgg tttaacaggc acaggtgttc ttactgagtc taacaaaaag 2580
tttctgcctt tccaacaatt tggcagagac attgctgaca ctactgatgc tgtccgtgat 2640
ccacagacac ttgagattct tgacattaca ccatgttctt ttggtggtgt cagtgttata 2700
acaccaggaa caaatacttc taaccaggtt gctgttcttt atcaggatgt taactgcaca 2760
gaagtccctg ttgctattca tgcagatcaa cttactccta cttggcgtgt ttattctaca 2820
ggttctaatg tttttcaaac acgtgcaggc tgtttaatag gggctgaaca tgtcaacaac 2880
tcatatgagt gtgacatacc cattggtgca ggtatatgcg ctagttatca gactcagact 2940
aattctcctc ggcgggcacg tagtgtagct agtcaatcca tcattgccta cactatgtca 3000
cttggtgcag aaaattcagt tgcttactct aataactcta ttgccatacc cacaaatttt 3060
actattagtg ttaccacaga aattctacca gtgtctatga ccaagacatc agtagattgt 3120
acaatgtaca tttgtggtga ttcaactgaa tgcagcaatc ttttgttgca atatggcagt 3180
ttttgtacac aattaaaccg tgctttaact ggaatagctg ttgaacaaga caaaaacacc 3240
caagaagttt ttgcacaagt caaacaaatt tacaaaacac caccaattaa agattttggt 3300
ggttttaatt tttcacaaat attaccagat ccatcaaaac caagcaagag gtcatttatt 3360
gaagatctac ttttcaacaa agtgacactt gcagatgctg gcttcatcaa acaatatggt 3420
gattgccttg gtgatattgc tgctagagac ctcatttgtg cacaaaagtt taacggcctt 3480
actgttttgc cacctttgct cacagatgaa atgattgctc aatacacttc tgcactgtta 3540
gcgggtacaa tcacttctgg ttggaccttt ggtgcaggtg ctgcattaca aataccattt 3600
gctatgcaaa tggcttatag gtttaatggt attggagtta cacagaatgt tctctatgag 3660
aaccaaaaat tgattgccaa ccaatttaat agtgctattg gcaaaattca agactcactt 3720
tcttccacag caagtgcact tggaaaactt caagatgtgg tcaaccaaaa tgcacaagct 3780
ttaaacacgc ttgttaaaca acttagctcc aattttggtg caatttcaag tgttttaaat 3840
gatatccttt cacgtcttga caaagttgag gctgaagtgc aaattgatag gttgatcaca 3900
ggcagacttc aaagtttgca gacatatgtg actcaacaat taattagagc tgcagaaatc 3960
agagcttctg ctaatcttgc tgctactaaa atgtcagagt gtgtacttgg acaatcaaaa 4020
agagttgatt tttgtggaaa gggctatcat cttatgtcct tccctcagtc agcacctcat 4080
ggtgtagtct tcttgcatgt gacttatgtc cctgcacaag aaaagaactt cacaactgct 4140
cctgccattt gtcatgatgg aaaagcacac tttcctcgtg aaggtgtctt tgtttcaaat 4200
ggcacacact ggtttgtaac acaaaggaat ttttatgaac cacaaatcat tactacagac 4260
aacacatttg tgtctggtaa ctgtgatgtt gtaataggaa ttgtcaacaa cacagtttat 4320
gatcctttgc aacctgaatt agactcattc aaggaggagt tagataaata ttttaagaat 4380
catacatcac cagatgttga tttaggtgac atctctggca ttaatgcttc agttgtaaac 4440
attcaaaaag aaattgaccg cctcaatgag gttgccaaga atttaaatga atctctcatc 4500
gatctccaag aacttggaaa gtatgagcag tatataaaat ggccatggta catttggcta 4560
ggttttatag ctggcttgat tgccatagta atggtgacaa ttatgctttg ctgtatgacc 4620
agttgctgta gttgtctcaa gggctgttgt tcttgtggat cctgctgcaa atttgatgaa 4680
gacgactctg agccagtgct caaaggagtc aaattacatt acacataagc ggccgctcga 4740
gtctagaggg cccgtttaaa cccgctgatc agcctcgact gtgccttcta gttgccagcc 4800
atctgttgtt tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt 4860
cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattct 4920
ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata gcaggcatgc 4980
tggggatgcg gtgggctcta tggcttctga ggcggaaaga accagctggg gctctagggg 5040
gtatccccac gcgccctgta gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag 5100
cgtgaccgct acacttgcca gcgccctagc gcccgctcct ttcgctttct tcccttcctt 5160
tctcgccacg ttcgccggct ttccccgtca agctctaaat cgggggctcc ctttagggtt 5220
ccgatttagt gctttacggc acctcgaccc caaaaaactt gattagggtg atggttcacg 5280
tagtgggcca tcgccctgat agacggtttt tcgccctttg acgttggagt ccacgttctt 5340
taatagtgga ctcttgttcc aaactggaac aacactcaac cctatctcgg tctattcttt 5400
tgatttataa gggattttgc cgatttcggc ctattggtta aaaaatgagc tgatttaaca 5460
aaaatttaac gcgaattaat tctgtggaat gtgtgtcagt tagggtgtgg aaagtcccca 5520
ggctccccag caggcagaag tatgcaaagc atgcatctca attagtcagc aaccaggtgt 5580
ggaaagtccc caggctcccc agcaggcaga agtatgcaaa gcatgcatct caattagtca 5640
gcaaccatag tcccgcccct aactccgccc atcccgcccc taactccgcc cagttccgcc 5700
cattctccgc cccatggctg actaattttt tttatttatg cagaggccga ggccgcctct 5760
gcctctgagc tattccagaa gtagtgagga ggcttttttg gaggcctagg cttttgcaaa 5820
aagctcccgg gagcttgtat atccattttc ggatctgatc aagagacagg atgaggatcg 5880
tttcgcatga ttgaacaaga tggattgcac gcaggttctc cggccgcttg ggtggagagg 5940
ctattcggct atgactgggc acaacagaca atcggctgct ctgatgccgc cgtgttccgg 6000
ctgtcagcgc aggggcgccc ggttcttttt gtcaagaccg acctgtccgg tgccctgaat 6060
gaactgcagg acgaggcagc gcggctatcg tggctggcca cgacgggcgt tccttgcgca 6120
gctgtgctcg acgttgtcac tgaagcggga agggactggc tgctattggg cgaagtgccg 6180
gggcaggatc tcctgtcatc tcaccttgct cctgccgaga aagtatccat catggctgat 6240
gcaatgcggc ggctgcatac gcttgatccg gctacctgcc cattcgacca ccaagcgaaa 6300
catcgcatcg agcgagcacg tactcggatg gaagccggtc ttgtcgatca ggatgatctg 6360
gacgaagagc atcaggggct cgcgccagcc gaactgttcg ccaggctcaa ggcgcgcatg 6420
cccgacggcg aggatctcgt cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg 6480
gaaaatggcc gcttttctgg attcatcgac tgtggccggc tgggtgtggc ggaccgctat 6540
caggacatag cgttggctac ccgtgatatt gctgaagagc ttggcggcga atgggctgac 6600
cgcttcctcg tgctttacgg tatcgccgct cccgattcgc agcgcatcgc cttctatcgc 6660
cttcttgacg agttcttctg agcgggactc tggggttcga aatgaccgac caagcgacgc 6720
ccaacctgcc atcacgagat ttcgattcca ccgccgcctt ctatgaaagg ttgggcttcg 6780
gaatcgtttt ccgggacgcc ggctggatga tcctccagcg cggggatctc atgctggagt 6840
tcttcgccca ccccaacttg tttattgcag cttataatgg ttacaaataa agcaatagca 6900
tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt ttgtccaaac 6960
tcatcaatgt atcttatcat gtctgtatac cgtcgacctc tagctagagc ttggcgtaat 7020
catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac 7080
gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa 7140
ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat 7200
gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc 7260
tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg 7320
cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 7380
gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc 7440
gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag 7500
gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga 7560
ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc 7620
atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 7680
tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt 7740
ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca 7800
gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 7860
ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 7920
ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggttttttt gtttgcaagc 7980
agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 8040
ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa 8100
ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat 8160
atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga 8220
tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac 8280
gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg 8340
ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg 8400
caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt 8460
cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct 8520
cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat 8580
cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta 8640
agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca 8700
tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat 8760
agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac 8820
atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa 8880
ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt 8940
cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg 9000
caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat 9060
attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt 9120
agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca cctgacgtc 9179
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtacccgcta acagtgcaga a 21
<210> 4
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cggccttact gttttgccac ctttgc 26
<210> 5
<211> 125
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tgccttggtg atattgctgc tagagacctc atttgtgcac aaaagtttaa cggccttact 60
gttttgccac ctttgctcac agatgaaatg attgctcaat acacttctgc actgttagcg 120
ggtac 125
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
caatggttta acaggcacag g 21
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ctcaagtgtc tgtggatcac g 21
<210> 8
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ggcagagaca ttgctgacac tactgatgc 29
<210> 9
<211> 121
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
caatggttta acaggcacag gtgttcttac tgagtctaac aaaaagtttc tgcctttcca 60
acaatttggc agagacattg ctgacactac tgatgctgtc cgtgatccac agacacttga 120
g 121
Claims (10)
1. The primer and the probe for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus are characterized in that the primer comprises an upstream primer SA-F1 and a downstream primer SA-R1, wherein the nucleotide sequence of SA-F1 is shown as SEQ ID NO.2, and the nucleotide sequence of SA-R1 is shown as SEQ ID NO. 3; the nucleotide sequence of the probe is shown as SEQ ID NO. 4.
2. The primer and probe of claim 1, wherein the probe is labeled with a fluorescent reporter at the 5 'end and a fluorescent quencher at the 3' end.
3. The primer and probe as claimed in claim 2, wherein the fluorescence reporter group is any one selected from FAM, ROX, CY5 and HEX, and the fluorescence quencher group is any one selected from TAMRA, BHQ and Eclipse.
4. A kit for real-time fluorescent quantitative PCR detection of SARS-COV-2 coronavirus comprising the primers and probes of any one of claims 1-3;
when the kit is used, the dosage of the primer and the probe in a 20-microliter real-time fluorescent quantitative PCR detection system is as follows: the final use concentration of each primer is 0.1-1.0 mu M, and the final use concentration of the probe is 0.1-0.5 mu M.
5. The kit of claim 4, further comprising a positive control and a negative control, wherein the positive control is a SARS-COV-2 coronavirus positive control, and the negative control is a reaction system without SARS-COV-2 coronavirus.
6. Use of the kit according to claim 4 or 5 for the detection of SARS-COV-2 coronavirus for non-disease diagnostic purposes.
7. Use according to claim 6, characterized in that:
the qualitative and quantitative detection method for SARS-COV-2 coronavirus with real-time fluorescent quantitative PCR technology includes the following steps:
1) establishing a standard curve: diluting SARS-COV-2 coronavirus positive quality control product to 1 × 10 by gradient of 10 times7copies/μL、1×106copies/μL、1×105copies/μL、1×104copies/μL、1×103copies/μL、1×102copies/μL、1×101copies/. mu.L as standard; taking standard substances with different concentrations as templates, carrying out real-time fluorescence quantitative PCR detection under the guide of the primer and the probe in any one of claims 1-3, after the detection is finished, drawing a corresponding Ct value (Y axis) by using a concentration Log value (X axis) of each standard substance, and drawing a standard curve;
2) extracting the genome RNA of a sample to be detected, carrying out real-time fluorescent quantitative PCR detection under the guide of the primer and the probe of any one of claims 1 to 3 by taking the extracted genome RNA as a template, and synchronously detecting a positive control and a negative control;
3) and (3) realizing qualitative detection of SARS-COV-2 coronavirus by using the obtained Ct value and the change of the fluorescence signal, and obtaining the copy number of SARS-COV-2 coronavirus contained in the sample to be detected according to the Ct value and the standard curve in the step 1) to realize quantitative detection.
8. The use of claim 7, wherein the sample to be tested in step 2) comprises raw materials for vaccine production, vaccine semi-finished products and finished products.
9. The use of claim 7, wherein the 20 μ L real-time fluorescent quantitative PCR detection system in step 1) and step 2) comprises: 2 μ L of template, 2 Xone Step RT-PCR Buffer III 10 μ L of real-time fluorescence quantitative One-Step PCR reaction solution, 0.4 μ L of PrimeScript RT Enzyme Mix II, 0.4 μ L of 5U/. mu.L of TaKaRa Ex Taq HS, 0.4 μ L of upstream primer, 0.4 μ L of downstream primer, 0.8 μ L of probe, RNase Free ddH2O 5.6μL；
The real-time fluorescent quantitative PCR detection conditions in the step 1) and the step 2) are as follows: reverse transcription reaction procedure: 5min at 42 ℃; 10sec at 95 ℃; 1 cycle; PCR reaction procedure: 5sec at 95 ℃; 20sec at 60 ℃; 40 cycles.
10. The application of claim 7, wherein the determination method in step 3) is as follows:
if the positive reference substance has an S-shaped amplification curve in the channel corresponding to the fluorescence reporter group, and the negative reference substance has no amplification curve in the channel corresponding to the fluorescence reporter group, judging that the experiment is established; otherwise, the experimental result is invalid;
when the experiment is established, the following judgment is made:
if the sample to be detected has an S-type amplification curve in the channel corresponding to the fluorescence reporter group and the Ct value is less than or equal to 38, determining that the sample to be detected contains SARS-COV-2 coronavirus;
if the sample to be detected has an S-shaped amplification curve in the channel corresponding to the fluorescence reporter group and the Ct value is greater than 38, judging that the sample to be detected is an undetermined sample, and detecting after re-extracting RNA; if the rechecking results are the same, judging the sample to be weakly positive;
if the sample to be detected has no obvious S-type amplification curve in the channel corresponding to the fluorescence reporter group, the sample is judged to be negative, namely the sample does not contain SARS-COV-2 coronavirus.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010227826.7A CN113444830A (en) | 2020-03-27 | 2020-03-27 | Kit for detecting SARS-CoV-2 coronavirus and its special primer and probe |
| PCT/CN2020/084154 WO2021189546A1 (en) | 2020-03-27 | 2020-04-10 | Kit for detecting sars-cov-2 coronavirus, and specific primer and probe thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010227826.7A CN113444830A (en) | 2020-03-27 | 2020-03-27 | Kit for detecting SARS-CoV-2 coronavirus and its special primer and probe |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113444830A true CN113444830A (en) | 2021-09-28 |
Family
ID=77807674
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010227826.7A Pending CN113444830A (en) | 2020-03-27 | 2020-03-27 | Kit for detecting SARS-CoV-2 coronavirus and its special primer and probe |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN113444830A (en) |
| WO (1) | WO2021189546A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20230074664A (en) | 2023-05-03 | 2023-05-31 | 김승찬 | COVID-19 mutation and translation blocker complementary DNA hairpin folder |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113846186A (en) * | 2021-10-20 | 2021-12-28 | 云南农业大学 | Universal detection primer and detection method for animal beta coronavirus |
| CN114672591B (en) * | 2022-01-11 | 2022-11-01 | 湖北省疾病预防控制中心（湖北省预防医学科学院） | Primer group and kit for identifying novel coronavirus and application of primer group and kit |
| CN114480742A (en) * | 2022-02-28 | 2022-05-13 | 山西大学 | qRT-PCR method for identifying BA-1 branch of novel coronavirus Omicron variant |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110468237A (en) * | 2016-03-10 | 2019-11-19 | 中山大学达安基因股份有限公司 | Detect the primed probe mixed liquor and kit of Middle East respiration syndrome coronavirus |
| KR20200032050A (en) * | 2020-03-05 | 2020-03-25 | 김승찬 | CoVID-19 suitable triple knockout DNAi remedy |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7220852B1 (en) * | 2003-04-25 | 2007-05-22 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention | Coronavirus isolated from humans |
| CN1188530C (en) * | 2003-05-16 | 2005-02-09 | 浙江大学医学院附属第一医院 | Gene detection reagent kit for SARS virus and its detection method |
| US20050112558A1 (en) * | 2003-09-24 | 2005-05-26 | The Chinese University Of Hong Kong | Prognostic PCR assay for severe acute respiratory syndrome (SARS) |
| CN103484565B (en) * | 2013-09-02 | 2016-06-08 | 湖北朗德医疗科技有限公司 | The test kit of a kind of real-time fluorescence RT-PCR detection coronavirus and application thereof |
| CN109371174A (en) * | 2018-12-20 | 2019-02-22 | 江苏和创生物科技有限公司 | Middle East respiration syndrome coronavirus fluorescence PCR detection reagent kit |
-
2020
- 2020-03-27 CN CN202010227826.7A patent/CN113444830A/en active Pending
- 2020-04-10 WO PCT/CN2020/084154 patent/WO2021189546A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110468237A (en) * | 2016-03-10 | 2019-11-19 | 中山大学达安基因股份有限公司 | Detect the primed probe mixed liquor and kit of Middle East respiration syndrome coronavirus |
| KR20200032050A (en) * | 2020-03-05 | 2020-03-25 | 김승찬 | CoVID-19 suitable triple knockout DNAi remedy |
Non-Patent Citations (2)
| Title |
|---|
| KAZUYA SHIRATO ET AL.: "Development of Genetic Diagnostic Methods for Detection for Novel Coronavirus 2019(nCoV-2019) in Japan", 《JAPANESE JOURNAL OF INFECTIOUS DISEASES》 * |
| VICTOR M CORMAN ET AL.: "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR", 《EURO SURVEILL.》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20230074664A (en) | 2023-05-03 | 2023-05-31 | 김승찬 | COVID-19 mutation and translation blocker complementary DNA hairpin folder |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2021189546A1 (en) | 2021-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113444830A (en) | Kit for detecting SARS-CoV-2 coronavirus and its special primer and probe | |
| CN1304575C (en) | Nucleic acid vaccines for prevention of flavivirus infection | |
| CN110117577B (en) | Low-toxicity herpes simplex virus system and construction method and application thereof | |
| TW200533376A (en) | Compositions and methods for treating lung cancer | |
| CN101688195A (en) | Method for production of recombinant human thrombin `644 | |
| CN114616000A (en) | Carrier compositions and methods for their use in treating lysosomal storage disorders | |
| CN109415429B (en) | HERV-E reactive T cell receptor and methods of use | |
| KR20060123152A (en) | Method for producing gamma-carboxylated proteins | |
| CN109734793B (en) | ZnT8 recombinant protein and preparation method and application thereof | |
| KR20210142599A (en) | Treatment of diseases involving ENPP1 or ENPP3 deficiency | |
| CN111690687B (en) | Method and application for promoting skeletal muscle development | |
| CN111278981A (en) | Constructs for expressing G protein-coupled receptors or subunits thereof and uses thereof | |
| CN103773803A (en) | Recombined cattle parainfluenza carrier for expressing protein VP1 of porcine O type foot-and-mouth disease virus | |
| CN1780912B (en) | Method for inhibiting cell growth and composition therefor | |
| CN114375396A (en) | Improved NMDA receptor autoantibody detection | |
| CN112778425B (en) | Preparation method of RNA gene editing system for reducing off-target effect | |
| AU2022257301A1 (en) | Casrx/cas13d systems targeting c9orf72 | |
| CN110423736B (en) | Base editing tool, application thereof and method for editing wide-window and non-sequence preference bases in eukaryotic cells | |
| CN113652412A (en) | Method for preparing restriction enzyme products | |
| KR20230167100A (en) | Compositions and methods for ocular transgene expression | |
| CN114231568B (en) | Auxiliary protein for improving DNA repair efficiency, gene editing vector and application thereof | |
| CN109943567B (en) | Application of CRISPR-Cas 9-mediated exon site-directed mutagenesis technology in cell line | |
| CN112646838B (en) | HSPA13 gene expression vector and construction method and application thereof | |
| CN108893491A (en) | A method of screening CREB signal path agonist or inhibitor | |
| KR20180100028A (en) | Preparation Process for CCN5 protein by using transfected CHO |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20210928 |