CN113444779B - Method for quantitative correction of exosome mRNA detection - Google Patents

Abstract

The invention provides application of two reference genes UIMC1 and RNF25 in detecting the mRNA expression level of an exosome. Also, the present invention provides a kit comprising a forward primer SEQ ID NO. 1 and a reverse primer SEQ ID NO. 2 of the UIMC1 gene, and a forward primer SEQ ID NO. 4 and a reverse primer SEQ ID NO. 5 of the RNF25 gene. The expression of the two reference genes is stable at different time points of the same individual and among different individuals, particularly the relative expression level between the two genes is stable, and the two reference genes can be used for correcting the expression level of mRNA in an exosome and can also be used for detecting cancers of a urinary tract system.

Description

Method for quantitative correction of exosome mRNA detection

Technical Field

The invention provides a pair of reference genes for detecting exosome mRNA, which is used for quantitative correction of fluorescence PCR.

Background

In humans, different tissues have different gene expression patterns, but some gene products are essential for maintaining basic cell functions, and stably expressed in all cells, and these genes are called housekeeping genes (HK gene) ¹ . HK genes can be used generally as a measure of calibration gene expression ² . It has been reported that GAPDH is a relatively common housekeeping gene in cells and tissues ³ 。

An Exosome, also called Exosome, with a diameter of 30-150 nm, is a vesicle encapsulated by a lipid bilayer membrane released into the extracellular environment after the intracellular multivesicular body (MVB) is fused with a cell membrane, and comprises nucleic acid (DNA, mRNA, microRNA (miRNA), lncRNA, circRNA, etc.), protein ⁴ . The urine exosome is a vesicle secreted by urothelial cells, and research results show that the urine exosome of patients with urinary tract tumor contains mRNA specific to bladder cancer ^5,6 . However, the expression of the currently used housekeeping gene GAPDH is unstable in urine exosome mRNA detection, and the housekeeping gene GAPDH has large differences among different individuals.

The housekeeping gene conventionally used for mRNA fluorescent PCR quantitative detection is GAPDH, and there are many problems mainly as follows: 1. the exosome GAPDH gene is used as a housekeeping gene, and the stability is poor in detection results sampled by the same person at different times. 2. The exosome GAPDH gene is used as a housekeeping gene, and a tumor patient and a healthy person cannot be well distinguished in mRNA detection of the exosome in urine of different people.

The invention aims to provide a pair of reference genes UIMC1 and RNF25 for detecting urine exosome mRNA, which mainly have the following advantages: first, in the mRNA results sampled and detected at different time points of the same person, the detection results of two reference genes are relatively more stable. Secondly, the gene is used as a reference gene for correction, so that the discrimination between a tumor patient and a healthy person can be remarkably improved, and the sensitivity and specificity of a detection system can be further improved in the detection process of the cancer in the urinary tract system.

Disclosure of Invention

Herein, the UIMC1 gene is also called ubiquitin interaction motif 1, and the GenBank number thereof is KJ902619.1; RNF25 gene is also called ring finger protein 25, and its NCBI Reference Sequence is NM-022453.3.

The invention mainly aims to provide the application of reference genes UIMC1 and RNF25 genes in exosome mRNA detection;

the primer and probe sequences for UIMC1 and RNF25 detection were as follows:

primer, probe name	Sequence information (5 '- -3')	SEQ ID
			UIMC1 forward primer	AAGCAAGTTACTGTCCAGCCA	SEQ ID NO:1
UIMC1 reverse primer	TTTGTACAAGAAAGTTGGGCAGA	SEQ ID NO:2
			UIMC1 probe	GTCGGACACGGACCAAAGCTGGCAGAGG	SEQ ID NO:3
RNF25 forward primer	AAATCAGCAAAGGTTGGGCG	SEQ ID NO:4
			RNF25 reverse primer	GGGGTTCTGGCTTTAGGTCC	SEQ ID NO:5
RNF25 Probe	AGTCGAGGTCCCTGGCGACAGCCCGAAC	SEQ ID NO:6

Preferably, the primer concentration of the reference gene for detection is set conventionally, for example, the final concentration is between 100-900nM, and the probe concentration can be between 25-500 nM;

preferably, all probes for detecting the reference gene have a fluorescent group at the 5 'end, the fluorescence may be VIC, FAM, ROX or HEX, and a quenching group at the 3' end, such as MGB or BHQ1 group.

Specifically, the invention relates to the following technical scheme:

1. use of an internal reference gene for detecting the level of exosome mRNA expression, wherein the internal reference gene is UIMC1 and RNF25.

2. The use of an internal reference gene in the preparation of a kit for detecting the expression level of mRNA in exosomes or a kit for diagnosing a tumor of the urinary tract system, wherein the internal reference gene is UIMC1 and RNF25;

wherein the tumor of the urinary tract system comprises bladder cancer, kidney cancer, ureter cancer or prostate cancer.

3. The use according to item 1 or 2, wherein the primer sequence of UIMC1 is shown as SEQ ID NO. 1 and 2, and the primer sequence of RNF25 is shown as SEQ ID NO. 4 and 5; preferably, the final concentration of the primer is between 100-900 nM;

optionally, the probe of the UIMC1 is shown as SEQ ID NO. 3, and the probe of the RNF25 gene is shown as SEQ ID NO. 6; preferably, the probe carries a fluorescent group (e.g., VIC, FAM, ROX, or HEX) at the 5 'end and a quencher group (e.g., MGB or BHQ1 group) at the 3' end; preferably, the probe concentration is between 25-500 nM.

4. The use of item 1 or 2, wherein the exosomes are urine exosomes or human body fluid exosomes (e.g., exosomes of blood, pleural fluid, cerebrospinal fluid).

5. A method for detecting mRNA expression level in exosomes, wherein UIMC1 and RNF25 are used as internal reference genes.

6. The method according to item 5, wherein the expression level of mRNA is corrected using the relative expression values of UIMC1 and RNF25.

7. The method of clause 5, wherein the expression level of mRNA is obtained using the following equation:

mRNA expression level = (mRNA measurement value/UIMC 1 measurement value) (RNF 25 measurement value/UIMC 1 measurement value).

8. A kit comprising forward primer SEQ ID NO 1 and reverse primer SEQ ID NO 2 of UIMC1 gene, and forward primer SEQ ID NO 4 and reverse primer SEQ ID NO 5 of RNF25 gene.

9. The kit according to item 8, further comprising a probe SEQ ID NO. 3 for the UIMC1 gene and a probe SEQ ID NO. 6 for the RNF25 gene; preferably, the probe carries a fluorescent group (e.g., VIC, FAM, ROX, or HEX) at the 5 'end and a quencher group (e.g., MGB or BHQ1 group) at the 3' end; preferably, the probe concentration is between 25-500 nM.

10. The use of the kit of item 8 in the detection of exosome mRNA expression levels.

The technical effects are as follows:

the invention provides a pair of reference genes UIMC1 and RNF25, which can be used for detecting the mRNA expression level of an exosome. The more stable expression of these two reference genes, and in particular the more stable relative expression levels between the two genes, at different time points in the same individual as well as between different individuals, can be used to correct the expression level of mRNA in exosomes. Specifically, the reference gene has the following advantages: first, in the mRNA results sampled and detected at different time points of the same person, the relative detection results of two reference genes are more stable. Secondly, the two genes are used as reference genes to be corrected, so that the discrimination between tumor patients and healthy people can be remarkably improved, and the sensitivity and specificity of a detection system can be further improved in the process of detecting the cancer in the urinary tract system.

Drawings

FIG. 1 shows the expression of the reference genes UIMC1 and RNF25 in different samples;

figure 2 shows the results of comparison of tumor groups to healthy groups after correction with (differential genes/UIMC 1) (RNF 25/UIMC 1);

fig. 3 shows the results of comparison of tumor group to healthy group after correction using GAPDH.

Detailed Description

In order that the objects, technical solutions and advantages of the present invention will become more apparent, the present invention will be further described in detail with reference to the accompanying drawings in conjunction with the following specific embodiments.

The methods used in the following examples are conventional methods unless otherwise specified, and the reagents used are commercially available reagents unless otherwise specified.

Example 1 urine exosome reference gene screening

1.1 urine exosome preparation and exosome RNA extraction

1) Preparing urine samples, wherein the required amount is 30mL, taking 9 urine samples of healthy volunteers, and numbering the urine samples in sequence from N1 to N9; 9 urine samples of urothelial cancer patients are numbered as T1-T9 in sequence;

2) Taking a urine sample, centrifuging at 4 ℃ for 15min at 3000g, transferring a supernatant into a new centrifuge tube, adding 15mL of PEG8000 aqueous solution (with the concentration of 30%), shaking and uniformly mixing, standing overnight at 4 ℃, then centrifuging at 3000g for 10min, and performing RNA extraction on an exosome by using Qiagen miRNeasy Micro Kit (Qiagen, 217084) on the obtained precipitate;

1.2 urine exosomes RNA library construction

Urine exosome library was constructed using Ovation SoLo RNA-Seq System kit (NuGen, cat # M01406), the procedure of which is described in the kit instructions.

1.3 the urine exosome RNA library is sent to a clear code organism Nova platform for sequencing, and the PE150 sequencing technology is used, wherein the required quantity of each sample data is 15G.

1.4 sequencing data analysis and reference Gene screening

The sequencing data analysis flow is as follows:

the offline data is subjected to quality control by fastqc, data comparison is performed by using STAR software, and after a count is obtained, data normalization is performed by using TPM (Transcripts Per Million).

Wherein N1-N9 is a healthy group, T1-T9 is a tumor group, the analysis of the differential genes among the groups is carried out by taking pvalue <0.01& | logF | >2, and the differential genes between the tumor group and the healthy group which are identified are sequentially as follows: the detection results of IGF2, FSCN1, H1-5, and the differential genes are shown in Table 1:

gene_name	N1	N2	N3	N4	N5	N6	N7	N8	N9
										IGF2	192.82	159.56	93.04	147.66	121.28	108.47	228.99	201.46	170.11
FSCN1	13.7	15.47	22.18	19.05	15.58	24.3	19.64	10.4	14.78
										H1-5	4.23	6.08	4.88	3.66	4.23	8.01	6.03	2.31	4.9
gene_name	T1	T2	T3	T4	T5	T5	T7	T8	T9
										IGF2	481.22	304.23	248.27	2269.19	259.37	102.23	411.84	259.7	1643.52
FSCN1	102.43	18.13	27.84	245.01	35.11	11.36	24.37	49.15	61.83
										H1-5	19.57	8.15	7.8	28.95	11.2	2.07	4.17	31.9	62.43

TABLE 1 differential Gene test results

Analyzing CV values of all sample genes, wherein CV = sd/mean × 100%, screening genes with CV less than or equal to 0.3 as reference genes, and after analyzing TPM values of the reference genes, finding that the CV values of RNF25 and UIMC1 are less than 0.3 in all samples and expression changes of the two genes are basically consistent among different samples, the detection results of the reference genes are shown in Table 2, and the change trends of the reference genes in different samples are shown in FIG. 1, which indicates that RNF25 and UIMC1 are basically stably expressed in different samples.

TABLE 2 results of detection of reference genes

gene_name	N1	N2	N3	N4	N5	N6	N7	N8	N9
										RNF25	42.5	57.02	33.15	49	25.57	31.2	35.1	45.76	42.18
UIMC1	36.39	46.36	33.53	42.32	28.87	36.21	37.21	42.3	45.46
										gene_name	T1	T2	T3	T4	T5	T5	T7	T8	T9
RNF25	27.39	44.46	31.19	53.33	51.07	15.31	40.38	26.22	46.88
										UIMC1	21.57	41.24	26.92	33.61	43.16	13.4	35.29	17.73	34.03

Example 2 differential genes screened from urine exosome sequencing samples were corrected using the screened reference genes RNF25/UIMC1

Through calculation analysis, the maximum detection value of 18 samples is 57.02, the minimum detection value is 15.31 and the difference is 3.72 times for the reference gene RNF25; for UIMC1, the maximum detection value of 18 samples was 46.36, the minimum detection value was 13.4, the difference was 3.45-fold, and the trend of the relative expression (RNF 25/UIMC 1) of the two genes was between 0.86 and 1.59 (see Table 3), and the fluctuation was relatively small, as shown in Table 3.

TABLE 3 calculation of expression differences and relative expression of reference genes

gene_name	N1	N2	N3	N4	N5	N6	N7	N8	N9
										RNF25	42.5	57.02	33.15	49	25.57	31.2	35.1	45.76	42.18
UIMC1	36.39	46.36	33.53	42.32	28.87	36.21	37.21	42.3	45.46
										RNF25/UIMC1	1.17	1.23	0.99	1.16	0.89	0.86	0.94	1.08	0.93
gene_name	T1	T2	T3	T4	T5	T5	T7	T8	T9
										RNF25	27.39	44.46	31.19	53.33	51.07	15.31	40.38	26.22	46.88
UIMC1	21.57	41.24	26.92	33.61	43.16	13.4	35.29	17.73	34.03
										RNF25/UIMC1	1.27	1.08	1.16	1.59	1.18	1.14	1.14	1.48	1.38

Thus, the relative expression of RNF25 and UIMC1 can be used to correct for gene expression. Subsequently, we found that the screened differential genes are processed by the following processes: (detection value of difference gene/detection value of UIMC 1) — (detection value of RNF 25/detection value of UIMC 1), the calculated values after correction are shown in table 4, and the detection values of the three difference genes after correction have significant difference between the healthy sample and the tumor sample, so that the data after correction can clearly distinguish the healthy sample from the tumor sample, as shown in fig. 2.

TABLE 4 calculation of data after correction of differential genes/UIMC 1 RNF25/UIMC1

Correction value	N1	N2	N3	N4	N5	N6	N7	N8	N9
										IGF2	6.19	4.23	2.74	4.04	3.72	2.58	5.81	5.15	3.47
FSCN1	0.44	0.41	0.65	0.52	0.48	0.58	0.50	0.27	0.30
										H1-5	0.14	0.16	0.14	0.10	0.13	0.19	0.15	0.06	0.10
Correction value	T1	T2	T3	T4	T5	T5	T7	T8	T9
										IGF2	28.33	7.95	10.69	107.13	7.11	8.72	13.35	21.66	66.53
FSCN1	6.03	0.47	1.20	11.57	0.96	0.97	0.79	4.10	2.50
										H1-5	1.15	0.21	0.34	1.37	0.31	0.18	0.14	2.66	2.53

In this example, only three mRNAs in urine exosomes were taken as an example, and the expression levels of the three mRNAs were corrected using RNF25/UIMC 1. From the data of this example, it is clear that the relative expression fluctuations of RNF25 and UIMC1 are small, and therefore, in theory RNF25/UIMC1 could be applied to the correction and detection of the expression levels of all mRNAs in exosomes.

Comparative experiment differential genes screened from urine exosomes were corrected using the traditional internal reference gene GAPDH

We also corrected for the difference gene using the comparative classical internal reference GAPDH (which is a commonly used internal reference in the prior art), i.e., difference gene/GAPDH, where the detection of GAPDH is shown in table 5, the data after correction of the difference gene is shown in table 6, and the analysis of the difference gene after correction using GAPDH is shown in fig. 3. As can be seen from the data results, the detection values of the three differential genes in the healthy sample and the tumor sample are not significantly different by using the correction of GAPDH, so that the healthy sample and the tumor sample cannot be clearly distinguished.

TABLE 5 detection results of GAPDH

gene_name	N1	N2	N3	N4	N5	N6	N7	N8	N9
										GAPDH	503.13	488.96	593.73	506.43	588.18	448.46	356.76	499.45	309.76
gene_name	T1	T2	T3	T4	T5	T5	T7	T8	T9
										GAPDH	403.32	472.75	1332.27	214.54	484.29	563.15	1074.25	657.34	407.47

TABLE 6 GAPDH corrected data calculation results

GAPDH correction	N1	N2	N3	N4	N5	N6	N7	N8	N9
										IGF2	0.38	0.33	0.16	0.29	0.21	0.24	0.64	0.40	0.55
FSCN1	0.03	0.03	0.04	0.04	0.03	0.05	0.06	0.02	0.05
										H1-5	0.01	0.01	0.01	0.01	0.01	0.02	0.02	0.00	0.02
GAPDH correction	T1	T2	T3	T4	T5	T5	T7	T8	T9
										IGF2	1.19	0.64	0.19	10.58	0.54	0.18	0.38	0.40	4.03
FSCN1	0.25	0.04	0.02	1.14	0.07	0.02	0.02	0.07	0.15
										H1-5	0.05	0.02	0.01	0.13	0.02	0.00	0.00	0.05	0.15

Example 3 qPCR validation of urine exosome RNF25 Gene and UIMC1 Gene between different people

In order to test the relative stability of the RNF25 gene and UIMC1 gene in different samples, we collected 7 urine samples of healthy people, numbered N1-N7 in sequence, and performed exosome and exosome RNA preparation, wherein the exosome and exosome RNA preparation refers to the procedure shown in example 1, and then performed qPCR verification on the two genes, the two primers and probe sequence information are shown in table 7, the qPCR detection employs a fenc One-step reagent, one step RT-PCR kit (MD 027, fenc biotechnology limited), and the sample well reaction system is configured as follows:

composition (A)	Volume (mu L)
		RT-PCR Master Mix	10
Enzyme Mix	3
		Primer probe solution	2
Form panel	5
		Enzyme-free water	30

The reaction process is as follows:

TABLE 7 primer and probe sequences for RNF25 and UIMC1 genes

Primer, probe name	Sequence information (5 '- -3')	SEQ ID
			UIMC1 forward primer	AAGCAAGTTACTGTCCAGCCA	SEQ ID NO:1
UIMC1 reverse primer	TTTGTACAAGAAAGTTGGGCAGA	SEQ ID NO:2
			UIMC1 probe	GTCGGACACGGACCAAAGCTGGCAGAGG	SEQ ID NO:3
RNF25 Forward primer	AAATCAGCAAAGGTTGGGCG	SEQ ID NO:4
			RNF25 reverse primer	GGGGTTCTGGCTTTAGGTCC	SEQ ID NO:5
RNF25 Probe	AGTCGAGGTCCCTGGCGACAGCCCGAAC	SEQ ID NO:6

The PCR detection results are as follows:

sample name	RNF25Ct value	UIMC1 Ct value	ΔCt(UIMC1 Ct-RNF25 Ct)
				N1	28.06	29.42	1.36
N2	29.93	31.46	1.53
				N3	30.93	32.73	1.76
N4	30.46	31.75	1.30
				N5	30.67	31.98	1.31
N6	29.92	31.38	1.46
				N7	30.47	32.29	1.82

Detection results show that in different samples, the delta Ct values of two reference genes are between 1.30 and 1.82, the fluctuation range of the RNF25Ct value is between 28.06 and 30.93, the difference between the highest value and the lowest value is 2.87 Cts, the fluctuation range of the UIMC1 Ct value is between 29.42 and 32.73, and the difference between the highest value and the lowest value is 3.31 Cts. Therefore, it is more advantageous to choose the relative expression values of two genes to calibrate between different samples.

Example 4 qPCR validation of urine exosome RNF25 Gene and UIMC1 Gene at different time points in the same human

In order to test the relative stability of the RNF25 gene and UIMC1 gene in the same sample, we collected urine samples of 2 healthy people at 7 time points each, numbered as S (1-1) -S (1-7) and S (2-1) -S (2-7), performed exosome and exosome RNA preparation, referring to the procedure shown in example 1 for exosome and exosome RNA preparation, followed by qPCR validation of the two genes, with the two primers and probe sequence information shown in table 7, qPCR detection using the fepeng One-step reagent, one step RT-PCR kit, and the sample well reaction system configured as follows:

composition (I)	Volume (μ L)
		RT-PCR Master Mix	10
Enzyme Mix	3
		Primer probe solution	2
Form panel	5
		Enzyme-free water	30

The reaction process is as follows:

the PCR detection results are as follows:

sample name	RNF25Ct	UIMC1Ct	ΔCt(UIMC1 Ct-RNF25 Ct)
				S(1-1)	32.08	33.86	1.78
S(1-2)	31.73	33.63	1.90
				S(1-3)	33.60	34.93	1.33
S(1-4)	33.96	35.85	1.89
				S(1-5)	32.61	34.32	1.71
S(1-6)	32.79	34.54	1.76
				S(2-1)	31.94	33.77	1.83
S(2-2)	32.19	33.74	1.54
				S(2-3)	31.58	32.95	1.37
S(2-4)	32.38	33.81	1.43
				S(2-5)	33.05	34.59	1.54
S(2-6)	30.78	32.53	1.75

The detection result shows that in the same sample, the detection is carried out at different time points, the delta Ct value of two reference genes of S1 is between 1.33 and 1.90, for a single gene, the fluctuation range of the RNF25Ct value of the S1 sample is between 31.73 and 33.96, the difference between the highest value and the lowest value is 2.23 Ct, the fluctuation range of the UIMC1 Ct value is between 33.63 and 35.85, and the difference between the highest value and the lowest value is 2.22 Ct; the delta Ct values of the two reference genes of S2 are between 1.37 and 1.83, for a single gene, the fluctuation range of the RNF25Ct value of the S2 sample is between 30.78 and 33.05, the difference between the highest value and the lowest value is 2.27 Cts, the fluctuation range of the UIMC1 Ct value is between 32.53 and 34.59, and the difference between the highest value and the lowest value is 2.09 Cts; the relative expression of the two genes is more stable in the detection of the same individual at different time points, and the relative value of the two genes is selected for calibration in the detection of the gene expression of the same individual at different time points, so that the method is more advantageous.

The above-mentioned embodiments, objects, technical solutions and advantages of the present invention are further described in detail, it should be understood that the above-mentioned embodiments are only examples of the present invention, and should not be construed as limiting the present invention, and any modifications, equivalent substitutions, improvements and the like made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Reference to the literature

1.Butte,A.J.et al.Further defining housekeeping,or‘maintenance,’genes focus on‘a compendium of gene expression in normal human tissues’.Physiol.Genomics 7,95–96.2001

2.Gibson,U.E.et al.A novel method for real time quantitative RT–PCR.Genome Res.6,995–1001.1996

3.Robert D Barber.et al.GAPDH as a housekeeping gene:analysis of GAPDH mRNA expression in a panel of 72human tissues.Physiol.Genomics21(3):389-95.2005

4.

-Mó,M.et al.Biological properties of extracellular vesicles and their physiological functions.J.Extracell.Vesicles 4,27066(2015).

5.Aoki J,Ohashi K,Mitsuhashi M,Murakami T,Oakes M,Kobayashi T,Doki N,Kakihana K,Sakamaki H.Posttransplantation Bone Marrow Assessment by Quantifying Hematopoietic Cell-Derived mRNAs in Plasma Exosomes.Microvesicles.Clin Chem.2014

Yamamoto CM,Oakes ML,Murakami T,Muto MG,Berkowitz RS,Ng SW.Comparison of benign peritoneal fluid-and ovarian cancer ascites-derived extracellular vesicle RNA biomarkers.J Ovarian Res.2018

Claims (10)

1. The application of a detection reagent of an internal reference gene in preparing a kit for diagnosing the urinary tract tumor, wherein the internal reference gene is UIMC1 and RNF25;

wherein the tumor of the urinary tract system comprises bladder cancer, renal cancer, ureteral cancer or prostate cancer.

2. The use of claim 1, wherein the detection reagent is a primer, the primer sequence of UIMC1 is shown as SEQ ID NO 1 and 2, and the primer sequence of RNF25 is shown as SEQ ID NO 4 and 5.

3. The use according to claim 2, wherein the final concentration of the primer is between 100-900 nM.

4. The use of claim 1 or 2, wherein the UIMC1 probe is set forth as SEQ ID NO. 3 and the RNF25 gene probe is set forth as SEQ ID NO. 6.

5. The use of claim 4, wherein the probe has a fluorophore at the 5 'end and a quencher at the 3' end.

6. Use according to claim 5, wherein the fluorophore is VIC, FAM, ROX or HEX.

7. Use according to claim 5, wherein the quencher group is an MGB or BHQ1 group.

8. The use according to claim 4, wherein the probe concentration is between 25-500 nM.

9. Use according to claim 1, wherein the relative expression values of UIMC1 and RNF25 are used to correct the expression level of mRNA in urine exosomes.

10. Use according to claim 9, wherein the expression level of mRNA is obtained using the following equation:

mRNA expression level = (mRNA measurement value/UIMC 1 measurement value) (RNF 25 measurement value/UIMC 1 measurement value).

Images