CN113337518B - Corn ZmDnajA6 gene related to high-temperature and drought dual stress as well as vector and application thereof - Google Patents

Abstract

The invention belongs to the field of molecular breeding, relates to the cultivation of a new corn variety, and particularly relates to a corn gene related to high-temperature and drought dual stress, and a vector and application thereof. The corn gene isZmDnajA6A promoter sequence comprising an abiotic stress response element, a plant growth and development element, and a hormone response element, wherein the abiotic stress response element comprises LTR, MBS, sp1, ARE, and G-box; elements of plant growth and development include O2-site and CAT-box; hormone-responsive elements include ABRE, CGTCA-motif, GARE-motif. OverexpressionZmDnajA6The gene discovery improves the drought and high temperature resistance and interference of plantsZmDnajA6The gene improves the sensitivity of plants to drought and high temperature, and provides a new idea for cultivating new varieties with high temperature resistance and drought dual stress resistance.

Description

Corn associated with high temperature, drought dual stressZmDnajA6Gene, vector and application thereof

Technical Field

The invention belongs to the field of molecular breeding, relates to the cultivation of a new corn variety, and particularly relates to a corn gene related to high-temperature and drought dual stress, and a vector and application thereof.

Background

Corn has a wider planting area in China, is one of three grain crops in China, and has larger requirements in feeding and industrial raw materials. The high and stable yield of the corn is one of the prerequisites of guaranteeing the grain safety in China. With the increase of global temperature, extreme weather events are in a high-frequency and frequent transition state, and the natural growth of crops is seriously influenced. In the summer, the high-temperature weather seriously influences the growth and development of the corn, reduces the grouting capacity of the corn and reduces the yield and the quality of the corn. Meanwhile, the natural pollen scattering of the pollen can be influenced in high-temperature weather by the corn which is of the same male and female plants, so that the flowering period is not met, the activity of anthers can be influenced, and the maturing rate of the corn is reduced. Drought stress is one of the other abiotic stresses which harm the yield and the quality of corn, and data statistics show that the yield of corn is reduced by about 260 ten thousand tons, the disaster area reaches 1400 million hectares and the absolute harvest area reaches 170 million hectares in China every year in the last decade. In recent years, summer corn in Huang-Huai-Hai region is planted for about 1000 million hectares throughout the year, the annual total yield reaches 4500 million tons, and the method is a dominant industrial zone for corn production. However, the raw tea of summer corn in the area is easily subjected to double stresses of high temperature and drought, and serious threat is caused to the corn production in the area.

In order to deal with the double stresses of high temperature and drought, planting the corn variety with better high temperature resistance and drought resistance is an economic and effective method. The cultivation of new corn varieties with high temperature resistance and good drought resistance becomes a key task of breeders. The traditional breeding technology often requires experience and opportunity of a breeder, and has great blindness and unpredictability. In recent years, with the breakthrough of various technologies such as genome sequencing and the like, genomics, phenomics, bioinformatics and the like are developed rapidly, and crop breeding theories and technologies are also revolutionized significantly. The modern crop molecular breeding technology represented by molecular marker breeding, transgenic breeding and molecular design breeding gradually becomes the mainstream of crop breeding all over the world, and the breeding efficiency is greatly improved. The key to cultivate good varieties is to mine good gene resources which are resistant to high temperature and drought from the molecular level. Therefore, the method excavates gene resources of the corn with high temperature resistance and drought resistance, analyzes the action way of the gene resources in the aspect of enhancing the high temperature resistance and the drought resistance of the corn, defines major genes and is the key for quickly cultivating new varieties of excellent corn.

As a molecular chaperone of other Proteins, heat Shock Proteins (Hsps) have a strong cell protection effect, participate in processes such as protein folding degradation, signal transduction and plant growth and development, and are induced and expressed by high temperature, drought, hormones and high salt. HSPs can be classified into 6 groups, such as HSP20 (sHsp), HSP40 (J-class protein), HSP60, HSP70, HSP90 and HSP100, according to the structure, function and molecular weight of Hsps. HSP40 is abundant in living organisms with molecular weight around 40kDa, each HSP40 comprises a J domain (DnaJ) with highly conserved amino acid sequence, which consists of four helix parts, the second helix is surface-enriched with lysine, and a third helix has a three amino acid sequence HPD, the J domain is a sequence in which HSP40 and HSP70 interact. According to protein domains, HSP40/DnaJ proteins can be divided into three subtypes I, II and III, and the HSP40/DnaJ protein I comprises three complete domains: a helical J domain, a zinc finger domain linked by a glycine/phenylalanine rich region, and a carboxyl terminal region; there are two domains in HSP40/DnaJ type II proteins: a helical J domain and a carboxy-terminal region linked by a glycine/phenylalanine rich region; type III HSP40/DnaJ proteins have only a helical J domain.

Digging drought-resistant key genes, and analyzing the drought-resistant action mechanism of the drought-resistant key genes is a key basis for carrying out corn drought-resistant molecular breeding. DnaJ protein plays an important role in the growth and development of plants and the response to adversity stress.

Disclosure of Invention

The application screens a DnaJ protein gene with obvious differential expression in maize drought-rehydration transcriptome data carried out in the early stage of a subject group, and provides a gene related to high-temperature and drought dual stress, a vector and application thereof.

The technical scheme of the invention is realized as follows:

corn gene related to high-temperature and drought dual stressZmDnajA6The promoter sequence of the plant growth promoter comprises an abiotic stress response element, a plant growth and development element and a hormone response element.

The abiotic stress response elements include LTR, MBS, sp1, ARE and G-box; elements of plant growth and development include O2-site and CAT-box; hormone-responsive elements include ABRE, CGTCA-motif, GARE-motif.

The above-mentionedZmDnajA6The nucleotide sequence of the gene is shown as SEQ ID No.1, and the amino acid sequence of the protein coded by the gene is shown as SEQ ID No. 2.

A vector containing the above gene.

The vector is a fusion expression vector.

The preparation steps of the fusion expression vector are as follows:

(1) Taking cDNA obtained by reverse transcription of total RNA of corn as a template, and taking ZmDnaja6-F and ZmDnaja6-R as primer pairs to amplify target segments and recover;

(2) Amplifying by taking the target fragment in the step (1) as a template and taking ZmDnaja6-F-AscI and ZmDnaja6-R-BamHI as specific primer pairs respectively;

(3) After double enzyme digestion, the amplification product in the step (2) is connected and transformed by T4 ligase overnight, and the positive clone which is correct to verification is selected to be the cornZmDnajA6The fusion expression vector of the gene ZmDnajA 6-pFGC 5941.

In the step (1), the sequence of the primer ZmDnaja6-F is shown as SEQ ID No.3, and the sequence of the primer ZmDnaja6-R is shown as SEQ ID No. 4.

The sequence of the primer ZmDnaja6-F-AscI in the step (2) is shown as SEQ ID No.5, and the sequence of the primer ZmDnaja6-R-BamHI is shown as SEQ ID No. 6.

The carrier is applied to culturing high-temperature-resistant and drought-resistant maize plants.

The invention has the following beneficial effects:

1. the invention screens a DnaJ protein gene with obviously different expression quantity under drought stress through transcriptome dataZmDnajA6Experiments prove that the gene has important functions in the aspects of corn growth and development, weakening of no influence caused by external stress and the like. A DnaJ protein gene with significantly differential expression was selected compared to leaf transcriptomes under normal conditions. NCBI functional annotation found that the gene is located on chromosome 10 and contains 8 exons and 7 introns. The protein conserved domain analysis discovers that the protein sequence contains DnaJ structural domain (figure 1) as shown in SEQ ID No.2, and the gene is tentatively namedZmDnajA6。

2. DnaJ protein Gene of the present applicationZmDnajA6The over-expression of the gene can obviously enhance the tolerance of the transgenic plant to drought and high temperature.ZmDnajA6The over-expression can reduce the influence on chlorophyll of leaves, improve the content of soluble protein of arabidopsis leaf osmotic adjusting substances and the activities of superoxide dismutase and peroxidase, slow down the damage of drought and high-temperature stress on cell membranes, and improve the drought tolerance and heat resistance of arabidopsis; interference in cornZmDnajA6The expression of the protein can reduce the chlorophyll content and the soluble protein content of the corn leaves under the stress of high temperature and drought, reduce the activity of superoxide dismutase and peroxidase, and influence the growth of corn plants. The above results show thatZmDnajA6The expression of the protein can enhance the tolerance and interference of plants to drought and high temperature stressZmDnajA6The expression of (A) can enhance the sensitivity of plants to drought and high temperature stress.

3. In thatZmDnajA6The gene exists in 2000bp upstream of ATGA variety of cis-acting elements, including abiotic stress response elements; LTR, MBS, sp1, ARE and G-box; elements involved in plant growth and development are O2-site, CAT-box; the hormone-responsive element is ABRE, CGTCA-motif, GARE-motif. Show thatZmDnajA6The expression of the plant is induced by abiotic stress and related hormones, and has important regulation effect in the growth and development of plants.

4. Under treatment with drought (20% PEG 6000), high temperature (42 ℃), salt (200 mmol/L) and ABA (0.1 mmol/L) hormonesZmDnajA6The expression pattern of (a) was analyzed. As shown in FIG. 4, under drought, high temperature, salt and ABA hormone treatmentZmDnajA6The expression is up-regulated, and particularly the up-regulation amplitude under drought stress induction is large and reaches 10 times; the high temperature, salt and hormone treatment up-regulated amplitudes also reach 3.21 times, 1.71 times and 2.57 times respectively, and the results show thatZmDnajA6The positive up-regulation expression responds to drought, high temperature, salt and ABA treatment. OverexpressionZmDnajA6The gene discovery improves the drought and high temperature tolerance of plants.

5. In maize using VIGS technologyZmDnajA6Silencing the gene and carrying out drought and high temperature treatment on the silenced plant. The growth of VIGS plants is more obviously inhibited under high-temperature treatment, leaves are seriously wilted, the withered and yellow leaves at the lower parts of the plants are serious, and the phenomenon of withered and yellow leaves is found. Wild type plants are also inhibited by high temperature, but the inhibition effect is obviously less than that of VIGS plants. Proving interferenceZmDnajA6The expression of the gene leads to the sensitivity of the corn to drought and high temperature, and the result shows thatZmDnajA6The gene plays a positive regulation role in drought and high temperature stress, and provides a new idea for cultivating high temperature and drought resistant corn plants.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is a schematic view ofZmDnajA6The gene structure of (2).

FIG. 2 is a graph of the evolutionary analysis of the ZmDnajA6 protein.

FIG. 3 is a drawing showingZmDnajA6Expression patterns of different tissues.

FIG. 4 is a schematic view ofZmDnajA6In response to abiotic stresses and patterns of abscisic acid expression.

FIG. 5 shows PCR detectionZmDnajA6Transgenic positive clones.

FIG. 6 is a schematic view ofZmDnajA6Expression levels in wild-type and transgenic lines.

FIG. 7 shows wild type and wild type under drought, high temperature stressZmDnajA6Transgenic Arabidopsis thaliana was grown on MS medium.

FIG. 8 shows drought, high temperature stress vs. wild type andZmDnajA6root length effects of transgenic arabidopsis thaliana.

FIG. 9 is a graph of drought, high temperature vs. wild type andZmDnajA6influence of transgenic Arabidopsis thaliana.

FIG. 10 shows the effect of drought and high temperature stress on chlorophyll content in Arabidopsis thaliana leaves.

FIG. 11 shows the effect of drought and high temperature stress on the soluble sugar content of Arabidopsis leaves.

FIG. 12 is a graph of the effect of drought and high temperature stress on the antioxidase activity of Arabidopsis leaves.

FIG. 13 shows drought, high temperature versus wild type and viral silencingZmDnajA6Effects of mutant maize.

FIG. 14 is drought, high temperature versus wild type and viral silencingZmDnajA6Effect of physiological indices of mutant maize.

Detailed Description

The technical solutions of the present invention will be described clearly and completely below with reference to embodiments of the present invention, and it should be apparent that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without inventive effort based on the embodiments of the present invention, are within the scope of the present invention.

Example 1: ZmDnajA6sequence analysis of

The application screens a DnaJ protein gene with obvious differential expression in maize drought-rehydration transcriptome data carried out in the early stage of a subject group. Treatment of maize inbred line Zheng 8713 with 20% PEG6000 selected a DnaJ protein gene with significantly differential expression compared to leaf transcriptome under normal conditions. NCBI functional annotation found that the gene is located on chromosome 10 and contains 8 exons and 7 introns. The protein conserved domain analysis finds that the protein sequence contains DnaJ structural domain (figure 1) as shown in SEQ ID No.2, and the gene is tentatively named asZmDnajA6。

To be provided withZmDnajA6NCBI search is carried out on a protein sequence coded by the gene, and the genetic relationship of the genetic coding protein sequence to XP _008662881.1 protein of corn, XP _002443709.1 of sorghum and CAD6246652.1 of miscanthus is found to be closer, so that the genetic coding protein sequence is presumed to be closer to the genetic coding protein sequence of XP _008662881.1 protein of corn, XP _002443709.1 of sorghum and CAD6246652.1 of miscanthusZmDnajA6Similar biological functions may exist with homologous genes of sorghum and miscanthus.

The cis-acting element analysis of the promoter is carried out, and the results are shown in the table 1: in thatZmDnajA6 Various cis-acting elements exist in 2000bp upstream of the ATG, including abiotic stress response elements; LTR, MBS, sp1, ARE and G-box; elements involved in plant growth and development are O2-site, CAT-box; the hormone-responsive element is ABRE, CGTCA-motif, GARE-motif. Show thatZmDnajA6The expression of the plant is induced by abiotic stress and related hormones, and has important regulation effect in the growth and development of plants. In thatZmDnajA6Various cis-acting elements exist in 2000bp upstream of the ATG, including abiotic stress response elements; LTR, MBS, sp1, ARE and G-box; elements involved in plant growth and development are O2-site, CAT-box; the hormone-responsive element is ABRE, CGTCA-motif, GARE-motif. Show thatZmDnajA6The expression of the plant is induced by abiotic stress and related hormones, and has important regulation effect in the growth and development of plants.

TABLE 1ZmDnajA6Promoter cis-elements of genes

Example 2: corn (maize)ZmDnajA6Analysis of expression patterns

1.ZmDnajA6Expression patterns of different tissues

Using B73 inbred line as material, analysisZmDnajA6The expression patterns of the gene (the sequence is shown as SEQ ID No. 1) in different organs show that the gene is expressed in roots, stems, leaves and developing organs as shown in figure 3, belongs to a tissue type expression gene and has higher expression level in the female ear and the old leaves.

2.ZmDnajA6Expression patterns in response to abiotic stresses and abscisic acid

Analysis of promoter core elements (Table 1) showsZmDnajA6The promoter regions of the genes all contain elements that respond to abiotic stress and phytohormones, and thus are treated with hormones such as drought (20% PEG 6000), high temperature (42 ℃), salt (200 mmol/L) and ABA (0.1 mmol/L)ZmDnajA6The expression pattern of (a) was analyzed. As shown in FIG. 4, under drought, high temperature, salt and ABA hormone treatmentZmDnajA6The expression is up-regulated, and particularly the up-regulation amplitude under drought stress induction is large and reaches 10 times; the up-regulation amplitude of high temperature, salt and hormone treatment also reaches 3.21 times, 1.71 times and 2.57 times respectively, and the results show thatZmDnajA6The positive up-regulation expression responds to drought, high temperature, salt and ABA treatment.

Example 3:ZmDnajA6cloning of genes and construction of fusion vectors

1.ZmDnajA6Cloning of genes

Extracting total RNA of corn, using Reverse transcribed cDNA as module, zmDnajA6-F (Forward Primer) sequence as shown in SEQ ID No.3, ATGGCGCTAGTACAGTTCAACGGTG and ZmDnajA6-R (Reverse Primer) sequence as shown in SEQ ID No.4, selecting TaKaRa high fidelity enzyme (TAKARA, china, great even) as Primer for amplificationZmDnajA6ORF (open reading frame) of the gene. The amplification procedure comprises pre-denaturation at 95 deg.C for 5 min, denaturation at 95 deg.C for 45s, annealing at 60 deg.C for 45s, and extension at 72 deg.C for 1min, the third step is circulated 35 times, and finally extension at 72 deg.C for 10 min, and the amplification system is shown in Table 2. 1% of PCR amplification productAgarose gel electrophoresis detection, single and band size andZmDnajA6the genes were of uniform size, as shown in FIG. 5.

TABLE 2ZmDnajA6Amplification system for gene cloning

2.ZmDnajA6Construction of fusion vector for Gene

Purifying and recovering the PCR amplified band by using the recovered DNA as a template ZmDnajA6-F-AscI(Forward Primer) has a sequence shown in SEQ ID No. 5: AGGCGCGCCATGGCGCTAGTACAGTTC andZmDnajA6-R-BamHI(Reverse Primer) has the sequence shown in SEQ ID No.6, CGGGATCCThe specific sequence of TCATCCTGCTATTGGC is used as a primer, and TaKaRa high fidelity enzyme is used for PCR amplification, and the system is shown in Table 2.

AscI and BamHIAnd (3) carrying out double enzyme digestion on the pFGC5941 vector and a PCR purified recovery product amplified by a corresponding enzyme, enabling the recovery product and the fusion vector to generate the same cohesive end, carrying out overnight ligation at 16 ℃ by using T4 ligase, then transforming Escherichia coli DH5a, and picking a positive clone with correct PCR detection to send to a company for sequencing. The plasmid was extracted from the correctly sequenced cell solution for further experiments.

Example 4:ZmDnajA6identification of transgenic Material

By the method of infecting arabidopsis inflorescenceZmDnajA6The gene is overexpressed and transferred into arabidopsis thaliana. The transgenic seeds are sown in soil, and glyphosate is sprayed after emergence of seedlings. The robust Arabidopsis and maize transgenic lines were selected for DNA extraction, and positive plants were selected by PCR amplification with Bar (421 bp) primers (Bar-Forward: 5-.

Extracting RNA of wild type and Arabidopsis thaliana and maize strain with Bar band, reverse transcribing into cDNA, detectingZmDnajA6The expression level of the gene, as shown in FIG. 6, in the transgenic Arabidopsis (L1 and L2) lines was significantly higher than that of the wild type. The results show that success will beZmDnajA6The gene was transferred into Arabidopsis thaliana.

Example 5:ZmDnajA6stress resistance analysis of over-expressed Arabidopsis thaliana

1. Seedling stageZmDnajA6Stress resistance analysis of over-expressed Arabidopsis thaliana

And (3) vernalizing the T3 generation transgenic arabidopsis seeds for 3 days, spreading the vernalized seeds on a normal MS culture medium and an MS culture medium containing 200 mM mannitol respectively, wherein part of the normal MS culture medium simulates high-temperature treatment at 30 ℃, and observing the germination condition after 5 days. As can be seen from FIG. 7, under the drought stress and the high temperature stress,ZmDnajA6the growth of the transgenic Arabidopsis thaliana (L1 and L2) was better than that of the wild type (Col). Further statistical analysis showed that under normal growth conditions, the root length of wild type and transgenic Arabidopsis (L1 and L2) was substantially the same, and under drought, high temperature stress, the root length of wild type was significantly less than that of transgenic Arabidopsis (L1 and L2), the results are shown in FIG. 8.

2. Influence of drought and high-temperature stress on growth and development of arabidopsis seedlings

Along with the change of climate and frequent abiotic stresses such as drought and high temperature, the experiment designs the conditions of drought (water is lost, the temperature is suitable for plant growth) and high temperature (water is normal, and the temperature is higher than the temperature suitable for normal growth) to preliminarily explore the gene function of the ZmDnajA 6.

As can be seen in FIG. 9, under normal growth conditions, wild type and transgeneZmDnajA6The growth vigor of the strains L1 and L2 is basically consistent, and the growth state is better. After drought stress for 7 days, the growth of the transgenic line and the wild type is inhibited, leaves are wilted and leaf tips are yellow, but the transgenic over-expression lines L1 and L2 show better growth state compared with the wild type. Under the high temperature (30 ℃), the growth of wild plants is seriously threatened, leaves begin to wilting and yellowing, and the endangered condition appears, although transgenic lines L1 and L2 are also stressed by high temperature to cause the yellowing of the leaves, the growth condition of the transgenic lines is obviously better than that of the wild plants. OverexpressionZmDnajA6The gene improves the tolerance of arabidopsis plants to drought and high temperature.

Chlorophyll is a main place for photosynthesis of plants and is sensitive to external stress, and as can be seen from fig. 10, under the condition of normal growth, the chlorophyll content of wild type and transgenic arabidopsis thaliana is at a higher level, and after drought and high-temperature stress, the chlorophyll content is obviously reduced, but the chlorophyll content of a transgenic line is obviously higher than that of a wild type line.

The soluble protein is used as an important osmoregulation substance of the plant, can stabilize the osmotic potential in the plant body and enhance the water retention and water loss capacity of the plant. As can be seen from FIG. 11, under normal growth conditions, the soluble protein content of both wild type and transgenic lines is at a lower level, and after drought and high temperature stress, the soluble protein content of the transgenic line is significantly increased, and the soluble protein content of the transgenic line is significantly higher than that of the wild type.

When the plant is stressed by the outside, active oxygen free radicals in the plant are increased, the membrane lipid structure of the plant is damaged, a cell membrane system is degraded, the normal physiological and biochemical reactions in the plant are influenced, and the antioxidase can eliminate excessive active oxygen free radicals, so that the normal growth and development of the plant are promoted. As can be seen from FIG. 12, under normal growth conditions, the antioxidase activities of the wild type and the transgenic line are both at a lower level, and the antioxidase activities of the transgenic line are significantly higher than those of the wild type Arabidopsis thaliana after drought and high temperature stress, and the antioxidase activities of the transgenic line are not different from those of the wild type Arabidopsis thaliana.

Example 6:ZmDnajA6stress resistance analysis of silenced maize

In maize using VIGS technologyZmDnajA6Silencing the gene, and carrying out drought and high temperature (42 ℃) treatment on the silenced plant. As can be seen from FIG. 13, under normal conditions, wild type plants and VIGS plants grew in the same manner. After drought stress is carried out on the plants, the growth of the corn plants is obviously inhibited, and the conditions of leaf wilting, leaf tip yellowing and withered lower leaves occur, wherein the inhibition effect of the growth of the VIGS plants is obviously higher than that of wild plants. Under high-temperature treatment, the growth of VIGS plants is more obviously inhibited, leaves are seriously wilted, the withered and yellow leaves at the lower parts of the plants are serious, and the phenomenon of withered and yellow leaves occurs. Wild type plantAlthough the plant is inhibited by high temperature, the inhibition effect of the plant is obviously less than that of the VIGS plant.

The physiological indexes of the corn are measured, and the result shows that the chlorophyll content of the wild type plant and the VIGS plant is not different under the normal condition. After drought, high temperature stress treatment, chlorophyll content decreased and under both drought and high temperature conditions, the chlorophyll content of VIGS plants was significantly lower than that of wild type plants (fig. 14).

Soluble protein content was not different before treatment, soluble protein content increased after drought stress, but soluble protein content of VIGS plants was significantly lower than that of normal plants, the same condition was seen in the case of high temperature treatment (fig. 14).

The important enzymes in the antioxidant system of superoxide dismutase and peroxidase crops play an important role in removing active oxygen free radicals and protecting cell membrane systems. Under the normal growth condition, the enzymatic activity of the wild type plant and the VIGS plant is not different, and the superoxide dismutase is increased after drought and high-temperature stress, but the enzymatic activity of the wild type plant is obviously higher than that of the VIGS plant. Peroxidase activity was consistent with that of superoxide dismutase (FIG. 14).

The above results indicate interferenceZmDnajA6Expression of the gene renders maize susceptible to drought and high temperatures. The results show thatZmDnajA6The gene plays a positive regulation role in drought and high temperature stress.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and should not be taken as limiting the scope of the present invention, which is intended to cover any modifications, equivalents, improvements, etc. within the spirit and scope of the present invention.

<110> institute of food crops of academy of agricultural sciences of Henan province

<120>Corn associated with high temperature, drought dual stressZmDnajA6Gene, vector and application thereof

<141> 2021-06-01

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2387

<212> DNA

<213> Zea mays

<400> 1

ctcttatctc cttcccccag ccgccctccg cctccgcgcc atcgacacgc tcgagagcgt 60

cgctgcctgc tgctcgcggt acgttcaccc ctcctcgtct ttcgtttctc ctctcccgtt 120

cagctctccc tgccccctct ctcggcgtgc cgtggccttc ctttttctgg cggcgtcgac 180

tgggcgagcc cagtcagcgg cgccacatcg ccacggcact gccggagacg agtgcccaca 240

ccaggtatgc gtatgcctcc ccctctcccc ctcgtgctgt gcggtacggg gcgccccaaa 300

ccctaaagta agttgtttca ttcggatctg accctgctac gagtatgtat gtacatggat 360

tgtacctacc gaccttgatt tcatcgccaa agttatcggg gtccgcccgt gcgctgtggc 420

atgctaattt cggttttgtt tttgggattt cgagtgagac ctcatttgtt tctgggctct 480

gaattacaac tatgtttctt gattagtagt tagggatagt ttgttacgca acaatgcctg 540

gtgtcattgg cacttgtatt cctggaatac ctaatgcagc aaagctctta actttgccct 600

gtcatctttc agatggcgct agtacagttc aacggtgcct tggttcctca actcggtgaa 660

aagcctcggc tgctatcctt gtcagctgca atcgcaaagg ctgcctattc tgatgcaaga 720

ttcctgacac caaaaactgg ttcaagaggt agaggtaaac acctgctatc acctagttat 780

agtttgcatt cacagacctc ttctgaacaa ctaaaccatg taccatcgtc aagatttcgc 840

cagaaaaggg gttcacgttt tatcgtcaga gctgaagctg atttctatag tgtacttggt 900

gtctcaagaa atgctagtaa atctgaaatc aagagcgcct atcggaagct tgctaggagc 960

tatcatccag atgtaaacaa agatcctggt gctgaacaaa agttcaagga tatcagtaat 1020

gcttatgagg ttctgtctga tgatgagaag cgatcgatct atgataaata tggagaagca 1080

ggtctgaagg gtgctggcat gggcacagga gattactcaa acccgtttga tctctttgag 1140

tccctgtttg aagggtttgg tggaatgggt ggaatggggg gtggccgtgc tgctcggaac 1200

agaccaatgc aaggtgatga tgagagctac aatctggtac tcaatttcaa ggaagctgtg 1260

tttggtgtgg agaaggagat tgagataacc agattggaag gctgtaacac ctgcgacgga 1320

agtggtgcca agccaggtac aaaggcaacc acatgtaaaa cttgtggagg tcagggccag 1380

gtagtctcct ccacaagaac accgcttgga atattccagc aagtctccac ctgcaatact 1440

tgtggtggca ccggtgaatt ctccactcct tgcaacacct gtgggggtga tggccgggtg 1500

cgaaggacaa agaggatcag cctaaaggtt cctgctggag tggattctgg aagcaggctg 1560

agggtccggt ctgagggtaa tgctgggcgg cgaggaggcc ctcctgggga cctttatgtc 1620

ttcattgatg ttctctctga tcctgttctt aagcgagatg ggacaaacat tctctacaca 1680

tgcaaggttt cttacattga tgcaatcctt gggacaaccg tcaaagtccc cactgttgac 1740

ggaacggttg accttaagat accctcaggg actcagccag gcacaactct ggtgatgtcc 1800

aagaaaggtg tcccgcttct cgggaagtca aatgcccgtg gagaccagct ggtgcgtgtc 1860

caggttgaga ttccgaagcg tctgagcagc gacgagaaga agctaattga ggagcttgca 1920

aacctgaaca aggctcaaac agccaatagc aggagatgat tatcgcacat ggcttcgtag 1980

gacagcgtgc ttgtgtgata ggcaattttg atgcaaactg cagtgatgat tggatgaaaa 2040

gagttggtag tgataaactc ttctacgaac tacatacagc aaggggtctg gagcaaaaaa 2100

atgtgccgtt ccacatctgt aacctcgttt ttaagctatt gaaagttgag tcagtgaact 2160

ggacgttttt gcaatagctt agcatatgca ctaggcgact ttattagcca tttttttttg 2220

ttgttatacg gcttttgtat tcttggaagc cttaggcaag atatctgatg gtggaatcag 2280

gtttagactt gacatttctt gcacaaatgc tgcaccatgc attcatggaa tctgtaagct 2340

gtaccatgga aatgttaact gtagttttat ggtttgtgat gcattgg 2465

<210> 2

<211> 448

<212> PRT

<213> Zea mays

<400> 2

Met Ala Leu Val Gln Phe Asn Gly Ala Leu Val Pro Gln Leu Gly Glu

1 5 10 15

Lys Pro Arg Leu Leu Ser Leu Ser Ala Ala Ile Ala Lys Ala Ala Tyr

20 25 30

Ser Asp Ala Arg Phe Leu Thr Pro Lys Thr Gly Ser Arg Gly Arg Gly

35 40 45

Lys His Leu Leu Ser Pro Ser Tyr Ser Leu His Ser Gln Thr Ser Ser

50 55 60

Glu Gln Leu Asn His Val Pro Ser Ser Arg Phe Arg Gln Lys Arg Gly

65 70 75 80

Ser Arg Phe Ile Val Arg Ala Glu Ala Asp Phe Tyr Ser Val Leu Gly

85 90 95

Val Ser Arg Asn Ala Ser Lys Ser Glu Ile Lys Ser Ala Tyr Arg Lys

100 105 110

Leu Ala Arg Ser Tyr His Pro Asp Val Asn Lys Asp Pro Gly Ala Glu

115 120 125

Gln Lys Phe Lys Asp Ile Ser Asn Ala Tyr Glu Val Leu Ser Asp Asp

130 135 140

Glu Lys Arg Ser Ile Tyr Asp Lys Tyr Gly Glu Ala Gly Leu Lys Gly

145 150 155 160

Ala Gly Met Gly Thr Gly Asp Tyr Ser Asn Pro Phe Asp Leu Phe Glu

165 170 175

Ser Leu Phe Glu Gly Phe Gly Gly Met Gly Gly Met Gly Gly Gly Arg

180 185 190

Ala Ala Arg Asn Arg Pro Met Gln Gly Asp Asp Glu Ser Tyr Asn Leu

195 200 205

Val Leu Asn Phe Lys Glu Ala Val Phe Gly Val Glu Lys Glu Ile Glu

210 215 220

Ile Thr Arg Leu Glu Gly Cys Asn Thr Cys Asp Gly Ser Gly Ala Lys

225 230 235 240

Pro Gly Thr Lys Ala Thr Thr Cys Lys Thr Cys Gly Gly Gln Gly Gln

245 250 255

Val Val Ser Ser Thr Arg Thr Pro Leu Gly Ile Phe Gln Gln Val Ser

260 265 270

Thr Cys Asn Thr Cys Gly Gly Thr Gly Glu Phe Ser Thr Pro Cys Asn

275 280 285

Thr Cys Gly Gly Asp Gly Arg Val Arg Arg Thr Lys Arg Ile Ser Leu

290 295 300

Lys Val Pro Ala Gly Val Asp Ser Gly Ser Arg Leu Arg Val Arg Ser

305 310 315 320

Glu Gly Asn Ala Gly Arg Arg Gly Gly Pro Pro Gly Asp Leu Tyr Val

325 330 335

Phe Ile Asp Val Leu Ser Asp Pro Val Leu Lys Arg Asp Gly Thr Asn

340 345 350

Ile Leu Tyr Thr Cys Lys Val Ser Tyr Ile Asp Ala Ile Leu Gly Thr

355 360 365

Thr Val Lys Val Pro Thr Val Asp Gly Thr Val Asp Leu Lys Ile Pro

370 375 380

Ser Gly Thr Gln Pro Gly Thr Thr Leu Val Met Ser Lys Lys Gly Val

385 390 395 400

Pro Leu Leu Gly Lys Ser Asn Ala Arg Gly Asp Gln Leu Val Arg Val

405 410 415

Gln Val Glu Ile Pro Lys Arg Leu Ser Ser Asp Glu Lys Lys Leu Ile

420 425 430

Glu Glu Leu Ala Asn Leu Asn Lys Ala Gln Thr Ala Asn Ser Arg Arg

435 440 445

<210> 3

<211> 25

<212> DNA/RNA

<213> Unknown (Unknown)

<400> 3

atggcgctag tacagttcaa cggtg 25

<210> 4

<211> 25

<212> DNA/RNA

<213> Unknown (Unknown)

<400> 4

tcatctcctg ctattggctg tttga 25

<210> 5

<211> 27

<212> DNA/RNA

<213> Unknown (Unknown)

<400> 5

aggcgcgcca tggcgctagt acagttc 27

<210> 6

<211> 26

<212> DNA/RNA

<213> Unknown (Unknown)

<400> 6

cgggatcctc atctcctgct attggc 26

Claims (6)

1. The maize gene related to high-temperature and drought dual stress is characterized in that: the corn gene is ZmDnajA6, and the promoter sequence of the corn gene comprises an abiotic stress response element, a plant growth and development element and a hormone response element;

the abiotic stress response elements include LTR, MBS, sp1, ARE and G-box; elements of plant growth and development include O2-site and CAT-box; hormone-responsive elements include ABRE, CGTCA-motif, GARE-motif;

the nucleotide sequence of the ZmDnajA6 gene is shown as SEQ ID No.1, and the amino acid sequence of the protein coded by the gene is shown as SEQ ID No. 2.

2. A vector comprising the maize gene of claim 1.

3. The carrier of claim 2, wherein: the vector is a fusion expression vector.

4. The vector of claim 3, wherein the fusion expression vector is prepared by the steps of:

(1) Taking cDNA obtained by reverse transcription of total RNA of corn as a template, and taking ZmDnaja6-F and ZmDnaja6-R as primer pairs to amplify target segments and recover;

(2) Amplifying by taking the target fragment in the step (1) as a template and taking ZmDnaja6-F-AscI and ZmDnaja6-R-BamHI as specific primer pairs respectively;

(3) After double enzyme digestion, connecting and transforming the amplified product obtained in the step (2) overnight by using T4 ligase, and selecting a correctly verified positive clone, namely a fusion expression vector ZmDnaja 6-pFGC 5941 of the corn ZmDnaja6 gene;

in the step (1), the sequence of the primer ZmDnaja6-F is shown as SEQ ID No.3, and the sequence of the primer ZmDnaja6-R is shown as SEQ ID No. 4;

the sequence of the primer ZmDnaja6-F-AscI in the step (2) is shown as SEQ ID No.5, and the sequence of the primer ZmDnaja6-R-BamHI is shown as SEQ ID No. 6.

5. The use of the gene of claim 1 in the cultivation of maize plants resistant to dual stresses of high temperature and drought.

6. Use of the vector of any one of claims 2-4 for cultivating maize plants resistant to dual stresses of high temperature and drought.

Images