CN113234845B - SNP molecular marker primer and marking method for identifying main-cultivated jujube variety in inner Mongolia region - Google Patents
SNP molecular marker primer and marking method for identifying main-cultivated jujube variety in inner Mongolia region Download PDFInfo
- Publication number
- CN113234845B CN113234845B CN202110271567.2A CN202110271567A CN113234845B CN 113234845 B CN113234845 B CN 113234845B CN 202110271567 A CN202110271567 A CN 202110271567A CN 113234845 B CN113234845 B CN 113234845B
- Authority
- CN
- China
- Prior art keywords
- jujube
- primer
- variety
- mongolian
- snp molecular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of biology, in particular to a SNP molecular marker primer and a marking method for identifying a main jujube variety planted in an inner Mongolia region, which are characterized in that: the SNP molecular marker is used for identifying 'Meng jujube No. 1', 'Meng jujube No. 2' and 'Meng jujube No. 3', and the sequence of the SNP molecular marker primer is as follows: forward primer Mogsnp1-F: AGTGGTGGTTTGAAGTTGGAGT; reverse primer: mogsnp1-R: GAAGAAGATCATCGACGCAGTT; the method is characterized in that the jujube variety is identified based on the specificity of the INDEL (insertion/deletion) or SNP locus of DNA base, provides a quick, accurate and effective molecular means for identifying the main-cultivated jujube variety in the inner Mongolia region, is beneficial to solving the problem of mixed cultivation of jujube varieties in the region, and provides a technical basis for the cultivation, management and management of the jujube in the region. The invention has the advantages that: greatly improves the detection speed and efficiency, and effectively ensures the detection precision and the stability of PCR amplification.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a SNP molecular marker primer and a marking method for identifying a main jujube variety planted in an inner Mongolia region.
Background
Date (A)ZiziphusjujubaMill.) is Rhamnaceae (Rhamnaceae) Ziziphus (Rhamnaceae)ZiziphusMill.) deciduous small tree, its leaves, fruit pits, fruits, bark, roots, thorns, etc. can be made into medicine. The jujube has strong resistance, barren resistance, dry climate preference, developed root system and strong sprout tillering capability, and is commonly used in landscaping aspects such as bonsai manufacture, plant configuration and the like. The jujube fruit integrates ornamental, medicinal and honey-sourced plants, can be eaten or used as medicines, contains various bioactive substances such as polysaccharide, flavonoid, gleditsia sinensis lam and the like, has various pharmacological effects of preventing allergy, resisting tumors, protecting liver and reducing fat and the like, and has ecological benefit and economic value.
At present, the research and utilization of jujube tree resources in China have been greatly developed, but still some problems still exist, such as the loss of the genetic diversity of jujube, poor disease resistance, poor fruit crack resistance and the like, meanwhile, in the long-term cultivation practice, a variety and variety are generated, the growth environment is similar, so that the jujube tree has the similar morphological characteristics and other reasons, and the phenomenon of the same object, different name or same name foreign matter of the jujube variety is common in the production and market. Particularly, the main jujube varieties of 'Meng jujube No. 1', 'Meng jujube No. 2' and 'Meng jujube No. 3' newly bred in inner Mongolia region are difficult to identify due to the extremely similar tree types, leaf types and fruit types, so that the same foreign body phenomenon often occurs in production practice. This severely affects the management, harvesting and yield of jujube orchards. Therefore, when the method is circulated in the market, the varieties of the Chinese dates of Mongolia date No. 1, mongolian date No. 2 and Mongolian date No. 3 need to be accurately distinguished, the management and management of the Chinese date orchard are guided, and the method has important practical significance for the healthy development of the Chinese date industry in the Mongolia region.
At present, the identification of the main jujube varieties of Mongolian jujube, namely Mongolian jujube No. 1, mongolian jujube No. 2 and Mongolian jujube No. 3, in inner Mongolian regions is mainly completed by a traditional morphological characteristic identification method, and the traditional identification method needs a growth cycle of 4-5 years, is easily influenced by the environment and is not beneficial to popularization.
Disclosure of Invention
The invention aims to provide an SNP molecular marker primer and a marking method for identifying the main jujube variety planted in the inner Mongolia region according to the defects of the prior art, the design of the SNP molecular marker primer is adopted to screen the quantity of INDEL of DNA base and specific SNP sites, and 6 specific SNP sites are utilized to identify the main jujube variety planted in the inner Mongolia region, so that the detection speed and efficiency are greatly improved, and the detection precision is effectively ensured.
The purpose of the invention is realized by the following technical scheme:
an SNP molecular marker primer for identifying a main-cultivated jujube variety in inner Mongolia areas is characterized in that: the SNP molecular marker is used for identifying 'Meng jujube No. 1', 'Meng jujube No. 2' and 'Meng jujube No. 3', and the sequence of the SNP molecular marker primer is as follows: forward primer Mogsnp1-F: AGTGGTGGTTTGAAGTTGGAGT; reverse primer: mogsnp1-R: GAAGAAGATCATCGACGCAGTT.
A molecular marking method of SNP molecular marking primers related to the identification of main jujube varieties in inner Mongolia areas is characterized in that: the molecular marking method comprises the following steps:
1) Respectively collecting young leaves of 'Mongolian jujube No. 1', 'Mongolian jujube No. 2' and 'Mongolian jujube No. 3' to store at a certain temperature below zero, and extracting total genomic DNA of the three jujube varieties through the young leaves;
carrying out PCR amplification reaction of the SNP molecular marker primer by taking the extracted total genomic DNA of the three jujube varieties as a template;
and purifying and sequencing the PCR amplification products which are successfully amplified, and comparing the sequences.
The PCR amplification reaction system is a 20uL mixed system and is composed of 5.5uL sterile deionized water (ddH) 2 O), DNA template for 1uL (20 ng. UL) -1 ) 11.5uL of 2 × Tab Master Mix,1uL of the SNP molecular marker primer composed of a forward primer and a 1uL reverse primer.
The conditions of the PCR amplification reaction are as follows: 95. pre-denaturation at 95 ℃ for 3min,30 cycles of denaturation at 95 ℃ for 30s, annealing at 53.5 ℃ for 30s and extension at 72 ℃ for 30s, and final extension at 72 ℃ for 3min.
The PCR amplification products were detected by an ABI 3500XL (Applied Biosystems, USA) DNA analyzer.
The invention has the advantages that: greatly improves the detection speed and efficiency, and effectively ensures the detection precision and the stability of PCR amplification.
Drawings
FIG. 1 is a diagram showing the quality of DNA of jujube species extracted by agarose gel electrophoresis in the present invention;
fig. 2 is a schematic diagram of the identification methods of 'mongolian jujube No. 1', 'mongolian jujube No. 2' and 'mongolian jujube No. 3' in the invention.
Detailed Description
The features of the present invention and other related features are described in further detail below by way of example in conjunction with the following drawings to facilitate understanding by those skilled in the art:
example (b): the SNP molecular marker primers and the marking method for identifying the main-cultivated jujube varieties in the inner Mongolia region can be used for identifying the main-cultivated jujube varieties 'Mongolia No. 1', 'Mongolia No. 2' and 'Mongolia No. 3' in the inner Mongolia region, so that a quick, accurate and effective molecular means is provided for identifying the main-cultivated jujube varieties in the inner Mongolia region, and the problem of mixed cultivation of the jujube varieties in the region is solved.
The instrument adopted in this embodiment is: PCR instruments (Eppendorf, model 5332), cryo-centrifuges (Eppendorf, model 5810R), micropipettes (Eppendorf), electrophoresis systems (six instruments, beijing, model DYY-12), gel imaging analyzers (BIO-RADChemidoc XRS), ABI 3500XL (Applied Biosystems, USA) DNA analyzers.
Plant DNA rapid extraction kit (Beijing Tiangen company), TAE buffer solution, agarose (Promega company), goldview (Beijing Sorley Bay science and technology Co., ltd.), DNA Taq polymerase (Takara company), chloroform, and absolute ethanol are domestic analytical purifications.
The samples selected in this example were:
| name of the breed | Type of material | Seed source |
| Meng date No. 1 | Cuttage seedling | West solid area of Lanzhou, gansu |
| Meng date No. 2 | Grafted seedling | Xinjiang Ruoqiang county |
| Meng date No. 3 | Grafted seedling | Xinjiang Hetian city |
The embodiment comprises the following methods:
1) Extraction of sample genomic DNA:
respectively collecting young leaves of three jujube varieties of 'Meng jujube No. 1', 'Meng jujube No. 2' and 'Meng jujube No. 3', storing at-80 deg.C, and extracting total genome DNA from the young leaves.
Specifically, the total DNA of the sample is extracted by the plant DNA rapid extraction kit, the quality of the sample is detected based on 1% agarose gel electrophoresis, and the result shows that the brightness, the uniformity, the spot sample port light spot and the like of an electrophoresis strip are good (shown in figure 1), which indicates that the sample has high purity and no pollution, and can be directly used for subsequent molecular biology experiments.
2) Amplification of the specific DNA sequence of the test sample:
amplifying a specific DNA sequence by using specific primers Mogsnp1-F and Mogsnp 1-R; the PCR amplification reaction system is as follows: the PCR amplification reaction system is a mixed system of 20uL, and consists of 5.5uL sterile deionized water (ddH 2O), 1uL of DNA template (20 ng. UL-1), 11.5uL of 2 xTab Master Mix,1uL of forward primer and 1uL of reverse primer.
The PCR reaction conditions were as follows: 95. pre-denaturation at 3min, denaturation at 95 ℃ for 30 cycles of 30 ℃ for 30s, annealing at 53.5 ℃ for 30s and extension at 72 ℃ for 30s, and final extension at 72 ℃ for 3min. The PCR amplification products were detected by an ABI 3500XL (Applied Biosystems, USA) DNA analyzer.
Wherein the specific primer Mogsnp1-F: AGTGGTGGTTTGAAGTTGGAGT is the forward primer; the specific primer Mogsnp1-R: GAAGAAGATCATCGACGCAGTT is the reverse primer.
3) And (3) sequence alignment analysis:
the sequence of the 3 tested jujube variety specific gene fragment sequences obtained by sequencing is compared by GENEDOC and DNAMAN software to obtain the specific INDEL and SNP of the three jujube varieties 'Mongolian jujube No. 1', 'Mongolian jujube No. 2' and 'Mongolian jujube No. 3', and then the species are identified.
And (4) analyzing results:
the results of comparison of the sequence of the short fragment of the gene fragment of the 'Mongolian date No. 1', 'Mongolian date No. 2' and 'Mongolian date No. 3' nuclear genome Mog can show that 6 base variation sites exist among the sequence of the 'Mongolian date No. 1', 'Mongolian date No. 2' and 'Mongolian date No. 3' varieties. The vast number sequence in the sequence of the Mog intergenic zone of the jujube variety to be tested shows high consistency, and the method has the advantages of stable result, strong repeatability and high accuracy, so that the base difference based on the Mog intergenic zone can be used as a molecular marker for distinguishing the species of the 'Mongolian jujube No. 1', the 'Mongolian jujube No. 2' and the 'Mongolian jujube No. 3', and the identification method is simple and easy to operate.
As shown in fig. 2, the PCR products were purified and then subjected to bidirectional sequencing, and the sequences of 3 sample groups were compared, and the comparison results of the target fragment sequences of the "mongolian jujube No. 1", "mongolian jujube No. 2" and "mongolian jujube No. 3" jujube varieties in the Mog intergenic region were:
"Mengzao date No. 2":
CGATACGTTTAAAGCCCCGAAGGCGAAGAAAGCCGGAAAAGATGCTCCGGCGGTCAGGCAATGGGCTAATGGTTGCCATAACCACCATTGCTAtCATCACCACGGATACTGTCATTTTCTTACTCTCtATTTTTTGCTTTTGATTTTCTTATACAACTCCCTTTCTCTAAAATATGGTATCTTTGTGTAGGTGCTTTAATTTTTTTGCAGGAACTTTTTAAAAAAAGGAATGTGGTCGGAGTCTAATAATACGGAGCAGCCAAGTCCGGGAATCgGTGCTGGATGAGTTGAGTGGCAGTAGAGGTACTCCTCCT
"Mengzao date No. 3":
CGATACGTTTAAAGCCCCGAAGGCGAAGAAAGCCGGAAAAGATGCTCCGGCGGATCAGGCAATGGGCTAATGGTTGCCATAACCACCATTGCTAtCATCACCACGGATACTGTCATTTTCTTACTCTCtATTTTTTGCTTTTGATTTTCTTATACAACTCCCTTTCTCTAAAATATGGTATCTTTGTGTAGGTGCTTTAATTTTTTTGCAGGAACTTTTTAAAAAAAGGATGTGGTCGGAGTCTAATAATACGGAGCAGCGAAGTCCGGTATCGGTGCTGGATGAGTTGAGTGGCAGTAGAGGTACTCCTCCT
"Mengzao date No. 1":
CGATACGTTTAAAGCCCCGAAGGCGAAGAAAGCCGGAAAAGATGCTCCGGCGGATCAGGCAATGGGCTAATGGTTGCCATAACCACCATTGCTAtCATCACCACGGATACTGTCATTTTCTTACTCTCtATTTTTTGCTTTTGATTTTCTTATACAACTCCCTTTCTCTAAAATATGGTATCTTTGTGTAGGTGCTTTAATTTTTTTGCAGGAACTTTTTAAAAAAAGGATGTGGTCGGAGTCTAATAATACGGAGCAGCCAAGTCCGGTATCGGTGCTGGATGAGTGAGTGGCAGTAGAGGTACTCCTCCT
specific INDEL and SNP profiles for the three jujube varieties are shown by the markers in fig. 2.
Although the conception and the embodiments of the present invention have been described in detail with reference to the drawings, those skilled in the art will recognize that various changes and modifications can be made therein without departing from the scope of the appended claims, and therefore, they are not to be considered repeated herein.
SEQUENCE LISTING
<110> university of inner Mongolia agriculture
<120> molecular marking method of SNP molecular marking primer for identifying main-cultivated jujube variety in inner Mongolia region
<130> 20210085
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 311
<212> DNA
<213> Artificial sequence
<400> 1
gatacgttta aagccccgaa ggcgaagaaa gccggaaaag atgctccggc ggatcaggca 60
atgggctaat ggttgccata accaccattg ctatcatcac cacggatact gtcattttct 120
tactctctat tttttgcttt tgattttctt atacaactcc ctttctctaa aatatggtat 180
ctttgtgtag gtgctttaat ttttttgcag gaacttttta aaaaaaggat gtggtcggag 240
tctaataata cggagcagcc aagtccggta tcggtgctgg atgagtgagt ggcagtagag 300
<210> 2
<211> 314
<212> DNA
<213> Artificial sequence
<400> 2
cgatacgttt aaagccccga aggcgaagaa agccggaaaa gatgctccgg cggtcaggca 60
atgggctaat ggttgccata accaccattg ctatcatcac cacggatact gtcattttct 120
tactctctat tttttgcttt tgattttctt atacaactcc ctttctctaa aatatggtat 180
ctttgtgtag gtgctttaat ttttttgcag gaacttttta aaaaaaggaa tgtggtcgga 240
gtctaataat acggagcagc caagtccggg aatcggtgct ggatgagttg agtggcagta 300
gaggtactcc tcct 314
<210> 3
<211> 313
<212> DNA
<213> Artificial sequence
<400> 3
cgatacgttt aaagccccga aggcgaagaa agccggaaaa gatgctccgg cggatcaggc 60
aatgggctaa tggttgccat aaccaccatt gctatcatca ccacggatac tgtcattttc 120
ttactctcta ttttttgctt ttgattttct tatacaactc cctttctcta aaatatggta 180
tctttgtgta ggtgctttaa tttttttgca ggaacttttt aaaaaaagga tgtggtcgga 240
gtctaataat acggagcagc gaagtccggt atcggtgctg gatgagttga gtggcagtag 300
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence
<400> 4
agtggtggtt tgaagttgga gt 22
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence
<400> 5
gaagaagatc atcgacgcag tt 22
Claims (3)
1. A molecular marking method of SNP molecular marking primers for identifying main planting jujube varieties in inner Mongolia areas is characterized in that: the molecular marking method comprises the following steps:
1) Respectively collecting young leaves of the three jujube varieties of 'Mongolian jujube No. 1', 'Mongolian jujube No. 2' and 'Mongolian jujube No. 3', storing at minus 80 ℃, and extracting total genomic DNA of the three jujube varieties through the young leaves;
carrying out PCR amplification reaction by using the extracted total genome DNA of the three jujube varieties as a template and using SNP molecular marker primers; purifying and sequencing the PCR amplification product which is successfully amplified, and comparing the sequence to be tested; when the sequence is: GATACGTTTAAAGCCCCGAAGGCGAAGAAAGCCGGAAAAGATGCTCCGGCGGATCAGGCAATGGGCTAATGGTTGCCATAACCACCATTGCTAtCATCACCACGGATACTGTCATTTTCTTACTCTCtATTTTTTGCTTTTGATTTTCTTATACAACTCCCTTTCTCTAAAATATGGTATCTTTGTGTAGGTGCTTTAATTTTTTTGCAGGAACTTTTTAAAAAAAGGATGTGGTCGGAGTCTAATAATACGGAGCAGCCAAGTCCGGTATCGGTGCTGGATGAGTGAGTGGCAGTAGAGGTACTCCTCCT, the variety of the jujube is Meng jujube No. 1;
when the sequence is: 5363 and when it is CGATACGTTTAAAGCCCCGAAGGCGAAGAAAGCCGGAAAAGATGCTCCGGCGGTCAGGCAATGGGCTAATGGTTGCCATAACCACCATTGCTAtCATCACCACGGATACTGTCATTTTCTTACTCTCtATTTTTTGCTTTTGATTTTCTTATACAACTCCCTTTCTCTAAAATATGGTATCTTTGTGTAGGTGCTTTAATTTTTTTGCAGGAACTTTTTAAAAAAAGGAATGTGGTCGGAGTCTAATAATACGGAGCAGCCAAGTCCGGGAATCgGTGCTGGATGAGTTGAGTGGCAGTAGAGGTACTCCTCCT, the fructus Jujubae is Meng fructus Jujubae No. 2;
when the sequence is: CGATACGTTTAAAGCCCCGAAGGCGAAGAAAGCCGGAAAAGATGCTCCGGCGGATCAGGCAATGGGCTAATGGTTGCCATAACCACCATTGCTAtCATCACCACGGATACTGTCATTTTCTTACTCTCtATTTTTTGCTTTTGATTTTCTTATACAACTCCCTTTCTCTAAAATATGGTATCTTTGTGTAGGTGCTTTAATTTTTTTGCAGGAACTTTTTAAAAAAAGGATGTGGTCGGAGTCTAATAATACGGAGCAGCGAAGTCCGGTATCGGTGCTGGATGAGTTGAGTGGCAGTAGAGGTACTCCTCCT, the variety of the Chinese date is Mongolian No. 3;
the sequence of the SNP molecular marker primer is as follows: forward primer Mogsnp1-F: AGTGGTGGTTTGAAGTTGGAGT; reverse primer: mogsnp1-R: GAAGAAGATCATCGACGCAGTT.
2. The molecular marking method of the SNP molecular marking primer for identifying the main planting jujube variety in inner Mongolia area according to claim 1, which is characterized in that: the PCR amplification reaction system is a 20uL mixed system, and comprises 5.5uL of sterile deionized water and 1uL of 20 ng.uL -1 DNA template, 11.5uL of 2 × Tab Master Mix,1uL of forward primer and 1uL of reverse primer of the SNP molecular marker primer.
3. The molecular marking method of the SNP molecular marking primer for identifying the main planting jujube variety in inner Mongolia area according to claim 1, which is characterized in that: the conditions of the PCR amplification reaction are as follows: 95. pre-denaturation at 3min, denaturation at 95 ℃ for 30 cycles at 30s, annealing at 53.5 ℃ for 30s and extension at 72 ℃ for 30s, and final extension at 72 ℃ for 3min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110271567.2A CN113234845B (en) | 2021-03-12 | 2021-03-12 | SNP molecular marker primer and marking method for identifying main-cultivated jujube variety in inner Mongolia region |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110271567.2A CN113234845B (en) | 2021-03-12 | 2021-03-12 | SNP molecular marker primer and marking method for identifying main-cultivated jujube variety in inner Mongolia region |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113234845A CN113234845A (en) | 2021-08-10 |
| CN113234845B true CN113234845B (en) | 2023-03-24 |
Family
ID=77130298
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110271567.2A Active CN113234845B (en) | 2021-03-12 | 2021-03-12 | SNP molecular marker primer and marking method for identifying main-cultivated jujube variety in inner Mongolia region |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113234845B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109554503A (en) * | 2019-01-31 | 2019-04-02 | 中国农业科学院郑州果树研究所 | A kind of tara vine seedling gender identification molecular labeling and its application in early days |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2993574B1 (en) * | 2012-07-19 | 2015-05-29 | Inst Rech Developpement Ird | MOLECULAR MARKERS AND METHODS FOR THE EARLY IDENTIFICATION OF THE SEX OF PALM DATTIER |
| US20190330649A1 (en) * | 2016-12-21 | 2019-10-31 | Institute Of Crop Sciences, The Chinese Academy Of Agricultural Sciences | Plant Grain Trait-Related Protein, Gene, Promoter and SNPS and Haplotypes |
| JP7198555B2 (en) * | 2017-04-27 | 2023-01-04 | ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア | Microorganisms and methods for producing cannabinoids and cannabinoid derivatives |
| CN108998567B (en) * | 2018-05-24 | 2022-05-13 | 内蒙古农业大学 | Molecular marker primer and method for identifying amygdalus pedunculata pall, amygdalus mongolicus and prunus ulmaria |
| CN109609686B (en) * | 2019-01-31 | 2021-11-23 | 中国农业科学院郑州果树研究所 | Molecular marker for early sex identification of actinidia arguta seedlings and application of molecular marker |
| CN111615983A (en) * | 2020-05-28 | 2020-09-04 | 李孔 | Planting technology of Mongolian jujube trees |
-
2021
- 2021-03-12 CN CN202110271567.2A patent/CN113234845B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109554503A (en) * | 2019-01-31 | 2019-04-02 | 中国农业科学院郑州果树研究所 | A kind of tara vine seedling gender identification molecular labeling and its application in early days |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113234845A (en) | 2021-08-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108342465A (en) | A method of crop rhizosphere prokaryotic micro-organisms is detected based on high-flux sequence | |
| CN108660247B (en) | Primer SmemboI-2 for identifying purity of solanum torvum third eggplant based on SNP marker and application | |
| CN109628635B (en) | Development and application of gene marker for regulating purple color of capsicum olivum | |
| KR102212054B1 (en) | Molecular marker based on chloroplast genome sequence for discriminating Schisandrae Fructus and uses thereof | |
| CN113151553A (en) | Molecular marker coseparated with gene Clbl of watermelon plant few lateral branches and application | |
| CN113234845B (en) | SNP molecular marker primer and marking method for identifying main-cultivated jujube variety in inner Mongolia region | |
| CN108676903B (en) | Primer SmemboI-1 for identifying purity of solanum torvum third eggplant based on SNP marker and application | |
| CN114525355B (en) | Method for identifying authenticity of Viola variety and special SSR primer combination thereof | |
| CN108165652A (en) | For the specific molecular marker TGMI001 of Chinese torreya seedling stage sex identification | |
| CN108998567B (en) | Molecular marker primer and method for identifying amygdalus pedunculata pall, amygdalus mongolicus and prunus ulmaria | |
| CN109554498B (en) | Molecular marker for identifying early-late maturing characteristics of single-cropping water bamboo and application and acquisition method thereof | |
| CN114574615B (en) | Indel mark for identifying Hainan oil tea germplasm and detection method | |
| CN109943659B (en) | Primer for identifying purity of Jinyankuai green No. 1 pakchoi seeds and application of primer | |
| CN116162722B (en) | InDel marker for identifying bupleurum chinense in different producing areas and application thereof | |
| CN114634991B (en) | InDel marker for identifying high-variety coconuts and application thereof | |
| CN113249514B (en) | Cucumber female line character related SCAR marker and application thereof | |
| KR102163234B1 (en) | Molecular marker based on chloroplast sequence for discriminating Angelica dahurica from Angelica species and uses thereof | |
| KR102163238B1 (en) | Molecular marker based on chloroplast sequence for discriminating Angelica acutiloba from Angelica species and uses thereof | |
| CN112680542B (en) | Universal SSR molecular marker primer composition for orchidaceae plants and application of universal SSR molecular marker primer composition | |
| CN110172528B (en) | Special SSR primers for pomegranate variety identification and application thereof | |
| KR102163235B1 (en) | Molecular marker based on chloroplast sequence for discriminating Angelica decursiva from Angelica species and uses thereof | |
| CN114517238B (en) | SSR molecular marker and method for identifying tremella aurantialba ZJJJE 001 strain | |
| KR102163239B1 (en) | Molecular marker based on chloroplast sequence for discriminating Angelica gigas from Angelica species and uses thereof | |
| CN110205403B (en) | SSR primers for high-polymorphism pomegranate and application thereof | |
| CN111363845B (en) | Special primer for specific identification of Chinese Huangguo ginseng and PCR method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |