CN113186267A - Primer-probe combination, kit and method for detecting human CYP2D6 copy number variation and genotyping - Google Patents
Primer-probe combination, kit and method for detecting human CYP2D6 copy number variation and genotyping Download PDFInfo
- Publication number
- CN113186267A CN113186267A CN202110633466.5A CN202110633466A CN113186267A CN 113186267 A CN113186267 A CN 113186267A CN 202110633466 A CN202110633466 A CN 202110633466A CN 113186267 A CN113186267 A CN 113186267A
- Authority
- CN
- China
- Prior art keywords
- sample
- genotyping
- cyp2d6
- copy number
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention provides a primer probe combination, a kit and a method for detecting human CYP2D6 copy number variation and genotyping. The nucleotide sequence of a primer probe combination for detecting the copy number variation of human CYP2D6 is shown in SEQ ID No. 1-9, and the nucleotide sequence of a primer probe combination for detecting the genotyping of human CYP2D6 gene is shown in SEQ ID No. 10-17. The invention can be used for qualitatively detecting CYP2D6 copy number variation and 10 and 41 genotypes in human genome DNA in vitro, realizes that 10 and 41 genotypes are not interfered with each other by one-tube simultaneous detection on imported/domestic fluorescent quantitative PCR equipment, has the advantages of high accuracy, good stability and excellent detection limit, can assist clinical selection of anti-mental drugs according to the detection result to realize medication guidance for mental/depression patients, ensures the curative effect and reduces toxic and side reactions.
Description
Technical Field
The invention relates to the field of molecular biology, in particular to a primer-probe combination, a kit and a method for detecting human CYP2D6 copy number variation and genotyping.
Background
The fluorescent quantitative PCR technology is a simple, rapid, high-sensitivity and specific gene detection method, and CYP2D6 enzyme participates in the liver metabolism of about 25% of common drugs, including antidepressants, antipsychotics, antiarrhythmics, opioids and beta-receptor blockers. Differences in the CYP2D6 alleles may result in increased, decreased or no activity of the encoded enzyme, which may lead to differences in drug response and risk of adverse reactions between individuals, while copy number variations of the gene (e.g., 5 deletions, 36X2, 36+ 10 rearrangements, etc.) play a critical role in the metabolism of the drug in its individual. Among them, the frequencies of 1 (34.9%), + 2 (13.3%), + 5 (5%), + 10 (43%), + 36 (1.2%), + 41 (2.34%) were high in east asian population, and the CYP2D6 gene copy number variation (Duplication/Deletion) also had a significant effect on the enzymatic activity.
FDA drug study CYP2D6 poor metabolizers when strong inhibitor (paroxetine and fluoxetine) drugs are used in combination with tetrabenazine, which leads to increased exposure to tetrabenazine, the intermediate metabolites a-and β -dihydrotetrabenazine, should be adjusted in conjunction with clinical symptoms, and gene testing of CYP2D6 metabolism should be performed before daily dosing of more than 50 mg to avoid the risk faced by CYP2D6 poor metabolizers. In addition, the pimozide drug should be individually used in different metabolic types of adults and children, when the dosage of the pimozide drug for children is higher than 0.05mg/kg/D, CYP2D6 genotyping should be carried out, and in the people with CYP2D6 metabolic failure, the dosage should not exceed 0.05mg/kg/D and should not be increased earlier than 14 days; for adult administration, CYP2D6 genotyping should be performed at doses exceeding 4 mg/D. In CYP2D6 poor metabolizers, the dose should not exceed 4 mg/day and should not be increased earlier than 14 days (PharmGKB).
Therefore, the detection of CYP2D6 copy number variation and genotyping in human genomic DNA is of great importance in the application of the above-mentioned drugs.
Current detection techniques for CYP2D6 copy number variation and genotyping include: long-chain PCR, allele-specific PCR, fluorescent quantitative PCR, first-generation sequencing, long-read single-molecule sequencing, etc., but detecting CYP2D6 is technically challenging due to the high homology of CYP2D6 with CYP2D7 and CYP2D8 pseudogenes, which may ultimately lead to inconsistent results and potential inaccuracies between genotyping platforms and thereby impact CYP2D6 metabolite phenotype prediction.
The kit for CYP2D6 genotyping with medical device registration certificate in the market at present comprises: hunan grand macromolecule gene biotechnology limited company (CYP2D 6x 10, CYP2C9 x 3, ADRB1(1165G > C), AGTR1(1166A > C), ACE (I/D) detection kit (gene chip method)) and Wuxi Shaoqi gene biotechnology limited company (CYP2D 6x 10, CYP2C9 x 3, ADRB1(1165G > C), AGTR1(1166A > C), ACE (I/D) detection kit (PCR-melting curve method)), and other unregistered kit products include Agena VeriDose Core Panel (MALD-TOF), thermo Taq SNP (fluorescent quantitation). The MALD-TOF has the defects of long experimental period, complicated operation steps, high requirement on the surrounding environment and the like; the thermolish parting product only supports a single tube to detect one SNP point at present, and the cost of the reagent is relatively high; the Hunan macromolecular gene biological product is not comprehensive enough and the chip manufacturing process is complicated because the product only contains 10 sites; the tin-free Ruiqi gene biological product only detects 10 sites, and the dissolution curve method has higher requirements on the performance of the instrument (temperature uniformity and extremely small temperature change) and the determination of a result interpretation threshold.
At present, no biological product for obtaining a medical instrument registration certificate aiming at CYP2D6 copy number variation detection exists in the market, and a kit for research products comprises: agena Veridose CYP2D6(MALD-TOF), thermolish CYP2D6 (fluorescent quantitative PCR), and the like. The Agena product also has the disadvantages of complicated experimental steps, high environmental requirements and the like, but the thermolish product is calibrated by only adopting one internal reference gene, and certain problems may exist because the sample quality (inaccurate judgment caused by degradation and the like) factor is not considered.
Disclosure of Invention
The invention aims to provide a primer probe combination, a kit and a method for detecting human CYP2D6 copy number variation and genotyping, so as to solve the problems of high cost of detection reagents, low accuracy, high requirements for determining instrument performance and result interpretation thresholds and complicated experimental steps existing in human CYP2D6 copy number variation and genotyping detection in the prior art.
In order to solve the technical problems, the invention adopts the following technical scheme:
according to a first aspect of the present invention, there is provided a specific primer-probe combination for use in the detection of human CYP2D6 copy number variation, comprising: an upstream primer CYP2D6-F for the human CYP2D6 gene: 5'-CACCAGGAAAGCAAAGACAC-3', respectively; the downstream primer CYP2D6-R aiming at the human CYP2D6 gene: 5'-TGCAGCACTTCAGCTTCT-3', respectively; an upstream primer TERT-F aiming at a reference gene TERT gene segment: 5'-AGGGTCCTCGCCTGTGTA-3', respectively; the downstream primer TERT-R aiming at the reference gene TERT gene segment: 5'-CCCAGATTCGCCATTGTTCA-3', respectively; an upstream primer RPPH-F aiming at an internal reference gene RPPH gene segment: 5'-CCGCCTCTGGCCCTAGT-3', respectively; a downstream primer RPPH-R aiming at the reference gene RPPH gene segment: 5'-GCCACGAGCTGAGTGCGT-3', respectively; the Probe CYP2D6-Probe for recognizing human CYP2D6 mutation: 5 '-FAM-ACACCATGGTGGCTGGGCCG-BHQ 1-3'; and (2) identifying the Probe TERT-Probe with reference gene TERT gene fragment conserved sequence specificity: 5 '-CY 5-TGGTGGGGGTGGAAGGCAAA-BHQ 3-3'; a Probe RPPH-Probe for identifying the conserved sequence specificity of the reference gene RPPH gene segment: 5 '-VIC-TGTCACTCCACTCCCATGTCCCTTGG-BHQ 1-3'.
According to a second aspect of the present invention, there is provided a specific primer probe combination for human CYP2D6 genotyping detection, comprising: upstream primer 10-F for human CYP2D6 × 10 genotyping: 5'-CCATTTGGTAGTGAGGCAGGT-3', respectively; downstream primer 10-R for human CYP2D6 × 10 genotyping: 5'-GGAAGTCCACATGCAGCAG-3', respectively; upstream primer 41-F for human CYP2D6 × 41 genotyping: 5'-GGGTGTCCCAGCAAAGTTCA-3', respectively; downstream primers 41-R for human CYP2D6 × 41 genotyping: 5'-CCCATCTGGGAAACAGTGCA-3', respectively; probe 10-Probe-W that recognized human CYP2D6 × 10 genotyping: 5 '-FAM-CTGCACGCTACCCA-MGB-3'; probe 10-Probe-M that recognized human CYP2D6 × 10 genotyping: 5 '-VIC-CTGCACGCTACTCA-MGB-3'; probe 41-Probe-W that recognized human CYP2D6 × 41 genotyping: 5 '-ROX-ACCCTTGGTCCCTACGC-BHQ 2-3'; probe 41-Probe-M for identifying human CYP2D6 × 41 genotyping: 5 '-Cy 5-ACCCTTGGTCCCTCTGCC-BHQ 3-3'.
According to a third aspect of the invention, there is provided a specific primer probe combination for simultaneous detection of human CYP2D6 copy number variation and genotyping.
According to a fourth aspect of the present invention there is provided a kit for human CYP2D6 copy number variation and genotyping detection, said kit comprising a specific primer-probe combination for human CYP2D6 copy number variation and genotyping detection as described above.
The kit further comprises: reaction solution A: 1.25U DNA polymerase, 0.3mM DNTP (A, G, C, T), 0.3mM DUTP, 0.4U UDG enzyme, 50mM Tris-HCl (pH 9), 20mM (NH)4)2SO4，2mM Mg2+SO41% glycerol, 0.1mg/ml BSA; reaction solution B: 1.25U DNA polymerase, 0.3mM DNTP (A, G, C, T), 0.4U UDG enzyme, 50mM Tris-HCl (pH 8.8), 20mM (NH)4)2SO4，2mM Mg2+Cl21% glycerol, 0.1mg/mL BSA, 0.007% Tween 20, 0.5% mg/mL fish gelatin.
The kit further comprises: blank control, calibrator, positive control; the blank control is nuclease-free water, the calibrator is human 9947 genome DNA, and the positive control is DNA containing three genotypes of CYP2D6 (GG, TT; AA, CC; GA, CT).
According to a fifth aspect of the present invention there is provided a method of human CYP2D6 copy number variation and genotyping detection for non-disease diagnostic purposes, said method comprising: simultaneously detecting human CYP2D6 copy number variation and human CYP2D6 genotyping;
the method for detecting the variation of the human CYP2D6 copy number comprises the following steps: a: designing a primer probe combination according to claim 1 aiming at sequence characteristics of human CYP2D6 gene, reference gene TERT gene and reference gene RPPH gene; b: obtaining extracted genome DNA of a sample to be detected; c: in a reaction system, the specific primer probe combination of claim 1 is mixed according to a certain proportion and added into a reaction solution; d: carrying out real-time quantitative fluorescent PCR detection; e: the CT difference of the TERT-CYP2D6 of each sample is counted to be CT1,RPPThe absolute value of the CT difference of the H-TERT is CT2，CT3CT difference for TERT-CYP2D6 for calibrator 9947; the sample should satisfy 0 ≤ CT2Less than or equal to 1.5, and judging that the quality of the sample is qualified; after the sample is qualified, calculating the copy number of the M sample to be detected as 2^(CT1-CT3+1)(ii) a And (3) judging according to the M value: m<0.5, is a 0 copy sample, if 0.5. ltoreq.M<1.4, 1 copy sample; when M is more than or equal to 1.4 and less than or equal to 2.6, the sample is a 2-copy sample; m>2.6, 3 and above copy samples.
The method for detecting the human CYP2D6 genotyping comprises the following steps: a: designing a primer probe combination according to claim 2, based on sequence characteristics of human CYP2D6 gene 10 genotype or 41 genotype; b: obtaining extracted genome DNA of a sample to be detected; c: in a reaction system, the specific primer probe combination of claim 2 is mixed according to a certain proportion and added into a reaction solution; d: carrying out real-time quantitative fluorescent PCR detection; e: counting CT values corresponding to four channels FAM, VIC, ROX and CY5 of the sample to be detected, if | CTFAM-CTVICIf ≧ 4, the sample is either wild homozygous or 10 mutant homozygous, otherwise heterozygous, like if CTROX-CTCY5And | ≧ 4, the sample is homozygous for the wild or homozygous for the 41 mutation, otherwise, the sample is heterozygous.
When the copy number variation of the detected sample is 0, the sample can be judged as a weak metabolic type without detecting two SNP genotypes; when the copy number variation is 1, namely, the sample is deleted, the sample can be judged as the intermediate metabolic type without detecting two SNP genotypes; the copy number variation is 2, namely normal, and when SNP x 10 is mutation homozygous AA and SNP x 41 is wild homozygous CC, the sample is judged to be intermediate metabolic type; when SNP 10 is wild homozygous GG and SNP 41 is mutant homozygous TT, the sample is judged to be an intermediate metabolic type; when SNP 10 is wild homozygous GG and SNP 41 is wild homozygous CC or heterozygous CT, the sample is judged to be normal metabolic type; when SNP 10 is heterozygous GA and SNP 41 is wild homozygous CC, the sample is judged as normal metabolic type; when SNP 10 is heterozygous GA and SNP 41 is heterozygous CT, the sample is judged to be intermediate metabolic type; the copy number variation is more than or equal to 3, and when SNP x 10 is mutation homozygous AA and SNP x 41 is wild homozygous CC, the sample is judged as an intermediate metabolic type; when SNP 10 is wild homozygous GG and SNP 41 is mutant homozygous TT, the sample is judged to be normal metabolic type; and when SNP 10 is wild homozygous GG or heterozygous GA, and SNP 41 is wild homozygous CC or heterozygous CT, the sample is judged to be the ultrafast metabolic type.
According to a preferred embodiment of the present invention, the method for detecting variation in copy number of human CYP2D6 and the method for detecting genotyping of human CYP2D6 use the same amplification procedure: 30 ℃, 10min, 1 cycle; 95 ℃, 5min, 1 cycle; 95 ℃, 15s, 61 ℃, 40s, 40 cycles.
According to a preferred embodiment of the invention, the concentration of each primer in the specific primer probe combination used in step C of the method for detecting variation in copy number of human CYP2D6 is 800-1000 nM, and the concentration of each probe is 200-300 nM; the concentration of each primer in the specific primer probe combination used in the step c of the method for detecting the human CYP2D6 genotyping is 400-600 nM, and the concentration of each probe is 200-300 nM.
As described in the background section of the present invention, CYP2D6 enzyme is involved in the hepatic metabolism of approximately 25% of the commonly used drugs including antidepressants, antipsychotics, antiarrhythmics, opioids, beta-blockers, and the like. Differences in the CYP2D6 alleles may result in increased, decreased or no activity of the encoded enzyme, which may lead to differences in drug response and risk of adverse reactions between individuals, while copy number variations of the gene (e.g., 5 deletions, 36X2, 36+ 10 rearrangements, etc.) play a critical role in the metabolism of the drug in its individual. Therefore, the inventors of the present invention screened 1 (34.9%), 2 (13.3%), '5 (5%),' 10 (43%), '36 (1.2%),' 41 (2.34%) alleles against the higher allele frequency (> 1%) of the east asian population by referring to databases of CPIC, PharmGKB, pharmvr, etc., while specifically amplifying the CYP2D6 exon 9 region, and since 36 and 5 are non-functional alleles, which had copy number variations that had not contributed to the enzymatic function, excluded the design of specific probes and primers for the two copy number variation detections of 36 and 5, and finally determined to design specific probes and primers only for the two gene typing detections of 10 and 41, thereby performing typing detection of the two genotypes, i.e., up to two target molecules (10 and 41 for all the four target molecules), the simultaneous identification of the genotype is realized under the procedure completely consistent with copy number detection, the experimental time is reduced, and meanwhile, the reagent also contains UDG enzyme, so that the risk of misinterpretation of the genotype caused by aerosol pollution can be effectively prevented.
Furthermore, the invention simultaneously increases the double internal reference TERT and the RPPH as qualified parameters of the evaluation sample, avoids the risk of misjudgment caused by the quality problem of the sample, realizes the simultaneous detection of 3 target genes (2D6+ TERT + RPPH) in a single tube, reduces the reagent and the material cost to the maximum extent on the premise of ensuring the performance indexes such as detection accuracy, reproducibility, detection limit and the like, simplifies the operation of experimenters, and simultaneously can effectively prevent the false positive amplification possibly caused by aerosol by UDG enzyme in the reaction liquid, thereby further ensuring the accuracy of detecting copy number variation of clinical samples.
The invention integrates CYP2D6 gene copy number variation (such as X5 deletion, 36X2, 36+ 10 rearrangement, Duplication, etc.) and SNP polymorphism to individual drug metabolism, and gene polymorphism and individual drug metabolism capability difference can be divided into four types of PM (1%), UM (1.5%), IM (48.5%) and NM (49%) based on copy number variation.
According to the invention, the inventor designs PCR primers and fluorescent labeled probes specifically combined with target genes aiming at CYP2D6 exon 9 region, excluding pseudogenes CYP2D7, CYP2D8 and allele 36 (without biological function) region, and designs wild-type fluorescent labeled probes and fluorescent labeled probes of 10 and 41 mutant types at the same time, in the PCR extension reaction process, the 5 ' exonuclease activity of Taq enzyme cuts the 5 ' end fluorescent group of the probe, so that the probe is dissociated in the reaction system, and the shielding of 3 ' fluorescent quenching group is eliminated, thereby, the fluorescent light which can be detected by a detection instrument is emitted when the probe is excited by laser with specific wavelength, and the copy number variation and the corresponding genotype of the sample are determined after calibration according to a calibrator.
In conclusion, the primer probe combination, the kit and the method for detecting human CYP2D6 copy number variation and genotyping provided by the invention can be used for qualitatively detecting CYP2D6 copy number variation and 10 and 41 genotypes in human genome DNA in vitro, so that the simultaneous detection of 10 and 41 genotypes in a single tube of imported/domestic fluorescent quantitative PCR equipment is realized, and the kit has the advantages of high accuracy, good stability and excellent detection limit, and can assist clinical selection of anti-mental drugs (paroxetine, fluoxetine, aripiprazole, Vortioxetine, Venlafaxine, risperidone tetrabenazine, pimozide and the like) according to the detection result to realize medication guidance for mental/depressive patients, ensure curative effect and reduce toxic and side reaction.
Drawings
FIG. 1 is an amplification profile of calibrator 9947 in case one;
FIG. 2 is an amplification map of sample 1 in case one;
FIG. 3 is an amplification map of sample 2 in case one;
FIG. 4 is an amplification map of sample 3 in case two;
figure 5 is a 10 genotyping map of sample 3 in case two.
Figure 6 is a 41 genotyping map of sample 3 in case two.
Detailed Description
The present invention will be further described with reference to the following specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.
Example 1 design of primers and probes
According to the invention, a TaqMAN fluorescence quantitative method is adopted for aiming at CYP2D6 exon 9 region, identification of 36 and 5 non-functional allele copy number is eliminated, specific amplification is carried out, double internal references TERT and RPPH are added as qualified parameters of an evaluation sample, the risk of misjudgment caused by sample quality problems is avoided, and simultaneous detection of 3 target genes (2D6+ TERT + RPPH) is realized in a single tube. The invention designs primers and probes respectively aiming at human CYP2D6 gene, TERT reference gene and RPPH reference gene, the nucleotide sequences of which are shown in the following table 1, and the preferable using concentrations of the primers and the probes are also shown.
TABLE 1 primer Probe sequences designed for human CYP2D6 copy number detection
Meanwhile, the inventors also designed specific probes and primers for the detection of the genotyping of the human CYP2D6 genes 10 and 41, the nucleotide sequences of which are shown in table 2 below, and also show the preferred concentrations of each primer and probe.
TABLE 2 primer Probe sequences designed for human CYP2D6 genotyping assays
| Primer name | Sequence of | Concentration nM |
| *10-F(SEQ ID No.10) | CCATTTGGTAGTGAGGCAGGT | 500 |
| *10-R(SEQ ID No.11) | GGAAGTCCACATGCAGCAG | 500 |
| *41-F(SEQ ID No.12) | GGGTGTCCCAGCAAAGTTCA | 500 |
| *41-R(SEQ ID No.13) | CCCATCTGGGAAACAGTGCA | 500 |
| *10-Probe-W(SEQ ID No.14) | FAM-CTGCACGCTACCCA-MGB | 250 |
| *10-Probe-M(SEQ ID No.15) | VIC-CTGCACGCTACTCA-MGB | 250 |
| *41-Probe-W(SEQ ID No.16) | ROX-ACCCTTGGTCCCTACGC-BHQ2 | 250 |
| *41-Probe-M(SEQ ID No.17) | Cy5-ACCCTTGGTCCCTCTGCC-BHQ3 | 250 |
Example 2A kit for human CYP2D6 copy number variation and genotyping detection
1. The main components
According to the preferred embodiment, a kit for detecting human CYP2D6 copy number variation and genotyping is provided, wherein the kit comprises the following main components as shown in Table 3.
TABLE 3 major Components of the kit
2. Components necessary for detection but not included in the kit
1.5ml centrifuge tubes (for preparation of PCR reactions and DNA extraction), 0.2ml PCR tubes or 8-up tubes or 96-well plates, stoppered tips (1ml, 200. mu.L and 10. mu.L), DNA extraction kits (Qiamp DNA Blood Mini Kit, Raniti swab/spot extraction Kit are recommended).
3. Adapted for instruments
Is suitable for a Real-time PCR amplification instrument with ABI7500 model.
4. Sample requirement
4.1 suitable samples are EDTA anticoagulated whole blood, buccal swab and blood card; the sample is preserved for no more than 7 days at 4-10 ℃ and no more than 1 year at-20 ℃, and repeated freezing and thawing are avoided.
4.2 extraction of human genomic DNA using commercial kits, it is recommended to extract whole Blood samples using Qiamp DNA Blood Mini Kit from Qiagen (cat # 51104 or 51106), saliva or swab samples using the swab genomic DNA extraction Kit from Ranichi (NSSDE-P-6004), Blood card samples using the plaque genomic DNA extraction Kit from Ranichi (BSDE-P-5004), concentration and purity of the extracted DNA being determined using Nanodrop, the DNAOD260/280 is 1.4-2.0, the concentration is more than 10 ng/muL, the sample quality is unqualified and cannot be used for detection, resampling under 10 ng/muL is recommended to carry out nucleic acid extraction, the concentration is properly diluted to a specified concentration range above 100 ng/muL, the extracted DNA is recommended to be immediately detected, otherwise, the DNA is required to be stored under the condition of-20 ℃, and the storage time is not more than 6 months.
5. Inspection method
5.1 nucleic acid extraction
Extracting nucleic acid according to different sample types and strict according to the instruction of the corresponding kit. Necessary marking method should be adopted in the extraction process to avoid reagent addition omission and sample confusion.
5.2 reagent preparation
Taking out the reagent from the refrigerator, melting at room temperature, mixing uniformly, and quickly centrifuging at 1000rpm for 20s for later use.
5.3 preparation of reaction System
5.3.1 calculating the required reaction liquid according to the number of the detection samples, if the number of the samples is N, performing N +6 reaction, wherein three positive controls, two blank controls and one calibrator.
5.3.2 calculate the volume of each required reaction solution according to the following table 4, prepare the reaction system, mix the reaction system evenly, centrifuge rapidly at 3000rpm for 30 seconds, and dispense into PCR tubes with 19. mu.L each.
TABLE 4 sample application Table
| Components | Copy number (μ L) | SNP typing (μ L) |
| |
4 | / |
| Reaction solution B | / | 4 |
| Reaction solution I | 1 | / |
| Reaction solution II | / | 1 |
| Water (W) | 14 | 14 |
| Total volume | 19 | 19 |
5.4 sample application
Adding 1 mu L of DNA (10-100 ng is recommended) of a sample to be detected into a PCR reaction tube, covering a tube cover, and centrifuging at 1000rpm to remove bubbles at the bottom of the tube; and (4) carrying a positive control, a blank control and a calibrator by using the kit.
5.5 on-machine detection
5.5.1 opening the fluorescent quantitative PCR instrument, and putting the PCR tube containing the detected sample into the detection bin of the machine. The instrument control software was then turned on.
5.5.2 set up the reaction program according to the prompt.
When the detection machine is operated for the first time, the following operations should be performed.
Click on "advanced setting" and set the reaction program in the experimental attributes as per table 5 below.
TABLE 5 reaction procedure
Then in the reaction plate setup, click "define genes and samples" and then click "add new genes" button. Then "Gene 1" was renamed to "CYP 2D 6", reporter group selected "FAM", quencher group "None"; the gene 2 is renamed to be RPPH, the reporter group is selected to be VIC, and the quencher group is selected to be None; the "Gene 3" was renamed "TERT", reporter selection "CY 5", quencher "None". Rename "gene 4" as "W1-G", reporter group selected "FAM", quencher group "NFQ-MGB"; rename "gene 5" as "10M-a", reporter group selected as "VIC", quencher group "NFQ-MGB"; rename "gene 6" as "W2-C", reporter group select "ROX", quencher group "None"; the "gene 7" was renamed ". 41M-T", reporter selection "CY 5", quencher "None".
Then, in the reaction procedure, the reaction system was changed to "20. mu.L", and the amplification procedure was set as in Table 6 below.
TABLE 6 amplification procedure
Then click the "save" button, select "save as template", save as "CYP 2D6-CNV + SNP". The template is then closed.
5.5.3 if the machine used is detected to have completed the above operation, please follow the following operation.
1) Click the "open" button, open the file CYP2D6-CNV + snp.
2) After the file is opened, the name of the sample to be tested is added to the "define gene sample" in the "reaction plate setup". Then click "assign genes and samples", in this panel, according to the actual sample placement position. In the column "designated gene", a gene corresponding to a sample test item (copy number identification or SNP typing) and a sample are selected and checked, and "none" is selected with reference to a fluorescent dye.
3) After all the settings are finished, the files are saved as eds files according to the experiment names, and simultaneously, a Start button at the upper right corner is clicked to Start the experiment.
6 analysis of results
6.1 after the reaction program runs, enter the analysis interface, click the "analysis settings" in the top right corner, set the threshold to 3000, set the baseline "start cycle" to 5, and "end cycle" to 18, and then click the "application analysis settings".
6.2 the selection of "pattern" in amplification map is "Delta Rn VS cycle number", "pattern type" is "linear map", the color is "gene" for direct observation, and the menu bar "export" key can be used to save the data as XLS/. TXT file for convenient calculation of copy number variation and SNP typing identification.
7 interpretation of test results
7.1 copy number variation
7.1.1 statistics of the CT difference for TERT-CYP2D6 for each sample as CT1The absolute value of the CT difference of RPPH-TERT is CT2，CT3The two last decimal places were rounded off for the CT difference for TERT-CYP2D6 for calibrator 9947.
7.1.2 first, when the sample satisfies 0. ltoreq. CT2If the sample quality is less than or equal to 1.5, the sample quality is judged to be qualified, and if the sample quality is not qualified, the copy number judgment may not be carried outAccurately, sample re-extraction or re-sampling should be considered.
7.1.3 after the sample is qualified, calculating the copy number of the M sample to be detected to be 2^ 2(CT1-CT3+1)(ii) a M retains the last two decimal places.
7.1.4 according to the M value: if M <0.5, it is a 0 copy sample, if M <1.4 is more than or equal to 0.5, it is a 1 copy sample; if M is more than or equal to 1.4 and less than or equal to 2.6, the sample is a 2-copy sample; if M >2.6, it is 3 and above copy samples.
7.2 SNP typing
7.2.1 statistics of CT values corresponding to channels of W1-G (FAM),. about.10M-A (VIC),. about. 2-C (ROX),. about.41M-T (CY5) (namely CT values of four channels including FAM, VIC, ROX and CY5) of the sample to be detected, if | CTFAM-CTVICIf | is not less than 4, the sample is wild homozygous or 10 mutant homozygous, otherwise it is heterozygous, the same way, if | CTROX-CTCY5And | ≧ 4, the sample is homozygous for the wild or homozygous for the 41 mutation, otherwise, the sample is heterozygous.
7.2.2 binding copy number variation and SNP typing correspondence phenotype see Table 7 below.
TABLE 7 combination of copy number variation and SNP typing correspondence phenotypes
Note: SNP1 is FAM (G), VIC (A); SNP2 is ROX (C), CY5 (T).
When the copy number variation of the detected sample is 0, the sample can be judged as a weak metabolic type without detecting two SNP genotypes; when the copy number variation is 1, namely, the sample is deleted, the sample can be judged as the intermediate metabolic type without detecting two SNP genotypes; the copy number variation is 2, namely the copy number variation is normal, the SNP1 is mutation homozygous AA, and when the SNP2 is wild homozygous CC, the sample is judged to be an intermediate metabolic type; when SNP1 is wild homozygous GG and SNP2 is mutant homozygous TT, the sample is judged to be an intermediate metabolic type; when SNP1 is wild homozygous GG and SNP2 is wild homozygous CC or heterozygous CT, the sample is judged to be normal metabolic type; when SNP1 is heterozygous GA and SNP2 is wild homozygous CC, the sample is judged to be normal metabolic type; when SNP1 is heterozygous GA and SNP2 is heterozygous CT, the sample is judged to be intermediate metabolic type; the copy number variation is more than or equal to 3, and when the SNP1 is mutation homozygous AA and the SNP2 is wild homozygous CC, the sample is judged as an intermediate metabolic type; the SNP1 is wild homozygous GG, and when the SNP2 is mutant homozygous TT, the sample is judged as normal metabolic type; and when the SNP1 is wild homozygous GG or heterozygous GA, and the SNP2 is wild homozygous CC or heterozygous CT, the sample is judged to be the ultrafast metabolic type.
Detection of one-case CYP2D6 copy number variation
Known copy numbers of dried blood samples 1 and 2(1 and 2 copies of the long judgment amplification confirmation, respectively) were tested. The results of the detection are shown in FIGS. 1 to 3, and agree with the known copy number.
Detection of case two human CYP2D6 genotyping
The product was used to detect the genotype of the sample 3 (. about.10,. about.41 is GA, CT) of the known genotype (MALD-TOF confirmed), and the detection results were shown in FIGS. 4 to 6 and were consistent with the known genotype.
The above embodiments are merely preferred embodiments of the present invention, which are not intended to limit the scope of the present invention, and various changes may be made in the above embodiments of the present invention. All simple and equivalent changes and modifications made according to the claims and the content of the specification of the present application fall within the scope of the claims of the present patent application. The invention has not been described in detail in order to avoid obscuring the invention.
SEQUENCE LISTING
<110> Shanghai Kangli diagnostic technology Co., Ltd
<120> primer-probe combination, kit and method for detecting human CYP2D6 copy number variation and genotyping
<160> 17
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
<210> 2
<211> 18
<212> DNA
<213> Artificial sequence
<400> 2
<210> 3
<211> 18
<212> DNA
<213> Artificial sequence
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
<210> 5
<211> 17
<212> DNA
<213> Artificial sequence
<400> 5
ccgcctctgg ccctagt 17
<210> 6
<211> 18
<212> DNA
<213> Artificial sequence
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<400> 7
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence
<400> 8
<210> 9
<211> 26
<212> DNA
<213> Artificial sequence
<400> 9
tgtcactcca ctcccatgtc ccttgg 26
<210> 10
<211> 21
<212> DNA
<213> Artificial sequence
<400> 10
ccatttggta gtgaggcagg t 21
<210> 11
<211> 19
<212> DNA
<213> Artificial sequence
<400> 11
ggaagtccac atgcagcag 19
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence
<400> 12
<210> 13
<211> 20
<212> DNA
<213> Artificial sequence
<400> 13
<210> 14
<211> 14
<212> DNA
<213> Artificial sequence
<400> 14
<210> 15
<211> 14
<212> DNA
<213> Artificial sequence
<400> 15
<210> 16
<211> 17
<212> DNA
<213> Artificial sequence
<400> 16
acccttggtc cctacgc 17
<210> 17
<211> 18
<212> DNA
<213> Artificial sequence
<400> 17
acccttggtc cctctgcc 18
Claims (10)
1. A specific primer-probe combination for use in the detection of copy number variation in human CYP2D6, comprising:
an upstream primer CYP2D6-F for the human CYP2D6 gene: 5'-CACCAGGAAAGCAAAGACAC-3', respectively;
the downstream primer CYP2D6-R aiming at the human CYP2D6 gene: 5' -TGCAGCACTTCAGCTTCT-3 ";
an upstream primer TERT-F aiming at a reference gene TERT gene segment: 5'-AGGGTCCTCGCCTGTGTA-3', respectively;
the downstream primer TERT-R aiming at the reference gene TERT gene segment: 5'-CCCAGATTCGCCATTGTTCA-3', respectively;
an upstream primer RPPH-F aiming at an internal reference gene RPPH gene segment: 5'-CCGCCTCTGGCCCTAGT-3', respectively;
a downstream primer RPPH-R aiming at the reference gene RPPH gene segment: 5'-GCCACGAGCTGAGTGCGT-3', respectively;
the Probe CYP2D6-Probe for recognizing human CYP2D6 mutation: 5 '-FAM-ACACCATGGTGGCTGGGCCG-BHQ 1-3';
and (2) identifying the Probe TERT-Probe with reference gene TERT gene fragment conserved sequence specificity: 5 '-CY 5-TGGTGGGGGTGGAAGGCAAA-BHQ 3-3';
a Probe RPPH-Probe for identifying the conserved sequence specificity of the reference gene RPPH gene segment: 5 '-VIC-TGTCACTCCACTCCCATGTCCCTTGG-BHQ 1-3'.
2. A specific primer probe combination for genotyping detection of human CYP2D6, comprising:
upstream primer 10-F for human CYP2D6 × 10 genotyping: 5'-CCATTTGGTAGTGAGGCAGGT-3', respectively;
downstream primer 10-R for human CYP2D6 × 10 genotyping: 5'-GGAAGTCCACATGCAGCAG-3', respectively;
upstream primer 41-F for human CYP2D6 × 41 genotyping: 5'-GGGTGTCCCAGCAAAGTTCA-3', respectively;
downstream primers 41-R for human CYP2D6 × 41 genotyping: 5'-CCCATCTGGGAAACAGTGCA-3', respectively;
probe 10-Probe-W that recognized human CYP2D6 × 10 genotyping: 5 '-FAM-CTGCACGCTACCCA-MGB-3';
probe 10-Probe-M that recognized human CYP2D6 × 10 genotyping: 5 '-VIC-CTGCACGCTACTCA-MGB-3';
probe 41-Probe-W that recognized human CYP2D6 × 41 genotyping: 5 '-ROX-ACCCTTGGTCCCTACGC-BHQ 2-3';
probe 41-Probe-M for identifying human CYP2D6 × 41 genotyping: 5 '-Cy 5-ACCCTTGGTCCCTCTGCC-BHQ 3-3'.
3. A specific primer probe combination for detecting human CYP2D6 copy number variation and genotyping, comprising: the specific primer-probe combination for human CYP2D6 copy number variation detection according to claim 1, and the specific primer-probe combination for human CYP2D6 genotyping detection according to claim 2.
4. A kit for human CYP2D6 copy number variation and genotyping detection, said kit comprising the specific primer-probe combination for human CYP2D6 copy number variation and genotyping detection of claim 3.
5. The kit of claim 4, further comprising: reaction solution A: 1.25U DNA polymerase, 0.3mM DNTP (A, G, C, T), 0.3mM DUTP, 0.4U UDG enzyme, 50mM Tris-HCl (pH 9), 20mM (NH)4)2SO4，2mM Mg2+SO41% glycerol, 0.1mg/ml BSA; reaction solution B: 1.25U DNA polymerase, 0.3mM DNTP (a, G, C, T), 0.4U UDG enzyme, 50mM Tris-HCl (PH 8.8), 20mM (NH)4)2SO4，2mM Mg2+Cl21% glycerol, 0.1mg/ml BSA, 0.007% Tween 20, 0.5% mg/ml fish gelatin.
6. The kit of claim 5, further comprising: blank control, calibrator, positive control; wherein the blank control is water without nuclease, the calibrator is human 9947 genome DNA, and the positive control is DNA containing three genotypes of CYP2D 6.
7. A method of human CYP2D6 copy number variation and genotyping detection for non-disease diagnostic purposes, said method comprising: simultaneously detecting human CYP2D6 copy number variation and human CYP2D6 genotyping;
the method for detecting the variation of the human CYP2D6 copy number comprises the following steps:
a: designing a primer probe combination according to claim 1 aiming at sequence characteristics of human CYP2D6 gene, reference gene TERT gene and reference gene RPPH gene;
b: obtaining extracted genome DNA of a sample to be detected;
c: in a reaction system, the specific primer probe combination of claim 1 is mixed according to a certain proportion and added into a reaction solution;
d: carrying out real-time quantitative fluorescent PCR detection;
e: the CT difference of the TERT-CYP2D6 of each sample is counted to be CT1The absolute value of the CT difference of RPPH-TERT is CT2，CT3CT difference for TERT-CYP2D6 for calibrator 9947; the sample should satisfy 0 ≤ CT2Less than or equal to 1.5, and judging that the quality of the sample is qualified; after the sample is qualified, calculating the copy number of the M sample to be detected as 2^(CT1-CT3+1)(ii) a And (3) judging according to the M value: if M is<0.5, is a 0 copy sample, if 0.5. ltoreq.M<1.4, 1 copy sample; if M is more than or equal to 1.4 and less than or equal to 2.6, the sample is a 2-copy sample; m>2.6, 3 and above copy samples;
the method for detecting the human CYP2D6 genotyping comprises the following steps:
a: designing a primer probe combination according to claim 2, based on sequence characteristics of human CYP2D6 gene 10 genotype or 41 genotype;
b: obtaining extracted genome DNA of a sample to be detected;
c: in a reaction system, the specific primer probe combination of claim 2 is mixed according to a certain proportion and added into a reaction solution;
d: carrying out real-time quantitative fluorescent PCR detection;
e: counting CT values corresponding to four channels FAM, VIC, ROX and CY5 of the sample to be detected, if | CTFAM-CTVICIf ≧ 4, the sample is either wild homozygous or 10 mutant homozygous, otherwise heterozygous, like if CTROX-CTCY5And | ≧ 4, the sample is homozygous for the wild or homozygous for the 41 mutation, otherwise, the sample is heterozygous.
8. The method for detecting human CYP2D6 copy number variation and genotyping according to claim 7, wherein when detecting a sample copy number variation as 0, the sample is determined to be weakly metabolic without detecting two SNP genotypes; when the copy number variation is 1, namely, the sample is deleted, the sample can be judged as the intermediate metabolic type without detecting two SNP genotypes; the copy number variation is 2, namely normal, and when SNP x 10 is mutation homozygous AA and SNP x 41 is wild homozygous CC, the sample is judged to be intermediate metabolic type; when SNP 10 is wild homozygous GG and SNP 41 is mutant homozygous TT, the sample is judged to be an intermediate metabolic type; when SNP 10 is wild homozygous GG and SNP 41 is wild homozygous CC or heterozygous CT, the sample is judged to be normal metabolic type; when SNP 10 is heterozygous GA and SNP 41 is wild homozygous CC, the sample is judged as normal metabolic type; when SNP 10 is heterozygous GA and SNP 41 is heterozygous CT, the sample is judged to be intermediate metabolic type; the copy number variation is more than or equal to 3, and when SNP x 10 is mutation homozygous AA and SNP x 41 is wild homozygous CC, the sample is judged as an intermediate metabolic type; when SNP 10 is wild homozygous GG and SNP 41 is mutant homozygous TT, the sample is judged to be normal metabolic type; and when SNP 10 is wild homozygous GG or heterozygous GA, and SNP 41 is wild homozygous CC or heterozygous CT, the sample is judged to be the ultrafast metabolic type.
9. The method for detecting copy number variation and genotyping of human CYP2D6 according to claim 7, wherein the method for detecting copy number variation of human CYP2D6 and the method for detecting genotyping of human CYP2D6 use the same amplification procedure: 30 ℃, 10min, 1 cycle; 95 ℃, 5min, 1 cycle; 95 ℃, 15s, 61 ℃, 40s, 40 cycles.
10. The method for detecting human CYP2D6 copy number variation and genotyping according to claim 7, wherein the concentration of each primer in the specific primer probe combination used in step C of the method for detecting human CYP2D6 copy number variation is 800-1000 nM, and the concentration of each probe is 200-300 nM; the concentration of each primer in the specific primer probe combination used in the step c of the method for detecting the human CYP2D6 genotyping is 400-600 nM, and the concentration of each probe is 200-300 nM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110633466.5A CN113186267A (en) | 2021-06-07 | 2021-06-07 | Primer-probe combination, kit and method for detecting human CYP2D6 copy number variation and genotyping |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110633466.5A CN113186267A (en) | 2021-06-07 | 2021-06-07 | Primer-probe combination, kit and method for detecting human CYP2D6 copy number variation and genotyping |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113186267A true CN113186267A (en) | 2021-07-30 |
Family
ID=76975997
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110633466.5A Pending CN113186267A (en) | 2021-06-07 | 2021-06-07 | Primer-probe combination, kit and method for detecting human CYP2D6 copy number variation and genotyping |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113186267A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113981060A (en) * | 2021-09-27 | 2022-01-28 | 首都医科大学附属北京安贞医院 | Genotype detection method and kit |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240338A (en) * | 2007-02-09 | 2008-08-13 | 株式会社东芝 | Method of detecting gene mutation |
| CN103492590A (en) * | 2011-02-22 | 2014-01-01 | 卡里斯生命科学卢森堡控股有限责任公司 | Circulating biomarkers |
| EP2742154A2 (en) * | 2011-08-08 | 2014-06-18 | Caris Life Sciences Luxembourg Holdings, S.a.r.l. | Biomarker compositions and methods |
| CN104263820A (en) * | 2014-09-11 | 2015-01-07 | 广州基迪奥生物科技有限公司 | Multi-site mutation detection method of CYP2D6 gene |
| CN106498053A (en) * | 2016-10-25 | 2017-03-15 | 北京亿昊基因技术有限公司 | A kind of method for fast and accurately detecting CYP2D6 gene copy number variations |
| CN108342464A (en) * | 2018-04-04 | 2018-07-31 | 良培基因生物科技（武汉）有限公司 | One-step method detects the kit and its detection method of HER2/neu gene expression amounts |
-
2021
- 2021-06-07 CN CN202110633466.5A patent/CN113186267A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240338A (en) * | 2007-02-09 | 2008-08-13 | 株式会社东芝 | Method of detecting gene mutation |
| CN103492590A (en) * | 2011-02-22 | 2014-01-01 | 卡里斯生命科学卢森堡控股有限责任公司 | Circulating biomarkers |
| EP2742154A2 (en) * | 2011-08-08 | 2014-06-18 | Caris Life Sciences Luxembourg Holdings, S.a.r.l. | Biomarker compositions and methods |
| CN104263820A (en) * | 2014-09-11 | 2015-01-07 | 广州基迪奥生物科技有限公司 | Multi-site mutation detection method of CYP2D6 gene |
| CN106498053A (en) * | 2016-10-25 | 2017-03-15 | 北京亿昊基因技术有限公司 | A kind of method for fast and accurately detecting CYP2D6 gene copy number variations |
| CN108342464A (en) * | 2018-04-04 | 2018-07-31 | 良培基因生物科技（武汉）有限公司 | One-step method detects the kit and its detection method of HER2/neu gene expression amounts |
Non-Patent Citations (2)
| Title |
|---|
| 宣姚吉等: "实时荧光定量 PCR 检测毕赤酵母基因组中外源基因拷贝数", 《中国生物制品学杂志》 * |
| 蒙晓平等: "COX1、12SrＲNA、16SrＲNA 基因复合扩增种属鉴定研究", 《中国法医学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113981060A (en) * | 2021-09-27 | 2022-01-28 | 首都医科大学附属北京安贞医院 | Genotype detection method and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2556981C (en) | Method for detecting and quantifying rare mutations or polymorphisms | |
| WO2020011277A1 (en) | Test kit and method for detecting cyp3a4 and cyp3a5 polymorphic sites | |
| CN107488711B (en) | Method for detecting genotype of point mutation and kit thereof | |
| CN106929591A (en) | A kind of human HLA B*5801 genetic polymorphism detection kits | |
| CN107119107A (en) | A kind of method and kit for detecting mankind's CYP2C19 gene pleiomorphisms | |
| CN106520950A (en) | UGT1A1 gene polymorphism detection primer and probe and kit | |
| CN111118138A (en) | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR | |
| CN110387407A (en) | For detecting primer combination of probe object, kit and the detection method of people's SLCO1B1 and ApoE Genotyping | |
| CN113186266B (en) | Method for detecting human CYP2D6 gene copy number variation | |
| CN106755360A (en) | Nucleic acid, kit and method for detecting mankind's CYP2D6 gene pleiomorphisms | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| CN113186267A (en) | Primer-probe combination, kit and method for detecting human CYP2D6 copy number variation and genotyping | |
| Baudhuin et al. | Comparison of three methods for genotyping the UGT1A1 (TA) n repeat polymorphism | |
| CN116949143A (en) | Sequence composition for detecting MTHFR and MTRR genes, kit and application | |
| CN111187824A (en) | Nicholol medication guide gene detection kit for antihypertensive drug | |
| CN111235251A (en) | Kit for detecting gene of nitrendipine individualized medication guidance of antihypertensive drug | |
| CN111235252A (en) | Method for distinguishing individual medication of nitrendipine by mass spectrometry through detecting product | |
| CN115505648A (en) | Development and application of KASP molecular marker of drought-resistant gene of corn | |
| CN107043808A (en) | UGT1A1 genetic polymorphism detection primer peptide nucleic acids and its kit | |
| CN111187820A (en) | Method for distinguishing Nistrol personalized medicine by detecting product and performing mass spectrometry | |
| CN111187822A (en) | Detection product for distinguishing individual drug type of Nicholol | |
| CN111187823A (en) | Primer composition for distinguishing Nichol individual medicine type | |
| CN111187821A (en) | Method for distinguishing Nicol lol personalized medicine by using primer composition to perform mass spectrometry | |
| CN110438224B (en) | Primer, kit and detection method for UGT1A1 gene polymorphism detection | |
| CN111235255A (en) | Method for distinguishing individual medication of nitrendipine by using primer composition through mass spectrometry |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zha Guangbin Inventor after: He Jiong Inventor after: Zhang Hui Inventor after: Han Yan Inventor before: Zha Guangbin Inventor before: He Jiong Inventor before: Zhang Hui Inventor before: Han Yan |