CN113025701A - Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene - Google Patents
Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene Download PDFInfo
- Publication number
- CN113025701A CN113025701A CN202110261815.5A CN202110261815A CN113025701A CN 113025701 A CN113025701 A CN 113025701A CN 202110261815 A CN202110261815 A CN 202110261815A CN 113025701 A CN113025701 A CN 113025701A
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- primer pair
- extension
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6872—Methods for sequencing involving mass spectrometry
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method and a kit for early screening of non-alcoholic fatty liver disease susceptibility genes, particularly the method and the kit consider the difference of non-alcoholic fatty liver disease gene spectrums of Chinese people and European and American people, screen out the combination of SNP (single nucleotide polymorphism) sites of non-alcoholic fatty liver disease susceptibility related genes of Chinese people, and utilize a nucleic acid mass spectrometer to carry out wide (high-flux detection sites and high-flux detection samples) screening and detection on genetic markers related to non-alcoholic fatty liver diseases. The method has high detection success rate, good technical reproducibility and high cost performance, can realize the detection of multiple genes of a single small sample, and meets the maximum use of the small sample; the method has the technical advantages of high accuracy and high sensitivity, the detection result is stable, and the detection positive rate is improved.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method and a kit for early screening of non-alcoholic fatty liver disease susceptibility genes.
Background
Non-alcoholic fatty liver disease (NAFLD) refers to the clinical pathological syndrome characterized mainly by excessive fat deposition in liver cells due to the exclusion of alcohol and other definite liver damage factors, and acquired metabolic stress liver damage closely related to insulin resistance and genetic susceptibility. The nonalcoholic fatty liver disease is an important cause of chronic liver disease in developed countries such as Europe and America and affluent areas of China, the prevalence rate of NAFLD of a common adult is 10-30%, wherein 10-20% of NASH is NASH, and the incidence rate of cirrhosis in 10 years of NASH is up to 25%. Over the last 10 years, more and more studies have revealed the association of genetic polymorphisms with NAFLD, and genes may play a key role, especially in some patients with NAFLD who are not both central obesity and insulin resistance.
Single Nucleotide Polymorphisms (SNPs) are genetic markers, which refer to polymorphisms in DNA sequences at the genomic level due to single nucleotide variations. The occurrence frequency in the population is more than 1 percent, and the expression comprises the conversion and inversion of single bases, the insertion or deletion of the single bases and the like, is a new genetic marker, and can provide reliable and effective scientific basis for the prediction, diagnosis and treatment of diseases and the development of novel medicaments.
The roles that SNPs play in disease gene localization mainly include: 1. searching for a pathogenic SNP in a disease localization area, wherein the occurrence of the SNP can directly cause the change of gene transcription level and translation level, namely, the change of gene expression amount or the composition structure of gene product protein, thereby causing a certain disease to occur or making an individual susceptible to a certain special environment; SNP as a genetic marker, closely linked to a disease or phenotype. In recent years, the prediction of the occurrence and development of diseases by using SNP has become a hot spot of clinical and scientific researchers, and the application value of the SNP in the prediction of important diseases such as tumors, cardiovascular and cerebrovascular diseases and the like is very early seen.
Many NAFLD are asymptomatic, and suspected diagnoses of the disease also often rely on elevated ALT levels, as well as other clinical and biochemical examination features, or are inadvertently discovered by abdominal ultrasound examination. Since NAFLD progresses slowly, most randomized controlled trials have not found drugs that can absolutely reduce the risk of developing cirrhosis, but sustained weight loss can improve liver function, liver pathology, and thus lifestyle improvement remains a critical intervention at present. Some prognostic factors that determine the higher risk of NAFLD patients are therefore very important, which may help in the adoption of appropriate therapeutic approaches for a given patient at the time of NAFLD diagnosis. At present, no effective early detection method exists in clinic, so a high-sensitivity, economic and simple molecular technology screening method is urgently needed to be established to benefit the diagnosis and treatment of the non-alcoholic fatty liver disease.
Disclosure of Invention
The invention aims to provide a method and a kit for early screening of non-alcoholic fatty liver disease susceptibility genes.
In a first aspect of the invention, a kit for early screening of non-alcoholic fatty liver disease susceptibility genes is provided, the kit comprises a PCR amplification primer pair group, and the PCR amplification primer pair group comprises a primer pair for specifically amplifying SNP sites selected from the following groups: rs738409, rs58542926, rs780094, rs641738, rs72613567, rs3480, rs7674434, rs12152703, rs5764455 and rs 6006473.
In another preferred example, the kit is used for detecting the SNP gene mutation site of the non-alcoholic fatty liver disease susceptibility gene based on multiple PCR flight time mass spectrometry.
In another preferred embodiment, the kit further comprises a single base extension primer set.
In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs738409 is shown as SEQ ID No.1 to SEQ ID No. 2.
In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs58542926 is shown as SEQ ID No.3 to SEQ ID No. 4.
In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs780094 is shown as SEQ ID No.5 to SEQ ID No. 6.
In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs641738 is shown as SEQ ID No.7 to SEQ ID No. 8.
In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs72613567 is shown as SEQ ID No.9 to SEQ ID No. 10.
In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs3480 is shown as SEQ ID No.11 to SEQ ID No. 12.
In another preferred example, in the PCR amplification primer pair group, the primer pair for specific amplification of rs7674434 is shown as SEQ ID No.13 to SEQ ID No. 14.
In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs12152703 is shown as SEQ ID No.15 to SEQ ID No. 16.
In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs5764455 is shown as SEQ ID No.17 to SEQ ID No. 18.
In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs6006473 is shown as SEQ ID No.19 to SEQ ID No. 20.
In another preferred example, in the single-base extension primer set, the extension primer for rs738409 is shown as SEQ ID No. 21.
In another preferred example, in the single-base extension primer set, the extension primer for rs58542926 is shown as SEQ ID No. 22.
In another preferred embodiment, in the single-base extension primer set, the extension primer for rs780094 is shown as SEQ ID No. 23.
In another preferred embodiment, in the single-base extension primer set, the extension primer for rs641738 is shown as SEQ ID NO. 24.
In another preferred example, in the single-base extension primer set, the extension primer for rs72613567 is shown as SEQ ID No. 25.
In another preferred embodiment, in the single base extension primer set, the extension primer for rs3480 is shown as SEQ ID NO. 26.
In another preferred embodiment, in the single-base extension primer set, the extension primer for rs7674434 is shown as SEQ ID NO. 27.
In another preferred embodiment, in the single-base extension primer set, the extension primer for rs12152703 is shown as SEQ ID NO. 28.
In another preferred embodiment, in the single-base extension primer set, the extension primer for rs5764455 is shown as SEQ ID NO. 29.
In another preferred embodiment, in the single base extension primer set, the extension primer for rs6006473 is shown as SEQ ID No. 30.
In another preferred embodiment, the kit comprises a first container, and the PCR amplification primer pair group is contained in the first container.
In another preferred embodiment, the kit comprises a second container, and the single-base extension primer set is contained in the second container.
In another preferred embodiment, the kit comprises a third container, wherein a PCR premix is contained in the third container, and the PCR premix mainly comprises hot-start Taq enzyme, dNTPs and MgCl2And PCR buffer solution.
In another preferred embodiment, the kit comprises a fourth container containing shrimp alkaline phosphatase (SAP Enzyme).
In another preferred embodiment, the kit comprises a fifth container, and the fifth container contains an SAP buffer solution.
In another preferred embodiment, the kit comprises a sixth container containing an elongase (iPLEX Enzyme) therein.
In another preferred embodiment, the kit comprises a seventh container comprising ddNTPs.
In another preferred embodiment, the kit comprises an eighth container containing an extension reaction buffer.
In another preferred example, the kit further comprises pure water.
In a second aspect of the invention, a method for detecting a non-alcoholic fatty liver disease susceptibility gene SNP gene mutation site based on multiple PCR flight time mass spectrometry is provided, which comprises the following steps:
(1) carrying out PCR amplification by taking the peripheral blood genome DNA of a sample to be detected as a template to obtain an amplification product;
(2) SAP treatment of the amplification product of step (1) with shrimp alkaline phosphatase;
(3) carrying out single base extension reaction on the purified product in the step (2) by using an extension primer to obtain an extension product;
(4) purifying the extension product with desalting resin;
(5) and (5) detecting and analyzing by a mass spectrum platform, and judging whether genetic variation exists.
In another preferred example, in the step (1), during the PCR amplification, SNP sites selected from the following group are specifically amplified: rs738409, rs58542926, rs780094, rs641738, rs72613567, rs3480, rs7674434, rs12152703, rs5764455 and rs 6006473.
In another preferred example, in the step (1), during the PCR amplification, the amplification primer pair group is used for PCR amplification.
In another preferred example, in the step (3), the single-base extension reaction is performed using the single-base extension primer set.
In the third aspect of the invention, the application of the PCR amplification primer pair group is provided, and the PCR amplification primer pair group is used for preparing a detection kit, wherein the detection kit is used for detecting the SNP gene mutation site of the non-alcoholic fatty liver disease susceptibility gene;
the primer pair group comprises primers with sequences shown as SEQ ID NO.1 to SEQ ID NO. 20.
In the fourth aspect of the invention, the application of the single base extension primer group is provided, and the single base extension primer group is used for preparing a detection kit, wherein the detection kit is used for detecting the SNP gene mutation site of the non-alcoholic fatty liver disease susceptibility gene;
the single-base extension primer group comprises extension primers with sequences shown as SEQ ID NO.21 to SEQ ID NO. 30.
It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.
Detailed Description
The invention provides a method and a kit for early screening of non-alcoholic fatty liver disease susceptibility genes, which screen out 10 SNP sites of the non-alcoholic fatty liver disease susceptibility related genes of Chinese people by comparing the difference of the non-alcoholic fatty liver disease gene profiles of Chinese people and European and American people, and further can utilize a nucleic acid mass spectrometer to carry out wide (high-throughput detection sites and high-throughput detection samples) screening and inspection on the genetic markers related to the non-alcoholic fatty liver disease. Through multi-round screening, a multiplex PCR amplification primer pair which can carry out high-efficiency multiplex amplification on the 10 SNP loci and is suitable for mass spectrometric detection of MassARRAY nucleic acid is obtained, and a suitable extension primer is obtained through screening, so that high-accuracy and high-sensitivity detection on the 10 SNP loci is realized, the detection result is stable, and the detection positive rate is improved.
The determination method of the application is used for detecting the SNP gene mutation site of the non-alcoholic fatty liver disease susceptibility gene based on the multiplex PCR technology and the Mass ARRAY nucleic acid Mass spectrum technology, and can simultaneously detect 10 sites.
Multiplex PCR (multiplex PCR), also called multiplex PCR or multiplex PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments, and the reaction principle, reaction reagents and operation process are the same as those of ordinary PCR.
There are many factors that affect multiplex PCR reactions, such as:
(1) the imbalance of the reaction system causes some dominant primers and templates thereof to be rapidly amplified in the previous rounds of reactions, and a large amount of amplification products are obtained, and the amplification products are good inhibitors of DNA polymerase. Therefore, the polymerization ability of polymerase is more and more strongly inhibited with the occurrence of a large amount of amplification products, and thus, primers and templates thereof which are at a disadvantage in the early stage are more difficult to react, and finally, the amount of amplification products is so small that they cannot be detected.
(2) The primer specificity, if the primer has stronger binding force with other non-target gene fragments in the system, the ability of the target gene to bind the primer is contended, thereby leading to the reduction of the amplification efficiency.
(3) The optimal annealing temperatures are different, a plurality of pairs of primers are placed in a system for amplification, and the optimal annealing temperatures of each pair of primers are required to be close to each other because the annealing temperatures for PCR reaction are the same.
(4) Primer dimers, including dimers between primers and hairpin structures formed by the primers themselves, are third-party DNA-mediated dimers, and these dimers, like non-specific primers, interfere with the competition between primers and target binding sites, affecting amplification efficiency.
Although several factors affecting amplification efficiency are mentioned above, more are not clear. To date, there is no effective method for clearly predicting amplification efficiency.
Although the multiplex PCR-time-of-flight mass spectrometry detection technology can carry out ultrahigh-flux detection, the requirement on the quality of a PCR amplification product is high. The inventor finds in research that the existing amplification primer and extension primer capable of carrying out detection by a multiplex fluorescence PCR method are directly applied to multiplex PCR-time-of-flight mass spectrometry, and have many defects, such as false negative of mass spectrometry caused by incapability of carrying out single base extension reaction, low sensitivity and poor repeatability, which are difficult to meet clinical application. Therefore, the inventor redesigns a plurality of pairs of amplification primers and extension primers aiming at each detection site, performs multiple combined detection verification under the condition that single-site detection can meet the requirement, and finally obtains a multiple PCR detection system and extension primers which have high sensitivity, good specificity and stable detection result and are suitable for flight time mass spectrometry detection through a large amount of test screening.
The invention adopts a multiplex PCR method to amplify a target sequence, artificially designs a plurality of pairs of primers, optimally selects and verifies the primers, and finally determines a nucleic acid detection kit which comprises the following amplification primers and is used for detecting 10 sites in total of SNP gene mutation sites of the non-alcoholic fatty liver disease susceptibility gene.
TABLE 1 amplification primers
Wherein, F is an upstream primer, and R is a downstream primer.
The extension primers are shown in table 2:
TABLE 2 extension primers
The primer sequences listed in tables 1 and 2 can be synthesized by conventional polynucleotide synthesis methods.
Besides the above-mentioned amplification primer and extension primer, the invention also provides a kit for detecting the SNP gene mutation site of the non-alcoholic fatty liver disease susceptibility gene, and the specific contents of the components in the detection kit are as follows:
TABLE 3 kit Components
The invention also provides a method for detecting the SNP gene mutation site of the non-alcoholic fatty liver disease susceptibility gene based on the multiple PCR flight time mass spectrum, which comprises the following steps:
(1) carrying out PCR amplification by taking the peripheral blood genome DNA of a sample to be detected as a template to obtain an amplification product;
(2) SAP treatment of the amplification product of step (1) with shrimp alkaline phosphatase;
(3) carrying out single base extension reaction on the purified product in the step (2) by using an extension primer to obtain an extension product;
(4) purifying the extension product with desalting resin;
(5) and (5) detecting and analyzing by a mass spectrum platform, and judging whether genetic variation exists.
Further, in the step (1), during the PCR amplification process, SNP sites selected from the following group are specifically amplified: rs738409, rs58542926, rs780094, rs641738, rs72613567, rs3480, rs7674434, rs12152703, rs5764455 and rs 6006473.
Further, in the step (1), in the PCR amplification process, the amplification primer pair group is used for PCR amplification.
Further, in the step (3), a single base extension reaction is performed using the extension primer set.
Further, the amplification conditions of step (1) are as follows: 95 deg.C for 3 min; 95 deg.C, 15s, 55 deg.C, 15s, 72 deg.C, 1min, 45 cycles; keeping at 72 deg.C for 5 min.
Further, the SAP treatment conditions of the step (2) are as follows: 57 ℃ for 40min and 65 ℃ for 5 min.
Further, the conditions of the extension reaction of step (3) are as follows: 95 ℃ for 30 s; 95 ℃, 5s, (51 ℃, 5s, 72 ℃, 5s, 5 cycles), 35 cycles; keeping at 72 deg.C for 5 min.
The main advantages of the invention are:
the nucleic acid mass spectrum early screening method of the non-alcoholic fatty liver disease susceptibility gene provided by the invention considers the difference of non-alcoholic fatty liver disease gene spectrums of Chinese people and European and American people, the detected susceptibility gene is more advanced, and a plurality of non-alcoholic fatty liver disease susceptibility SNP sites are brought into the early screening method, and the sites have high detection success rate, good technical reproducibility and high cost performance;
the detection technology provided by the invention has obvious price advantage, and overcomes the disadvantages of high price, long time consumption, complicated operation and the like of the traditional single-base detection. The sensitivity in the aspect of early screening detection of the non-alcoholic fatty liver disease susceptibility gene is higher, the flux is larger, the detection of multiple genes of a single small sample can be realized, and the maximized use of the small sample is met.
The nucleic acid mass spectrometry method for detecting the non-alcoholic fatty liver disease susceptibility gene early screen based on the MassARRAY nucleic acid mass spectrometry technology has the technical advantages of high accuracy and high sensitivity, is stable in detection result, has obvious advantages compared with Sanger sequencing, and improves the detection positive rate.
The present invention will be described in further detail with reference to the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures for conditions not specified in detail in the following examples are generally carried out under conventional conditions such as those described in molecular cloning, A laboratory Manual (Huang Petang et al, Beijing: scientific Press, 2002) by Sambrook. J, USA, or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.
Example 1
Feasibility analysis of SNP site screening of human non-alcoholic fatty liver disease susceptibility related gene
The non-alcoholic fatty liver disease occurrence related sites verified in large-scale pathology control group clinical research by searching NCBI (national and international genome association analysis, GWAS) are screened and evaluated by the inventor, 10 single nucleotide polymorphism sites which are obviously related to the risk of the Chinese population suffering from the non-alcoholic fatty liver disease are selected, and are independent of each other and do not have linkage disequilibrium, so that the site selection provided by the invention has representativeness, independence and risk value accumulativeness, and can be used for evaluating the risk of individuals suffering from the non-alcoholic fatty liver disease.
The selected SNP sites are as follows:
rs738409、rs58542926、rs780094、rs641738、rs72613567、rs3480、rs7674434、rs12152703、rs5764455、rs6006473。
example 2 system verification
The system verification comprises accuracy, specificity, sensitivity, precision, inter-personnel comparison and the like.
An accuracy verification scheme: 20 sites were tested and compared to Sanger sequencing, the expected target was 95%.
Specificity verification scheme: included in the accuracy is the expected target of 95%.
Sensitive verification protocol: the positive sample of human genome DNA is taken as a template, and the content of the labeled sample DNA is 1 ng/muL, 5 ng/muL, 10 ng/muL, 50 ng/muL and 100 ng/muL respectively for sensitivity investigation.
Precision validation protocol (including intra-batch, inter-batch, personnel comparisons, not involving inter-instrument comparisons) expected target 95%.
Internal precision: the same batch was repeated 3 times for each sample and the intra-batch precision was compared.
Batch precision: the same operator examines the same samples in multiple batches and compares the batch-to-batch precision.
The personnel alignment: 2 operators tested the same samples and compared the differences in results between the individuals.
The specific test steps are as follows:
1. DNA extraction: human peripheral blood genomic DNA (50 mu LddH) was prepared according to the procedures provided in the instruction manual of a blood DNA extraction kit (commercially available kit for rapid and efficient extraction of genomic DNA) independently developed by southern medicine2Eluting with oxygen;
2. PCR procedure
(1) Samples were diluted to 20 ng/. mu.L;
(2) the following table was used to prepare a PCR reaction system (hereinafter, a single sample amount, 40ng of sample DNA in total)
TABLE 4 PCR reaction System
| Reagent | W1(μL) | W2(μL) |
| Water, ddH2O | 0.8 | 0.8 |
| 10PCR Buffer with 20mM | 0.5 | 0.5 |
| 25mM MgCl2 | 0.4 | 0.4 |
| 25mM dNTP mixture | 0.1 | 0.1 |
| 25 mu M amplification primer mixture | 1 | 1 |
| 5U/. mu.L PCR Taq enzyme | 0.2 | 0.2 |
| 20ng/μL DNA | 2 | 2 |
| Total volume | 5.00 | 5.00 |
(3) Sealing the membrane, mixing with vortex for 30 seconds, and centrifuging at 500g for 1 minute;
(4) place the plate on a PCR instrument for the following thermal cycling:
95 ℃ for 3 minutes
45 cycles:
(95 ℃ for 15 seconds)
55 ℃ for 15 seconds
72 ℃ for 1 minute
5 minutes at 72 DEG C
Keeping the temperature at 4 DEG C
2. SAP flow scheme
(1) Taking out the PCR plate, and centrifuging for 3 minutes at 500 g;
(2) SAP reaction systems (individual sample amounts below) were formulated as follows;
TABLE 5 SAP reaction System
| Reagent | Per well sample (μ L) | ×2 |
| ddH2O | 1.53 | 3.06 |
| SAP buffer | 0.17 | 0.34 |
| SAP enzyme (1.7U/. mu.L) | 0.3 | 0.6 |
| Total volume | 2.00 | 4.00 |
(3) Adding 2 mu L of SAP mixed solution into each hole;
(4) sealing the membrane, mixing with vortex for 30 seconds, and centrifuging at 500g for 1 minute;
(5) place the plate on a PCR instrument for the following thermal cycling:
40 minutes at 57 DEG C
5 minutes at 65 DEG C
Keeping the temperature at 4 DEG C
3. EXT (Single base extension) protocol
(1) Taking out the PCR plate, and centrifuging for 3 minutes at 500 g;
(2) the following table was followed to formulate the EXT reaction system (individual sample amounts below);
TABLE 6 EXT reaction System
| Reagent | W1(μL) | W2(μL) |
| ddH2O | 0.62 | 0.62 |
| iPLEX buffer solution | 0.2 | 0.2 |
| ddNTP mixed liquor | 0.2 | 0.2 |
| Extension primer mixture | 0.94 | 0.94 |
| iPLEX enzyme | 0.04 | 0.04 |
| Total volume | 2.00 | 2.00 |
(3) Adding 2 mu L of iPLEX extension mixed solution;
(4) sealing the membrane, mixing with vortex for 30 seconds, and centrifuging at 500g for 1 minute;
(5) place the plate on a PCR instrument for the following thermal cycling:
95℃30s
35 cycles:
(95℃、5s
5 cycles:
(51℃5s
72℃5s))
72℃5min
keeping the temperature at 4 DEG C
4. Resin desalination
Taking out the PCR plate, and centrifuging for 3 minutes at 500 g; spreading clean Resin (Resin) on the sample plate hole, and air-drying for at least 10 min; adding 10uL of water into each hole with the sample in the sample plate; plate closed, vortex 10 seconds, 500g centrifugation for 1 minute; slightly inverting the sample plate in a volley manner, placing the sample plate on the sample plate with the resin, and then inverting the sample plate together with the sample plate (the two quick plates cannot move horizontally in the process) to allow the resin to fall into the holes; taking down the sample plate, sealing the sample plate, and shaking up for 3 minutes with the rotator upside down; centrifuge at 2000g for 5 minutes.
5. Dispensing spotting
MALDI-TOF (matrix assisted laser Desorption ionization-time of flight) mass spectrometer was used to obtain a clustering plot (clear homopolymeric) of each site of the data.
And (3) test results: the accuracy verification results of 1 sample are shown in table 7.
TABLE 7 accuracy verification (comparison of first generation sequencing with MassARRAY results)
The site rs12152703 of this sample is taken as an example, and the results of the precision verification are shown in Table 5.
TABLE 8 verification of accuracy of rs12152703 locus
| Repetition of 1 | Repetition 2 | Repetition of 3 | |
| Batch 1 | GG | GG | GG |
| Batch 2 | GG | GG | GG |
| Batch 3 | GG | GG | GG |
| Batch 4 | GG | GG | GG |
| Batch 5 | GG | GG | GG |
On the whole, all the sites of the method are clustered clearly, basically have no gray areas, and the false detection is possibly small. The accuracy (including sensitivity and specificity) and precision of each site detection of the present application were verified and are shown in table 9.
TABLE 9 verification results of accuracy, sensitivity, specificity
| SNP_ID | Accuracy of | Sensitivity of the probe | Specificity of | Precision in batch | Inter-batch precision | Comparison of persons |
| rs738409 | 100％ | 5ng/μL | 100％ | 100％ | 100％ | 100％ |
| rs58542926 | 100％ | 5ng/μL | 100％ | 100％ | 100％ | 100％ |
| rs780094 | 100％ | 5ng/μL | 100％ | 100％ | 100％ | 100％ |
| rs641738 | 100％ | 5ng/μL | 100％ | 100％ | 100％ | 100％ |
| rs72613567 | 100％ | 5ng/μL | 100％ | 100％ | 100％ | 100％ |
| rs3480 | 100％ | 5ng/μL | 100％ | 100％ | 100％ | 100％ |
| rs7674434 | 100％ | 5ng/μL | 100％ | 100％ | 100％ | 100％ |
| rs12152703 | 100％ | 5ng/μL | 100％ | 100％ | 100％ | 100％ |
| rs5764455 | 100％ | 5ng/μL | 100％ | 100％ | 100％ | 100％ |
| rs6006473 | 100％ | 5ng/μL | 100％ | 100％ | 100％ | 100％ |
In the above table, the accuracy of 100% indicates that all positive samples were correctly detected and consistent with Sanger sequencing results; the specificity of 100 percent indicates that no false positive result appears in the detected sample; the batch precision is 100%, which indicates that the repeated detection results of the same batch of samples can be kept consistent; the batch precision is 100 percent, which indicates that the detection results of the same operator for detecting the same sample in multiple batches can be kept consistent; the personnel comparison of 100 percent shows that the detection results of 2 operators detecting the same sample can be kept consistent.
In conclusion, the nucleic acid mass spectrum early screening method of the non-alcoholic fatty liver disease susceptibility gene provided by the invention considers the difference of non-alcoholic fatty liver disease gene spectrums of Chinese people and European and American people, the detected susceptibility gene is advanced, a plurality of non-alcoholic fatty liver disease susceptibility SNP loci are included, and the loci have high detection success rate, good technical reproducibility and high cost performance.
Comparative example 1 screening of PCR amplification primer set and extension primer
Aiming at each site, the inventor designs several to ten pairs of amplification primers and extension primers, and then verifies and optimizes the amplification primers and the extension primers to finally establish a multiplex PCR amplification primer and extension primer combination which can be used for MassARRAY nucleic acid mass spectrometry technology detection.
In this comparative example, the rs738409 site was taken as an example, and an amplification primer and an extension primer having partially unsatisfactory effects were exemplified.
Control primer pair 1:
F-1：ACGTTGGATGTCCGAGGGTGTATGTTAGTT(SEQ ID NO.:31)
R-1：ACGTTGGATGTCTGAAAGGCAGTGAGGC(SEQ ID NO.:32)
control primer pair 2:
F-2：ACGTTGGATGCTGAAGTCCGAGGGTGTA(SEQ ID NO.:1)
R-2：ACGTTGGATGCGGGTAGCCTGGAAATAG(SEQ ID NO.:33)
control primer pair 3:
F-3：ACGTTGGATGGAAGTCCGAGGGTGTATG(SEQ ID NO.:34)
R-3：ACGTTGGATGAAGGAAGGAGGGATAAGG(SEQ ID NO.:35)
control extension primer 1:
Y-1：TTGGTATGTTCCTGCTTCAT(SEQ ID NO.:36)
control extension primer 2:
Y-2：GGTATGTTCCTGCTTCAT(SEQ ID NO.:37)
the primer pair of the invention comprises: SEQ ID NO.1 and 2
The invention extends primer: SEQ ID NO.21
In the single-fold screening experiment, different extension primers are used for single base extension after single-fold PCR amplification, and then mass spectrometry detection is carried out on extension products, and the result of the single-fold detection shows that the control primer pair 1 can normally work in the single-fold system, but can not obtain a positive result in the multiple system.
In the multiplex system, the detection sensitivity of the combination of the control primer pairs 2 and 3 and the control extension primer 1 is respectively 50 ng/muL and 10 ng/muL; the detection sensitivity of the combination of the control primer pairs 2 and 3 and the control extension primer 2 is respectively 10 ng/mu L and 10 ng/mu L; the detection sensitivity of the control primer pairs 2 and 3 respectively combined with the extension primer shown in SEQ ID NO.21 can reach 10 ng/muL and 10 ng/muL. And the combination of the primer pair shown in SEQ ID NO.1 and 2 and the extension primer shown in SEQ ID NO.21 can reach the detection sensitivity of 5 ng/muL.
The result shows that the control primer pair 1 can not effectively amplify the target nucleic acid sequence in the multiple detection system, so that the control primer pair can not normally work in the multiple detection system; control primer pairs 2 and 3 work well in multiplex detection systems, but are less sensitive. The combination of the primer pair (SEQ ID NO.1 and 2) and the extension primer (SEQ ID NO.21) can normally work in a multiple detection system, and the sensitivity is high and reaches 5 ng/muL.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Beijing Kelidandi biomedical science and technology Co., Ltd
Early screening method and kit for <120> non-alcoholic fatty liver disease susceptibility gene
<130> P210097
<160> 37
<170> PatentIn version 3.5
<210> 1
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
acgttggatg ctgaagtccg agggtgta 28
<210> 2
<211> 27
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
acgttggatg ctgaaaggca gtgaggc 27
<210> 3
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
acgttggatg ttcaggcaca ttgggaca 28
<210> 4
<211> 29
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
acgttggatg ctgggtgaca gagcaagac 29
<210> 5
<211> 27
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
acgttggatg atgttggcta ggcttgt 27
<210> 6
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
acgttggatg ggtgacttat tctgctcc 28
<210> 7
<211> 29
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
acgttggatg gactcccacc tagcctgaa 29
<210> 8
<211> 27
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
acgttggatg ggccctgaga aaccaca 27
<210> 9
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
acgttggatg tttgggtgtt ctgtgc 26
<210> 10
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
acgttggatg tcctgccatc atttac 26
<210> 11
<211> 27
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
acgttggatg ttgggcaaag cagagtg 27
<210> 12
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
acgttggatg ccattggtgg tcaaggat 28
<210> 13
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
acgttggatg gtgaaggact gagaca 26
<210> 14
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 14
acgttggatg tttggctttg atact 25
<210> 15
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 15
acgttggatg gtagggaagc tgagaa 26
<210> 16
<211> 27
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 16
acgttggatg aaacaatgta aggagga 27
<210> 17
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 17
acgttggatg tgggtgttgg tggagg 26
<210> 18
<211> 27
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 18
acgttggatg caggaaggca cgactga 27
<210> 19
<211> 27
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 19
acgttggatg ccctcttgcc tcctctg 27
<210> 20
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 20
acgttggatg aatgtcccgc actccc 26
<210> 21
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 21
tggtatgttc ctgcttcat 19
<210> 22
<211> 15
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 22
aggcaggcct gatct 15
<210> 23
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 23
acaaatgtat tgatcagcaa a 21
<210> 24
<211> 15
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 24
cggggggcca gccac 15
<210> 25
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 25
tgggtgttct gtgctgtact 20
<210> 26
<211> 15
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 26
gaaggggcgg tcatt 15
<210> 27
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 27
caaagctgat gagtgaatta 20
<210> 28
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 28
ggatctttta gtatttgggg 20
<210> 29
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 29
tggctgtaca caggagaac 19
<210> 30
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 30
gctgtctttg aaggaccc 18
<210> 31
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 31
acgttggatg tccgagggtg tatgttagtt 30
<210> 32
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 32
acgttggatg tctgaaaggc agtgaggc 28
<210> 33
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 33
acgttggatg cgggtagcct ggaaatag 28
<210> 34
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 34
acgttggatg gaagtccgag ggtgtatg 28
<210> 35
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 35
acgttggatg aaggaaggag ggataagg 28
<210> 36
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 36
ttggtatgtt cctgcttcat 20
<210> 37
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 37
ggtatgttcc tgcttcat 18
Claims (10)
1. The early screening kit for the non-alcoholic fatty liver disease susceptibility gene is characterized by comprising a PCR amplification primer pair group, wherein the PCR amplification primer pair group comprises a primer pair for specifically amplifying SNP loci selected from the following groups: rs738409, rs58542926, rs780094, rs641738, rs72613567, rs3480, rs7674434, rs12152703, rs5764455 and rs 6006473.
2. The kit of claim 1, further comprising a single base extension primer set.
3. The kit of claim 1, wherein the PCR amplification primer pair set comprises:
the primer pair for specifically amplifying rs738409 is shown as SEQ ID NO.1 to SEQ ID NO. 2;
the primer pair for specifically amplifying rs58542926 is shown in SEQ ID NO.3 to SEQ ID NO. 4;
the primer pair for specific amplification of rs780094 is shown as SEQ ID NO.5 to SEQ ID NO. 6;
the primer pair for specific amplification of rs641738 is shown as SEQ ID NO.7 to SEQ ID NO. 8;
the primer pair for specifically amplifying rs72613567 is shown as SEQ ID NO.9 to SEQ ID NO. 10;
the primer pair for specifically amplifying rs3480 is shown as SEQ ID NO.11 to SEQ ID NO. 12;
the primer pair for specific amplification of rs7674434 is shown as SEQ ID NO.13 to SEQ ID NO. 14;
the primer pair for specifically amplifying rs12152703 is shown as SEQ ID NO.15 to SEQ ID NO. 16;
the primer pair for specific amplification of rs5764455 is shown in SEQ ID NO.17 to SEQ ID NO. 18; and/or
The primer pair for specifically amplifying rs6006473 is shown in SEQ ID NO.19 to SEQ ID NO. 20.
4. The kit of claim 2, wherein in the set of single base extension primers:
the extension primer aiming at rs738409 is shown as SEQ ID NO. 21;
the extension primer aiming at rs58542926 is shown as SEQ ID NO. 22;
the extension primer aiming at rs780094 is shown as SEQ ID NO. 23;
the extension primer aiming at rs641738 is shown as SEQ ID NO. 24;
the extension primer aiming at rs72613567 is shown as SEQ ID NO. 25;
the extension primer aiming at rs3480 is shown as SEQ ID NO. 26;
the extension primer aiming at rs7674434 is shown as SEQ ID NO. 27;
the extension primer aiming at rs12152703 is shown as SEQ ID NO. 28;
the extension primer aiming at rs5764455 is shown as SEQ ID NO. 29; and/or
The extension primer aiming at rs6006473 is shown as SEQ ID NO. 30.
5. The kit of claim 2, wherein the kit comprises a first container containing the PCR amplification primer pair set; and/or
The kit comprises a second container, and the single-base extension primer group is contained in the second container.
6. A method for detecting a non-alcoholic fatty liver disease susceptibility gene SNP gene mutation site based on multiple PCR flight time mass spectrometry is characterized by comprising the following steps:
(1) carrying out PCR amplification by taking the peripheral blood genome DNA of a sample to be detected as a template to obtain an amplification product;
(2) SAP treatment of the amplification product of step (1) with shrimp alkaline phosphatase;
(3) carrying out single base extension reaction on the purified product in the step (2) by using an extension primer to obtain an extension product;
(4) purifying the extension product with desalting resin;
(5) and (5) detecting and analyzing by a mass spectrum platform, and judging whether genetic variation exists.
7. The method according to claim 6, wherein in the step (1), the SNP sites selected from the group consisting of: rs738409, rs58542926, rs780094, rs641738, rs72613567, rs3480, rs7674434, rs12152703, rs5764455 and rs 6006473.
8. The method according to claim 6, wherein in the step (1), the amplification primer pair group is used for PCR amplification during PCR amplification; and/or
In the step (3), a single-base extension reaction is performed using the single-base extension primer set.
The application of the PCR amplification primer pair group is characterized in that the application is used for preparing a detection kit, and the detection kit is used for detecting the SNP gene mutation site of the non-alcoholic fatty liver disease susceptibility gene;
the primer pair group comprises primers with sequences shown as SEQ ID NO.1 to SEQ ID NO. 20.
10. The application of the single base extension primer group is characterized in that the single base extension primer group is used for preparing a detection kit, and the detection kit is used for detecting the SNP gene mutation site of the non-alcoholic fatty liver disease susceptibility gene;
the single-base extension primer group comprises extension primers with sequences shown as SEQ ID NO.21 to SEQ ID NO. 30.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110261815.5A CN113025701B (en) | 2021-03-10 | 2021-03-10 | Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110261815.5A CN113025701B (en) | 2021-03-10 | 2021-03-10 | Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113025701A true CN113025701A (en) | 2021-06-25 |
| CN113025701B CN113025701B (en) | 2022-11-08 |
Family
ID=76469231
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110261815.5A Active CN113025701B (en) | 2021-03-10 | 2021-03-10 | Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113025701B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109628564A (en) * | 2019-02-25 | 2019-04-16 | 北京市理化分析测试中心 | A method of for detecting the primer sets of SNP polymorphism and detecting SNP polymorphism using primer sets |
| CN114262738A (en) * | 2021-12-31 | 2022-04-01 | 吉林大学第一医院 | Application of HSD17B13 gene polymorphism in diagnosis of moderate and severe MAFLD (myeloproliferative disorder) |
| CN114317715A (en) * | 2021-12-31 | 2022-04-12 | 吉林大学第一医院 | Application of SNP marker of MBOAT7 in diagnosis of non-obese MAFLD |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039513A (en) * | 2015-05-29 | 2015-11-11 | 广州市第一人民医院 | Method and primer for detection of non-alcoholic fatty liver disease-correlated target gene polymorphism, as well as kit |
| CN109929926A (en) * | 2019-03-21 | 2019-06-25 | 青岛市市立医院 | A kind of method of gene pleiomorphism prediction nonalcoholic fatty liver occurrence risk |
| CN110079597A (en) * | 2019-05-29 | 2019-08-02 | 阿吉安(福州)基因医学检验实验室有限公司 | The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver |
-
2021
- 2021-03-10 CN CN202110261815.5A patent/CN113025701B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039513A (en) * | 2015-05-29 | 2015-11-11 | 广州市第一人民医院 | Method and primer for detection of non-alcoholic fatty liver disease-correlated target gene polymorphism, as well as kit |
| CN109929926A (en) * | 2019-03-21 | 2019-06-25 | 青岛市市立医院 | A kind of method of gene pleiomorphism prediction nonalcoholic fatty liver occurrence risk |
| CN110079597A (en) * | 2019-05-29 | 2019-08-02 | 阿吉安(福州)基因医学检验实验室有限公司 | The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver |
Non-Patent Citations (3)
| Title |
|---|
| FANG JI等: "KLB gene polymorphism is associated with obesity and non-alcoholic fatty liver disease in the Han Chinese", 《AGING (ALBANY NY)》 * |
| GANG WU等: "Association of rs5764455 and rs6006473 polymorphisms in PARVB with liver damage of nonalcoholic fatty liver disease in Han Chinese population", 《GENE》 * |
| 吴瑞红等: "非酒精性脂肪性肝病无创诊断研究进展", 《药学进展》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109628564A (en) * | 2019-02-25 | 2019-04-16 | 北京市理化分析测试中心 | A method of for detecting the primer sets of SNP polymorphism and detecting SNP polymorphism using primer sets |
| CN109628564B (en) * | 2019-02-25 | 2022-02-01 | 北京市理化分析测试中心 | Primer set for detecting SNP polymorphism and method for detecting SNP polymorphism by using primer set |
| CN114262738A (en) * | 2021-12-31 | 2022-04-01 | 吉林大学第一医院 | Application of HSD17B13 gene polymorphism in diagnosis of moderate and severe MAFLD (myeloproliferative disorder) |
| CN114317715A (en) * | 2021-12-31 | 2022-04-12 | 吉林大学第一医院 | Application of SNP marker of MBOAT7 in diagnosis of non-obese MAFLD |
| CN114317715B (en) * | 2021-12-31 | 2022-10-25 | 吉林大学第一医院 | Application of SNP marker of MBOAT7 in diagnosis of non-obese MAFLD |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113025701B (en) | 2022-11-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113025701B (en) | Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene | |
| CN108977499A (en) | A kind of detection method and kit of mankind's alcohol metabolism ability gene mutation site | |
| CN106987640A (en) | PIK3CA detection in Gene Mutation primed probe and its kit | |
| WO2016192252A1 (en) | Systemic lupus erythematosus biomarker and diagnostic kit thereof | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| CN110846409A (en) | Primer combination for detecting TNNI3K gene mutation and application thereof | |
| CN110592217A (en) | Kit for detecting KRAS gene mutation in free DNA of peripheral blood and application thereof | |
| CN111057755A (en) | Cardiovascular and cerebrovascular disease genetic risk assessment detection panel and application thereof | |
| CN113025702B (en) | Early screening method and kit for ankylosing spondylitis susceptibility genes | |
| CN112592972B (en) | Early screening method and kit for diffuse toxic goiter susceptibility genes | |
| CN112280849A (en) | Composite amplification system and kit for anti-depression individualized medication genotyping detection | |
| CN109355377B (en) | Warfarin individualized medication related gene polymorphism detection kit and preparation method and application thereof | |
| CN111944912A (en) | Skin gene detection method | |
| CN107022621A (en) | BRAF gene mutation detection primer probe and its kit | |
| CN112553325A (en) | Guiding method and kit for sufentanil personalized medicine gene | |
| CN112501283A (en) | Guiding method and kit for carbamazepine personalized medicine gene | |
| EP3625370A1 (en) | Composite epigenetic biomarkers for accurate screening, diagnosis and prognosis of colorectal cancer | |
| CN112831558B (en) | Early screening method and kit for Crohn disease susceptibility genes | |
| CN114672548A (en) | Human venous thrombosis risk gene polymorphism detection kit, process and application | |
| CN114196740A (en) | Digital amplification detection method, detection product and detection kit for simultaneously identifying multiple gene types | |
| CN112779322A (en) | Gene mutation detection kit based on non-fluorescence labeled probe and high-resolution melting curve, detection method and application thereof | |
| CN112646869B (en) | Guidance method and kit for atorvastatin personalized medicine genes | |
| CN111690736A (en) | Warfarin medication gene detection kit and use method thereof | |
| CN105969874B (en) | Primer for detecting KRAS gene mutation in microcomponent combines and its application | |
| CN112695094A (en) | Guiding method and kit for epirubicin individualized medication gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |