CN113004403A - Preparation method of allergen-specific IgE antibody composite quality control product and allergen-specific IgE antibody composite quality control product - Google Patents
Preparation method of allergen-specific IgE antibody composite quality control product and allergen-specific IgE antibody composite quality control product Download PDFInfo
- Publication number
- CN113004403A CN113004403A CN202110383916.XA CN202110383916A CN113004403A CN 113004403 A CN113004403 A CN 113004403A CN 202110383916 A CN202110383916 A CN 202110383916A CN 113004403 A CN113004403 A CN 113004403A
- Authority
- CN
- China
- Prior art keywords
- allergen
- ige antibody
- ige
- primer
- quality control
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000013566 allergen Substances 0.000 title claims abstract description 82
- 238000003908 quality control method Methods 0.000 title claims abstract description 36
- 239000002131 composite material Substances 0.000 title claims abstract description 22
- 238000002360 preparation method Methods 0.000 title claims abstract description 16
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 78
- 108010076504 Protein Sorting Signals Proteins 0.000 claims abstract description 28
- 241000282414 Homo sapiens Species 0.000 claims abstract description 26
- 238000005520 cutting process Methods 0.000 claims abstract description 21
- 239000012634 fragment Substances 0.000 claims abstract description 18
- 108090000790 Enzymes Proteins 0.000 claims abstract description 16
- 102000004190 Enzymes Human genes 0.000 claims abstract description 16
- 239000013604 expression vector Substances 0.000 claims abstract description 13
- 238000010367 cloning Methods 0.000 claims abstract description 12
- 238000012216 screening Methods 0.000 claims abstract description 9
- 239000013598 vector Substances 0.000 claims abstract description 9
- 238000003259 recombinant expression Methods 0.000 claims abstract description 7
- 238000000034 method Methods 0.000 claims description 15
- 239000002773 nucleotide Substances 0.000 claims description 14
- 125000003729 nucleotide group Chemical group 0.000 claims description 14
- 239000013612 plasmid Substances 0.000 claims description 14
- 238000011144 upstream manufacturing Methods 0.000 claims description 11
- 210000002966 serum Anatomy 0.000 claims description 9
- 108091008146 restriction endonucleases Proteins 0.000 claims description 7
- 238000001976 enzyme digestion Methods 0.000 claims description 5
- 230000003321 amplification Effects 0.000 claims description 4
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 4
- 102000004961 Furin Human genes 0.000 claims description 3
- 108090001126 Furin Proteins 0.000 claims description 3
- 150000001413 amino acids Chemical class 0.000 claims description 2
- 238000004458 analytical method Methods 0.000 claims description 2
- 238000003776 cleavage reaction Methods 0.000 claims description 2
- 230000000977 initiatory effect Effects 0.000 claims description 2
- 108020004707 nucleic acids Proteins 0.000 claims description 2
- 102000039446 nucleic acids Human genes 0.000 claims description 2
- 150000007523 nucleic acids Chemical class 0.000 claims description 2
- 238000010839 reverse transcription Methods 0.000 claims description 2
- 230000007017 scission Effects 0.000 claims description 2
- 238000012163 sequencing technique Methods 0.000 claims description 2
- 238000001890 transfection Methods 0.000 claims description 2
- 230000001131 transforming effect Effects 0.000 claims description 2
- 238000001261 affinity purification Methods 0.000 claims 2
- 241000894006 Bacteria Species 0.000 claims 1
- 238000010790 dilution Methods 0.000 abstract description 5
- 239000012895 dilution Substances 0.000 abstract description 5
- 238000004519 manufacturing process Methods 0.000 abstract description 3
- 238000012356 Product development Methods 0.000 abstract description 2
- 238000012795 verification Methods 0.000 abstract description 2
- 239000000047 product Substances 0.000 description 25
- 102000004169 proteins and genes Human genes 0.000 description 9
- 241000238557 Decapoda Species 0.000 description 7
- 244000105624 Arachis hypogaea Species 0.000 description 6
- PEDCQBHIVMGVHV-UHFFFAOYSA-N Glycerine Chemical compound OCC(O)CO PEDCQBHIVMGVHV-UHFFFAOYSA-N 0.000 description 6
- 229960004784 allergens Drugs 0.000 description 6
- 210000004027 cell Anatomy 0.000 description 6
- 235000020232 peanut Nutrition 0.000 description 6
- 108020004414 DNA Proteins 0.000 description 5
- 239000012148 binding buffer Substances 0.000 description 5
- 238000001514 detection method Methods 0.000 description 5
- DHMQDGOQFOQNFH-UHFFFAOYSA-N Glycine Chemical compound NCC(O)=O DHMQDGOQFOQNFH-UHFFFAOYSA-N 0.000 description 4
- 208000026935 allergic disease Diseases 0.000 description 4
- 239000000243 solution Substances 0.000 description 4
- 235000017060 Arachis glabrata Nutrition 0.000 description 3
- 235000010777 Arachis hypogaea Nutrition 0.000 description 3
- 235000018262 Arachis monticola Nutrition 0.000 description 3
- 238000001042 affinity chromatography Methods 0.000 description 3
- 239000010836 blood and blood product Substances 0.000 description 3
- 229940125691 blood product Drugs 0.000 description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 3
- 238000001962 electrophoresis Methods 0.000 description 3
- 108090000765 processed proteins & peptides Proteins 0.000 description 3
- 206010002198 Anaphylactic reaction Diseases 0.000 description 2
- 239000004471 Glycine Substances 0.000 description 2
- 206010020751 Hypersensitivity Diseases 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 230000007815 allergy Effects 0.000 description 2
- 208000003455 anaphylaxis Diseases 0.000 description 2
- 238000004587 chromatography analysis Methods 0.000 description 2
- 238000003745 diagnosis Methods 0.000 description 2
- 239000003480 eluent Substances 0.000 description 2
- 239000006249 magnetic particle Substances 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 239000012452 mother liquor Substances 0.000 description 2
- 238000001556 precipitation Methods 0.000 description 2
- 238000005185 salting out Methods 0.000 description 2
- 239000012096 transfection reagent Substances 0.000 description 2
- 241000238876 Acari Species 0.000 description 1
- 241000251468 Actinopterygii Species 0.000 description 1
- 241001674044 Blattodea Species 0.000 description 1
- 238000002965 ELISA Methods 0.000 description 1
- 241000588724 Escherichia coli Species 0.000 description 1
- 102000008946 Fibrinogen Human genes 0.000 description 1
- 108010049003 Fibrinogen Proteins 0.000 description 1
- 244000068988 Glycine max Species 0.000 description 1
- 235000010469 Glycine max Nutrition 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 244000000231 Sesamum indicum Species 0.000 description 1
- 235000003434 Sesamum indicum Nutrition 0.000 description 1
- 108010090804 Streptavidin Proteins 0.000 description 1
- 235000021307 Triticum Nutrition 0.000 description 1
- 241000209140 Triticum Species 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 230000004520 agglutination Effects 0.000 description 1
- 125000000539 amino acid group Chemical group 0.000 description 1
- 235000015278 beef Nutrition 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 238000004113 cell culture Methods 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 239000012228 culture supernatant Substances 0.000 description 1
- 210000004748 cultured cell Anatomy 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 238000003113 dilution method Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 235000013601 eggs Nutrition 0.000 description 1
- 230000002255 enzymatic effect Effects 0.000 description 1
- 229940012952 fibrinogen Drugs 0.000 description 1
- 238000001914 filtration Methods 0.000 description 1
- 235000019688 fish Nutrition 0.000 description 1
- 239000013568 food allergen Substances 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 229940046528 grass pollen Drugs 0.000 description 1
- 230000008105 immune reaction Effects 0.000 description 1
- 238000003018 immunoassay Methods 0.000 description 1
- 239000012535 impurity Substances 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 230000014759 maintenance of location Effects 0.000 description 1
- 235000013336 milk Nutrition 0.000 description 1
- 239000008267 milk Substances 0.000 description 1
- 210000004080 milk Anatomy 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 235000014571 nuts Nutrition 0.000 description 1
- 230000008520 organization Effects 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 238000012827 research and development Methods 0.000 description 1
- 239000006152 selective media Substances 0.000 description 1
- 239000011550 stock solution Substances 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
- 239000002699 waste material Substances 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/16—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/96—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving blood or serum control standard
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/24—Immunology or allergic disorders
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Hematology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Food Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Botany (AREA)
- Plant Pathology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a preparation method of an allergen specificity IgE antibody composite quality control product and the allergen specificity IgE antibody composite quality control product, wherein the preparation method specifically comprises the following steps: preparing an allergen-specific IgE antibody; obtaining a target gene, and obtaining a constant region gene sequence and a variable region gene sequence of human IgE; designing a primer containing an Xho I enzyme cutting site according to a gene sequence of a heavy chain constant region of human IgE, designing a primer containing a Hind III enzyme cutting site according to a gene sequence of a light chain constant region of human IgE, and constructing an expression empty vector containing a light chain signal peptide, a heavy chain C region gene fragment and a light chain C region gene fragment of human IgE; constructing recombinant expression vectors of different allergens; transfecting a cell; cloning, identifying and screening; the quality control product has high titer, high purity, good dilution linearity and good stability, and has high use value in the aspects of quality control, conventional quality control, performance verification and product development of mass production.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a preparation method of an allergen-specific IgE antibody composite quality control product and the allergen-specific IgE antibody composite quality control product prepared by the method.
Background
The type I anaphylactic reaction diseases are quite common, the total morbidity of people is as high as 10-30%, the type I anaphylactic reaction diseases are major hygiene problems in the world at present and are listed as one of three major diseases mainly controlled in the twenty-first century by the World Health Organization (WHO). IgE antibodies play a key role in the development of allergic diseases. The detection of the allergen-specific IgE antibody has important significance in the auxiliary diagnosis, treatment and prevention of allergic diseases. The detection of allergen IgE generally adopts immunodiagnosis methods, such as an enzyme-linked immunosorbent assay, a fluorescence immunoassay method, a chemiluminescence method and the like, and the research and development, product quality control and industrial standardization of the diagnosis products can not leave the IgE antibody quality control product. The conventional method for preparing the IgE antibody quality control product mainly collects allergy positive serum at present, and has the huge defects that the positive serum is difficult to collect, the cost is very high, and the supply is often insufficient; secondly, the difference between batches is large, the quantity is small, and large-scale and industrialized preparation is difficult; thirdly, the stability of natural blood products is poor, the natural blood products are easy to deteriorate or degrade in the processes of processing, subpackaging, transportation and use, and the consistency is difficult to effectively ensure when the natural blood products are used as conventional quality control products; and fourthly, the composite quality control product for detecting multiple allergen specificity IgE antibodies can use multiple cases of positive serum to be mixed, the mixing and debugging of the multiple specificity IgE antibodies are very complicated and difficult in the adjustment of the quantity value, and the serum mixture of different donor sources can cause serum agglutination due to immune reaction, thereby causing huge waste.
Disclosure of Invention
Aiming at the problems existing in the method for collecting the allergy positive serum, the invention provides a preparation method of an allergen specificity IgE antibody compound quality control product.
The technical scheme of the invention is as follows: a preparation method of an allergen specificity IgE antibody composite quality control product comprises the following steps:
s1: preparing an allergen-specific IgE antibody;
s2: obtaining a target gene, and obtaining a constant region gene sequence and a variable region gene sequence of human IgE;
s3: preparing a gene segment containing a signal peptide and C regions of heavy chains and light chains of human IgE, which comprises the following steps:
s3-1: designing a first primer according to a gene sequence of a heavy chain constant region of human IgE, wherein the first primer comprises an Xho I enzyme cutting site; designing a second primer according to the light chain constant region gene sequence of the human IgE, wherein the second primer comprises a HindIII enzyme cutting site;
s3-2: designing an upstream primer HLF containing a heavy chain signal peptide initiation site sequence and a restriction enzyme cutting site Nhe I, designing a downstream primer HLR containing an Xho I site, and carrying out reverse transcription on the upstream primer HLF and the downstream primer HLR by using a plasmid pAc-kappa-CH3Amplifying heavy chain signal peptide gene segment as template;
s3-3: designing an upstream primer HCF containing Xho I and Kpn I sites and a downstream primer HCR containing a Furin sequence and an enzyme cutting site Xba I to obtain a plasmid pAc-kappa-CH3Amplifying heavy chain constant region gene segment as template;
s3-4: connecting the heavy chain constant region gene segment with the heavy chain signal peptide gene segment by using Xho I to obtain a gene segment containing a heavy chain signal peptide, a multiple cloning site and a heavy chain constant region;
s3-5: designing upstream primer LLF containing restriction enzyme cutting site Apa I and downstream primer LLR containing EcoRI site to obtain plasmid pAc-kappa-CH3Amplifying a light chain signal peptide gene segment as a template;
s3-6: the forward primer LCF containing EcoRI and HindIII sites and the reverse primer LCR containing pmeI were designed as plasmid pAc-kappa-CH3Amplifying a light chain constant region gene segment as a template;
s3-7: connecting the light chain signal peptide gene segment and the light chain constant region gene segment by using EcoRI to obtain a gene segment containing a light chain signal peptide, a multiple cloning site and a light chain constant region;
s4: constructing an expression empty vector containing a signal peptide and C region gene segments of a heavy chain and a light chain of human IgE;
s5: constructing recombinant expression vectors of different allergens;
s6: transfecting a cell;
s7: cloning, identifying and screening.
The invention has the beneficial effects that: compared with the prior art, the allergen specificity IgE antibody composite quality control product prepared by the method has high purity, contains a constant region and a plurality of variable regions aiming at different types of allergens, has the antigenicity of Fc end, and can identify different types of allergens; can be effectively used as a composite quality control product of the allergen specificity IgE antibody; the allergen specific IgE antibody composite quality control product can be expressed in a large amount by cultured cells, the primary yield can reach 1-2mg, the stability is good, and the allergen specific IgE antibody composite quality control product can be used for scale production and quality control of allergen specific IgE antibodies as conventional quality control.
The invention also discloses the allergen specificity IgE antibody composite quality control product obtained by the preparation method.
Drawings
FIG. 1 is a plasmid map of pcDNA3.1 vector;
FIG. 2 is an electrophoretogram of the shrimp-peanut allergen-specific IgE antibody in example 1.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the embodiments of the present invention are described in detail and completely, and it is obvious that the described embodiments are a part of the embodiments of the present invention, but not all of the embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
It will be understood by those skilled in the art that, unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the prior art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.
A preparation method of an allergen specificity IgE antibody composite quality control product comprises the following steps:
s1: allergen-specific IgE antibodies were prepared as follows: purifying the collected allergen positive serum by using allergen specific IgE antibody affinity chromatography, eluting and collecting human IgE; purifying the allergen specific IgE antibody by high-purity allergen affinity chromatography, eluting and collecting the allergen specific IgE antibody;
or separating and purifying by electrophoresis, salting out precipitation or other techniques to obtain total IgE antibody, and purifying to obtain allergen specific IgE antibody to prevent IgG antibody from being mixed;
s2: obtaining a target gene, and obtaining a constant region gene sequence and a variable region gene sequence of human IgE;
and (3) performing amino acid sequencing on the purified allergen-specific IgE antibody, classifying and performing homology analysis on the obtained nucleotide sequence in a Genebank nucleic acid database, and identifying a constant region sequence and a variable region nucleotide sequence of the allergen-specific IgE antibody so as to obtain variable region gene fragments of different types of allergen-specific IgE antibodies. Enzyme cutting sites are added at two ends of a nucleotide sequence of the allergen specificity IgE antibody, a flexible peptide gene sequence (Linker sequence) with 5 amino acid residues (GGGGS) is added between the nucleotide sequences of the allergen specificity IgE antibody, a primer containing the enzyme cutting sites is designed according to the nucleotide sequence of a variable region gene segment of the allergen specificity IgE antibody, amplification is carried out again, so that the variable region gene segment of the allergen specificity IgE antibody has the enzyme cutting sites matched with a vector, the insertion of an expression vector is facilitated, and a purified amplification product is recovered for later use.
Variable region V of IgE antibodies specific to different allergensLHThrough flexible peptide gene sequence and IgE antibody constant region CLHThe allergen-specific IgE antibodies are not limited to common food allergens such as eggs, milk, fish, wheat, sesame, peanuts, soybeans, shrimps, crabs, beef, mutton, fruits, nuts and the like, and common inhalation allergens such as mites, animal dander, cockroaches, molds, grass pollen and the like; variable region V of IgE antibodies specific for these different allergensLHThe sequence can be obtained by the steps S1 and S2. V linking one or more allergen antibodies by flexible peptide gene sequences (e.g. EAAAK or GGGGS etc.)LHThe variable region nucleotide sequence to achieve the purpose of expressing composite quality control.
S3: preparing a gene segment containing a signal peptide and C regions of heavy chains and light chains of human IgE, which comprises the following steps:
s3-1: designing a first primer according to a gene sequence of a heavy chain constant region of human IgE in a Genebank library: p1ACCACTC TCGAGGGCCCGCGTGCTGCCCCG, respectively; the marked line is Xho I enzyme cutting site; designing a second primer according to the light chain constant region gene sequence of human IgE: p2 GCTAGTAAGCTTTTTA CCGGGATTTACAGA, the underlined position is Hind III enzyme cutting site;
s3-2: designing an upstream primer HLF containing a heavy chain signal peptide initial site sequence and a restriction enzyme cutting site Nhe I, wherein the nucleotide sequence of the HLF is as follows: GCCGCCATGG, respectively; downstream primer HLR containing Xho I site and plasmid pAc-kappa-CH3Amplifying heavy chain signal peptide gene segment as template；
S3-3: designing an upstream primer HCF containing Xho I and Kpn I sites and a downstream primer HCR containing a Furin sequence and an enzyme cutting site Xba I to obtain a plasmid pAc-kappa-CH3Amplifying heavy chain constant region gene segment as template;
s3-4: connecting the fragments by Xho I to obtain a gene fragment containing a heavy chain signal peptide, MCS (multiple cloning site) and a heavy chain constant region;
s3-5: designing upstream primer LLF containing restriction enzyme cutting site Apa I and downstream primer LLR containing EcoRI site to obtain plasmid pAc-kappa-CH3Amplifying a light chain signal peptide gene segment as a template;
s3-6: the forward primer LCF containing EcoRI and HindIII sites and the reverse primer LCR containing pmeI were designed as plasmid pAc-kappa-CH3Amplifying a light chain constant region gene segment as a template;
s3-7: connecting the fragments by EcoRI to obtain a gene fragment containing a light chain signal peptide, MCS (multiple cloning site) and a light chain constant region;
s4: constructing an expression empty vector containing a signal peptide and C region gene segments of a heavy chain and a light chain of human IgE;
the heavy and light chains were ligated by using synthetic 2A sequences containing enzymatic cleavage sites (Xba I and Apa I) to obtain gene fragment LigC (Leader + Ig Constant) containing the signal peptide and the C region genes of the heavy and light chains of human IgE. Then connected with large fragment of pcDNA3.1 which is double-enzyme-digested by Nhe I and Pme I to obtain the eukaryotic double expression vector pcDNA3.1-C of IgE antibodyLH。
S5: constructing recombinant expression vectors of different allergens;
double enzyme digestion expression vector pcDNA3.1-CLHPurifying VLH of IgE with different allergen specificities by agarose gel electrophoresis, separating and purifying target fragments, connecting, transforming Escherichia coli, and screening pcDNA3.1-CLH-VLHAnd (4) n positive cloning, carrying out enrichment culture, and extracting plasmids for enzyme digestion identification. Then, the expression vector pcDNA3.1-C was digested in two enzymesLH-VLHAnd (4) separating and purifying corresponding enzyme digestion fragments, and repeating the steps to construct a recombinant expression vector pcDNA3.1-IgE-xx (different allergen codes).
S6: transfecting a cell;
inoculating appropriate amount of cells in culture flask, at 37 deg.C and 5% CO2Culturing until the cells are 40% -80% confluent, and then transfecting the purified DNA of the vector pcDNA3.1-IgE-xx by adopting a Transfection Reagent (PolyFect Transfection Reagent QIAGEN) according to the instruction of a kit; the cells without the vector and the empty vector are set as a control, after transfection for 72h, screening is carried out by using a selective medium, and after 2 weeks, the grown positive clones are monocloned by using a limiting dilution method.
S7: cloning, identification and screening
The specificity and the recombinability of the antibody were examined by using an allergen-specific IgE antibody detection kit (magnetic particle chemiluminescence method) (22 items in general) (registration No. of medical instruments: Xiangjizhaiqiao 20212400343). After the cell culture supernatant is reacted, the corresponding values of the allergen-specific IgE antibody concentration are respectively detected according to the instruction operation of the allergen-specific IgE antibody detection kit. Screening out appropriate cell strains with strong positive values of the allergen-specific IgE antibodies, carrying out subsequent culture and passage, taking supernatant, repeating the step S1, purifying by using an affinity chromatography column, eluting, dialyzing by using 0.1MPBS to obtain a high-purity allergen-specific IgE antibody composite quality control product, and adding 50% glycerol to store at-20 ℃; this step may also be separated and purified by electrophoresis, salting-out precipitation or other chromatographic techniques.
Example 1
This example illustrates the preparation of a shrimp-peanut allergen-specific IgE antibody complex quality control.
Firstly, preparing a high-purity shrimp-peanut allergen specific IgE antibody: one example of each of shrimp allergen positive and peanut allergen positive samples purchased from plasmalalab, usa was selected and mixed with a binding buffer (0.02MPBS, ph7.4) at a volume ratio of 1: 1 mixing and 0.8 μm filtration through a filter to remove fibrinogen (to prevent clogging of the column). Passing the binding buffer solution with 5-10 times volume through the anti-human IgE antibody column; then the prepared serum sample is loaded, the column is washed by the binding buffer solution, and the hybrid protein is eluted; eluting with glycine eluent, and collecting eluate (about 3-4 ml/tube) until the eluate contains no protein; measuring the protein content in each collecting pipe, and combining the protein pipes to obtain a shrimp-peanut allergen specific IgE antibody; biotinylated shrimp and peanut allergens at 20. mu.g/mL were added to two streptavidin chromatography columns, mixed for 1h, and the column was washed with binding buffer to remove unbound contaminating proteins. And respectively adding the primarily purified shrimp-peanut allergen specific IgE antibodies into the corresponding columns, washing with a binding buffer solution to remove impurity proteins, and eluting with glycine eluent to collect proteins. And preparing the purified allergen specific IgE antibody of the shrimps and the peanuts.
Shrimp and peanut allergen specific IgE antibody VLHThe target gene is as follows: the nucleotide sequences of the variable regions of the allergen-specific IgE of the shrimps and the peanuts are respectively as follows:
SEQ ID No.1
GAAATTGTGTTGACGCAGTCTCCAGGCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCGCCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGGGGCGCCTCCTTCGCCTGGTACCAGCAAAAACCTGGCCAGGCTCCCAGGCTCCACACGTTTGGTGCATCCGCCAGGGCCACGACAGGTTCAGTAGCAGTGGGTCTGGGACAGAGTGGACTCTCATCATCAGCAGAGTGGAGTCCGAAGATGTTGGAGTGTATTACTGTCAGCACTATGGTGGCTCACCTCAGGTCACCTTCGCCCAAGGGACACGACTGCAGATTAAAC
SEQ ID No.2
CAATGTCAGCTCGTACAGTCTGGGGCCGAGTGCAAGAAGCCAGGCGCCTCCGTTAAGGTGTCATGCAAAGCATCTCGGCTATACTTTCACGGGATACTATATGCATTGGGTGCGCCAAGCACCAGGTCAGGGCCTAGAATGGATGGGGTGGATCAACCCCAACTCAGGAGGGTACAATTACGCACAGAAGCCACAGGGCCGTGTGACTATGACACGCGATACGTCTATCTCAACTGCAATGGAGCTCTCTCGACTTCGTTCAGACGATACGGCCGTGTACTACTGCGCACGCGACGTGCCGGATACGCACTTCCTAACGTGGCTCGAGCCATGGGGTCAAGGGACGCTTGTAACGGTTTCG
secondly, cloning and identifying: the expressed shrimp-peanut allergen-specific IgE antibody is purified and quantified by BCA protein, and the protein concentration is about 0.058 mg/mL. Then, the purity and titer were determined by using an allergen-specific IgE antibody detection kit (magnetic particle chemiluminescence method) (22 items in general) (registration No. of medical instruments: Xiangjizhuiqiao 20212400343):
(1) protein band: as shown in fig. 2;
purity: 95 percent.
(2) Titers, as shown in table 1:
TABLE 1
The linear range of the kit is 0.1-100IU/mL, and the concentration of the stock solution is estimated to be 8000-9000IU/mL according to the back calculation of the dilution ratio.
(3) Dilution linearity: the mother liquor was prepared to a concentration near the upper limit of the linear range of the kit (about 100 IU/mL), diluted in multiples to near the lower limit of the linear range (0.1IU/mL), and the theoretical concentration was compared to the actual concentration, as shown in Table 2.
TABLE 2
The correlation coefficient R is >0.99, and the dilution linearity is very good.
(4) Stability: diluting the mother liquor with 0.01MPBS (containing 1 ‰ BSA, 2% glycerol and 1 ‰ Proclin-300) to three concentrations, respectively standing at 4 deg.C for 30 days and 37 deg.C for 7 days, comparing with the initial value, and the data are shown as 3;
TABLE 3
From table 3 it can be derived: the product is preserved at 4 ℃ and thermally destroyed at 37 ℃, the retention rate of the concentration is over 90 percent, and the stability is good.
In conclusion, the shrimp-peanut allergen specific IgE antibody composite quality control product has high titer and purity, dilution linearity and good stability, and has high use value in the aspects of quality control, conventional quality control, performance verification and product development of mass production.
The invention is not limited to the above alternative embodiments, and any other various forms of products can be obtained by anyone in the light of the present invention, but any changes in shape or structure thereof, which fall within the scope of the present invention as defined in the claims, fall within the scope of the present invention.
Sequence listing
<110> Hunan Portable Biotechnology Co., Ltd
<120> preparation method of allergen-specific IgE antibody composite quality control product and allergen-specific IgE antibody composite quality control product
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 318
<212> DNA
<213> Intelligent (Homo sapiens)
<400> 1
gaaattgtgt tgacgcagtc tccaggcacc ctgtctttgt ctccagggga aagagccgcc 60
ctctcctgca gggccagtca gagtgttagg ggcgcctcct tcgcctggta ccagcaaaaa 120
cctggccagg ctcccaggct ccacacgttt ggtgcatccg ccagggccac gacaggttca 180
gtagcagtgg gtctgggaca gagtggactc tcatcatcag cagagtggag tccgaagatg 240
ttggagtgta ttactgtcag cactatggtg gctcacctca ggtcaccttc gcccaaggga 300
cacgactgca gattaaac 318
<210> 2
<211> 361
<212> DNA
<213> Intelligent (Homo sapiens)
<400> 2
caatgtcagc tcgtacagtc tggggccgag tgcaagaagc caggcgcctc cgttaaggtg 60
tcatgcaaag catctcggct atactttcac gggatactat atgcattggg tgcgccaagc 120
accaggtcag ggcctagaat ggatggggtg gatcaacccc aactcaggag ggtacaatta 180
cgcacagaag ccacagggcc gtgtgactat gacacgcgat acgtctatct caactgcaat 240
ggagctctct cgacttcgtt cagacgatac ggccgtgtac tactgcgcac gcgacgtgcc 300
ggatacgcac ttcctaacgt ggctcgagcc atggggtcaa gggacgcttg taacggtttc 360
g 361
<210> 3
<211> 30
<212> DNA
<213> Intelligent (Homo sapiens)
<400> 3
accactctcg agggcccgcg tgctgccccg 30
<210> 4
<211> 30
<212> DNA
<213> Intelligent (Homo sapiens)
<400> 4
gctagtaagc tttttaccgg gatttacaga 30
Claims (10)
1. A preparation method of an allergen specificity IgE antibody composite quality control product is characterized by comprising the following steps:
s1: preparing an allergen-specific IgE antibody;
s2: obtaining a target gene, and obtaining a constant region gene sequence and a variable region gene sequence of human IgE;
s3: preparing a gene segment containing a signal peptide and C regions of heavy chains and light chains of human IgE, which comprises the following steps:
s3-1: designing a first primer according to a gene sequence of a heavy chain constant region of human IgE, wherein the first primer comprises an Xho I enzyme cutting site; designing a second primer according to the light chain constant region gene sequence of the human IgE, wherein the second primer comprises a HindIII enzyme cutting site;
s3-2: designing an upstream primer HLF containing a heavy chain signal peptide initiation site sequence and a restriction enzyme cutting site Nhe I, designing a downstream primer HLR containing an Xho I site, and carrying out reverse transcription on the upstream primer HLF and the downstream primer HLR by using a plasmid pAc-kappa-CH3Amplifying heavy chain signal peptide gene segment as template;
s3-3: designing an upstream primer HCF containing Xho I and Kpn I sites and a downstream primer HCR containing a Furin sequence and an enzyme cutting site Xba I to obtain a plasmid pAc-kappa-CH3Amplifying heavy chain constant region gene segment as template;
s3-4: connecting the heavy chain constant region gene segment with the heavy chain signal peptide gene segment by using Xho I to obtain a gene segment containing a heavy chain signal peptide, a multiple cloning site and a heavy chain constant region;
s3-5: designing upstream primer LLF containing enzyme cutting site Apa I and downstream primer LLR containing EcoRI site to obtain plasmid pAc-kappa-CH3Amplifying a light chain signal peptide gene segment as a template;
s3-6: the forward primer LCF containing EcoRI and HindIII sites and the reverse primer LCR containing pmeI were designed as plasmid pAc-kappa-CH3Amplifying a light chain constant region gene segment as a template;
s3-7: connecting the light chain signal peptide gene segment and the light chain constant region gene segment by using EcoRI to obtain a gene segment containing a light chain signal peptide, a multiple cloning site and a light chain constant region;
s4: constructing an expression empty vector containing a signal peptide and C region gene segments of a heavy chain and a light chain of human IgE;
s5: constructing recombinant expression vectors of different allergens;
s6: transfecting a cell;
s7: cloning, identifying and screening.
2. The method according to claim 1, wherein step S4 specifically comprises:
s4-1: connecting the gene fragment prepared in the step S3-4 and the gene fragment prepared in the step S3-7 by using a sequence simultaneously containing XbaI and ApaI to obtain a gene fragment containing a signal peptide and human IgE heavy chain and light chain C region genes;
s4-2: connected with the large fragment of pcDNA3.1 which is subjected to double enzyme digestion by Nhe I and Pme I to obtain the IgE antibody eukaryotic double expression vector pcDNA3.1-CLH。
3. The method according to claim 2, wherein step S5 specifically comprises: IgE antibody eukaryotic double expression vector pcDNA3.1-CLHAnd VLH of purified IgE with different allergen specificities, transforming and expressing bacteria, and screening to obtain pcDNA3.1-CLH-VLHN positive clone, restriction enzyme pcDNA3.1-CLH-VLHSeparating and purifying after n to obtain enzyme digestion fragments; repeating the steps to construct a recombinant expression vector pcDNA3.1-IgE-xx, wherein xx is different allergen codes.
4. The preparation method according to claim 3, wherein the step S6 is specifically as follows: and (3) transfecting the DNA of the recombinant expression vector pcDNA3.1-IgE-xx obtained in the step S5 into cells, screening after the transfection is finished, and finally performing monoclonalization.
5. The method according to any one of claims 1 to 4, wherein step S1 specifically comprises: carrying out affinity purification on the collected allergen positive serum by using an anti-IgE antibody, and eluting to collect IgE; and then the IgE antibody is subjected to affinity purification by using high-purity allergen, and the allergen-specific IgE antibody is eluted and collected.
6. The preparation method according to claim 5, wherein the step S2 is specifically as follows:
s2-1: amino acid sequencing is carried out on the allergen specificity IgE antibody, and the obtained nucleotide sequence is classified and subjected to homology analysis in a Genebank nucleic acid database to identify the nucleotide sequence of a constant region and a variable region of the IgE antibody, so that variable region gene fragments of different types of allergen specificity IgE are obtained;
s2-2: enzyme cutting sites are added at two ends of the obtained allergen specificity IgE nucleotide sequence, and a connecting sequence is added in the nucleotide sequence;
s2-3: designing a primer containing a restriction enzyme site according to the nucleotide sequence of the variable region gene fragment of the allergen specificity IgE antibody, carrying out amplification again, and recovering and purifying an amplification product for later use.
7. The method of claim 1, wherein the nucleotide sequence of the first primer is ACCACTCTCGAGGGCCCGCGTGCTGCCCCG, and CTCTCGA is the Xho I cleavage site.
8. The method of claim 7, wherein the nucleotide sequence of the second primer is GCTAGTAAGCTTTTTACCGGGATTTACAGA, and AAGCTT is HindIII site.
9. The method according to claim 6, wherein the nucleotide sequence of the linker is GGGGS or EAAAK.
10. An allergen-specific IgE antibody complex quality control product prepared by the preparation method of any one of claims 1-9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110383916.XA CN113004403A (en) | 2021-04-09 | 2021-04-09 | Preparation method of allergen-specific IgE antibody composite quality control product and allergen-specific IgE antibody composite quality control product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110383916.XA CN113004403A (en) | 2021-04-09 | 2021-04-09 | Preparation method of allergen-specific IgE antibody composite quality control product and allergen-specific IgE antibody composite quality control product |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113004403A true CN113004403A (en) | 2021-06-22 |
Family
ID=76388193
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110383916.XA Pending CN113004403A (en) | 2021-04-09 | 2021-04-09 | Preparation method of allergen-specific IgE antibody composite quality control product and allergen-specific IgE antibody composite quality control product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113004403A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117384277A (en) * | 2023-12-05 | 2024-01-12 | 中国人民解放军军事科学院军事医学研究院 | Humanized IgA antibody heavy chain expression plasmid and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104558190A (en) * | 2015-01-06 | 2015-04-29 | 中国药科大学 | All-human targeted IgG sample bispecific antibody of EGFR/KDR |
| CN105849323A (en) * | 2013-10-28 | 2016-08-10 | 多茨设备公司 | Allergen detection |
| CN112166119A (en) * | 2018-05-18 | 2021-01-01 | 陈扎克伯格生物中心公司 | Method for isolating allergen-specific antibodies from humans and uses thereof |
-
2021
- 2021-04-09 CN CN202110383916.XA patent/CN113004403A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105849323A (en) * | 2013-10-28 | 2016-08-10 | 多茨设备公司 | Allergen detection |
| CN104558190A (en) * | 2015-01-06 | 2015-04-29 | 中国药科大学 | All-human targeted IgG sample bispecific antibody of EGFR/KDR |
| CN112166119A (en) * | 2018-05-18 | 2021-01-01 | 陈扎克伯格生物中心公司 | Method for isolating allergen-specific antibodies from humans and uses thereof |
Non-Patent Citations (1)
| Title |
|---|
| HOH RAMONA A等: "《Single B-cell deconvolution of peanut-specific antibody responses in allergic patients》", 《JOURNAL OF ALLERGY AND CLINICAL IMMUNOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117384277A (en) * | 2023-12-05 | 2024-01-12 | 中国人民解放军军事科学院军事医学研究院 | Humanized IgA antibody heavy chain expression plasmid and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US4675285A (en) | Method for identification and isolation of DNA encoding a desired protein | |
| JPH02799A (en) | Manufacture of antibody by genetic engineering technique | |
| CN113004403A (en) | Preparation method of allergen-specific IgE antibody composite quality control product and allergen-specific IgE antibody composite quality control product | |
| CN112358536B (en) | Scy p 1 derivative of scylla paramamosain sensitization protein and application thereof | |
| CN106632618B (en) | Preparation method of porcine hepatitis E virus ORF2 recombinant protein and virus antibody liquid chip detection kit | |
| CN112375769A (en) | Encoding gene of portuguese oyster allergenic protein AK and application thereof | |
| CN110726837A (en) | ELISA detection kit for fasciolopsis diagnosis and application thereof | |
| CN108948181A (en) | A kind of preparation method of phospholipase A2 receptor protein | |
| CN115975028A (en) | Progesterone antibody, preparation method and application thereof | |
| US20220195442A1 (en) | Protein Engineering via Error-Prone Orthogonal Replication and Yeast Surface Display | |
| CN113667014B (en) | anti-BSA (bovine serum albumin) nano antibody and application | |
| CN112094853A (en) | White spot syndrome virus VP28 gene, recombinant protein, polyclonal antibody, preparation method and application | |
| CN106995801B (en) | Anti-tree shrew CD4 molecular monoclonal antibody, hybridoma cell strain secreting antibody and application | |
| CN112342198A (en) | PAT/PAT monoclonal antibody hybridoma cell strain, antibody produced by same and preparation method thereof | |
| CN105906716A (en) | Echovirus type-9 VP1 protein specific antigen epitope and preparation method and application of fusion protein thereof | |
| CN112745390A (en) | Binding protein containing NT-proBNP antigen binding structural domain | |
| CN112521461B (en) | Preparation of hepatitis A virus recombinant protein and rapid detection method thereof | |
| CN116836273B (en) | Anti-serum amyloid A antibody, reagent for detecting serum amyloid A and kit | |
| CN113603758B (en) | Spodoptera littoralis SoxC gene, encoding protein, vector, strain and application thereof | |
| LU500445B1 (en) | PREPARATION METHOD AND USE OF ANTI-HYDROXYLAMINE OXIDOREDUCTASE (HAO) RABBIT POLYCLONAL ANTIBODY (pAb) | |
| US20240182911A1 (en) | Protein Engineering via Error-Prone Orthogonal Replication and Yeast Surface Display | |
| CN111925447B (en) | Human and mouse egg zona pellucida fusion protein and preparation method and application thereof | |
| CN106916842B (en) | Expression method of saliva allergen FSA1 of potamogeton fetida flea | |
| CN116903752A (en) | Mycoplasma pneumoniae recombinant antigen and application thereof | |
| CN117567607A (en) | anti-CREG monoclonal antibody 20F6 and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210622 |