CN112941205A

CN112941205A - RhD blood group gene RHD634G & gtA allele and detection

Info

Publication number: CN112941205A
Application number: CN202110315856.8A
Authority: CN
Inventors: 王学东; 王保龙; 邵超鹏; 王玥苹; 顾娟; 马静; 姬艳丽
Original assignee: Wuxi Fifth Peoples Hospital
Current assignee: Wuxi Fifth Peoples Hospital
Priority date: 2021-03-24
Filing date: 2021-03-24
Publication date: 2021-06-11

Abstract

The invention discloses a RhD blood group gene RHD634G > A allele and detection thereof. The invention provides a mutation of RhD blood group gene RHD634G & gtA allele site g.25301093G & gtA. A primer sequence aiming at gene mutation is designed by adopting a specific primer-PCR technology, and a region containing the mutant gene is specially detected aiming at the RHD634G A allele by a gene amplification method.

Description

RhD blood group gene RHD634G & gtA allele and detection

Technical Field

The invention relates to the technical field of molecular biology, in particular to an allele of RhD blood group gene RHD634G & gtA and detection.

Background

The Rh blood group is the most complex and polymorphic system of the human erythrocyte blood group system and is also the main erythrocyte blood group causing clinical transfusion reactions and severe neonatal hemolytic disease. More than 50 Rh blood group antigens are found, wherein RhD antigens have strong immunogenicity, are coded by RHD genes and are the key points of blood group research. Clinically, Rh blood group antigens are classified into two main types, namely RhD positive and RhD negative, according to whether D antigen is detected on the surface of an erythrocyte membrane.

Currently, the conventional method for detecting Rh blood group D antigen is to identify by adopting a serological saline method, an indirect anti-human globulin test and an absorption and diffusion test. Serological techniques, however, have certain limitations. The results of some individuals when serotyped are difficult to determine due to disease or other factors; serological results of chronic long-term transfusion patients sometimes exhibit a phenomenon of "mixed visual field"; serological tests also fail to obtain correct results when samples cannot be obtained or when there are insufficient red blood cells or red blood cell samples, such as fetal blood grouping, forensic remains, etc.

The detection of RhD blood type by means of immunoserology depends mainly on the specificity of the anti-D antibodies and the amount of antigen expressed. Currently, with the development of molecular biotechnology, RhD mutants increase year by year, and the antigen expression amount and the gene mutation site thereof are different. The detection of the gene mutants mainly determines the Rh blood group D antigen genotype by a molecular biological method, has important clinical practical significance on making up the defects of a serology technology, and also has wide scientific research and application values. Therefore, it is necessary to provide an allele of RhD blood group gene RHD634G > A and a specific primer for detecting the allele.

Disclosure of Invention

The purpose of the invention is as follows: in order to overcome the defects in the prior art, the invention provides an allele of RhD blood group gene RHD634G & gtA and a specific primer for detecting the allele.

The technical scheme is as follows: to achieve the purpose, the RHD blood group gene RHD634G > A allele of the invention has the RHD634G > A allele site g.25301093G > A mutation; the g.25301093G > A mutation means that the mutation site is A from the 219 th base G of the SEQ ID NO. 1 sequence; the DNA sequence of the mutant gene is shown as SEQ ID NO: 2, respectively.

A specific primer for detecting RHD634G > A allele, the upstream primer sequence of the specific primer is shown as SEQ ID NO. 3, the downstream primer sequence is shown as SEQ ID NO. 4, and the specific primer is used for detecting RHD634G > A allele.

The detection method is completed by utilizing the change of specific sequence sites of different alleles of human RhD blood types and designing a specific primer sequence to carry out polymerase chain reaction.

RhD blood group gene RHD634G > A allelic locus g.25301093G > A mutation. This mutation occurred at position 25301093 in chromosome 1, the gene numbered NC-000001.11 in the NCBl reference database GRCh38.p13 (25272393 and 25330445). Partial base sequences containing the wild type of the site in the database are listed here for reference, as shown in SEQ ID NO:1, the mutation site is mutated from base G to A at position 219 of the sequence of SEQ ID NO. 1. The corresponding sequence of the RHD gene mutation is shown as SEQ ID NO: 2, respectively.

SEQ ID NO:1

CCAAGGACTATCAGGGCTTGCCCCGGGCAGAGGATGCCGACACTCACTGCTCTTACTGGGTTTTATTGCAGACAGACTACCACATGAACATGATGCACATCTACGTGTTCGCAGCCTATTTTGGGCTGTCTGTGGCCTGGTGCCTGCCAAAGCCTCTACCCGAGGGAACGGAGGATAAAGATCAGACAGCAACGATACCCAGTTTGTCTGCCATGCTGGGTAAGGACAAGGTGGGGTGAGTGGTCTCCTACTTGGGCTGAGCAGAATGGCTCAGAAAAGGCTCTGGCTGAAAAAATCTCCCTCCTTTACCAAGTTCCCCTGGGTGTCTGAAGCCCTTCCATCATGATTCATTTCTTTGAGTAGTGTTTGCTAAATTCATAC

SEQ ID NO:2

CCAAGGACTATCAGGGCTTGCCCCGGGCAGAGGATGCCGACACTCACTGCTCTTACTGGGTTTTATTGCAGACAGACTACCACATGAACATGATGCACATCTACGTGTTCGCAGCCTATTTTGGGCTGTCTGTGGCCTGGTGCCTGCCAAAGCCTCTACCCGAGGGAACGGAGGATAAAGATCAGACAGCAACGATACCCAGTTTGTCTGCCATGCTGAGTAAGGACAAGGTGGGGTGAGTGGTCTCCTACTTGGGCTGAGCAGAATGGCTCAGAAAAGGCTCTGGCTGAAAAAATCTCCCTCCTTTACCAAGTTCCCCTGGGTGTCTGAAGCCCTTCCATCATGATTCATTTCTTTGAGTAGTGTTTGCTAAATTCATAC

The method for detecting the allele of the RhD blood group gene RHD634G > A selectively amplifies a target part containing a mutant gene by gene amplification so as to detect the existence of the mutant gene. The detection method comprises the following steps:

(1) extracting DNA in a sample to be detected;

(2) carrying out PCR reaction by using the DNA as a template and a PCR primer designed aiming at a coding region near the RHD634G & gtA mutant gene to obtain a PCR reaction product;

(3) measuring the nucleotide sequence composition of the PCR reaction product;

(4) the nucleotide sequence was compared to the sequence of the RHD wild-type gene to determine whether there was a 634G → a mutation. The nucleotide sequence composition of the PCR reaction product can be used for sequencing the PCR reaction product through a sequencer.

Detection of the RhD blood group gene RhD634G > a allele. The method comprises the following specific steps:

(1) designing a primer: designing primers through Oligo 6.0 primer software according to RHD gene (sequence number: NC-000001.11) recorded by the GenBank of National Center for Biotechnology Information (NCBI), and finally determining 1 pair of specific oligonucleotide primer sequences, wherein the sequence of the upstream primer is shown as SEQID NO. 3 in Table 1; the sequence of the downstream primer is shown as SEQID NO. 4, and the length of the amplified product fragment is 174 bp.

TABLE 1 RHD993C > T allele detection primer sequences and reaction specificity

Note: the position of the exon base sequence referred to by the oligonucleotide primer sequence refers to the entire arrangement of 10 exons starting from the ATG start codon; the position of the base sequence of the intron in question refers to the single order of arrangement of each intron.

(2)RHD634G>Amplification of a allele: the total volume of the reaction system is 50 mu L; wherein the PCR reaction solution contains 10 μ L of PCR 5 × buffer solution, 5.0 μ L of DNA template, 1.0 μ L of Taq polymerase and 1.0 μ L MgCl₂Final concentration of 2.0mmol/L, dNTP final concentration of 200nmol/L, and final specificity of forward primer and reverse primerThe concentration is 200 nmol/L; adding sterilized double distilled water to the total volume of the reaction system to be 50 mu L; and (3) reacting the reaction system in a PCR instrument. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min, followed by denaturation at 94 ℃ for 30s in sequence, followed by annealing at 62 ℃ for 35s and extension at 72 ℃ for 1min for 35 cycles.

(3) RHD634G > a allele detection: and (3) carrying out electrophoresis on the amplified product obtained in the step (2) by using an agarose gel to detect whether the amplified product contains the target fragment.

Has the advantages that: the invention adopts a molecular biology method to detect the gene level, and can detect the existence of the mutant gene doped in the gene library with high sensitivity and high precision. Due to the difference of RHD genes among different nationalities, on the basis of related research, the RHD634G A allele which is newly discovered is specially designed according to the molecular background of the RHD gene of Chinese. The invention not only has important clinical practical significance in making up the defects of the serology technology, but also has wide scientific research application value.

Drawings

FIG. 1 is a gel electrophoresis of the RHD634G > A allele detection;

FIG. 2 is a sequence chart of the RHD634G > A allelic mutation.

Detailed Description

The present invention will be further described with reference to the accompanying drawings.

EXAMPLE 1 preparation of DNA template

The method adopts a purchased kit to extract the whole blood genome DNA, and comprises the following specific steps:

(1) one sterile 2.0mL centrifuge tube was added to 1mL of cell lysate.

(2) Gently shaking the whole blood sample anticoagulated by EDTA until the whole blood sample is thoroughly mixed; then, 500. mu.L of blood sample is sucked and added into the centrifuge tube containing the cell lysate, and the centrifuge tube is gently poured 5-6 times to mix evenly.

(3) Incubate for 10 minutes at room temperature (during which the tube is inverted for 2-3 rounds of mixing).

(4) Centrifuge at 12000rpm for 5 minutes at room temperature.

(5) The supernatant was removed as slowly as possible with a pipette, taking care not to aspirate the white material at the interface between the two phases.

(6) Mix vigorously using a vortex shaker (Votex) until the leukocytes are resuspended (10-15 seconds).

(7) To the resuspended cell solution was added 300. mu.L of the lysis solution. The solution was pipetted 5-6 times to lyse the leukocytes. At which point the solution should become very viscous. If a clump of cells is visible after mixing, the solution is incubated at 37 ℃ until the clump dissipates. If cell clumps remain visible after 1 hour of incubation, an additional 100. mu.L of nuclear lysate is added and incubation at 37 ℃ is repeated.

(8) To the nuclear lysate, 100. mu.L of protein precipitation solution was added, and vigorously shaken with a vortex shaker for 10-20 seconds.

(9) Centrifuge at 12000rpm for 5 minutes at room temperature.

(10) The supernatant was transferred to a correspondingly numbered 2.0mL centrifuge tube to which 300. mu.L of room temperature isopropanol had been added.

(11) The solution was mixed by gentle inversion until a white linear DNA precipitate formed.

(12) Centrifuge at 12000rpm for 1min at room temperature.

(13) The supernatant was discarded, and a volume of room temperature 70% ethanol equal to the volume of the sample was added, and the tube was gently inverted several times.

(14) The ethanol solution was removed as slowly as possible by pipette. And (3) baking the centrifugal tube at 50 ℃ for 5-10 minutes to completely volatilize residual ethanol liquid as far as possible.

(15) Add 50-100. mu.L of DNA lysis solution to the tube and mix gently.

(16) The DNA extraction effect was evaluated by 1% agarose gel electrophoresis, and the content was quantified by Nanodrop nucleic acid analyzer and stored at-20 ℃.

Example 2RHD634G > a allele detection protocol:

the instrument comprises the following steps: veriti 96 type PCR instrument, BIO-RAD Gel Doc XR + type Gel imager (Berle, USA), Gel electrophoresis instrument (Hex, Beijing).

Reagent: QIAamp DNA extraction kit (Qiagen, Germany); DNA Isolation Kit extraction Kit (Beijing PELFREEZ company); PCR buffer, dNTP, Taq enzyme (ABI, USA); primers and probes were synthesized by Shanghai Biotechnology Ltd.

(1)RHD634G>Amplification of a allele: total volume of reaction: 50 μ L, 10 μ L of PCR-containing 5 Xbuffer, 5.0 μ L of DNA template, 1.0 μ L of Taq polymerase (1U/. mu.L), MgCl₂Final concentration 2.0mmol/L, dNTP final concentration 200nmol/L, and specificity upper and lower primer final concentration 200nmol/L, and adding sterilized double distilled water to total volume of 50 μ L. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min followed by subsequent denaturation at 94 ℃ for 30 sec, followed by annealing at 62 ℃ for 35 sec and extension at 72 ℃ for 1min for 35 cycles.

(2) RHD634G > a allele detection: the amplified product obtained in step (1) was subjected to electrophoresis using 1.5% agarose gel to detect the presence or absence of the desired fragment. And observing and photographing the result by a gel imager, and displaying the PCR product as a single band after electrophoresis without a miscellaneous band, thus prompting that the PCR product is single and has no non-specific amplification. If the position of the stripe is in a position with proper size, the target segment is obtained. As shown in fig. 1, M: 50bp gradient molecular weight markers, 1: blank control, 2: wild-type control, 3: RHD634G > a mutant sample.

(3) And (3) purifying an amplification product: in the research, an Agarose Gel DNA Purification Kit of Takara company is adopted, and a PCR product subjected to Agarose Gel electrophoresis is purified and recovered to prepare sequencing.

(4) Sanger sequencing and result judgment: the purified PCR product was sequenced on an ABI3730 type fully automatic DNA sequencer. The sequencing results were aligned with the RHD wild-type Reference Sequence (NCBI Reference Sequence: NC-000001.11) and the results were reported as a function of the actual mutation. The gene mutation pattern obtained by detection is shown in FIG. 2, and the arrow in the figure indicates that the RHD gene shows the g.25301093G > A mutation.

The above description is only of the preferred embodiments of the present invention, and it should be noted that: it will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the principles of the invention and these are intended to be within the scope of the invention.

Sequence listing

<110> fifth people hospital in Wuxi city

<120> RhD blood group gene RHD634G > A allele and detection

<130> 2021.03.18

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 381

<212> DNA

<213> Homo sapiens

<400> 1

ccaaggacta tcagggcttg ccccgggcag aggatgccga cactcactgc tcttactggg 60

ttttattgca gacagactac cacatgaaca tgatgcacat ctacgtgttc gcagcctatt 120

ttgggctgtc tgtggcctgg tgcctgccaa agcctctacc cgagggaacg gaggataaag 180

atcagacagc aacgataccc agtttgtctg ccatgctggg taaggacaag gtggggtgag 240

tggtctccta cttgggctga gcagaatggc tcagaaaagg ctctggctga aaaaatctcc 300

ctcctttacc aagttcccct gggtgtctga agcccttcca tcatgattca tttctttgag 360

tagtgtttgc taaattcata c 381

<210> 2

<211> 381

<212> DNA

<213> Homo sapiens

<400> 2

ccaaggacta tcagggcttg ccccgggcag aggatgccga cactcactgc tcttactggg 60

ttttattgca gacagactac cacatgaaca tgatgcacat ctacgtgttc gcagcctatt 120

ttgggctgtc tgtggcctgg tgcctgccaa agcctctacc cgagggaacg gaggataaag 180

atcagacagc aacgataccc agtttgtctg ccatgctgag taaggacaag gtggggtgag 240

tggtctccta cttgggctga gcagaatggc tcagaaaagg ctctggctga aaaaatctcc 300

ctcctttacc aagttcccct gggtgtctga agcccttcca tcatgattca tttctttgag 360

tagtgtttgc taaattcata c 381

<210> 3

<211> 27

<212> DNA

<213> Homo sapiens

<400> 3

cgatacccag tttgtctgcc atgctga 27

<210> 4

<211> 22

<212> DNA

<213> Homo sapiens

<400> 4

acactactca aagaaatgaa tc 22

Claims

1. An RhD blood group gene RhD634G > a allele characterized by: the RHD634G > A allelic locus g.25301093G > A mutation; the g.25301093G > A mutation means that the mutation site is A from the 219 th base G of the SEQ ID NO. 1 sequence; the DNA sequence of the mutant gene is shown as SEQ ID NO: 2, respectively.

2. A specific primer for the detection of the RHD634G > a allele, characterized in that: the upstream primer sequence of the specific primer is shown as SEQ ID NO. 3, and the downstream primer sequence is shown as SEQ ID NO. 4, and the specific primer is used for detecting RHD634G > A allele.