CN112941187A - Breast cancer related gene PIK3CA-Q928H mutant and specific primer thereof - Google Patents
Breast cancer related gene PIK3CA-Q928H mutant and specific primer thereof Download PDFInfo
- Publication number
- CN112941187A CN112941187A CN202110361334.1A CN202110361334A CN112941187A CN 112941187 A CN112941187 A CN 112941187A CN 202110361334 A CN202110361334 A CN 202110361334A CN 112941187 A CN112941187 A CN 112941187A
- Authority
- CN
- China
- Prior art keywords
- leu
- glu
- ile
- lys
- arg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01137—Phosphatidylinositol 3-kinase (2.7.1.137)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Oncology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a breast cancer related gene PIK3CA-Q928H mutant and a specific primer thereof, belongs to the technical field of molecular biology, and discloses a breast cancer PIK3CA gene g.179230121A > C site mutation and application thereof. Compared with the normal gene sequence of PIK3CA, the PIK3CA gene mutation has a g.179230121A > C site mutation. The invention provides a new mutation site of a breast cancer related gene, which can be used for screening early breast cancer.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a breast cancer related gene PIK3CA-Q928H mutant and a specific primer thereof.
Background
Breast cancer is the most common malignant tumor facing women all over the world at present and is also an important cause of female death. Since the 90 s, the incidence rate of Chinese breast cancer is increased by more than 2 times of the whole world, and the new breast cancer and the death rate of Chinese breast cancer account for 12.2 percent and 9.6 percent of the whole world each year. Currently, breast cancer is the cancer with the highest incidence rate in Chinese women, and the cause of cancer death is the sixth place and the trend of the cancer death is remarkable. Although the improvement of early detection and diagnosis techniques and the progress of surgery and comprehensive adjuvant therapy lead to the obvious improvement of the prognosis of patients, the overall survival rate is not ideal. For certain molecular subtypes, some middle and advanced patients lack effective therapeutic approaches due to primary or secondary resistance to drugs, and even lack of specific therapeutic targets. Therefore, the search for effective tumor markers has important clinical guiding significance for improving the diagnosis, prediction, development and prognosis of breast cancer.
The tumor marker can be effectively used as a clinical diagnosis basis, can be used for early diagnosis, guiding treatment, judging treatment curative effect and detecting relapse and metastasis, and is an important inspection index for tumor patients. Breast cancer is a systemic disease, and the occurrence and development of the breast cancer are complex processes involving multiple factors and multiple links, including the activation of oncogenes and the inactivation of cancer suppressor genes. Therefore, gene mutation plays an important role in the process of the occurrence and development of breast cancer. The PIK3CA gene is a mutation gene which is found in recent years to be the most common and important breast cancer except for p53 mutation and Her-2 amplification, the mutation rate is up to 40 percent, and the mutation can cause the abnormal regulation of multiple signal paths at different levels so as to promote the proliferation and survival of tumor cells.
Phosphatidylinositol-3-kinase (PI3K) is a phosphatidylinositol kinase that phosphorylates the third hydroxyl group of the inositol ring, and has dual activities of phosphatidylinositol kinase and serine-threonine protein kinase, and can regulate various biological functions such as cell proliferation, survival, migration, apoptosis and cell cycle. The PIK3CA gene encodes the class i PI3K catalytic subunit P110 α, which is located at 3q26.3, contains 21 exons, and encodes 1068 amino acids. The existing research shows that the method of PCR or gene sequencing is applied to detect the mutation condition of PIK3CA gene in the tissue, so that the sensitivity of tumor diagnosis can be improved; tumor cells with PIK3CA gene mutation are more sensitive to PI3K inhibitors, and the target treatment specifically aiming at PIK3CA mutation can effectively reduce the morbidity and mortality of malignant tumors. Although the influence of the PIK3CA mutation on the diagnosis and prognosis of breast cancer needs to be further researched, the discovery of the PIK3CA high-frequency mutation and the mutation hotspot region has important clinical significance for the gene diagnosis of breast cancer and the selection of targeted therapy according to the existing research data.
Disclosure of Invention
The purpose of the invention is as follows: in order to overcome the defects in the prior art, the invention provides a breast cancer related gene PIK3CA-Q928H mutant and a specific primer thereof, and a high-specificity mutation site related to breast cancer is searched by researching the mutation in peripheral blood DNA of a breast cancer patient and a healthy control matched with the breast cancer patient in age, so that support is provided for screening and diagnosing the breast cancer.
The technical scheme is as follows: in order to achieve the purpose, the technical scheme of the invention is as follows:
a breast cancer related gene PIK3CA-Q928H mutant, the mutant gene has g.179230121A > C site mutation compared with the PIK3CA normal gene sequence; the G.179230121A > C site mutation of the PIK3CA gene refers to that the 312 th base A of the SEQ ID NO. 1 sequence of the mutation site is mutated into C.
A specific primer for detecting the PIK3CA-K672N mutant as claimed in claim 1, wherein the upstream primer sequence of the specific primer is shown as SEQ ID NO. 3, and the downstream primer sequence is shown as SEQ ID NO. 4, and the specific primer is used for detecting G.179230121A > C site mutation of the PIK3CA gene.
Has the advantages that: the mutation site is found in Chinese Han family female breast cancer patients for the first time in the research, and has potential application prospect in breast cancer screening and gene diagnosis. The development and application of the related diagnosis kit are carried out through the change of the mutation site sequence, so that the diagnosis of the breast cancer is more convenient and feasible, the clinical doctor can quickly and accurately master the disease condition of the patient, the foundation is laid for the evaluation of the clinical treatment effect, and the help is provided for finding a novel micromolecule drug target with potential treatment value.
Drawings
FIG. 1 is a gel electrophoresis diagram of the g.179230121A > C mutation of PIK3CA gene;
FIG. 2 is a sequence chart of the g.179230121A > C mutation of PIK3CA gene.
Detailed Description
The present invention will be further described with reference to the accompanying drawings.
The invention aims to provide a PIK3CA-Q928H mutant with a novel mutation site.
The high-specificity mutation site related to the breast cancer is searched by researching the mutation in the peripheral blood DNA of the breast cancer patient and the healthy control matched with the breast cancer patient, so that the support is provided for the screening and diagnosis of the breast cancer.
A mutant of PIK3CA-Q928H related to breast cancer has g.179230121A > C site mutation compared with the sequence of PIK3CA normal gene. The G.179230121A > C site mutation of the PIK3CA gene refers to that the 312 th base A of the SEQ ID NO. 1 sequence of the mutation site is mutated into C.
The DNA sequence of the wild type gene is shown as SEQ ID NO. 1, and the DNA sequence of the mutant type gene is shown as SEQ ID NO. 2.
SEQIDNO:1
CAGGGAACATCTGGAAATTTCCTTAGAAACCCATGAAAACTTCACAATCTCAAAATCTTTGGACATAATTTCCTTATTCGTTGTCAGTGATTGTTTTCATTGTTTAAATGGAAACTTGCACCCTGTTTTCTTTTCTCAAGTTGGCCTGAATCACTATATTTCCATACTACTCATGAGGTGTTTATTCTTTGTAGATATGATGCAGCCATTGACCTGTTTACACGTTCATGTGCTGGATACTGTGTAGCTACCTTCATTTTGGGAATTGGAGATCGTCACAATAGTAACATCATGGTGAAAGACGATGGACAAGTAATGGTTTTCTCTGTTTAAAATGTTTTGGTGTTCTTAATTTATTCAAGACATTTTGTATCTGCATATATCAAACTATAACATAATTTCTTATT
SEQIDNO:2
CAGGGAACATCTGGAAATTTCCTTAGAAACCCATGAAAACTTCACAATCTCAAAATCTTTGGACATAATTTCCTTATTCGTTGTCAGTGATTGTTTTCATTGTTTAAATGGAAACTTGCACCCTGTTTTCTTTTCTCAAGTTGGCCTGAATCACTATATTTCCATACTACTCATGAGGTGTTTATTCTTTGTAGATATGATGCAGCCATTGACCTGTTTACACGTTCATGTGCTGGATACTGTGTAGCTACCTTCATTTTGGGAATTGGAGATCGTCACAATAGTAACATCATGGTGAAAGACGATGGACACGTAATGGTTTTCTCTGTTTAAAATGTTTTGGTGTTCTTAATTTATTCAAGACATTTTGTATCTGCATATATCAAACTATAACATAATTTCTTATT
The invention provides a mutant of a breast cancer related gene PIK3CA-Q928H, which occurs at the 179230121 position of chromosome 3. The number of the gene in NCBl reference database GRCh38.p13 is NC-000003.12 (179148114-179240093). The gene sequences listed in the database comprise a partial base sequence of a wild type of the site as shown in SEQ ID NO. 1, and a sequence corresponding to PIK3CA gene mutation as shown in SEQ ID NO. 2, wherein the mutation site is mutated from base A to C at the 312 th site of the sequence of SEQ ID NO. 1. The wild-type amino acid sequence of the PIK3CA gene coding sequence is shown as SEQ ID NO: 5, wherein the amino acid change is as set forth in SEQ ID NO: the 928 nd position in the 6 sequence is converted into histidine (H) by glutamine (Q).
SEQ ID NO:5
MPIGSKERPTFFEIFKTRCNKADLGPISLNWFEELSSEAPPYNSEPAEESEHKNNNYEPNLFKTPQRKPSYNQLASTPIIFKEQGLTLPLYQSPVKELDKFKLDLGRNVPNSRHKSLRTVKTKMDQADDVSCPLLNSCLSESPVVLQCTHVTPQRDKSVVCGSLFHTPKFVKGRQTPKHISESLGAEVDPDMSWSSSLATPPTLSSTVLIVRNEEASETVFPHDTTANVKSYFSNHDESLKKNDRFIASVTDSENTNQREAASHGFGKTSGNSFKVNSCKDHIGKSMPNVLEDEVYETVVDTSEEDSFSLCFSKCRTKNLQKVRTSKTRKKIFHEANADECEKSKNQVKEKYSFVSEVEPNDTDPLDSNVANQKPFESGSDKISKEVVPSLACEWSQLTLSGLNGAQMEKIPLLHISSCDQNISEKDLLDTENKRKKDFLTSENSLPRISSLPKSEKPLNEETVVNKRDEEQHLESHTDCILAVKQAISGTSPVASSFQGIKKSIFRIRESPKETFNASFSGHMTDPNFKKETEASESGLEIHTVCSQKEDSLCPNLIDNGSWPATTTQNSVALKNAGLISTLKKKTNKFIYAIHDETSYKGKKIPKDQKSELINCSAQFEANAFEAPLTFANADSGLLHSSVKRSCSQNDSEEPTLSLTSSFGTILRKCSRNETCSNNTVISQDLDYKEAKCNKEKLQLFITPEADSLSCLQEGQCENDPKSKKVSDIKEEVLAAACHPVQHSKVEYSDTDFQSQKSLLYDHENASTLILTPTSKDVLSNLVMISRGKESYKMSDKLKGNNYESDVELTKNIPMEKNQDVCALNENYKNVELLPPEKYMRVASPSRKVQFNQNTNLRVIQKNQEETTSISKITVNPDSEELFSDNENNFVFQVANERNNLALGNTKELHETDLTCVNEPIFKNSTMVLYGDTGDKQATQVSIKKDLVYVLAEENKNSVKQHIKMTLGQDLKSDISLNIDKIPEKNNDYMNKWAGLLGPISNHSFGGSFRTASNKEIKLSEHNIKKSKMFFKDIEEQYPTSLACVEIVNTLALDNQKKLSKPQSINTVSAHLQSSVVVSDCKNSHITPQMLFSKQDFNSNHNLTPSQKAEITELSTILEESGSQFEFTQFRKPSYILQKSTFEVPENQMTILKTTSEECRDADLHVIMNAPSIGQVDSSKQFEGTVEIKRKFAGLLKNDCNKSASGYLTDENEVGFRGFYSAHGTKLNVSTEALQKAVKLFSDIENISEETSAEVHPISLSSSKCHDSVVSMFKIENHNDKTVSEKNNKCQLILQNNIEMTTGTFVEEITENYKRNTENEDNKYTAASRNSHNLEFDGSDSSKNDTVCIHKDETDLLFTDQHNICLKLSGQFMKEGNTQIKEDLSDLTFLEVAKAQEACHGNTSNKEQLTATKTEQNIKDFETSDTFFQTASGKNISVAKESFNKIVNFFDQKPEELHNFSLNSELHSDIRKNKMDILSYEETDIVKHKILKESVPVGTGNQLVTFQGQPERDEKIKEPTLLGFHTASGKKVKIAKESLDKVKNLFDEKEQGTSEITSFSHQWAKTLKYREACKDLELACETIEITAAPKCKEMQNSLNNDKNLVSIETVVPPKLLSDNLCRQTENLKTSKSIFLKVKVHENVEKETAKSPATCYTNQSPYSVIENSALAFYTSCSRKTSVSQTSLLEAKKWLREGIFDGQPERINTADYVGNYLYENNSNSTIAENDKNHLSEKQDTYLSNSSMSNSYSYHSDEVYNDSGYLSKNKLDSGIEPVLKNVEDQKNTSFSKVISNVKDANAYPQTVNEDICVEELVTSSSPCKNKNAAIKLSISNSNNFEVGPPAFRIASGKIVCVSHETIKKVKDIFTDSFSKVIKENNENKSKICQTKIMAGCYEALDDSEDILHNSLDNDECSTHSHKVFADIQSEEILQHNQNMSGLEKVSKISPCDVSLETSDICKCSIGKLHKSVSSANTCGIFSTASGKSVQVSDASLQNARQVFSEIEDSTKQVFSKVLFKSNEHSDQLTREENTAIRTPEHLISQKGFSYNVVNSSAFSGFSTASGKQVSILESSLHKVKGVLEEFDLIRTEHSLHYSPTSRQNVSKILPRVDKRNPEHCVNSEMEKTCSKEFKLSNNLNVEGGSSENNHSIKVSPYLSQFQQDKQQLVLGTKVSLVENIHVLGKEQASPKNVKMEIGKTETFSDVPVKTNIEVCSTYSKDSENYFETEAVEIAKAFMEDDELTDSKLPSHATHSLFTCPENEEMVLSNSRIGKRRGEPLILVGEPSIKRNLLNEFDRIIENQEKSLKASKSTPD
SEQ ID NO:6
MPIGSKERPTFFEIFKTRCNKADLGPISLNWFEELSSEAPPYNSEPAEESEHKNNNYEPNLFKTPQRKPSYNQLASTPIIFKEQGLTLPLYQSPVKELDKFKLDLGRNVPNSRHKSLRTVKTKMDQADDVSCPLLNSCLSESPVVLQCTHVTPQRDKSVVCGSLFHTPKFVKGRQTPKHISESLGAEVDPDMSWSSSLATPPTLSSTVLIVRNEEASETVFPHDTTANVKSYFSNHDESLKKNDRFIASVTDSENTNQREAASHGFGKTSGNSFKVNSCKDHIGKSMPNVLEDEVYETVVDTSEEDSFSLCFSKCRTKNLQKVRTSKTRKKIFHEANADECEKSKNQVKEKYSFVSEVEPNDTDPLDSNVANQKPFESGSDKISKEVVPSLACEWSQLTLSGLNGAQMEKIPLLHISSCDQNISEKDLLDTENKRKKDFLTSENSLPRISSLPKSEKPLNEETVVNKRDEEQHLESHTDCILAVKQAISGTSPVASSFQGIKKSIFRIRESPKETFNASFSGHMTDPNFKKETEASESGLEIHTVCSQKEDSLCPNLIDNGSWPATTTQNSVALKNAGLISTLKKKTNKFIYAIHDETSYKGKKIPKDQKSELINCSAQFEANAFEAPLTFANADSGLLHSSVKRSCSQNDSEEPTLSLTSSFGTILRKCSRNETCSNNTVISQDLDYKEAKCNKEKLQLFITPEADSLSCLQEGQCENDPKSKKVSDIKEEVLAAACHPVQHSKVEYSDTDFQSQKSLLYDHENASTLILTPTSKDVLSNLVMISRGKESYKMSDKLKGNNYESDVELTKNIPMEKNQDVCALNENYKNVELLPPEKYMRVASPSRKVQFNQNTNLRVIQKNQEETTSISKITVNPDSEELFSDNENNFVFQVANERNNLALGNTKELHETDLTCVNEPIFKNSTMVLYGDTGDKQATQVSIKKDLVYVLAEENKNSVKQHIKMTLGQDLKSDISLNIDKIPEKNNDYMNKWAGLLGPISNHSFGGSFRTASNKEIKLSEHNIKKSKMFFKDIEEQYPTSLACVEIVNTLALDNQKKLSKPQSINTVSAHLQSSVVVSDCKNSHITPQMLFSKQDFNSNHNLTPSQKAEITELSTILEESGSQFEFTQFRKPSYILQKSTFEVPENQMTILKTTSEECRDADLHVIMNAPSIGQVDSSKQFEGTVEIKRKFAGLLKNDCNKSASGYLTDENEVGFRGFYSAHGTKLNVSTEALQKAVKLFSDIENISEETSAEVHPISLSSSKCHDSVVSMFKIENHNDKTVSEKNNKCQLILQNNIEMTTGTFVEEITENYKRNTENEDNKYTAASRNSHNLEFDGSDSSKNDTVCIHKDETDLLFTDQHNICLKLSGQFMKEGNTQIKEDLSDLTFLEVAKAQEACHGNTSNKEQLTATKTEQNIKDFETSDTFFQTASGKNISVAKESFNKIVNFFDQKPEELHNFSLNSELHSDIRKNKMDILSYEETDIVKHKILKESVPVGTGNQLVTFQGQPERDEKIKEPTLLGFHTASGKKVKIAKESLDKVKNLFDEKEQGTSEITSFSHQWAKTLKYREACKDLELACETIEITAAPKCKEMQNSLNNDKNLVSIETVVPPKLLSDNLCRQTENLKTSKSIFLKVKVHENVEKETAKSPATCYTNQSPYSVIENSALAFYTSCSRKTSVSQTSLLEAKKWLREGIFDGQPERINTADYVGNYLYENNSNSTIAENDKNHLSEKQDTYLSNSSMSNSYSYHSDEVYNDSGYLSKNKLDSGIEPVLKNVEDQKNTSFSKVISNVKDANAYPQTVNEDICVEELVTSSSPCKNKNAAIKLSISNSNNFEVGPPAFRIASGKIVCVSHETIKKVKDIFTDSFSKVIKENNENKSKICQTKIMAGCYEALDDSEDILHNSLDNDECSTHSHKVFADIQSEEILQHNQNMSGLEKVSKISPCDVSLETSDICKCSIGKLHKSVSSANTCGIFSTASGKSVQVSDASLQNARQVFSEIEDSTKQVFSKVLFKSNEHSDQLTREENTAIRTPEHLISQKGFSYNVVNSSAFSGFSTASGKQVSILESSLHKVKGVLEEFDLIRTEHSLHYSPTSRQNVSKILPRVDKRNPEHCVNSEMEKTCSKEFKLSNNLNVEGGSSENNHSIKVSPYLSQFQQDKQQLVLGTKVSLVENIHVLGKEQASPKNVKMEIGKTETFSDVPVKTNIEVCSTYSKDSENYFETEAVEIAKAFMEDDELTDSKLPSHATHSLFTCPENEEMVLSNSRIGKRRGEPLILVGEPSIKRNLLNEFDRIIENQEKSLNASKSTPD
Another objective of the invention is to provide a specific primer sequence for detecting the mutation site.
A specific primer for detecting the PIK3CA-K672N mutant as claimed in claim 1, wherein the upstream primer sequence of the specific primer is shown as SEQ ID NO. 3, and the downstream primer sequence is shown as SEQ ID NO. 4, and the specific primer is used for detecting G.179230121A > C site mutation of the PIK3CA gene.
The method for detecting the g.179230121A > C mutant of the PIK3CA locus of the breast cancer related gene detects the existence of the mutant gene by carrying out targeted amplification on a target part containing the mutant gene by a gene amplification method. The detection method comprises the following steps:
(1) extracting DNA in a sample to be detected;
(2) carrying out PCR reaction by using the DNA as a template and aiming at a PCR primer designed by the DNA sequence of the g.179230121A > C mutant region of the PIK3CA gene to obtain a PCR reaction product;
(3) measuring the nucleotide sequence composition of the PCR reaction product;
(4) the nucleotide sequence was compared with the sequence of the wild-type gene of PIK3CA to determine whether there was a mutation at PIK3CA site g.179230121A > C. The nucleotide sequence composition of the PCR reaction product can be used for sequencing the PCR reaction product through a sequencer.
The detection of the g.179230121A > C mutant at the site of the breast cancer related gene PIK3CA specifically comprises the following steps:
(1) designing a primer: designing primers through Oligo 6.0 primer software according to PIK3CA gene (sequence number: NC-000003.12) recorded by the GenBank of National Center for Biotechnology Information (NCBI), and finally determining 1 pair of specific oligonucleotide primer sequences, wherein the sequence of an upstream primer is shown as SEQID NO. 3 in Table 1; the sequence of the downstream primer is shown as SEQID NO. 4, and the length of the amplified product fragment is 166 bp.
TABLE 1 related mutation site oligonucleotide primer sequences
Note: f ═ forward primer sequence; r ═ reverse primer sequence
(2) Amplification of the g.179230121A > C mutant of the PIK3CA gene: the total volume of the reaction system is 50 mu L; wherein the PCR-contained 5 Xbuffer solution is 10 mu L, the DNA template is 5.0 mu L, 1U/. mu.L Taq polymerase is 1.0 mu L, the MgCl2 final concentration is 2.0mmol/L, the dNTP final concentration is 200nmol/L, and the specific forward primer and reverse primer final concentrations are both 200 nmol/L; adding sterilized double distilled water to the total volume of the reaction system to be 50 mu L; and (2) reacting the reaction system in a PCR instrument under the following reaction conditions: pre-denaturation at 95 ℃ for 5min, followed by denaturation at 94 ℃ for 35s, followed by annealing at 59 ℃ for 40s, and extension at 72 ℃ for 40s in sequence for 32 cycles.
(3) Detection of PIK3CA gene g.179220986A > T mutant: and (3) carrying out electrophoresis on the amplified product obtained in the step (2) by using an agarose gel to detect whether the amplified product contains the target fragment.
EXAMPLE 1 preparation of DNA template
The method adopts a purchased kit to extract the whole blood genome DNA, and comprises the following specific steps:
(1) one sterile 2.0mL centrifuge tube was added to 1mL of cell lysate.
(2) Gently shaking the whole blood sample anticoagulated by EDTA until the whole blood sample is thoroughly mixed; and then, sucking 500 mu L of blood sample, adding the blood sample into the centrifuge tube containing the cell lysate, and slightly pouring the centrifuge tube for 5-6 times to mix uniformly.
(3) Incubate for 10 minutes at room temperature (during which the tube is inverted for 2-3 times and mixed).
(4) Centrifuge at 12000rpm for 5 minutes at room temperature.
(5) The supernatant was removed as slowly as possible with a pipette, taking care not to aspirate the white material at the interface between the two phases.
(6) Mix vigorously using a vortex shaker (Votex) until the leukocytes are resuspended (10-15 seconds).
(7) To the resuspended cell solution was added 300. mu.L of the lysis solution. And sucking and discharging the solution by using a pipette tip for 5-6 times to crack the white blood cells. At which point the solution should become very viscous. If a clump of cells is visible after mixing, the solution is incubated at 37 ℃ until the clump dissipates. If cell clumps remain visible after 1 hour of incubation, an additional 100. mu.L of nuclear lysate is added and incubation at 37 ℃ is repeated.
(8) And adding 100 mu L of protein precipitation solution into the nuclear lysate, and violently shaking for 10-20 seconds by using a vortex oscillator.
(9) Centrifuge at 12000rpm for 5 minutes at room temperature.
(10) The supernatant was transferred to a correspondingly numbered 2.0mL centrifuge tube to which 300. mu.L of room temperature isopropanol had been added.
(11) The solution was mixed by gentle inversion until a white linear DNA precipitate formed.
(12) Centrifuge at 12000rpm for 1 min at room temperature.
(13) The supernatant was discarded, and a volume of room temperature 70% ethanol equal to the volume of the sample was added, and the tube was gently inverted several times.
(14) The ethanol solution was removed as slowly as possible by pipette. And (3) baking the centrifugal tube at 50 ℃ for 5-10 minutes to completely volatilize the residual ethanol solution as much as possible.
(15) Adding 50-100 mu L of DNA dissolving solution into a centrifuge tube, and gently mixing uniformly.
(16) And (3) evaluating the DNA extraction effect by using 1% agarose gel electrophoresis, detecting the content by using a Nanodrop nucleic acid instrument, quantifying to 20-50 ng/. mu.L, and storing at-20 ℃.
Example 2 technical scheme for detecting PIK3CA gene g.179230121A > C mutant gene:
the instrument comprises the following steps: veriti96 PCR instrument, BIO-RADGELDocXR + gel imager (Berle, USA), and gel electrophoresis instrument (Hexay, Beijing).
Reagent: QIAampDNA extraction kit (Qiagen, Germany); DNAIsolationKit extraction kit (PELFREEZ corporation, beijing); PCR buffer, dNTP, Taq enzyme (ABI, USA); the primers were synthesized by Shanghai Biometrics, Inc.
(1) Amplification of the g.179230121A > C mutant of the PIK3CA gene: total volume of reaction: 50 μ L, containing PCR5 Xbuffer 10 μ L, DNA template 5.0 μ L, Taq polymerase (1U/. mu.L) 1.0 μ L, MgCl2 final concentration of 2.0mmol/L, dNTP final concentration of 200nmol/L, and specific upper and lower primer final concentration of 200nmol/L, and adding sterile double distilled water to a total volume of 50 μ L.
Reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min followed by denaturation at 94 ℃ for 35 sec followed by annealing at 59 ℃ for 40 sec and extension at 72 ℃ for 40 sec for 32 cycles.
(2) Detection of G.179230121A > C mutant gene of PIK3CA gene: the amplified product obtained in step (1) was subjected to electrophoresis using 1.5% agarose gel to detect the presence or absence of the desired fragment. And observing and photographing the result by a gel imager, and displaying the PCR product as a single band after electrophoresis without a miscellaneous band, thus prompting that the PCR product is single and has no non-specific amplification. If the position of the stripe is in a position with proper size, the target segment is obtained. As shown in fig. 1, M: 50bp gradient molecular weight markers, 1: blank control, 2: wild-type control, 3: PIK3CA gene g.179230121A > C mutation sample.
(3) And (3) purifying an amplification product: in the research, an Agarose Gel DNA Purification Kit of Takara company is adopted, and a PCR product subjected to Agarose Gel electrophoresis is purified and recovered to prepare sequencing.
(5) Sanger sequencing and result judgment: the purified PCR product was sequenced on an ABI3730 type fully automatic DNA sequencer. The sequencing results were aligned with the PIK3CA wild-type Reference Sequence (NCBI Reference Sequence: NC-000003.12) and the results were reported as a function of the actual mutation. The gene mutation thus detected is shown in FIG. 2, and the arrow in the figure indicates the g.179230121A > C mutation of PIK3CA gene.
The above description is only of the preferred embodiments of the present invention, and it should be noted that: it will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the principles of the invention and these are intended to be within the scope of the invention.
Sequence listing
<110> fifth people hospital in Wuxi city
<120> breast cancer related gene PIK3CA-Q928H mutant and specific primer thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 407
<212> DNA
<213> Homo sapiens
<400> 1
cagggaacat ctggaaattt ccttagaaac ccatgaaaac ttcacaatct caaaatcttt 60
ggacataatt tccttattcg ttgtcagtga ttgttttcat tgtttaaatg gaaacttgca 120
ccctgttttc ttttctcaag ttggcctgaa tcactatatt tccatactac tcatgaggtg 180
tttattcttt gtagatatga tgcagccatt gacctgttta cacgttcatg tgctggatac 240
tgtgtagcta ccttcatttt gggaattgga gatcgtcaca atagtaacat catggtgaaa 300
gacgatggac aagtaatggt tttctctgtt taaaatgttt tggtgttctt aatttattca 360
agacattttg tatctgcata tatcaaacta taacataatt tcttatt 407
<210> 2
<211> 407
<212> DNA
<213> Homo sapiens
<400> 2
cagggaacat ctggaaattt ccttagaaac ccatgaaaac ttcacaatct caaaatcttt 60
ggacataatt tccttattcg ttgtcagtga ttgttttcat tgtttaaatg gaaacttgca 120
ccctgttttc ttttctcaag ttggcctgaa tcactatatt tccatactac tcatgaggtg 180
tttattcttt gtagatatga tgcagccatt gacctgttta cacgttcatg tgctggatac 240
tgtgtagcta ccttcatttt gggaattgga gatcgtcaca atagtaacat catggtgaaa 300
gacgatggac acgtaatggt tttctctgtt taaaatgttt tggtgttctt aatttattca 360
agacattttg tatctgcata tatcaaacta taacataatt tcttatt 407
<210> 3
<211> 28
<212> DNA
<213> Homo sapiens
<400> 3
taacatcatg gtgaaagacg atggacac 28
<210> 4
<211> 26
<212> DNA
<213> Homo sapiens
<400> 4
tgatccaaaa agtgtccaaa atctat 26
<210> 5
<211> 946
<212> PRT
<213> Homo sapiens
<400> 5
Met Pro Pro Arg Pro Ser Ser Gly Glu Leu Trp Gly Ile His Leu Met
1 5 10 15
Pro Pro Arg Ile Leu Val Glu Cys Leu Leu Pro Asn Gly Met Ile Val
20 25 30
Thr Leu Glu Cys Leu Arg Glu Ala Thr Leu Ile Thr Ile Lys His Glu
35 40 45
Leu Phe Lys Glu Ala Arg Lys Tyr Pro Leu His Gln Leu Leu Gln Asp
50 55 60
Glu Ser Ser Tyr Ile Phe Val Ser Val Thr Gln Glu Ala Glu Arg Glu
65 70 75 80
Glu Phe Phe Asp Glu Thr Arg Arg Leu Cys Asp Leu Arg Leu Phe Gln
85 90 95
Pro Phe Leu Lys Val Ile Glu Pro Val Gly Asn Arg Glu Glu Lys Ile
100 105 110
Leu Asn Arg Glu Ile Gly Phe Ala Ile Gly Met Pro Val Cys Glu Phe
115 120 125
Asp Met Val Lys Asp Pro Glu Val Gln Asp Phe Arg Arg Asn Ile Leu
130 135 140
Asn Val Cys Lys Glu Ala Val Asp Leu Arg Asp Leu Asn Ser Pro His
145 150 155 160
Ser Arg Ala Met Tyr Val Tyr Pro Pro Asn Val Glu Ser Ser Pro Glu
165 170 175
Leu Pro Lys His Ile Tyr Asn Lys Leu Asp Lys Gly Gln Ile Ile Val
180 185 190
Val Ile Trp Val Ile Val Ser Pro Asn Asn Asp Lys Gln Lys Tyr Thr
195 200 205
Leu Lys Ile Asn His Asp Cys Val Pro Glu Gln Val Ile Ala Glu Ala
210 215 220
Ile Arg Lys Lys Thr Arg Ser Met Leu Leu Ser Ser Glu Gln Leu Lys
225 230 235 240
Leu Cys Val Leu Glu Tyr Gln Gly Lys Tyr Ile Leu Lys Val Cys Gly
245 250 255
Cys Asp Glu Tyr Phe Leu Glu Lys Tyr Pro Leu Ser Gln Tyr Lys Tyr
260 265 270
Ile Arg Ser Cys Ile Met Leu Gly Arg Met Pro Asn Leu Met Leu Met
275 280 285
Ala Lys Glu Ser Leu Tyr Ser Gln Leu Pro Met Asp Cys Phe Thr Met
290 295 300
Pro Ser Tyr Ser Arg Arg Ile Ser Thr Ala Thr Pro Tyr Met Asn Gly
305 310 315 320
Glu Thr Ser Thr Lys Ser Leu Trp Val Ile Asn Ser Ala Leu Arg Ile
325 330 335
Lys Ile Leu Cys Ala Thr Tyr Val Asn Val Asn Ile Arg Asp Ile Asp
340 345 350
Lys Ile Tyr Val Arg Thr Gly Ile Tyr His Gly Gly Glu Pro Leu Cys
355 360 365
Asp Asn Val Asn Thr Gln Arg Val Pro Cys Ser Asn Pro Arg Trp Asn
370 375 380
Glu Trp Leu Asn Tyr Asp Ile Tyr Ile Pro Asp Leu Pro Arg Ala Ala
385 390 395 400
Arg Leu Cys Leu Ser Ile Cys Ser Val Lys Gly Arg Lys Gly Ala Lys
405 410 415
Glu Glu His Cys Pro Leu Ala Trp Gly Asn Ile Asn Leu Phe Asp Tyr
420 425 430
Thr Asp Thr Leu Val Ser Gly Lys Met Ala Leu Asn Leu Trp Pro Val
435 440 445
Pro His Gly Leu Glu Asp Leu Leu Asn Pro Ile Gly Val Thr Gly Ser
450 455 460
Asn Pro Asn Lys Glu Thr Pro Cys Leu Glu Leu Glu Phe Asp Trp Phe
465 470 475 480
Ser Ser Val Val Lys Phe Pro Asp Met Ser Val Ile Glu Glu His Ala
485 490 495
Asn Trp Ser Val Ser Arg Glu Ala Gly Phe Ser Tyr Ser His Ala Gly
500 505 510
Leu Ser Asn Arg Leu Ala Arg Asp Asn Glu Leu Arg Glu Asn Asp Lys
515 520 525
Glu Gln Leu Lys Ala Ile Ser Thr Arg Asp Pro Leu Ser Glu Ile Thr
530 535 540
Glu Gln Glu Lys Asp Phe Leu Trp Ser His Arg His Tyr Cys Val Thr
545 550 555 560
Ile Pro Glu Ile Leu Pro Lys Leu Leu Leu Ser Val Lys Trp Asn Ser
565 570 575
Arg Asp Glu Val Ala Gln Met Tyr Cys Leu Val Lys Asp Trp Pro Pro
580 585 590
Ile Lys Pro Glu Gln Ala Met Glu Leu Leu Asp Cys Asn Tyr Pro Asp
595 600 605
Pro Met Val Arg Gly Phe Ala Val Arg Cys Leu Glu Lys Tyr Leu Thr
610 615 620
Asp Asp Lys Leu Ser Gln Tyr Leu Ile Gln Leu Val Gln Val Leu Lys
625 630 635 640
Tyr Glu Gln Tyr Leu Asp Asn Leu Leu Val Arg Phe Leu Leu Lys Lys
645 650 655
Ala Leu Thr Asn Gln Arg Ile Gly His Phe Phe Phe Trp His Leu Lys
660 665 670
Ser Glu Met His Asn Lys Thr Val Ser Gln Arg Phe Gly Leu Leu Leu
675 680 685
Glu Ser Tyr Cys Arg Ala Cys Gly Met Tyr Leu Lys His Leu Asn Arg
690 695 700
Gln Val Glu Ala Met Glu Lys Leu Ile Asn Leu Thr Asp Ile Leu Lys
705 710 715 720
Gln Glu Lys Lys Asp Glu Thr Gln Lys Val Gln Met Lys Phe Leu Val
725 730 735
Glu Gln Met Arg Arg Pro Asp Phe Met Asp Ala Leu Gln Gly Phe Leu
740 745 750
Ser Pro Leu Asn Pro Ala His Gln Leu Gly Asn Leu Arg Leu Glu Glu
755 760 765
Cys Arg Ile Met Ser Ser Ala Lys Arg Pro Leu Trp Leu Asn Trp Glu
770 775 780
Asn Pro Asp Ile Met Ser Glu Leu Leu Phe Gln Asn Asn Glu Ile Ile
785 790 795 800
Phe Lys Asn Gly Asp Asp Leu Arg Gln Asp Met Leu Thr Leu Gln Ile
805 810 815
Ile Arg Ile Met Glu Asn Ile Trp Gln Asn Gln Gly Leu Asp Leu Arg
820 825 830
Met Leu Pro Tyr Gly Cys Leu Ser Ile Gly Asp Cys Val Gly Leu Ile
835 840 845
Glu Val Val Arg Asn Ser His Thr Ile Met Gln Ile Gln Cys Lys Gly
850 855 860
Gly Leu Lys Gly Ala Leu Gln Phe Asn Ser His Thr Leu His Gln Trp
865 870 875 880
Leu Lys Asp Lys Asn Lys Gly Glu Ile Tyr Asp Ala Ala Ile Asp Leu
885 890 895
Phe Thr Arg Ser Cys Ala Gly Tyr Cys Val Ala Thr Phe Ile Leu Gly
900 905 910
Ile Gly Asp Arg His Asn Ser Asn Ile Met Val Lys Asp Asp Gly Gln
915 920 925
Leu Phe His Ile Asp Phe Gly His Phe Leu Asp His Lys Lys Lys Lys
930 935 940
Phe Gly
945
<210> 6
<211> 946
<212> PRT
<213> Homo sapiens
<400> 6
Met Pro Pro Arg Pro Ser Ser Gly Glu Leu Trp Gly Ile His Leu Met
1 5 10 15
Pro Pro Arg Ile Leu Val Glu Cys Leu Leu Pro Asn Gly Met Ile Val
20 25 30
Thr Leu Glu Cys Leu Arg Glu Ala Thr Leu Ile Thr Ile Lys His Glu
35 40 45
Leu Phe Lys Glu Ala Arg Lys Tyr Pro Leu His Gln Leu Leu Gln Asp
50 55 60
Glu Ser Ser Tyr Ile Phe Val Ser Val Thr Gln Glu Ala Glu Arg Glu
65 70 75 80
Glu Phe Phe Asp Glu Thr Arg Arg Leu Cys Asp Leu Arg Leu Phe Gln
85 90 95
Pro Phe Leu Lys Val Ile Glu Pro Val Gly Asn Arg Glu Glu Lys Ile
100 105 110
Leu Asn Arg Glu Ile Gly Phe Ala Ile Gly Met Pro Val Cys Glu Phe
115 120 125
Asp Met Val Lys Asp Pro Glu Val Gln Asp Phe Arg Arg Asn Ile Leu
130 135 140
Asn Val Cys Lys Glu Ala Val Asp Leu Arg Asp Leu Asn Ser Pro His
145 150 155 160
Ser Arg Ala Met Tyr Val Tyr Pro Pro Asn Val Glu Ser Ser Pro Glu
165 170 175
Leu Pro Lys His Ile Tyr Asn Lys Leu Asp Lys Gly Gln Ile Ile Val
180 185 190
Val Ile Trp Val Ile Val Ser Pro Asn Asn Asp Lys Gln Lys Tyr Thr
195 200 205
Leu Lys Ile Asn His Asp Cys Val Pro Glu Gln Val Ile Ala Glu Ala
210 215 220
Ile Arg Lys Lys Thr Arg Ser Met Leu Leu Ser Ser Glu Gln Leu Lys
225 230 235 240
Leu Cys Val Leu Glu Tyr Gln Gly Lys Tyr Ile Leu Lys Val Cys Gly
245 250 255
Cys Asp Glu Tyr Phe Leu Glu Lys Tyr Pro Leu Ser Gln Tyr Lys Tyr
260 265 270
Ile Arg Ser Cys Ile Met Leu Gly Arg Met Pro Asn Leu Met Leu Met
275 280 285
Ala Lys Glu Ser Leu Tyr Ser Gln Leu Pro Met Asp Cys Phe Thr Met
290 295 300
Pro Ser Tyr Ser Arg Arg Ile Ser Thr Ala Thr Pro Tyr Met Asn Gly
305 310 315 320
Glu Thr Ser Thr Lys Ser Leu Trp Val Ile Asn Ser Ala Leu Arg Ile
325 330 335
Lys Ile Leu Cys Ala Thr Tyr Val Asn Val Asn Ile Arg Asp Ile Asp
340 345 350
Lys Ile Tyr Val Arg Thr Gly Ile Tyr His Gly Gly Glu Pro Leu Cys
355 360 365
Asp Asn Val Asn Thr Gln Arg Val Pro Cys Ser Asn Pro Arg Trp Asn
370 375 380
Glu Trp Leu Asn Tyr Asp Ile Tyr Ile Pro Asp Leu Pro Arg Ala Ala
385 390 395 400
Arg Leu Cys Leu Ser Ile Cys Ser Val Lys Gly Arg Lys Gly Ala Lys
405 410 415
Glu Glu His Cys Pro Leu Ala Trp Gly Asn Ile Asn Leu Phe Asp Tyr
420 425 430
Thr Asp Thr Leu Val Ser Gly Lys Met Ala Leu Asn Leu Trp Pro Val
435 440 445
Pro His Gly Leu Glu Asp Leu Leu Asn Pro Ile Gly Val Thr Gly Ser
450 455 460
Asn Pro Asn Lys Glu Thr Pro Cys Leu Glu Leu Glu Phe Asp Trp Phe
465 470 475 480
Ser Ser Val Val Lys Phe Pro Asp Met Ser Val Ile Glu Glu His Ala
485 490 495
Asn Trp Ser Val Ser Arg Glu Ala Gly Phe Ser Tyr Ser His Ala Gly
500 505 510
Leu Ser Asn Arg Leu Ala Arg Asp Asn Glu Leu Arg Glu Asn Asp Lys
515 520 525
Glu Gln Leu Lys Ala Ile Ser Thr Arg Asp Pro Leu Ser Glu Ile Thr
530 535 540
Glu Gln Glu Lys Asp Phe Leu Trp Ser His Arg His Tyr Cys Val Thr
545 550 555 560
Ile Pro Glu Ile Leu Pro Lys Leu Leu Leu Ser Val Lys Trp Asn Ser
565 570 575
Arg Asp Glu Val Ala Gln Met Tyr Cys Leu Val Lys Asp Trp Pro Pro
580 585 590
Ile Lys Pro Glu Gln Ala Met Glu Leu Leu Asp Cys Asn Tyr Pro Asp
595 600 605
Pro Met Val Arg Gly Phe Ala Val Arg Cys Leu Glu Lys Tyr Leu Thr
610 615 620
Asp Asp Lys Leu Ser Gln Tyr Leu Ile Gln Leu Val Gln Val Leu Lys
625 630 635 640
Tyr Glu Gln Tyr Leu Asp Asn Leu Leu Val Arg Phe Leu Leu Lys Lys
645 650 655
Ala Leu Thr Asn Gln Arg Ile Gly His Phe Phe Phe Trp His Leu Lys
660 665 670
Ser Glu Met His Asn Lys Thr Val Ser Gln Arg Phe Gly Leu Leu Leu
675 680 685
Glu Ser Tyr Cys Arg Ala Cys Gly Met Tyr Leu Lys His Leu Asn Arg
690 695 700
Gln Val Glu Ala Met Glu Lys Leu Ile Asn Leu Thr Asp Ile Leu Lys
705 710 715 720
Gln Glu Lys Lys Asp Glu Thr Gln Lys Val Gln Met Lys Phe Leu Val
725 730 735
Glu Gln Met Arg Arg Pro Asp Phe Met Asp Ala Leu Gln Gly Phe Leu
740 745 750
Ser Pro Leu Asn Pro Ala His Gln Leu Gly Asn Leu Arg Leu Glu Glu
755 760 765
Cys Arg Ile Met Ser Ser Ala Lys Arg Pro Leu Trp Leu Asn Trp Glu
770 775 780
Asn Pro Asp Ile Met Ser Glu Leu Leu Phe Gln Asn Asn Glu Ile Ile
785 790 795 800
Phe Lys Asn Gly Asp Asp Leu Arg Gln Asp Met Leu Thr Leu Gln Ile
805 810 815
Ile Arg Ile Met Glu Asn Ile Trp Gln Asn Gln Gly Leu Asp Leu Arg
820 825 830
Met Leu Pro Tyr Gly Cys Leu Ser Ile Gly Asp Cys Val Gly Leu Ile
835 840 845
Glu Val Val Arg Asn Ser His Thr Ile Met Gln Ile Gln Cys Lys Gly
850 855 860
Gly Leu Lys Gly Ala Leu Gln Phe Asn Ser His Thr Leu His Gln Trp
865 870 875 880
Leu Lys Asp Lys Asn Lys Gly Glu Ile Tyr Asp Ala Ala Ile Asp Leu
885 890 895
Phe Thr Arg Ser Cys Ala Gly Tyr Cys Val Ala Thr Phe Ile Leu Gly
900 905 910
Ile Gly Asp Arg His Asn Ser Asn Ile Met Val Lys Asp Asp Gly His
915 920 925
Leu Phe His Ile Asp Phe Gly His Phe Leu Asp His Lys Lys Lys Lys
930 935 940
Phe Gly
945
Claims (2)
1. A mutant of a breast cancer related gene PIK3CA-Q928H, which is characterized in that: compared with the normal gene sequence of PIK3CA, the mutant gene has g.179230121A > C site mutation; the G.179230121A > C site mutation of the PIK3CA gene refers to that the 312 th base A of the SEQ ID NO. 1 sequence of the mutation site is mutated into C.
2. A specific primer for detecting the PIK3CA-K672N mutant of claim 1, wherein: the upstream primer sequence of the specific primer is shown as SEQ ID NO. 3, the downstream primer sequence is shown as SEQ ID NO. 4, and the specific primer is used for detecting G.179230121A > C site mutation of PIK3CA gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110361334.1A CN112941187A (en) | 2021-04-02 | 2021-04-02 | Breast cancer related gene PIK3CA-Q928H mutant and specific primer thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110361334.1A CN112941187A (en) | 2021-04-02 | 2021-04-02 | Breast cancer related gene PIK3CA-Q928H mutant and specific primer thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112941187A true CN112941187A (en) | 2021-06-11 |
Family
ID=76232253
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110361334.1A Pending CN112941187A (en) | 2021-04-02 | 2021-04-02 | Breast cancer related gene PIK3CA-Q928H mutant and specific primer thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112941187A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110038862A1 (en) * | 2008-02-21 | 2011-02-17 | Universite Libre De Bruxelles | Method and kit for the detection of genes associated with pik3ca mutation and involved in pi3k/akt pathway activation in the er-postitive and her2-positive subtypes with clinical implications |
| US20130317037A1 (en) * | 2010-11-16 | 2013-11-28 | Glaxosmithkline Intellectual Property Development Limited | Method of administration and treatment |
| CN105238799A (en) * | 2015-10-19 | 2016-01-13 | 昆明理工大学 | Breast cancer PIK3CA mutant gene and application thereof |
| CN109913482A (en) * | 2019-04-24 | 2019-06-21 | 无锡市第五人民医院 | PIK3CA-I874R mutated gene and its application in Computer-aided Diagnosis of Breast Cancer |
| CN111154883A (en) * | 2020-03-10 | 2020-05-15 | 无锡市第五人民医院 | Breast cancer related gene PIK3CA site g.179220986A & gtT mutant and application thereof |
-
2021
- 2021-04-02 CN CN202110361334.1A patent/CN112941187A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110038862A1 (en) * | 2008-02-21 | 2011-02-17 | Universite Libre De Bruxelles | Method and kit for the detection of genes associated with pik3ca mutation and involved in pi3k/akt pathway activation in the er-postitive and her2-positive subtypes with clinical implications |
| US20130317037A1 (en) * | 2010-11-16 | 2013-11-28 | Glaxosmithkline Intellectual Property Development Limited | Method of administration and treatment |
| CN105238799A (en) * | 2015-10-19 | 2016-01-13 | 昆明理工大学 | Breast cancer PIK3CA mutant gene and application thereof |
| CN109913482A (en) * | 2019-04-24 | 2019-06-21 | 无锡市第五人民医院 | PIK3CA-I874R mutated gene and its application in Computer-aided Diagnosis of Breast Cancer |
| CN111154883A (en) * | 2020-03-10 | 2020-05-15 | 无锡市第五人民医院 | Breast cancer related gene PIK3CA site g.179220986A & gtT mutant and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| AMAURY G，等: "The favorable impact of PIK3CA mutations on survival: an analysis of 2587 patients with breast cancer", 《癌症》 * |
| 李鑫，等: "PIK3CA基因突变与乳腺癌的关系", 《中华乳腺病杂志(电子版)》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109097477B (en) | circRNA marker for breast cancer diagnosis and application thereof | |
| CN106148498B (en) | KRAS gene mutation detection kit and application thereof | |
| CN111088365B (en) | Primer and kit for detecting thyroid cancer RET gene mutation and fusion | |
| CN102776286B (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN109913482B (en) | PIK3CA-I874R mutant gene and application thereof in auxiliary diagnosis of breast cancer | |
| CN106148497A (en) | BRAF gene mutation detection kit and application thereof | |
| CN111304332B (en) | Detection of breast cancer related gene BRCA2 site g.32336265G & gtT mutant | |
| CN111154883B (en) | Breast cancer related gene PIK3CA site g.179220986A & gtT mutant and application thereof | |
| CN110029167B (en) | ERBB2-G519V mutant gene and application thereof in breast cancer auxiliary diagnosis | |
| CN109234396A (en) | A kind of g.32336534T > C mutant and its application of the site breast cancer susceptibility gene BRCA2 | |
| CN109457031B (en) | BRCA2 gene g.32338309A & gtG mutant and application thereof in breast cancer auxiliary diagnosis | |
| CN107937524A (en) | Mankind's KRAS gene mutation detection kit and detection method | |
| CN109913481B (en) | PIK3CA gene g.179224821G & gtA mutation and application thereof in breast cancer auxiliary diagnosis | |
| CN109593849B (en) | Plasma LncRNA marker related to colorectal cancer and application thereof | |
| CN107354197B (en) | Kit for detecting human NRAS gene mutation | |
| CN111154875A (en) | Breast cancer gene ERBB2 site g.39397711928A > G mutant and application thereof | |
| CN112941187A (en) | Breast cancer related gene PIK3CA-Q928H mutant and specific primer thereof | |
| CN110055258B (en) | Breast cancer related gene ERBB2 site g.3939700G > A mutant and application thereof | |
| CN111139301B (en) | Breast cancer related gene ERBB2 site g.39397319C > A mutant and application thereof | |
| Cordeiro et al. | A pilot study on Hla-G locus control region haplotypes and cervical intraepithelial neoplasias | |
| KR101918342B1 (en) | Methods for detecting hepatitis B virus surface gene non-sense mutations | |
| CN112941186B (en) | Breast cancer susceptibility gene BRCA2-K2305N mutant and specific primer thereof | |
| CN111154874A (en) | Breast cancer susceptibility gene BRCA2 site g.32332272G & gtA mutant and application thereof | |
| CN108866199B (en) | mRNA marker for breast cancer diagnosis, detection kit and application thereof | |
| Herreros-Villanueva et al. | No evidence for JAK 2 V617F mutation in colorectal cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20210611 |