CN112877333A

CN112877333A - Aptamer for specifically recognizing integrin beta 3 subunit protein and application thereof

Info

Publication number: CN112877333A
Application number: CN202110212754.3A
Authority: CN
Inventors: 杜玉珍; 滕小艳; 汪俊彦; 魏丽荣; 胡刘平
Original assignee: Shanghai Sixth Peoples Hospital
Current assignee: Shanghai Sixth Peoples Hospital
Priority date: 2021-02-25
Filing date: 2021-02-25
Publication date: 2021-06-01

Abstract

The invention relates to a nucleic acid aptamer for specifically recognizing integrin beta 3 subunit protein, which is selected from a sequence shown in SEQ ID NO. 1-10; or a sequence which is selected from the sequences shown in SEQ ID NO.1-10 and is subjected to label modification; or a sequence selected from the sequences shown in SEQ ID NO.1-10 after the substitution, deletion or addition of a plurality of nucleotides. The aptamers of the invention have many advantages over traditional antibodies: the preparation method has the advantages of no immunogenicity, difficult inactivation, easy synthesis and modification, mass production, rapid tissue penetration, good metabolic kinetics, small difference between product batches and good chemical stability. The short-chain aptamer provided by the invention is used and is added with a modification marker, the integrin beta 3 subunit protein can be identified and detected, the process is quick and simple, and a new thought is provided for early detection and clinical treatment of malignant tumor bone metastasis.

Description

Aptamer for specifically recognizing integrin beta 3 subunit protein and application thereof

Technical Field

The invention relates to the technical field of protein detection, in particular to a nucleic acid aptamer for specifically recognizing integrin beta 3 subunit protein and application thereof.

Background

Exosomes (TDEs) secreted by tumor cells play an important "bridge" role in the paternity and official metastasis of tumors. The TDEs membrane surface has the surface characteristics of tumor cells and also has the characteristics of binding with organs to be transferred. Integrins on the exosome membrane mediate the paternity of metastasis, and integrins α 2b β 3, α v β 3 are associated with the paternity of bone metastasis. The integrins α v β 3 and α 2b β 3 can bind to bone matrix cytokines such as Osteopontin (OPN), Bone Sialoprotein (BSP) and Fibronectin (FN) to promote the adhesion of the bone matrix microenvironment to tumor cells. B16 melanoma cells were injected into the left ventricle of β 3+/+ and β 3-/-mice, and it was found that 74% of the β 3+/+ mice developed osteolytic bone metastases within 14 days, while only 4% of the β 3-/-mice developed bone lesions. Therefore, integrin beta 3 subunit on TDEs membrane may mediate osteotropic metastasis of lung cancer.

The conventional method for identifying integrin beta 3 subunit protein is polyclonal or monoclonal antibody labeling technology, i.e. the method identifies integrin beta 3 subunit protein on the cell surface or membrane surface by the principle of antigen-antibody specific binding. The production of the antibody needs a complex genetic engineering technology, and the production cost is high; meanwhile, in use, the defects of large batch difference, immunogenicity, poor tissue permeability, poor stability and the like exist.

Aptamers can be described as "chemical antibodies". It is a single-stranded oligonucleotide molecule (ssDNA or ssRNA) that is screened from a DNA/RNA library by exponential enrichment of the ligand phylogenetic method. The aptamer can recognize target molecules of the aptamer with high specificity and affinity by folding the molecular structure into a unique molecular structure through acting forces such as intramolecular base accumulation, hydrophobicity, hydrogen bonds, static electricity and the like. Compared with the complex technology of genetic engineering, the aptamer can be prepared by an automatic solid-phase synthesis method, and the multifunctional molecular recognition probe can be prepared by nucleic acid assembly and chemical crosslinking technology synthesis. Meanwhile, the aptamer also has the advantages of small batch-to-batch difference, no immunogenicity, rapid tissue permeability and the like. Therefore, the nucleic acid aptamer attracts the attention of researchers as a potential therapeutic drug.

The invention aims to overcome the defects of the prior art and provides a nucleic acid aptamer for specifically recognizing integrin beta 3 subunit protein and application thereof.

Disclosure of Invention

The invention aims to provide a nucleic acid aptamer for specifically recognizing integrin beta 3 subunit protein and application thereof, aiming at the defects in the prior art.

In order to achieve the purpose, the invention adopts the technical scheme that:

the first aspect of the invention provides a nucleic acid aptamer specifically recognizing integrin beta 3 subunit protein, wherein the nucleic acid aptamer is selected from a sequence shown as SEQ ID NO. 1-10; or a sequence which is selected from the sequences shown in SEQ ID NO.1-10 and is subjected to label modification; or a sequence selected from the sequences shown in SEQ ID NO.1-10 after the substitution, deletion or addition of a plurality of nucleotides.

Preferably, the synthesized aptamer random DNA library of the integrin beta 3 subunit protein is sequentially screened by adopting integrin beta 3 subunit pure protein, positively screened by adopting integrin beta 3 high-expression cells NCI-H460 and negatively screened by adopting integrin beta 3 non-expression cells Hela to obtain the sequence shown in SEQ ID NO. 1-10.

Preferably, the label modification is selected from the group consisting of a fluorescent label, a radioactive label, a therapeutic label, a biotin label, or an enzymatic label.

Preferably, the label is modified to be a fluorescent label.

The second aspect of the invention provides a method for specifically recognizing integrin beta 3 subunit protein by using the aptamer, wherein a cell sample to be detected dispersed in a binding buffer solution is incubated with the aptamer in a shaking table, after incubation is completed, the cell sample is centrifugally washed by using a washing buffer solution, and after washing is completed, the cell sample is detected by a flow cytometer.

Preferably, the binding buffer comprises: 0.45% glucose, 5mM magnesium chloride, 100mg/L tRNA and 1g/L BSA.

Preferably, the wash buffer comprises: 0.45% glucose and 5mM magnesium chloride.

Preferably, the detection is fluorescence detection.

By adopting the technical scheme, compared with the prior art, the invention has the following technical effects:

the invention provides a molecular marker of aptamer for identifying integrin beta 3 subunit for early diagnosis of malignant tumor bone metastasis. Compared to commercially available monoclonal antibodies, aptamers have many advantages: the preparation method has the advantages of no immunogenicity, difficult inactivation, easy synthesis and modification, mass production, rapid tissue penetration, good metabolic kinetics, small difference between product batches and good chemical stability. The invention can be used for early diagnosis and monitoring of malignant tumor bone metastasis, is sensitive and specific, can be used as a molecular marker for minimally invasive material taking, and provides a new means for early discovery, early diagnosis and early intervention of bone metastasis of lung cancer patients.

Drawings

FIG. 1 shows the binding of 10 candidate sequences to human lung adenocarcinoma epithelial cells NCI-H460 cell, wherein (A) shows the binding profile of 10 candidate sequences, library sequences and NCI-H460 cell flow and (B) shows the binding profile of 10 candidate sequences, library sequences and NCI-H460 cell confocal;

FIG. 2 shows the binding of 10 candidate sequences to human lung adenocarcinoma epithelial cells A549 cells, wherein (A) shows the binding patterns of 10 candidate sequences, library sequences and A549 cells in flow mode, and (B) shows the binding patterns of 10 candidate sequences, library sequences and A549 cells in confocal mode;

FIG. 3 is a diagram showing the flow-type binding of 10 candidate sequences, library sequences and human ovarian carcinoma epithelial cell Hela;

FIG. 4 shows dissociation equilibrium constants of the aptamer S9 and the H460 cell (A) and the A549 cell (B), and the aptamer S10 and the H460 cell (C) and the A549 cell (D).

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

It should be noted that the embodiments and features of the embodiments may be combined with each other without conflict.

The experimental methods in the following examples are all conventional methods unless otherwise specified; the experimental materials used were purchased from a conventional biochemical reagent store unless otherwise specified.

Cell source: the cell lines used in the experiment, namely the human lung adenocarcinoma epithelial cells (NCI-H460), the human lung adenocarcinoma epithelial cells (A549) and the human cervical cancer cells (Hela), are all derived from ATCC.

The invention is further described with reference to the following drawings and specific examples, which are not intended to be limiting.

Example 1: screening of integrin beta 3 subunit protein aptamers

Based on SELEX technology, firstly, the integrin beta 3 subunit pure protein is used for screening, then the integrin beta 3 high expression cell NCI-H460 is used for positive screening, and finally the integrin beta 3 non-expression cell Hela is used for negative screening, so as to obtain the expected target sequence: synthesizing a random DNA library and a primer screened by the aptamer of integrin beta 3 subunit protein; in the first to seventh screening rounds, screening the obtained ssDNA secondary library of A0-A7 by using integrin beta 3 subunit pure protein; in the eighth round and the ninth round of screening, the A7-ssDNA is subjected to two rounds of cell screening by using the integrin beta 3 high-expression cell H460 to obtain A8-ssDNA and A9-ssDNA; the secondary libraries A7-ssDNA, A8-ssDNA, A9-ssDNA were sent to Shanghai for secondary sequencing and comparative analysis.

226533 sequences are totally detected by the screening through a second-generation sequencing positive experiment group, the inventor carries out homology comparison on the sequences and constructs an evolutionary tree through MEGA7 software according to the nucleic acid sequences 200 before abundance ranking in three positive library cross sets, the sequence comparison is divided into different family trees, and finally 10 candidate nucleic acid sequences are selected, wherein the sequences meet the selection conditions (shown in the following) that the sequences are only combined with cells expressed by integrin beta 3, have high combination abundance and are distributed in different family trees.

SEQ ID NO.1：TTCAGCACTCCACGCATAGCTGGCTATTCCGAGATTCCTTGCGCGAACTTCGTTGCTACACCTATGCGTGCTACCGTGAA

SEQ ID NO.2：TTCAGCACTCCACGCATAGCACATGTAGTGTGTGCGCCACAATTTGGGGCAACCAACTGACCTATGCGTGCTACCGTGAA

SEQ ID NO.3：TTCAGCACTCCACGCATAGCATACCCTGCCGCAAGCAGCTAATATTGATTAGTGACCGCCCCTATGCGTGCTACCGTGAA

SEQ ID NO.4：TTCAGCACTCCACGCATAGCAGCCGAAGCGACAAGCTTGTGTAGAAGTTGGAAGCGTCCGCCTATGCGTGCTACCGTGAA

SEQ ID NO.5：TTCAGCACTCCACGCATAGCTTCTGACTGAATCGCTCGGTGTCGAAACAGGTGAGCCTTACCTATGCGTGCTACCGTGAA

SEQ ID NO.6：TTCAGCACTCCACGCATAGCTGTGTTCACAAGATAAAGGGCTCCTAGGCTATGTGCGTCTCCTATGCGTGCTACCGTGAA

SEQ ID NO.7：TTCAGCACTCCACGCATAGCGAAACGGTGCCATAAGATCAAGCCACATGACATGACCTTCCCTATGCGTGCTACCGTGAA

SEQ ID NO.8：TTCAGCACTCCACGCATAGCGAGACACGCAGTGTAGATGGTCAGGGCGTAGTTGAGCTTGCCTATGCGTGCTACCGTGAA

SEQ ID NO.9：TTCAGCACTCCACGCATAGCTGACTGCTCCTTAGGTGTGACCTAAAGTGTTCTGTTTTCGCCTATGCGTGCTACCGTGAA

SEQ ID NO.10：TTCAGCACTCCACGCATAGCTCCACGATGTAGGATCCACATGAGCGCTCCTGTTACCCTGCCTATGCGTGCTACCGTGAA

Example 2: determination of the sequence with the strongest specific binding ability to the NCI-H640 cell line

NCI-H460 cells were cultured for 24 hours, washed with PBS, and then lysed from the dishes by treatment with 0.2% EDTA. NCI-H460 cells were washed 2 times by centrifugation in washing buffer (PBS containing 0.45% glucose, 5mM magnesium chloride) and then dispersed (volume 100. mu.L) in binding buffer (PBS containing 0.45% glucose, 5mM magnesium chloride, 100mg/L tRNA, 1g/L BSA). Then, NCI-H460 cells were incubated with 200nM of fluorescein-labeled aptamer (SEQ ID NO.1-10) and random library, respectively, for 30min at 4 ℃ in a shaker. After completion of incubation, NCI-H460 cells were washed twice by centrifugation in wash buffer (1000. mu.L volume) and dispersed in wash buffer (300. mu.L volume). Finally, fluorescence detection was performed by flow cytometry (see fig. 1(a) for the results).

After the NCI-H460 cells were cultured for 24 hours, the NCI-H460 adherent cells were washed 2 times with PBS and binding buffer (volume 100. mu.L; PBS containing 0.45% glucose, 5mM magnesium chloride, 100mg/L tRNA, 1g/L BSA) was added. Then NCI-H460 cells were incubated with 200nM fluorescein-labeled aptamers (SEQ ID NO: 1-10) and random library, respectively, for 30min at 4 ℃ in a shaker. After incubation was complete, the cells were washed 3 times with wash buffer. Finally, fluorescence detection was performed by laser confocal (see FIG. 1 (B)).

According to the flow-type results shown in FIG. 1(A), 10 aptamer sequences can be combined with NCI-H460 cells, and the combination conditions of different fluorescence intensities are shown, and the curve deviation degrees can be compared; while the library sequences did not bind to NCI-H460 cells. Meanwhile, the confocal result in FIG. 1(B) is basically consistent with the flow result, and each sequence has a binding phenomenon with NCI-H460 cells, and has a green fluorescence phenomenon with different intensities on the surface or inside of the cell membrane, which is to say, the binding condition with the FITC-labeled aptamer is illustrated. The combined flow and confocal verification result shows that the aptamers S9 and S10 have the strongest binding capacity with NCI-H460 cells.

Example 3: determining the sequence with the strongest specific binding capacity to A549 cell line

A549 cells were cultured for 24 hours, washed with PBS, and then digested from the dishes by treatment with 0.2% EDTA. A549 cells were washed 2 times by centrifugation in washing buffer (PBS containing 0.45% glucose, 5mM magnesium chloride) and then dispersed (volume: 100. mu.L) in binding buffer (PBS containing 0.45% glucose, 5mM magnesium chloride, 100mg/L tRNA, 1g/L BSA). Then, A549 cells were incubated with 200nM fluorescein-labeled aptamer (SEQ ID NO.1-10) and random library, respectively, for 30min at 4 ℃ in a shaker. After completion of incubation, a549 cells were washed twice by centrifugation in wash buffer (volume 1000 μ L) and dispersed in wash buffer (volume 300 μ L). Finally, fluorescence detection was performed by flow cytometry (see fig. 2(a) for the results).

After 24 hours of culture of A549 cells, A549 adherent cells were washed 2 times with PBS and binding buffer (100. mu.L in volume; PBS containing 0.45% glucose, 5mM magnesium chloride, 100mg/L tRNA, 1g/L BSA) was added. Then, A549 cells were incubated with 200nM fluorescein-labeled aptamer (SEQ ID NO.1-10) and random library, respectively, in a shaker at 4 ℃ for 30 min. After incubation was complete, the cells were washed 3 times with wash buffer. Finally, fluorescence detection was performed by laser confocal (see FIG. 2 (B)).

According to the flow-type results of FIG. 2(A), 10 aptamer sequences can bind to A549 cells, and show binding conditions with different fluorescence intensities, and the curve deviation degrees can be compared; while library sequences did not bind to a549 cells. Meanwhile, the confocal result in fig. 2(B) is basically consistent with the flow result, and the binding phenomenon between each sequence and a549 cells occurs, and green fluorescence with different intensities appears on the surface or inside of the cell membrane, which indicates the binding condition with the FITC-labeled aptamer. The combined flow and confocal verification result shows that the aptamers S9 and S10 have the strongest binding capacity with A549 cells.

Example 4: determination that aptamer S1-S10 did not bind to Hela, an integrin beta 3-negative cell

Hela cells were cultured for 24 hours, washed with PBS, and then digested from the dishes by treatment with 0.2% EDTA. Hela cells were washed 2 times by centrifugation in washing buffer (PBS containing 0.45% glucose, 5mM magnesium chloride) and then dispersed (volume: 100. mu.L) in binding buffer (PBS containing 0.45% glucose, 5mM magnesium chloride, 100mg/L tRNA, 1g/L BSA). Then, Hela cells were incubated with 200nM fluorescein-labeled aptamers (SEQ ID NO.1-10) and random library, respectively, in a shaker at 4 ℃ for 30 min. After completion of incubation, a549 cells were washed twice by centrifugation in wash buffer (volume 1000 μ L) and dispersed in wash buffer (volume 300 μ L). Finally, fluorescence detection was performed by flow cytometry (see FIG. 3 for results).

According to the flow chart of FIG. 3, 10 aptamer sequences and library sequences were not combined with Hela cells.

Example 5: determination of strength and weakness of binding affinity of nucleic acid aptamers S9 and S10 to lung adenocarcinoma epithelial cells

The binding affinities of the aptamers S9 and S10 to lung adenocarcinoma epithelial cells (NCI-H460, a549) were further studied, comparing the superior degrees of the two. First, pre-treatment was performed for S9 and S10, using the following concentration gradient settings: 0nM, 20nM, 40nM, 60nM, 80nM, 100nM, 120nM, 150nM, 180nM, 200nM, 250nM, 300nM, 350 nM. At the same time, NCI-H460 and A549 adherent cells were washed 2 times with PBS, and 0.2% EDTA was added to digest the cells at 37 ℃. After washing 2 times with PBS, the cells were collected by pipetting in washing buffer (PBS, 0.45% glucose, 5mM magnesium chloride) into a centrifuge tube. After centrifugation, binding buffer (PBS containing 0.45% glucose, 5mM magnesium chloride, 100mg/L tRNA, 1g/L BSA) and the treated aptamer sequence and library were added. Sucking, beating, mixing, and incubating in a shaking table at 4 deg.C for 30 min. After the incubation was completed, the cells were washed 2 times by centrifugation with washing buffer. Fluorescence detection was performed by flow cytometry.

According to flow data, a central fluorescence range is circled, a background fluorescence value is deducted, the average fluorescence intensity under each concentration is calculated, then according to a formula of Y ═ BmaxX/(Kd + X), dissociation equilibrium constants of the aptamers S9 and S10 and NCI-H460 and A549 cells are calculated through GraphPad prism7.0, and a dissociation curve graph is constructed by taking an X axis as different gradient concentrations of the aptamers and a Y axis as the average fluorescence intensity. As shown in FIG. 4, the dissociation equilibrium constants of the aptamers S9 and S10 and NCI-H460 cells and A549 cells were 90.14. + -. 31.29nM and 49.47. + -. 8.765nM and 84.11. + -. 13.25nM and 70.14. + -. 6.497nM, respectively. The dissociation equilibrium constants are all in nanomolar level, which indicates that the binding affinity of the aptamer and lung cancer epithelial cells is high, and the aptamer is an affinity molecule for recognizing integrin beta 3 subunit protein.

In summary, the aptamer of the present invention has many advantages over conventional antibodies: the preparation method has the advantages of no immunogenicity, difficult inactivation, easy synthesis and modification, mass production, rapid tissue penetration, good metabolic kinetics, small difference between product batches and good chemical stability. The short-chain aptamer provided by the invention is used and is added with a modification marker, the integrin beta 3 subunit protein can be identified and detected, the process is quick and simple, and a new thought is provided for early detection and clinical treatment of malignant tumor bone metastasis.

While the invention has been described with reference to a preferred embodiment, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention.

Sequence listing

<110> sixth people hospital in Shanghai City

<120> nucleic acid aptamer for specifically recognizing integrin beta 3 subunit protein and application thereof

<141> 2021-02-18

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 80

<212> DNA

<213> Artificial Sequence

<400> 1

ttcagcactc cacgcatagc tggctattcc gagattcctt gcgcgaactt cgttgctaca 60

cctatgcgtg ctaccgtgaa 80

<210> 2

<211> 80

<212> DNA

<213> Artificial Sequence

<400> 2

ttcagcactc cacgcatagc acatgtagtg tgtgcgccac aatttggggc aaccaactga 60

cctatgcgtg ctaccgtgaa 80

<210> 3

<211> 80

<212> DNA

<213> Artificial Sequence

<400> 3

ttcagcactc cacgcatagc ataccctgcc gcaagcagct aatattgatt agtgaccgcc 60

cctatgcgtg ctaccgtgaa 80

<210> 4

<211> 80

<212> DNA

<213> Artificial Sequence

<400> 4

ttcagcactc cacgcatagc agccgaagcg acaagcttgt gtagaagttg gaagcgtccg 60

cctatgcgtg ctaccgtgaa 80

<210> 5

<211> 80

<212> DNA

<213> Artificial Sequence

<400> 5

ttcagcactc cacgcatagc ttctgactga atcgctcggt gtcgaaacag gtgagcctta 60

cctatgcgtg ctaccgtgaa 80

<210> 6

<211> 80

<212> DNA

<213> Artificial Sequence

<400> 6

ttcagcactc cacgcatagc tgtgttcaca agataaaggg ctcctaggct atgtgcgtct 60

cctatgcgtg ctaccgtgaa 80

<210> 7

<211> 80

<212> DNA

<213> Artificial Sequence

<400> 7

ttcagcactc cacgcatagc gaaacggtgc cataagatca agccacatga catgaccttc 60

cctatgcgtg ctaccgtgaa 80

<210> 8

<211> 80

<212> DNA

<213> Artificial Sequence

<400> 8

ttcagcactc cacgcatagc gagacacgca gtgtagatgg tcagggcgta gttgagcttg 60

cctatgcgtg ctaccgtgaa 80

<210> 9

<211> 80

<212> DNA

<213> Artificial Sequence

<400> 9

ttcagcactc cacgcatagc tgactgctcc ttaggtgtga cctaaagtgt tctgttttcg 60

cctatgcgtg ctaccgtgaa 80

<210> 10

<211> 80

<212> DNA

<213> Artificial Sequence

<400> 10

ttcagcactc cacgcatagc tccacgatgt aggatccaca tgagcgctcc tgttaccctg 60

cctatgcgtg ctaccgtgaa 80

Claims

1. A nucleic acid aptamer for specifically recognizing integrin beta 3 subunit protein, which is characterized in that the nucleic acid aptamer is selected from a sequence shown as SEQ ID NO. 1-10; or a sequence which is selected from the sequences shown in SEQ ID NO.1-10 and is subjected to label modification; or a sequence selected from the sequences shown in SEQ ID NO.1-10 after the substitution, deletion or addition of a plurality of nucleotides.

2. The aptamer of claim 1, wherein the sequence shown in SEQ ID No.1-10 is obtained by screening the synthesized aptamer random DNA library of the integrin beta 3 subunit protein with integrin beta 3 subunit pure protein, positive screening with integrin beta 3 high-expression cell NCI-H460, and negative screening with integrin beta 3 non-expression cell Hela in sequence.

3. The nucleic acid aptamer of claim 1, wherein the label modification is selected from the group consisting of a fluorescent label, a radioactive label, a therapeutic label, a biotin label, and an enzymatic label.

4. The nucleic acid aptamer according to claim 3, wherein the label is modified to be a fluorescent label.

5. A method for specifically recognizing integrin beta 3 subunit protein by using the aptamer according to any one of claims 1 to 4, which comprises incubating a sample of cells to be tested dispersed in a binding buffer with the aptamer in a shaker, washing the sample with a washing buffer by centrifugation after the incubation is completed, and detecting the sample by a flow cytometer after the washing is completed.

6. The method of claim 5, wherein the binding buffer comprises: 0.45% glucose, 5mM magnesium chloride, 100mg/L tRNA and 1g/L BSA.

7. The method of claim 5, wherein the wash buffer comprises: 0.45% glucose and 5mM magnesium chloride.

8. The method of claim 5, wherein the detection is fluorescence detection.