CN112852829B - Wheat stem basal rot related gene TaDIR-B1 and application thereof - Google Patents
Wheat stem basal rot related gene TaDIR-B1 and application thereof Download PDFInfo
- Publication number
- CN112852829B CN112852829B CN202011509914.2A CN202011509914A CN112852829B CN 112852829 B CN112852829 B CN 112852829B CN 202011509914 A CN202011509914 A CN 202011509914A CN 112852829 B CN112852829 B CN 112852829B
- Authority
- CN
- China
- Prior art keywords
- wheat
- tadir
- gene
- seq
- rot
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Abstract
The invention relates to a gene related to wheat stem basal rotTaDIR‑B1And applications thereof. The gene sequence is shown in SEQ ID NO.1, the 15 th basic group from ATG at the 5' end of the gene is G or A, wherein the A type causes the codon to change from TGG to TGA to cause the premature termination of amino acid translation; the invention provides a wheat stem basal rot geneTaDIR‑B1Sequences, protein sequences encoded by the genes, and identificationTaDIR‑B1Specific primer pair of gene and dCAPS marker for identificationTaDIR‑B1Different allele types; the invention also constructs a silencing vector based on the gene and is applied to the functional verification of the gene. Discovery of the gene related to the wheat stem basal rot,The confirmation and the application not only help to reveal the genetic basis of the wheat stem basal rot, but also play an important role in improving the wheat quality by utilizing the genetic engineering technology.
Description
Technical Field
The invention relates to the technical field of biological gene engineering, in particular to a gene related to wheat stem basal rotTaDIR- B1And applications thereof.
Background
Basal rot of wheat (crown rotCR) is a soil-borne disease caused by a variety of pathogenic fungi, also known as "drought foot rotdry land foot rot) Sickle root rot disease (a)Fusarium root rot) And fusarium stem rot (Fusarium crown rot) And the like. The disease is a worldwide problem and has been reported to occur in more than 10 countries, including the United states, Australia, Italy, Turkey, Canada, etc. (R)PaulitzEtc., 2002;Smileyetc., 2005;Hollawayetc., 2013). In China, Li et al (2012) reported that Fusarium pseudograminearum (F.graminearum) ((II))Fusarium pseudograminearum) Causing wheat stem basal rot. According to the survey of the wheat soil-borne disease subject group of plant protection institute of Henan university of agriculture, due to the fact that straw is returned to the field all the year round, bacterial sources in soil are accumulated, and due to the factors of poor variety resistance, enlargement of area of water-irrigated land and the like, the disease is serious in Huang-Huai-Mai area in China and shows continuous aggravation and spreading trend. The occurrence of the wheat stem base rot not only causes serious yield loss and economic loss to the wheat,some also occur during developmentDON、 NIV、ZENIsotoxins and secondary metabolites (bin et al, 1999;Beccari2018), which have potential adverse effects on food and feed products, and can cause poisoning when too much grain containing the toxin is ingested by people and livestock, which also affects food safety to some extent.
Wheat basal stem rot is a potential soil-borne disease controlled by a micro-effective polygene, and because the scarcity of disease-resistant resources and the degree of disease attack are influenced by various factors, no wheat variety with immunity or high resistance to basal stem rot has been identified so far (1)MitterEtc., 2006; zhangpeng et al, 2009). Currently, the research on wheat stem basal rot focuses on the resistance identification of materials and the primary positioning of genes, and the QTL positioning is performed by using seedling-stage or adult-stage plants (Liu et al, 2015). At present, 14 wheat stem-root rot resistance QTL (Liu et al, 2015; Yang et al, 2019) are reported on 21 chromosomes of hexaploid wheat, and the repeatedly detected loci are respectively located on 2DL chromosomes, 3BL chromosomes, 4BS chromosomes and 5DS chromosomes, wherein the locus effect on 3BL is large, and the locus effect on 4BS is similar to a dwarf gene.
However, because the identification conditions and evaluation criteria of the wheat stem basal rot are not uniform, the resistance of wheat varieties is different and limited by a complex genetic background, and the excavation work of the genes related to the stem basal rot in the wheat is slow; so far, the cloning of the gene related to the control of the wheat stem basal rot is still rarely reported. Therefore, the screening range is expanded, the excellent disease-resistant genes are explored and utilized, the genetic mechanism of the genes is clarified from the molecular level, the regulation and control ways in which the disease-resistant genes participate are explored, the disease-resistant genes are utilized in a polymerization manner, and the method has important significance for breeding the disease resistance of the wheat stem basal rot.
Disclosure of Invention
The invention aims to provide a wheat stem basal rot geneTaDIR-B1The expression product, the silent vector and the like of the wheat stem basal rot inhibitor are applied to prevention and breeding of the wheat stem basal rot, so that more choices are provided for disease resistance breeding of the wheat stem basal rot.
In order to solve the technical problems, the invention adopts the following technical scheme:
digging out a gene related to the basal stem rot of wheatTaDIR-B1The nucleotide sequence of the genome is shown as SEQ ID NO.1, or the full-length cDNA nucleotide sequence is as follows:
a: a nucleic acid sequence shown as SEQ ID NO. 2; or
b: a nucleic acid sequence with the same function derived from the nucleic acid sequence shown in SEQ ID NO. 2.
Comprises a DNA molecule which is hybridized with the DNA sequence of SEQ ID NO.2 under strict conditions and codes a protein for controlling the wheat stem basal rot related characters; or DNA molecules which have more than 90 percent of homology with the DNA sequence of SEQ ID NO.2 and encode protein for controlling the related characters of wheat stem basal rot.
Provides a gene related to wheat stem basal rotTaDIR-B1The coded protein has an amino acid sequence as follows:
(1) an amino acid sequence shown as SEQ ID NO. 3; or
(2) On the basis of the amino acid sequence shown in SEQ ID NO.3, one or more amino acid additions, deletions or substitutions are carried out to obtain the sequence of an active fragment or a conservative variant.
Identifying the above-mentioned wheat stem basal rot geneTaDIR-B1The specific primer pair of (a), comprising:
an upstream primer having a nucleotide sequence shown in SEQ ID NO.4, and
the downstream primer has a nucleotide sequence shown as SEQ ID NO. 5.
The method for detecting the wheat stem basal rot allelic gene type by using the specific primer comprises the following steps:
step 1: extracting genome DNA of wheat to be detected;
step 2: taking genome DNA of wheat to be detected as a template, carrying out PCR amplification by using an upstream primer with a nucleotide sequence shown as SEQ ID NO.4 and a downstream primer with a nucleotide sequence shown as SEQ ID NO.5 to obtain an amplification product shown as SEQ ID NO.2, and then judging as follows:
in the gene sequence shown in SEQ ID NO.2, whether the 15 th nucleotide from the 5' end is G or not is judgedA, determining the protein coded by the wheat to be detected; wherein, the codon corresponding to wheat to be detected of G genotype is TGG, the coded protein is Try and is translated normally, and the corresponding allele type is named asTaDIR-B1a(ii) a The codon corresponding to the A genotype was changed from TGG to TGA, resulting in premature termination of amino acid translation, and its corresponding allele was namedTaDIR-B1b。
Further phenotypic characterization showed that the allelic type wasTaDIR-B1aThe corresponding disease index of the plant is higher, the disease resistance of the plant is weaker, and the allele type isTaDIR-B1bThe corresponding disease index of the plant is lower, and the disease resistance of the plant is stronger; therefore, the temperature of the molten metal is controlled,TaDIR-B1the discovery of different allele functions of the gene plays an important role in identifying the resistance of the stem rot of different wheat varieties by using a genetic engineering technology, and is also beneficial to more in-depth research of heredity and molecular biology of wheat breeding for disease resistance.
The present invention provides an assayTaDIR-B1Functional markers for alleles, specific primer pairs of which comprise:
an upstream primer having a nucleotide sequence shown in SEQ ID NO.6, and
the downstream primer with the nucleotide sequence shown in SEQ ID NO.7 uses restriction endonucleaseBal1，
The identified site is shown as SEQ ID NO. 8.
The invention designs a virus-induced gene silencing (constructed by the gene)VIGS) And (3) a carrier.
The primer sequence for amplifying the silent fragment is as follows:
the nucleotide sequence of the upstream primer is shown as SEQ ID NO.9, the nucleotide sequence of the downstream primer is shown as SEQ ID NO.10, and the nucleic acid sequence shown as SEQ ID NO.11 can be inserted between the enzyme cutting sites PacI and NotI of the gamma-PDS-as vector to obtain the recombinant plasmid.
Further carrying out linearization and in vitro transcription on the virus vector and the recombinant plasmid to obtain RNA viruses with different components, correspondingly treating and contrasting to inoculate wheat seedling leaf silencing through the combination setting of the components of the different RNA virusesTaDIR-B1Gene to verify the geneAnd (4) function.
By passingTaDIR-B1Silencing wheat plant by gene silencing recombinant vectorTaDIR-B1After gene, the following judgment is carried out on the phenotype of the plant after silencing:
(1) compared with WT plants, the disease index of wheat stem rot in silent plants is obviously reduced, the material resistance after silence is obviously increased,TaDIR-B1the gene plays a role in negative regulation and control in materials, and most of the materials are stem base rot susceptible materials;
(2) compared with WT plants, the disease index change of wheat stem basal rot of silent plants is not obvious, the material resistance is not changed,TaDIR-B1the effect of the gene in the material is not significant.
The wheat stem basal rot geneTaDIR-B1Application in wheat breeding for disease resistance.
Compared with the prior art, the invention has the main beneficial technical effects that:
1. the invention discloses and confirms a new wheat stem basal rot related gene for the first time, which is named asTaDIR- B1The gene is located on wheat 4B chromosome, and the expressed protein can regulate and control the resistance of wheat to stem rot.
2. The invention defines the gene related to the wheat stem basal rotTaDIR-B1The DNA sequence, CDS sequence and coding protein sequence of the wheat protein peptide lay a technical foundation for the application practice of wheat breeding for disease resistance.
3. The specific primer and the used restriction enzyme in the invention can be directly used for detecting the wheat stem basal rot allelic gene type, is beneficial to the cultivation of wheat disease-resistant varieties and the creation of excellent germplasm resources, realizes early screening, and saves time and resources.
4. The invention is utilized for the first timeVIGSDisease-resistant gene for wheat stem basal rot by technologyTaDIR-B1Carry out silencing and verifyTaDIR-B1The gene plays a role in disease-resistant breeding of the wheat stem basal rot.
5. The invention is helpful to reveal the molecular genetic basis of the wheat stem basal rot, plays an important role in detecting and improving wheat varieties by utilizing a genetic engineering technology, and provides a new way for breeding new disease-resistant and safe wheat varieties.
Drawings
FIG. 1 shows the whole genome association analysis of wheat stem basal rot of the inventionManhattanAndQ-Qplotsfigure (a).
FIG. 2 is a graph of haplotype analysis of significant sites for whole genome association analysis.
FIG. 3 is a QTL location map of wheat stalk base rot.
FIG. 4 is a drawing according toTaDIR-B1Electrophoresis picture of dCAPS marker enzyme cutting result developed by allele type.
FIG. 5 is a drawing showingVIGSIn silencing assaysTaDIR-B1Relative expression level of gene.
FIG. 6 is a drawing showingVIGSPhotographs of resistance of different treated materials to wheat stalk rot in the silencing test were compared.
FIG. 7 shows wild-type KWT and mutantKronos2734 phenotype resistance of wheat stem basal rot and disease index.
FIG. 8 is a disease index statistical chart and a resistance phenotype chart of AK58 different mutation systems on wheat stem basal rot.
Detailed Description
The following examples are intended to illustrate the present invention in detail and should not be construed as limiting the scope of the present invention in any way.
The instruments and devices referred to in the following examples are conventional instruments and devices unless otherwise specified; the related reagents are all conventional reagents in the market, if not specifically indicated; the test methods involved are conventional methods unless otherwise specified.
The phenotypic identification tests in the following examples were performed in triplicate and the results averaged. The primer synthesis and sequencing work are performed by Biotechnology engineering (Shanghai) Inc.
The wheat material referred to below is:
a natural population consisting of 435 elytrigia I introgression lines is subjected to genotyping by adopting a 660K SNP chip covering a whole genome, and the population is used for whole genome association analysis (GWAS);
DH population comprising 181 families consisting of Bainong 64 and Jingshu 16 (BJ) double induced by colchicine, this population being used for QTL localization and validationTaDIR-B1(ii) an allelic effect;
50 of plain: the genotype and phenotype belong to high-sensitivity wheat stem basal rot material used for VIGS test verificationTaDIR-B1Gene effect;
Kronosmutant: wild typeKronos-WTAndKronos2734（TaDIR-B1premature gene termination) for comparisonTaDIR-B1Gene effect;
AK58 mutant: the mutants used in the experiment are different mutant systems generated after wild type AK58 is subjected to EMS mutagenesis and are used for comparisonTaDIR-B1Gene effect.
The first embodiment is as follows: identification of resistance to basal stem rot of different wheat varieties
1. Test strain selection, experimental soil preparation and culture medium preparation
The strain used in the test is fusarium pseudograminearum WZ-8A, which is a popular strain in the Huang-Huai-Mai area at present, and has the remarkable characteristics of wide infection range, strong pathogenicity and the like.
The soil used in the test is moderate-fertility loam, weeds and large soil blocks are removed by using a 18-mesh sieve before the soil is used, and the soil is sterilized in a sterilization pot with the pressure of 0.1Mpa at the temperature of 121 ℃ for 1 hour for later use.
The culture medium used in the test comprises a PDA culture medium and a millet culture medium. The preparation method of the PDA culture medium comprises the following steps: selecting fresh potatoes with proper size, peeling, cutting into medium thin blocks, weighing 200g of the thin blocks, putting into a pot, adding distilled water, boiling for about 20min, and filtering with four layers of gauze when the potato blocks can be easily mashed with a glass stick. Heating the filtrate, adding 15g agar powder and 20g glucose in sequence, stirring, metering to 1000ml, cooling, packaging, wrapping, and performing wet heat sterilization at 121 deg.C and 0.1Mpa for 20 min. The preparation method of the millet culture medium comprises the following steps: selecting semen Setariae with uniform size, boiling in boiling water for 3min, pouring out, washing with cold water, spreading on clean gauze, air drying to remove water on surface, packaging in 150ml triangular bottle, sealing, and wet-heat sterilizing at 121 deg.C and 0.1Mpa for 30 min.
2. Variety planting and resistance identification
Pathogenic bacteria propagation: picking up healthy fungus blocks with hyphae from the edge of a newly activated pseudo fusarium graminearum PDA culture plate, inoculating the fungus blocks into a sterilized millet culture medium, and culturing at 25 ℃ for 7 days by shaking 2 times every day to uniformly distribute pathogenic bacteria.
Planting and culturing materials: weighing 150g of sterile soil in a 7cm by 7cm small square box, uniformly placing 12 wheat grains on the surface, covering 20g of soil for planting, repeating the treatment for three times, sequentially placing the wheat grains in a tray, watering and soaking the bottom of the wheat grains, and culturing the wheat grains in an environment with the temperature of 25 ℃/15 ℃ and the humidity of 60-80 percent in a light-dark alternation of 16h/8 h. 3 days after seedling, weak seedlings are removed, 0.4g of millet with bacteria is inoculated into the box, the box is uniformly paved, one grain of millet is ensured to exist at the base of each wheat seedling, and watering is carried out once every 2 days under the same culture conditions.
Material investigation and evaluation: the plant phenotype was investigated 4 weeks after inoculation. And (3) taking the wheat seedlings out of the culture box, washing the plant base parts with water, counting the occurrence degree of plant diseases according to a disease classification method of 0, 1, 3, 5, 7 and 9, and calculating disease indexes of the plants. Calculating the formula: disease Index (DI) = Σ (number of each disease-grade strain × representative value of disease grade)/(total number of investigated strains × representative value of the most serious disease grade) × 100, and the resistance evaluation criteria are: DI =0, immune; DI =0.01-10.00, high resistance; DI =10.01-20.00, medium resistant; DI =20.01-30.00, affection; DI > 30.01, high feeling.
Example two: wheat stem basal rot related geneTaDIR-B1Positioning and obtaining
Through phenotype identification, 435 wheat varieties with different resistances to the stem-base rot are distinguished, 660K SNP chip information (Beijing Compson Biotechnology Co., Ltd.) is further combined, genome-wide association analysis (GWAS) is carried out after quality control, and SNP sites which are obviously related to the stem-base rot of wheat are identified, as shown in figure 1. Haplotype analysis is carried out on the identified significant SNP sites on the 4B chromosome, the result is shown in figure 2, a block is formed, 5 haplotypes are contained, and the disease index difference of materials corresponding to different haplotypes is significant.
Further using the above SNP site, toEnsemblPlantsChinese spring data information in the database is subjected to blast, and the SNP locus locking segments are found to be positioned between 664152928 and 664679942 (. apprxeq.527 kb) of the wheat 4B chromosome.
Meanwhile, the resistance of the stem base rot of the BJ population is identified, and the population resistance is obviously separated through statistical analysis. After mapping the QTL mapping of the population, a total of 1 significant QTL was detected, located on chromosome 4B, as shown in fig. 3, with a mapping segment between 664393348 and 671667802.
Combining the results of GWAS and QTL, one annotation in the co-located section isdirigent protein(DIR) genes, several studies have demonstrated that such genes are plant disease resistance-related genes, and influence plant resistance by modulating lignin content: (PattenEtc., 2008; makinje et al, 2017), therefore, the gene is predicted to be a gene related to the wheat stem base rot trait.
Reference to NCBI andEnsemblPlantsthe Chinese spring database is designed with primer to amplify the gene. A PCR amplification primer pair, wherein a forward primer of the primer pair is an upstream primer with a nucleotide sequence shown as SEQ ID NO.4, and the forward primer comprises the following components: 5'-CACCTCTCAGAGCACTTTGG-3', the reverse primer of the primer pair is a downstream primer with a nucleotide sequence shown in SEQ ID No.5, such as: 5'-CCATCCCCAAGCACTAGGT-3' are provided.
Amplifying the genome DNA of Chinese spring wheat by using a primer pair to obtain a sequence andEnsemblPlantsthe corresponding sequences in the database are consistent. The PCR amplification system and the PCR amplification procedure are shown in Table 1 and Table 2, respectively.
TABLE 1 primer pairsTaDIR-B1PCR amplification system of gene
TABLE 2 primer pairsTaDIR-B1Gene PCR amplification program
Through sequencing verification, the identification is carried outTaDIR-B1The SEQ ID NO.1 sequence corresponding to the genome DNA of the gene has polymorphism among the anti-infection materials, the 15 th basic group of the anti-infection materials from ATG is mutated from G to A to form a stop codon so as to stop translation in advance, and the phenotype of the stem rot disease corresponding to the anti-infection materials is also obviously different. Therefore, the gene shown in SEQ ID NO.1 is a gene related to the wheat stem basal rot trait.
Example three:TaDIR-B1allele marker development and application
Based on the G/A separation of the 15 th base of the sequence of SEQ ID NO.1 from the ATG between different materials, a dCAPS marker was developed to detect this mutation site, and the differential site-specific primer pair included:
an upstream primer sequence 5'-ACTTTTGCGTCGTAGTGAGC-3' with the nucleotide sequence shown as SEQ ID NO.6
The nucleotide sequence is shown as a downstream primer sequence 5'-GGAGGACGAGAAGCAGCGGCAGTGG-3' of SEQ ID NO. 7.
Using specific restriction endonucleasesBal1Carrying out enzyme digestion on the amplification product, wherein the sequence with the difference site G in the amplification product is subjected to enzyme digestionBal1The wheat variety/line which is 170bp after enzyme digestion is named asTaDIR-B1aAllelic type, sequence whose difference site in amplified product is ABal1The wheat variety/line still being 190 bp after enzyme digestion is namedTaDIR-B1bAllelic gene type (see figure 4), the disease resistance of the corresponding plants of the two gene types is obviously different.
Will be further developedTaDIR-B1The dCAPS marker of the gene was detected and verified in the BJ population, and the results are shown in Table 3, i.e., in the populationTaDIR-B1aAndTaDIR-B1bthe separation of the two alleles is obvious, the disease resistance difference of the corresponding wheat stem basal rot is obvious, and the marker can be used as the wheat stem basal rotTaDIR-B1Gene detection markers and auxiliary selection markers for plant disease resistance.
TABLE 3 BJ populationTaDIR-B1Allelic type detection and phenotypic differences
Example four:TaDIR-B1geneVIGSSilencing assay and phenotypic identification thereof
（1）TaDIR-B1Of genesVIGSVector construction
According toTaDIR-B1Designing primers for cDNA sequences of the genes, and adding enzyme cutting sites and protective bases at the 5' ends of the forward primer and the reverse primer respectively to form an upstream primer shown in a SEQ ID NO.9 sequence: 5'-CCTTAATTAACGGCTTATTACGGTGCAGTC-3' and the downstream primer shown by SEQ ID NO.10 sequence: 5'-TATGCGGCCGCTTCCCCTCCGTGAACAAGAA-3' are provided. Amplification using this primer setTaDIR-B1Of genesVIGSSilencing fragments and recovering for use.
Further will beTaDIR-B1Of genesVIGSUse of silent fragments and gamma-PDS-as vectorsPac1 AndNot1double enzyme digestion, recovery of silent fragments and corresponding gamma-linearized vector fragments, and seamless cloning to complete the construction of recombinant vector (gamma-DIR).
（2）TaDIR-B1Plants of the GeneVIGSSilencing test
Viral vectors (alpha, beta, gamma-PDS) andTaDIR-B1the gene silencing recombinant vector (gamma-DIR) plasmid is respectively enzyme-cut and linearized, and further usedRiboMAXTM Large Scale RNA Production Systems-The T7 kit is used for in vitro transcription of the linearized plasmid to obtain virus in vitro transcription products with different components. Taking 2.5 muL of in vitro transcription products alpha, beta, gamma/gamma-PDS/gamma-DIR respectively, and performing in accordance with the following formula 1: 1: 1, and diluting with DEPC water in equal volume, and adding 5 mu L of diluted mixed solution into 90 mu L of FES buffer solution for sufficient sucking, beating and uniformly mixing. Each experiment was set with 4 different treatments, respectively: a complete blank control group (WT), a viral blank control group (α + β + γ), a albino positive control group (α + β + γ -PDS) and a gene silencing group (α + β + γ -DIR).
When the virus is infected, a small amount of DEPC water is sprayed on the surface of a plant to be infected, 8-10 mu LFES mixed liquor is spotted on clean gloves, the second leaves of the seedling are rubbed 3 times from the base part to the tip part of the leaves, the force is controlled during the rubbing, a small amount of DEPC water is sprayed from top to bottom after the rubbing is finished to keep the humidity, and the clean gloves are required to be replaced for each treatment. After inoculation of the virus, the virus is placed in an incubator at 23 +/-2 ℃ for heat preservation, moisture preservation and light-proof culture for 24 hours, then the light-dark period culture is adjusted to 16 hours/8 hours, and the phenotypic change is regularly observed and recorded.
（3）TaDIR-B1Genetic plantsVIGSPost-silencing phenotypic characterization
Further carrying out stem base rot resistance investigation on silent plants, and the result shows that,TaDIR-B1the disease index of the gene-silenced plant (DI = 54.80) was significantly lower than that of the wild-type plant (plain 50, DI = 70.45), and the disease resistance of the plant was significantly enhanced (see fig. 6).
In view of the above, in combination,TaDIR-B1the disease resistance of the plant is obviously enhanced after the gene is silenced, which indicates that the gene is a negative regulation gene in the response process of the wheat stem basal rot.
Example five: detection of EMS mutants
Further use of tetraploidsKronosMutant to verifyTaDIR-B1The function of the gene(s) is,Kronos2734 corresponds to chromosome 4BTaDIR-B1The nucleotide at 220bp behind the 5' ATG of the gene sequence is mutated from C to T, thereby causing the gene to terminate expression in advance. For mutantKronos2734And wild typeKronosThe wheat stalk rot resistance test by WT showed that, compared with K-WT (DI = 61.62),TaDIR-B1gene silencing plantKronos2734 (DI = 37.56) the disease index is significantly reduced, and the disease resistance of the plant is obviously enhanced (see figure 7), which supposes thatTaDIR-B1The gene plays a negative regulation role in the plant body.
Example six: detection of AK58 mutant
For further verificationTaDIR-B1Gene in wheat basal stem rotNegative control effect, the invention researches 1152 materials randomly selected from hexaploid wheat AK58 mutant library induced by EMS in the laboratory of the inventor to carry out amplification sequencing. 862 copies of sequenced material were obtained, of which 17 were mutated at the base, and 11 were of the type causing amino acid changes, resulting inTaDIR-B1There were 5 types of materials with early termination of the gene, and the mutation status is detailed in table 4.
Further performing phenotypic identification on all the screened AK58 mutant materials, and the results show that,TaDIR-B1the average disease index of the gene early termination material (AK 600, AK688, AK720, AK791, AK 948) was 34.26,TaDIR-B1the disease index of the mutant material (AK 226) with amino acid change from proline (P) to leucine (L) in the gene is 51.34, which is significantly lower than that of the wild type AK58 (60.36) (see FIG. 8), indicating that the material contains amino acid change from proline (P) to leucine (L) (see FIG. 8)TaDIR-B1Gene silencing or proline (P) -to-leucine (L) -producing mutations have a significant effect on plant resistance, particularlyTaDIR-B1After gene silencing, the disease resistance of the plant is obviously enhanced, which shows thatTaDIR-B1The gene has obvious regulation and control effect on the wheat stem basal rot.
TABLE 4TaDIR-B1Mutation statistics of genes in AK58 mutant library
| Numbering | Mutant line | Mutation site | Amino acid changes | Score of |
| 1 | AK600/688/720/ 791/948 | G 15 A | W to stop codon | -4 |
| 2 | AK226 | C 230 T | P to L | -3 |
| 3 | AK456 | G 208 A | D to |
1 |
| 4 | AK466 | G 121 A | E to K | 1 |
| 5 | AK491 | G 575 A | G to D | -1 |
| 6 | AK648 | G 191 A | G to E | -2 |
| 7 | AK818 | C 11 T | F to S | -2 |
| 8 | AK852/871 | G 482 A | S to |
1 |
| 9 | AK931/1103 | C 169 T | P to S | -1 |
| 10 | AK991 | C 118 T | H to |
2 |
| 11 | AK1094 | G 500 A | S to |
1 |
The invention is explained in detail above with reference to the drawings and the embodiments; however, those skilled in the art will understand that various changes in the above embodiments, or equivalent substitutions of related parts, structures and materials, may be made without departing from the spirit of the invention, thereby forming a plurality of embodiments, which are common variations of the invention and will not be described in detail herein.
Sequence listing
SEQUENCE LISTING
<110> Henan university of agriculture
<120> wheat stem basal rot related gene TaDIR-B1 and application thereof
<130> 2020
<160> 11
<170> PatentIn version 3.2
<210> 1
<211> 876
<212> DNA
<213> Triticum aestivum
<400> 1
gcctcacccg tcaacaaacc agcgttgtct caaaaaacca gtacgttcat actaccatcg 60
ccggccatgg cttcctcctg gccgctgccg ctgcttctcg tcctcctgct ggcctcgtcg 120
tgggcggccg tagcacgcac acggcgcggc gacaacgttt gggagcacac agtcgtgtac 180
atgcacgaga ggctgacggg cccgaacgcc acgcggctta ttacggtgca gtccccgctc 240
ggcggcgaca atttcgggca gttcggcgtg gtagacaacg agctgcgaga cggtccggat 300
cctctccgct cgtcgctctg tggccggttc caagccctgt ttgcgctggc gggtctggtg 360
agcccaccgg gcatgcagtc ggccgtcaac ttcttgttca cggaggggaa gttccgcggg 420
agcacggtgt ctgtgctggg ccccattctg gacttcgaga ccacctgcga acgcagcatc 480
gtgggcggca ccggtgtttt tcggatggcg cgcgggtaca gcttcatgag gcttgtgcct 540
gagatgagcg tacccgataa gtacagtgtc tacaggcttg acctcttcat tcaagtcagc 600
tcggaccgtc tgccacagct gccaccggtt gattccgttg gcgcttacga cactttaata 660
tgaaatacta aggttgtgct agctgcttgg tttaagttct gcttattatc tgtagcgcca 720
gaaacgtgct gtcgttcacg ttgcggccca ggttaatatg tttcccgtcg gagtaaaatc 780
gacacgatcc gcccacacct agtgcttggg gatggtggcg aagtttgtta atggaataaa 840
aatggaatcc tatctattta gaaatttaat ccttac 876
<210> 2
<211> 597
<212> DNA
<213> Triticum aestivum
<400> 2
atggcttcct cctggccgct gccgctgctt ctcgtcctcc tgctggcctc gtcgtgggcg 60
gccgtagcac gcacacggcg cggcgacaac gtttgggagc acacagtcgt gtacatgcac 120
gagaggctga cgggcccgaa cgccacgcgg cttattacgg tgcagtcccc gctcggcggc 180
gacaatttcg ggcagttcgg cgtggtagac aacgagctgc gagacggtcc ggatcctctc 240
cgctcgtcgc tctgtggccg gttccaagcc ctgtttgcgc tggcgggtct ggtgagccca 300
ccgggcatgc agtcggccgt caacttcttg ttcacggagg ggaagttccg cgggagcacg 360
gtgtctgtgc tgggccccat tctggacttc gagaccacct gcgaacgcag catcgtgggc 420
ggcaccggtg tttttcggat ggcgcgcggg tacagcttca tgaggcttgt gcctgagatg 480
agcgtacccg ataagtacag tgtctacagg cttgacctct tcattcaagt cagctcggac 540
cgtctgccac agctgccacc ggttgattcc gttggcgctt acgacacttt aatatga 597
<210> 3
<211> 198
<212> Protein
<213> Triticum aestivum
<400> 3
Met Ala Ser Ser Trp Pro Leu Pro Leu Leu Leu Val Leu Leu Leu Ala Ser Ser Trp Ala 20
Ala Val Ala Arg Thr Arg Arg Gly Asp Asn Val Trp Glu His Thr Val Val Tyr MET His 40
Glu Arg Leu Thr Gly Pro Asn Ala Thr Arg Leu Ile Thr Val Gln Ser Pro Leu Gly Gly 60
Asp Asn Phe Gly Gln Phe Gly Val Val Asp Asn Glu Leu Arg Asp Gly Pro Asp Pro Leu 80
Arg Ser Ser Leu Cys Gly Arg Phe Gln Ala Leu Phe Ala Leu Ala Gly Leu Val Ser Pro 100
Pro Gly MET Gln Ser Ala Val Asn Phe Leu Phe Thr Glu Gly Lys Phe Arg Gly Ser Thr 120
Val Ser Val Leu Gly Pro Ile Leu Asp Phe Glu Thr Thr Cys Glu Arg Ser Ile Val Gly 140
Gly Thr Gly Val Phe Arg MET Ala Arg Gly Tyr Ser Phe MET Arg Leu Val Pro Glu MET 160
Ser Val Pro Asp Lys Tyr Ser Val Tyr Arg Leu Asp Leu Phe Ile Gln Val Ser Ser Asp 180
Arg Leu Pro Gln Leu Pro Pro Val Asp Ser Val Gly Ala Tyr Asp Thr Leu Ile *** 198
<210> 4
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 4
<210> 5
<211> 19
<212> DNA
<213> Artificial Synthesis
<400> 5
ccatccccaagcactaggt 19
<210> 6
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 7
ggaggacgagaagcagcggcagtgg 25
<210> 8
<211> 6
<212> DNA
<213> Triticum aestivum
<400> 8
<210> 9
<211> 30
<212> DNA
<213> Triticum aestivum
<400> 9
<210> 10
<211> 31
<212> DNA
<213> Triticum aestivum
<400> 10
tatgcggccgcttcccctccgtgaacaagaa 31
<210> 11
<211> 197
<212> DNA
<213> Triticum aestivum
<400> 11
cggcttatta cggtgcagtc cccgctcggc ggcgacaatt tcgggcagtt cggcgtggta 60
gacaacgagc tgcgagacgg tccggatcct ctccgctcgt cgctctgtgg ccggttccaa 120
gccctgtttg cgctggcggg tctggtgagc ccaccgggca tgcagtcggc cgtcaacttc 180
Claims (4)
1. Identification of wheat stem basal rot related gene with nucleotide sequence shown as SEQ ID NO.1TaDIR-B1A primer specific for a site of allelic difference comprising:
an upstream primer with a nucleotide sequence shown as SEQ ID NO.6,
a downstream primer with a nucleotide sequence shown as SEQ ID NO.7,
differential site-specific endonucleasesBal1And a recognition site sequence SEQ ID NO. 8.
2. Detecting wheat stem basal rot related gene with nucleotide sequence shown as SEQ ID NO.1 or SEQ ID NO.2TaDIR-B1A method of genotyping comprising the steps of:
taking genome DNA of wheat to be detected as a template, carrying out PCR amplification by using an upstream primer with a nucleotide sequence shown as SEQ ID NO.6 and a downstream primer with a nucleotide sequence shown as SEQ ID NO.7, and then utilizing specific endonucleaseBal1Subjecting the amplification product to digestion and judging as described in (I) or (II) below:
(I) amplification products are subjected toBal1The wheat variety/system after enzyme digestion is 170bpTaDIR-B1aThe allelic gene type is statistically lower than the wheat variety/line with 190 bp of fragments after enzyme digestion in the disease resistance of the wheat stem basal rot;
(II) subjecting the amplification product toBal1The wheat variety/system still being 190 bp after enzyme digestionTaDIR-B1bThe allele type is a wheat variety/line with the disease resistance of wheat stem basal rot being higher than that of the wheat variety/line with the fragment of 170bp after enzyme digestion statistically.
3. The nucleotide sequence of the gene is shown as SEQ ID NO.1 or SEQ ID NO.2 which is related to wheat stem basal rotTaDIR-B1The application in the breeding of wheat variety with stem base rot resistance or the prevention and control of the stem base rot of wheat.
4.TaDIR-B1Application of gene silencing recombinant vector in breeding of wheat variety with stem-base rot resistance or preventing and treating stem-base rot of wheatTaDIR-B1The gene silencing recombinant vector contains nucleotide sequence shown as SEQ ID NO.1 or SEQ ID NO.2TaDIR-B1Of genesVIGSA silent fragment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011509914.2A CN112852829B (en) | 2020-12-19 | 2020-12-19 | Wheat stem basal rot related gene TaDIR-B1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011509914.2A CN112852829B (en) | 2020-12-19 | 2020-12-19 | Wheat stem basal rot related gene TaDIR-B1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112852829A CN112852829A (en) | 2021-05-28 |
| CN112852829B true CN112852829B (en) | 2022-07-08 |
Family
ID=75997583
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011509914.2A Active CN112852829B (en) | 2020-12-19 | 2020-12-19 | Wheat stem basal rot related gene TaDIR-B1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112852829B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114774570B (en) * | 2022-03-24 | 2023-08-29 | 四川农业大学 | Molecular marker closely linked with wheat stem rot resistance QTL and application |
| CN117777263A (en) * | 2024-02-27 | 2024-03-29 | 中国农业科学院作物科学研究所 | Application of wheat disease resistance related protein TaMTase in regulation and control of wheat stem basal rot resistance |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104884624A (en) * | 2012-05-25 | 2015-09-02 | 进化基因组股份有限公司 | Dirigent gene eg261 and its orthologs and paralogs and their uses for pathogen resistance in plants |
| CN109371158A (en) * | 2018-12-07 | 2019-02-22 | 江苏省农业科学院 | Molecular labeling and its application with wheat base rot disease Resistance QTL close linkage |
| WO2019182884A1 (en) * | 2018-03-23 | 2019-09-26 | Pioneer Hi-Bred International, Inc. | Methods of identifying, selecting, and producing disease resistant crops |
| CN110512021A (en) * | 2019-08-26 | 2019-11-29 | 江苏省农业科学院 | One molecular labeling and its application with wheat base rot disease Resistance QTL close linkage |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3447134B1 (en) * | 2017-08-22 | 2023-10-11 | KWS SAAT SE & Co. KGaA | Increased fungal resistance in crop plants |
-
2020
- 2020-12-19 CN CN202011509914.2A patent/CN112852829B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104884624A (en) * | 2012-05-25 | 2015-09-02 | 进化基因组股份有限公司 | Dirigent gene eg261 and its orthologs and paralogs and their uses for pathogen resistance in plants |
| WO2019182884A1 (en) * | 2018-03-23 | 2019-09-26 | Pioneer Hi-Bred International, Inc. | Methods of identifying, selecting, and producing disease resistant crops |
| CN109371158A (en) * | 2018-12-07 | 2019-02-22 | 江苏省农业科学院 | Molecular labeling and its application with wheat base rot disease Resistance QTL close linkage |
| CN110512021A (en) * | 2019-08-26 | 2019-11-29 | 江苏省农业科学院 | One molecular labeling and its application with wheat base rot disease Resistance QTL close linkage |
Non-Patent Citations (6)
| Title |
|---|
| A loss-of-function of the dirigent gene TaDIR-B1 improves resistance to Fusarium crown rot in wheat;Xia Yang et al.;《Plant Biotechnology Journal》;20211231;第19卷;第866-868页 * |
| Dirigent domain-containing protein is part of the machinery required for formation of the lignin-based Casparian strip in the root;Prashant S. Hosmani et al.;《PNAS》;20130827;第110卷(第35期);第14498-14503页 * |
| Identifcation of a novel genomic region associated with resistance to Fusarium crown rot in wheat;Jingjing Jin et al.;《Theoretical and Applied Genetics》;20200314;第1-11页 * |
| TaDIR13, a Dirigent Protein from Wheat, Promotes Lignan Biosynthesis and Enhances Pathogen Resistance;Qing-Hu Ma et al.;《Plant Mol Biol Rep》;20140523;第1-10页 * |
| Triticum aestivum cultivar Chinese Spring chromosome 4B, whole genome shotgun sequence，GenBank: CM022221.1;Zimin,A.V. et al.;《genbank》;20200820;第1-2页 * |
| 小麦茎基腐病和赤霉病抗源筛选及关联SNP位点分析;蒲乐凡等;《麦类作物学报》;20200701;第40卷(第7期);第780-788页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112852829A (en) | 2021-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106544357B (en) | A method of cultivating low cadmium-accumulation rice variety | |
| CN103848906B (en) | Rice high temperature resistance related gene OsZFP, screening marker and separation method thereof | |
| CN103215237B (en) | Set of paddy rice anti-brown-planthopper genes, coded protein thereof, and application thereof | |
| CN101704881B (en) | Plant male fertility-associated protein, coding gene and application thereof | |
| CN112852829B (en) | Wheat stem basal rot related gene TaDIR-B1 and application thereof | |
| CN1646561B (en) | Gene conferring resistance to phytophthora infestans (late-blight) in solanacea | |
| CN107475210B (en) | Rice bacterial leaf blight resistance related gene OsABA2 and application thereof | |
| CN108822194B (en) | Plant starch synthesis related protein OsFLO10, and coding gene and application thereof | |
| CN109705198A (en) | The application of OsCKX7 protein and its encoding gene in regulation plant sharp eyespot resistance | |
| CN107759676A (en) | A kind of plant amylose synthesis associated protein Du15 and its encoding gene and application | |
| CN108642065A (en) | A kind of paddy endosperm silty related gene OsSecY2 and its coding protein and application | |
| CN108441571B (en) | Application of corn molecular marker in identification and regulation of resistance traits of corn rough dwarf disease | |
| CN107475266A (en) | A kind of paddy endosperm silty related gene OscyMDH and its encoding proteins matter and application | |
| CN110607388A (en) | Wheat stripe rust resistant gene related SNP molecular marker in adult stage, primer and application thereof | |
| CN110004155B (en) | Disease-resistant gene and protein for controlling plant aversion and aphid resistance characters and application thereof | |
| CN114929881A (en) | CCA genes for virus resistance | |
| CN106589085A (en) | Protein OsFLO8 related to plant starch synthesis and coding gene and application thereof | |
| CN115125219B (en) | Application of OsJMJ718 gene and encoding protein thereof in regulation and control of rice grain types | |
| CN109706154B (en) | CsPR3 gene and application thereof in cucumber fusarium wilt resistance | |
| CN115976052A (en) | Wheat stem basal rot resistance gene TaHSP18.6, expression product, recombinant vector and application thereof | |
| CN111979233A (en) | Method for increasing rice grain type and application thereof | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN102559698A (en) | Rice recessive bacterial leaf blight-resistant major gene xa 25 and application thereof in rice disease-resistant improvement | |
| CA3200892A1 (en) | Compositions and methods to increase resistance to phytophthora sojae in soybean | |
| CN106497943A (en) | A kind of ash arrhizus bacteria gene BcSEP5 related to pathogenicity and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |