CN112574990A

CN112574990A - shRNA molecule for silencing human DAPK1 gene expression and application thereof

Info

Publication number: CN112574990A
Application number: CN202011463626.8A
Authority: CN
Inventors: 潘勤; 章晓联; 王亚平; 孙月华
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2020-12-11
Filing date: 2020-12-11
Publication date: 2021-03-30

Abstract

The invention provides an shRNA molecule for silencing human DAPK1 gene expression and application thereof, the shRNA molecule for silencing human DAPK1 gene expression comprises a sense strand and an antisense strand, and the nucleotide sequence of the sense strand is shown as SEQ ID NO: 2, the nucleotide sequence of the antisense strand is shown as SEQ ID NO: 3, constructing a lentiviral vector containing the shRNA molecule, and proving that the shRNA molecule can knock down the expression of the human DAPK1 protein, thereby inhibiting cell death and having the prospect of immunotherapy applied to acute and chronic inflammation and infectious diseases.

Description

shRNA molecule for silencing human DAPK1 gene expression and application thereof

Technical Field

The invention belongs to the technical field of biomedicine, and relates to a shRNA molecule for silencing human DAPK1 gene expression and application thereof, in particular to a shRNA molecule for silencing human DAPK1 gene expression for treating acute and chronic inflammation and infectious diseases and application thereof.

Background

Inflammation is a defense response of the body to stimuli and is mainly manifested by redness, swelling, heat, pain, and dysfunction. The inflammation may be infectious inflammation caused by invasion of pathogenic microorganisms into a human body, or non-infectious inflammation unrelated to pathogenic microorganisms. Often, inflammation is beneficial and is a defense response in the human body; sometimes, however, inflammation is also harmful, causing an attack on the body's own tissues. At present, antibiotic medicines are widely and long-term used, so that clinical drug-resistant bacteria appear more frequently, and related treatment becomes more severe. For example, tuberculosis, one of the major killers affecting human health, mycobacterium tuberculosis is often not completely eliminated by patients, resulting in chronic infection caused by the long-term survival of bacteria in tuberculosis patients.

Death-related protein kinase 1(DAPK1) is a serine/threonine protein kinase regulated depending on calcium ions, is one of positive regulators of apoptosis, and is widely involved in apoptosis induced by multiple pathways such as gamma-interferon (IFN-gamma), tumor necrosis factor-alpha (TNF-alpha), Fas and transforming growth factor-beta (TGF-beta) (Xiahai Hai Fang, Shanghang, Yaosulong. research progress of molecular structure and inflammation regulation of death-related protein kinase 1 [ J ]. Chinese critical disease emergency medicine 2015; 27 (2): 158-160. DOI: 10.3760/cma. J. issn.2095-4352.2015.02.018.).

RNA interference (RNAi) refers to a highly conserved, double-stranded RNA (dsRNA) -induced, highly efficient and specific degradation of homologous mrnas during evolution, a biological phenomenon that specifically interferes with the expression of target genes. The action mechanism is as follows: dicer enzyme of ribonuclease III family binds to dsRNA, cuts it into 21-25nt and Small interfering RNA (siRNA) with 3' end protrusion, then siRNA binds to RNA-induced silencing complex (RISC), unwinds into single strand, activated RISC is guided by single stranded siRNA, sequence-specifically binds to target messenger RNA (mRNA) and cuts it off, and triggers the specific decomposition of target mRNA, thus inhibiting the expression of corresponding gene. RNAi has high sequence specificity and effective interference, and can specifically silence specific genes, so that the gene function is lost or the gene expression level is reduced, and the RNAi can be used as a powerful research tool for functional genomics. shRNA, short hairpin RNA, is a small non-coding RNA molecule designed to form a hairpin structure, and can inhibit gene expression by RNA interference. shrnas can be processed into sirnas within cells, and target mRNA degradation is achieved by specific complementary binding to the target mRNA.

The lentivirus vector is one of retrovirus vectors, and shRNA is constructed on the lentivirus vector, so that on one hand, the amplification of the shRNA is facilitated; on the other hand, shRNA, after being packaged by a lentivirus packaging system, can be used for infecting cells which are difficult to transfect by traditional transfection reagents, such as primary cells, suspension cells and cells in a non-dividing state, and after infection, the shRNA can be integrated into the genome of the infected cells and stably expressed for a long time. At present, the potential relation between DAPK1 and inflammation and infectious diseases and treatment is not clear, and shRNA molecules for specifically silencing DAPK1 gene expression and application thereof are not reported, so that the research on the function of DAPK1 and the application thereof are influenced.

Disclosure of Invention

In order to solve the technical problems in the background art, the invention provides an shRNA molecule for silencing human DAPK1 gene expression and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

a target gene for silencing shRNA molecules expressed by a human DAPK1 gene is characterized in that the nucleotide sequence of the target gene for silencing shRNA molecules expressed by a human DAPK1 gene is CCACGTCGATACCTTGAAATT.

An shRNA molecule for silencing the expression of a human DAPK1 gene, which is characterized by comprising a sense strand and an antisense strand;

the nucleotide sequence of the sense strand is:

5'-CCGGCCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGGTTTTTG-3'；

the nucleotide sequence of the antisense strand is:

5'-AATTCAAAAACCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGG-3'。

the application of the shRNA molecule for silencing human DAPK1 gene expression in preparing a reagent for reducing cellular DAPK1 gene mRNA is disclosed.

The shRNA molecule expressed by the silent human DAPK1 gene is applied to the preparation of a reagent for inhibiting the expression of cell DAPK1 protein.

The application of the shRNA molecule for silencing the expression of the human DAPK1 gene in preparing the medicines for treating acute and chronic inflammation and infectious diseases. The shRNA molecule for silencing DAPK1 gene expression can specifically knock down the expression of DAPK1, finally promote the survival of T cells and improve the immunity of adults against pathogenic microorganism infection.

The application of the target gene for silencing shRNA molecule expressed by human DAPK1 gene in preparing the medicine for treating acute and chronic inflammation and infectious diseases is disclosed.

The invention has the advantages that:

first, it can specifically reduce the expression of DAPK1 target gene and promote the survival of T cell, and can be used for immunotherapy in the treatment of acute and chronic inflammation and infectious diseases. Secondly, shRNA is constructed on a lentiviral vector, and T cells are infected by shRNA-lentivirus to carry out gene silencing, so that the gene silencing efficiency is improved. The shRNA molecules obtained by the invention are not reported in the prior public. The shRNA molecule can interfere the expression of DAPK1 gene, reduce the death of T cells in acute and chronic inflammation and infectious diseases, and provide a new scheme for treating the acute and chronic inflammation and infectious diseases.

Drawings

FIG. 1 shows the results of agarose gel electrophoresis of recombinant shRNA-DAPK1 after double digestion with EcoRI and Nco I.

FIG. 2 shows the result of RTqPCR detection of mRNA expression of DAPK1 after 293T cells are transfected by unloaded pLKO.1 or recombinant shRNA-DAPK 1.

FIG. 3 shows the result of Western Blot detection of recombinant shRNA-DAPK1 for silencing expression of DAPK1 in a T cell line Jurkat.

FIG. 4 is a bar graph of the detection of cell death of activated T cell lines following silencing;

FIG. 5 is a graph of activated T cell line cell death following silencing.

Detailed Description

The following examples are provided to illustrate the present invention in more detail:

in all methods of the present invention, the experimental method and reagents used without specifying the specific conditions were purchased from promega, and the interference sequence was synthesized by technologies, ltd. The experimental methods in the examples are fromhttps：// www.addgene.org/protocols/plko/Or according to conditions recommended by the manufacturer.

Example 1: obtaining of specific interference sequence shRNA for silencing human DAPK1 gene expression

The design scheme I is as follows:

according to the website:

www.sigmaaldrich.com/catalog/genes/DAPK1lang＝zh&region＝CN#shRNA％ 20Products～humandesigning shRNA sequence, and obtaining a target gene sequence: CCACGTCGATACCTTGAAATT (SEQ ID NO: 1), as follows:

sense strand:

5'-CCGGCCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGGTTTTTG-3'(SEQ ID NO：2)

antisense strand:

5'-AATTCAAAAACCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGG-3'(SEQ ID NO：3)

the design scheme II comprises the following steps: searching the sequence of DAPK1 mRNA on NCBI-Nucleotide, and utilizing the websitehttp：// rnaidesigner.thermofisher.com/rnaiexpress/design.doThe shRNA2 was designed, and the obtained gene sequence was GCGAGCTGTTTGACTTCTTAG, which is control shRNA as follows:

sense strand:

5'-CCGGCTTCTTAGCTCGAGCTAAGAAGTCAAACAGCTCGCTTTTTG-3'(SEQ ID NO：4)

antisense strand:

5'-AATTCAAAAAGCGAGCTGTTTGACTTCTTAGCTCGAGCTAAGAAG-3'(SEQ ID NO：5)

example 2: construction of shRNA-lentiviral vector of DAPK1

The lentiviral vector was pLKO.1, and the helper vectors were psPAX2 and pMD2.G, both purchased from Youbao Bio Inc.

Preparation of competent cells

And (3) transformation: one competent cell was taken from a freezer at-80 ℃ and placed on ice for 5 minutes, and 2. mu.L of pLKO.1 no-load plasmid was added when the competence was in a half-soluble state. The mixture was left on ice for 30 minutes. The mixture was heat-stimulated at 42 ℃ for 90 seconds and then allowed to stand on ice for 5 minutes. To the competence, 700. mu.L of LB medium preheated at 37 ℃ was added, and the mixture was shaken at 200rpm on a shaker at 37 ℃ for 60 minutes. Centrifuge at 5000rpm for 5 minutes. The supernatant was discarded to leave 100. mu.L of the bacterial solution, and the solution was spread on a solid LB medium containing ampicillin (Amp) using a coating rod. The cells were incubated at 37 ℃ for 16 hours in a bacterial incubator.

Several single colonies were picked and placed in a glass tube of 5mL of liquid LB medium with 5. mu.L of ampicillin, and a small amount of bacteria was cultured at 37 ℃ and 200rpm for 8 hours. Then, the cells were transferred to a conical flask containing 200mL of liquid LB (containing 200. mu.L of Amp), and cultured at 37 ℃ and 200rpm for 16 hours.

The plasmid was extracted by using an Omega kit according to the instructions.

Plasmid plko.1 concentration determination: 642.6 ng/L.

The invention synthesizes double chains after the shRNA molecules of the designed interference sequence are annealed conventionally to obtain annealed fragments as follows:

shRNA：

5'-CCGGCCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGGTTTTTG-3'

5'-AATTCAAAAACCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGG-3'

control shRNA：

5'-CCGGCTTCTTAGCTCGAGCTAAGAAGTCAAACAGCTCGCTTTTTG-3'

5'-AATTCAAAAAGCGAGCTGTTTGACTTCTTAGCTCGAGCTAAGAAG-3'

annealing of the shRNA. shRNA at a concentration of 100 μ M, sense strand and antisense strand were mixed in pairs and annealed:

annealing shRNA:

5'-CCGGCCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGGTTTTTG-3'(SEQ ID NO：2)

5'-AATTCAAAAACCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGG-3'(SEQ ID NO：3)

annealing of control shRNA:

5'-CCGGCTTCTTAGCTCGAGCTAAGAAGTCAAACAGCTCGCTTTTTG-3'(SEQ ID NO：4)

5'-AATTCAAAAAGCGAGCTGTTTGACTTCTTAGCTCGAGCTAAGAAG-3'(SEQ ID NO：5)

annealing system (20 μ L):

sense strand 2. mu.L

Antisense strand 2. mu.L

ddH₂O complement 20 μ L

Annealing at 94 ℃ for 5 minutes, and then naturally cooling to room temperature.

Digesting the slow virus vector pLKO.1 and recovering the nucleic acid fragment.

Enzyme digestion system (50 μ L):

AgeI single enzyme digestion

The total 50. mu.L of the enzyme digestion system was placed in a water bath and digested at 37 ℃ for 4 hours.

And (5) tapping and recycling.

After completion of the electrophoresis, the gel containing the desired fragment was excised and placed in a 1.5mL sterile EP tube. The weight of the gel was calculated by subtracting the weight of the empty tube from the total weight of the balance, and the volume of the gel was calculated as 100. mu.L of 100mg of the gel, and the Binding Buffer was added in the same volume. The gel was thoroughly thawed in a 65 ℃ dry bath while the EP tube was shaken properly to speed up the dissolution of the gel. After the gel was completely melted, the whole amount of the liquid was transferred to a filter column and allowed to stand at room temperature for 3 minutes. 10000rcf for 1 min, discard the filtrate, add 300. mu.L Binding buffer to the column, 13000rcf for 1 min, discard the filtrate. Add 700. mu.L of SPW Wash Buffer, 13000rcf and centrifuge for 1 min, discard the filtrate and repeat once. 13000rcf adsorption column was air-separated for 2 min. And opening the cover and standing for 2 minutes to remove the absolute ethyl alcohol. Transferring the filter column to a new EP tube with the volume of 1.5mL, adding 15 mu L of deionized water into the filter column, standing for 2 minutes, and centrifuging at 13000rcf for 1 minute, wherein the liquid in the centrifuge tube is pLKO.1 recovered by enzyme digestion. The concentration was determined to be 120 ng/. mu.L.

EcoRI is used for secondary enzyme digestion of the recovered target fragment of the gel, and the enzyme digestion system (50 mu L):

the total 50. mu.L of the enzyme digestion system was placed in a water bath and digested at 37 ℃ for 4 hours. And (5) tapping and recycling, and the operation is the same as the above. This concentration was determined to be 69 ng/. mu.L.

Connection of shRNA and vector pLKO.1

The ligation system (6. mu.L) was as follows:

high fidelity enzyme 2 mu L

shRNA 3μL

mu.L of the digested vector

A total of 6. mu.L of enzyme conjugate was placed in a water bath and enzymatically ligated at 16 ℃ for 2 hours.

And (4) transformation. After the competent cells were placed on ice and allowed to thaw spontaneously, the ligation products were added to the competent cells and allowed to stand on ice for 30 minutes and then in a water bath at 42 ℃ for 90 seconds. Then placed on ice quickly for 5 minutes. The antibiotic-free LB medium was added in an amount of 700. mu.L, and the medium was incubated at 37 ℃ and 200rpm for 60 minutes with shaking. The transformed cells were removed, centrifuged at 5000rpm for 5 minutes, the supernatant discarded, and about 200. mu.L of the supernatant was left in the EP tube. After the residual liquid in the tube and the plasmid at the lower layer are blown and uniformly mixed, 100 mu L of the bacterial liquid is added into a solid LB culture dish containing the ampicillin, the bacterial liquid is uniformly coated by a sterilized coater, and the bacterial liquid is inversely placed in a constant-temperature incubator at 37 ℃ for culture for 16 hours.

And (4) preparing a recombinant plasmid. Several single colonies were picked, cultured with a small amount of shake bacteria at 37 ℃ and 200rpm for 8 hours, and after plasmid extraction, the concentration was determined to be 130 ng/. mu.L, and double restriction enzyme digestion was performed. The cleavage system (20. mu.L) was as follows:

the 20. mu.L total enzyme digestion system was placed in a water bath at 37 ℃ for 2 hours. Then, the cells were electrophoresed for 40 minutes in a 120V agarose gel of 1% concentration, and the results of electrophoresis are shown in FIG. 1 (in FIG. 1, after the previous transformation culture, several single colonies were picked up, 3 single colonies were picked up by the designed shRNA and named as shRNA-DAPK1-1, shRNA-DAPK1-2, shRNA-DAPK1-3, and 3 single colonies were picked up by the control-shRNA and named as control-shRNA-DAPK1-1, control-shRNA-DAPK1-2, and control-shRNA-DAPK 1-3). The result shows that the recombinant shRNA-DAPK1 is 7084bp, and after the recombinant shRNA-DAPK1 is subjected to double digestion by EcoRI and Nco I, 2 bands appear, namely 5111bp and 1973bp respectively. The results showed that 3 monoclonal bands of shRNA-DAPK1-1 and control shRNA-DAPK1 were correct. The shRNA-DAPK1 and the control-shRNA-DAPK1 which are successfully digested are sequenced by the Scenario Biotechnology Limited company, and the sequencing result shows that the clone sequencing is correct, thereby proving that the construction is successful.

Example 3RTqPCR and Western Blot detection of expression of DAPK1 protein in Jurkat cells

And (5) packaging the lentivirus. 293T cells were plated 10cm plates one day in advance at 80% cell density, and the original medium was removed 2 hours prior to transfection and replaced with new complete medium (10 mL). Mu.g of the DNA plasmid was diluted with 500. mu.L of serum-free diluent and mixed well (pLKO.1: PSPAX 2: PMD2.G mass ratio 4: 3: 1, plasmid concentration adjusted to 300 ng/. mu.L, diluent opti-MEM). Add 10. mu.L of Neofect to the DNA dilution, mix gently, and let stand at room temperature for 15 minutes. Adding the mixed solution into a cell culture medium, uniformly mixing the cells, and continuously culturing for 12 hours. After 12 hours, the medium was changed to a medium containing 1% of the double antibody to remove the transfection reagent, and the medium was incubated for 24 hours. The supernatant is the packaged virus particles and is filtered by a centrifuge tube containing a 0.45 mu m filter membrane to remove the residual cells in the supernatant. Adding fresh culture medium, culturing for 24 hr, and repeating the above steps.

shRNA infection. Jurkat cells were plated one day in advance, the cell density 70% the next day, the fresh medium was changed, and 8. mu.g/mL polybrene was added, and 2.5mL of lentiviral particle solution was added. After 24 hours, the medium was replaced with fresh medium, puromycin 1. mu.g/mL was added, and cells were harvested by passage 3.

RTqPCR detects the expression of DAPK1 protein. The cell layer was thawed with 1mL Trizol at room temperature, 200. mu.L chloroform was added, mixed well by inversion, allowed to stand for 10 minutes, centrifuged at 12000g at 4 ℃ for 15 minutes, the supernatant was removed, and transferred to a new EP tube. According to the following steps: adding isopropanol in a volume ratio of 1, fully inverting and mixing, standing for 10 minutes, centrifuging at 12000g for 10 minutes at the temperature of 4 ℃, and removing the supernatant. 1mL of 75% ethanol was added, the pellet was floated, 7500g was centrifuged at 4 ℃ for 10 minutes, and the supernatant was discarded. 1mL of absolute ethanol was added, and the mixture was centrifuged at 7500g at 4 ℃ for 10 minutes. The supernatant was decanted, emptied for 2 minutes, uncapped and allowed to stand for 5 minutes, and 20. mu.L (10-30. mu.L depending on the amount of precipitate) of 65 ℃ preheated DEPC water was added and mixed. And (5) measuring the RNA concentration. Denaturation at 65 ℃ for 5 min and immediate cooling on ice.

The reverse transcription system (10. mu.L) was as follows:

reverse transcription reaction was performed at 37 ℃ for 15 minutes → enzyme inactivation reaction was performed at 98 ℃ for 5 minutes.

Realtime PCR

1) The system (20. mu.L) was as follows:

2) cycling conditions of PCR: 95 ℃ for 30 seconds, followed by 40 PCR cycles, each cycle having the conditions: 5 seconds at 95 deg.C → 10 seconds at 55 deg.C → 15 seconds at 72 deg.C.

The RTqPCR result shows that the expression level of the constructed shRNA-DAPK1 in the Jurkat cell DAPK1 infected by slow virus packaging is obviously reduced and reduced, while the expression level of the control shRNA-DAPK1 in the Jurkat cell DAPK1 infected by slow virus packaging is not reduced. The results are shown in FIG. 2. In FIG. 2, there are shown an empty pLKO.1 group, an shRNA-DAPK1 group and a control group (control shRNA-DAPK1 group). The results suggest that expressed DAPK1 was significantly reduced in Jurkat cells infected with the lentiviral shRNA-DAPK1 group compared to the lentiviral unloaded plko.1 group and the control shRNA-DAPK1 group.

The Western Blot technology is used for detecting the expression of the DAPK1 protein of the Jurkat cells:

the Western Blot result shows that the expression level of the constructed shRNA-DAPK1 in the Jurkat cell DAPK1 infected by the lentivirus packaged is obviously reduced and reduced, while the expression level of the control shRNA-DAPK1 in the Jurkat cell DAPK1 infected by the lentivirus packaged is not reduced. The results are shown in FIG. 3. FIG. 3 measures the total amount of DAPK1 and the expression of its inactive form P-DAPK 1. In the figure 3, a Marker, an unloaded pLKO.1 group, a control shRNA-DAPK1 group and a shRNA-DAPK1 group are sequentially arranged, and the results show that after the lentivirus shRNA-DAPK1 group is infected with Jurkat cells, the total amount of DAPK1 expressed by the cells is remarkably reduced, but the expression of inactive P-DAPK1 is increased, and the fact that the lentivirus shRNA-DAPK1 can effectively reduce the expression of an active form DAPK1 in T cells is suggested.

Flow cytometry to detect changes in cell death of activated T cell lines following silencing:

flow cytometry detection results show that, compared with a control group, after the lentivirus shRNA-DAPK1 group is infected with Jurkat cells, the number of dead cells is increased (FVS 780)⁺) Obviously reduced, and increased number of living cells. The results are shown in FIG. 4 and FIG. 5.

While the preferred embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that the invention is not limited thereto, and that various changes and modifications may be made without departing from the spirit of the invention, and the scope of the appended claims is to be accorded the full range of equivalents.

Sequence listing

<110> Wuhan university

<120> shRNA molecule for silencing human DAPK1 gene expression and application thereof

<141> 2020-12-11

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccacgtcgat accttgaaat t 21

<210> 2

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccggccacgt cgataccttg aaattctcga gaatttcaag gtatcgacgt ggtttttg 58

<210> 3

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aattcaaaaa ccacgtcgat accttgaaat tctcgagaat ttcaaggtat cgacgtgg 58

<210> 4

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccggcttctt agctcgagct aagaagtcaa acagctcgct ttttg 45

<210> 5

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aattcaaaaa gcgagctgtt tgacttctta gctcgagcta agaag 45

Claims

1. A target gene for silencing shRNA molecules expressed by a human DAPK1 gene is characterized in that the nucleotide sequence of the target gene for silencing shRNA molecules expressed by a human DAPK1 gene is CCACGTCGATACCTTGAAATT.

2. An shRNA molecule for silencing the expression of a human DAPK1 gene, which is characterized by comprising a sense strand and an antisense strand;

the nucleotide sequence of the sense strand is:

5'-CCGGCCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGGTT TTTG-3'；

the nucleotide sequence of the antisense strand is:

5'-AATTCAAAAACCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGG-3'。

3. use of the shRNA molecule for silencing human DAPK1 gene expression according to claim 2 in the preparation of a reagent for reducing cellular DAPK1 gene mRNA.

4. The use of the shRNA molecule for silencing human DAPK1 gene expression according to claim 2 in the preparation of a reagent for inhibiting cell DAPK1 protein expression.

5. The use of the shRNA molecule of claim 2 that silences the expression of the human DAPK1 gene in the preparation of a medicament for the treatment of acute and chronic inflammatory and infectious diseases.

6. The use of the target gene of the shRNA molecule for silencing human DAPK1 gene expression according to claim 1 in the preparation of a medicament for treating acute and chronic inflammation and infectious diseases.