CN112522291A - Rice OsSH3P2 gene and application thereof - Google Patents

Abstract

The invention discloses a rice OsSH3P2 gene and application thereof, belonging to the technical field of plant genetic engineering. The OsSH3P2 gene knockout plant and the wild plant provided by the invention both have resistance to rice blast germs and show disease-resistant phenotype; and the OsSH3P2 gene overexpression plant shows a susceptible phenotype. The statistical results of the lesion area and the pathogenic bacteria biomass show that the lesion area and the pathogenic bacteria biomass of the over-expression plants are obviously higher than those of knockout and wild plants. In conclusion, the OsSH3P2 gene plays a negative control role in the 'cloud-induced' disease resistance mechanism of japonica rice varieties, and a good foundation is laid for further researching the biological functions of OsSH3P 2.

Description

Rice OsSH3P2 gene and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a rice OsSH3P2 gene and application thereof.

Background

Rice (Oryza sativa L.) is a valuable food crop, and rice blast caused by Magnaporthe oryzae (Magnaporthe oryzae) is of great concern. Long-term production practice proves that the most economical, most effective and most fundamental method for preventing and treating rice diseases is to select and utilize disease-resistant varieties, and the key for cultivating the disease-resistant varieties is to discover excellent resistance genes and explore resistance mechanisms. With the rapid development of molecular biology and genomics, the research of the functions and action mechanisms of disease-resistant related genes through molecular biology and transgenic technology is one of the ideal ways to explore the disease-resistant mechanism of rice.

The Src homology-3(SH3) domain is the non-catalytic domain of the tyrosine kinase Src, and is present in a variety of proteins. Marsh et al found that proteins containing the Src homology-3(SH3) domain play an important role in intracellular transport of vesicles.

However, little is known about how this metabolic process helps plants to improve disease resistance and immune competence.

Therefore, further research on the OsSH3P2 gene of rice and understanding its role in rice blast are problems that those skilled in the art need to solve.

Disclosure of Invention

In view of the above, the invention provides a rice OsSH3P2 gene and application thereof. Disease-resistant genes are always the hot spots of rice research. In the early stage of the invention, a resistance gene Pi-y43(t) is cloned in a rice disease-resistant variety 'Yunzhen' by using a map-based cloning technology, and the gene is found to be purposely combined with rice OsSH3P2 in the research process, while the function of OsSH3P2 in rice is not reported, so that the gene is supposed to play an important function in a disease-resistant mechanism. Further research finds that rice OsSH3P2 plays an important role in disease resistance, and the research is beneficial to further understanding Src homology domain family and has important significance for disclosing plant disease resistance mechanism.

In order to achieve the purpose, the invention adopts the following technical scheme:

a rice OsSH3P2 gene has a nucleotide sequence shown as SEQ ID NO: 11.

the invention also provides a primer for cloning the OsSH3P2 gene of rice, and the primer sequence is as follows:

OsSH3P2-F: 5'-ATGGAGGCCATCCGGAAGCA-3', as shown in SEQ ID NO: 1 is shown in the specification;

OsSH3P2-R: 5'-GAAGACCTGGGCGACTTTAC-3', as shown in SEQ ID NO: 2, respectively.

The invention also provides a biological material containing the rice OsSH3P2 gene or the rice OsSH3P2 gene obtained by the amplification of the primer, wherein the biological material is an expression vector, a cloning vector or an engineering bacterium.

The invention also provides a vector for knocking out the OsSH3P2 gene of rice as claimed in claim 1, pHUE411 driven by OsU3P is used as the knock-out vector, and the vector also comprises g RNA 1 and g RNA 2;

g RNA 1 has the nucleotide sequence GGCCGUGAUGAAGCAGUUCG as shown in SEQ ID NO: 12 is shown in the specification;

g RNA2 has the nucleotide sequence CCACCCCGCGAACUAUGUCC as shown in SEQ ID NO: shown at 13.

The invention also provides the application of the OsSH3P2 gene, the primer, the biological material or the carrier in improving the rice blast resistance of rice.

The invention also provides application of the OsSH3P2 gene, the primer, the biological material or the carrier in rice breeding.

The invention also provides the application of the gene expression vector for down-regulating OsSH3P2 gene expression or knocking out OsSH3P2 gene.

The invention also provides the application, and the rice comprises a japonica rice variety 'Yunying'.

According to the technical scheme, compared with the prior art, the rice OsSH3P2 gene and the application thereof are provided, and the technical effects are achieved: the SH3P2 gene is obtained by cloning in a rice variety named Yunying. An overexpression strain of OsSH3P2 is obtained through genetic transformation, and a target gene knockout strain is obtained by using a CRISPR/Cas9 technology. The holes are punched to inoculate rice blast germs, and the results show that both the knocked-out and wild plants have resistance to the rice blast germs and show a disease-resistant phenotype; and the over-expression plants show the susceptible phenotype. Meanwhile, the scab area and the pathogenic bacteria biomass are counted, and the result shows that the scab area and the pathogenic bacteria biomass of the over-expression plant are obviously higher than those of the knockout and wild plants. The results show that SH3P2 plays a negative regulation role in plant disease resistance mechanism.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a schematic diagram of the detection of the OsSH3P2 CDS sequence provided by the invention.

FIG. 2 is a schematic diagram of a vector map of pCUbi1390 provided by the present invention.

FIG. 3 is a schematic diagram of a construction strategy of an OsSH3P2 gene overexpression vector provided by the invention.

FIG. 4 is a diagram of a pHUE411 vector map provided by the present invention.

FIG. 5 is a schematic diagram of the construction of an OsSH3P2 gene knockout vector provided by the present invention.

FIG. 6 is a diagram of the physical form of Agrobacterium-mediated rice genetic transformation provided by the present invention, wherein A: rice callus induction; b: subculturing the rice callus; c: callus screening after infection; d: pre-differentiating callus after screening; e: transforming the seedling to take root; f: and (5) hardening seedlings.

FIG. 7 is a schematic diagram of expression amounts of OsSH3P2 of Wild type and Over-expression transgenic plants provided by the invention, wherein Wild-type (WT) is Wild type japonica rice variety 'Yunzi', and Over-expression1.2.3(OE1, OE2, OE3) are three different strains of Over-expression transgenic plants.

FIG. 8 is a diagram illustrating the base knockout result provided by the present invention.

FIG. 9 is a diagram of the lesion area and knockout and wild phenotype observation physical form of the overexpression plant provided by the invention, wherein Knock-out (KO)1, 2 and 3 are three different strains of knockout transgenic plants.

FIG. 10 is a bar graph of lesion length measurements provided by the present invention.

FIG. 11 is a histogram of the statistics of pathogenic bacteria biomass provided by the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The embodiment of the invention discloses a rice OsSH3P2 gene and application thereof.

In the examples, test materials and reagents:

rice variety: yunying japonica rice variety;

the rice blast strain "Sichuan-43" is a known strain, for example, see the literature: "genetic analysis and location of the japonica rice cloud induced rice blast resistance gene, 2003 Zhang Jianfu. Cloning and sequence analysis of ' Yunying ' glutathione S-transferase gene OsGST of japonica rice variety 2014, MaoXiaohui '.

The kits are all commercially available, for example:

a MultiS One Step Cloning Kit ligation Kit;

blunt-end cloning kit (bio-technologies ltd, nuozokenza, tokyo);

culture medium:

1) induction (subculture, preculture) medium: MS Basal Medium +2,4-D (2, 4-dichlorophenoxyacetic acid 3mg/L) + glutamine (500mg/L) + proline (500mg/L) + 3% sucrose + 0.25% Gelrite (vegetable gel), pH 5.8;

2) co-culture medium: DL3+2,4-D (2mg/L) + acetosyringone (AS, 100 μ M), pH 5.8;

3) screening medium I: DL3+2,4-D (2mg/L) + carbenicillin 400mg/L + hygromycin 50mg/L at pH 5.8;

4) and (4) screening a culture medium II: DL3+2,4-D (2mg/L) + carbenicillin 200mg/L + hygromycin 50mg/L at pH 5.8;

5) screening medium III: DL3+2,4-D (2mg/L) + carbenicillin 100mg/L + hygromycin 50mg/L at pH 5.8;

6) pre-differentiation culture medium: DL3+ carboxybenzyl (250mg/L) + Hyg (50mg/L), pH 5.9;

7) differentiation medium: DL + BA (2mg/L) + NAA (0.2mg/L) + KT (2mg/L) + IAA (0.2mg/L) + Glutamine (500mg/L) + proline (500mg/L) + Casein hydrolysate (800mg/L), pH 5.9;

8) rooting culture medium: 1/2MS inorganic salt + MS organic component +30g sucrose, pH 5.8.

9) Activating a culture medium: 3g/L of yeast powder, 10g/L of soluble starch, 15g/L of agar powder and 6.5 of pH.

10) Rice bran culture medium: 30g/L of rice bran, 3g/L of yeast powder, 20g/L of agar powder and 6.5 of pH value.

11) Inoculating a bacteria culture medium: agar powder 5 g/L.

The experimental equipment is conventional commercially available equipment and is not described in detail herein.

Example 1

Cloning analysis of OsSH3P2 Gene

According to a reference genome of Nipponbare of rice, corresponding specific primers are designed, and an OsSH3P2 gene is cloned from a japonica rice variety 'Yunzi', wherein the specific primer sequences are as follows:

OsSH3P2-F：5’-ATGGAGGCCATCCGGAAGCA-3’；SEQ ID NO.1；

OsSH3P2-R: 5'-GAAGACCTGGGCGACTTTAC-3', respectively; SEQ ID NO. 2. Amplifying the DNA by using a high fidelity enzyme Primer Star, wherein the amplification reaction system is as follows: primer Star 25 μL，ddH₂O21 mu L, OsSH3P 2-F1.5 mu L, OsSH3P 2-R1.5 mu L and template DNA (Yunyuan rice variety) 1 mu L. After adding the sample, mixing and centrifuging, and performing PCR amplification procedure as follows: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 90s, for a total of 34 cycles; extending for 10min at 72 ℃; keeping the temperature constant at 4 ℃. Obtaining the OsSH3P2 CDS sequence in the japonica rice variety Yunying (see figure 1). The amplified CDS sequence 1113bp (ATGGAGGCCATCCGGAAGCAGGCGTCCAAGCTCCGGGAGCAGGTCGCCCGGCAGCAGCAGGCCGTGATGAAGCAGTTCGGGGGCGGGTACGGCGCGGACGGCGCGTTCGCCGACGAGGCCGAGGCGCAGCAGCACTCCAAGCTCGAGAAGCTCTACATCTCCACGCGCGCCGCTAAGCACTTCCAAAGGGACATAGTTCGCGGGGTGGAGGGATACATTGTCACAGGGTCGAAGCAGGTCGAAATCGGTAATAAGTTATGCGAGGATGGCAAGAAGTATGGAGCGGAGAACACTTGCACCAGCGGAAGCACGCTGTCGAAGGCGGCGTTGTGTTTCGCCAAAGCACGCTCACTGATGGAGAAGGAGAGAGGGAACCTGCTGAAAGCACTGGGTACTCAGGTGGCAGAACCGTTGAGGGCTATGGTGATGGGAGCTCCTTTGGAAGATGCTCGCCATCTTGCCCAAAGATACGACAGGATGCGTCAGGAAGCCGAAGCACAGGCTATTGAAGTCTCGAAGCGCCAAATGAAATTAAGAGAAACATCTGGGAATGGTGATATGATTTCAAGATTAGAGGCTGCTGAATCAAAGTTGCAAGAGTTAAAGTCAAACATGGGGGTTCTAGGCAAGGAAGCCGTTGCATCAATGACTGCTGTTGAAGCTCAACAGCAAAGACTGACCTTGCAACGACTAATTGCAATGGTCGAATCTGAGAGAAGTTATCACCAGAGGGTTCTGCAGATTCTTGATCAACTTGAAAGAGAGATGGTATCTGAGCGCCAAAGAATTGAAGGAGCACCTCCTCCAGCTGTTGAGAGTTCTATGCCACCACCACCTTCATATGAAGAAATTAACGGTGTTTTCATGAGGAATCCAACAGTCGCTGAATTGGTGGAAACTGTGGAATTCTTCTTGGCTGAGGCCATCCAGTCTTATCGTGCTGAGAGTGAAACTGAGCTCAACCTGGCAGCTGGTGACTATATAGTTGTCCGGAAGGTGTCAAACAATGGATGGGCAGAAGGTGAATGCAGAGGGAAAGCTGGCTGGTTCCCTTACGACTACATCGAGAAAAGGGACCGTGTGCTTGCAAGTAAAGTCGCCCAGGTCTTCTAG, as shown in SEQ ID NO: 11) has 100 percent of homology with CDS in Nipponbare.

And detecting the PCR product by agarose gel electrophoresis after amplification, and recovering the amplified product by a gel recovery kit after a target band is determined to be correct, wherein the recovery step is carried out according to the instruction. Finally, the recovered product is recombined with a cloning vector of a blunt-end cloning kit (Nanjing Novozam Biotechnology Co., Ltd.), and a recombination reaction system is as follows: pTOPO-Blunt Simple Vector 0.5. mu.L, 10 XEnhancer 0.5. mu.L, purified PCR product 100ng, ddH₂And O is supplemented to 5 mu L.

Mixing, centrifuging at low speed, and connecting at room temperature (20-30 ℃) for 5 min. After recombination, the ligation products were transformed into Trans1-T1(DH 5. alpha.) competent cells by the following transformation procedure:

1) subjecting the above transformation product to ice bath treatment for 20min, and heat shock at 42 deg.C for 45 s;

2) adding 400 μ L LB liquid culture medium after ice bath for 2min, shaking and culturing at 37 deg.C and 220rpm for 60 min;

3) centrifuging at 2000rpm for 1min, discarding supernatant, and leaving about 100 μ L LB liquid to resuspend thallus;

4) coating a transformed bacterium liquid on a solid culture medium containing ampicillin resistance, and placing the medium in a constant temperature box at 37 ℃ for culturing for 12 h;

5) selecting 5-10 monoclonal colonies and placing the colonies in 700 mu L of LB liquid culture medium containing ampicillin resistance;

6) carrying out shaking culture at 37 ℃ and 220rpm for 4-5 h, and then carrying out PCR identification on the bacterial liquid, wherein a bacterial liquid sample can be temporarily stored in a refrigerator at 4 ℃, or the bacterial liquid can be directly sent to a sample for sequencing analysis.

The PCR identification of the bacteria liquid uses pTOPO carrier universal primer, and the reaction system is as follows: 2 × mix 5 μ L, F0.5 μ L, R0.5 μ L, template 1 μ L (. apprxeq.100 ng), ddH₂And O is supplemented to 10 mu L.

PCR amplification procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 1.5min for 34 cycles; extending for 10min at 72 ℃; keeping the temperature at 4 ℃.

The sequence of the pTOPO vector universal primer for bacterial liquid sequencing is as follows:

M13F-pTOPO-F: 5'-TGTGTAAAACGACGGCCAG-3', as shown in SEQ ID NO: 19;

M13R-pTOPO-R: 5'-CAGGAAACAGCTATGACC-3', as shown in SEQ ID NO: 20.

example 2

Construction of OsSH3P2 gene overexpression vector

Using Ubiquitin-driven pCUbi1390 (vector map shown in figure 2) as an overexpression vector, carrying out double enzyme digestion on a vector plasmid by using BamHI and Pst I as enzyme digestion sites, and recovering to obtain a linearized cloning vector fragment; a double enzyme digestion system: BamHI 2. mu.L, Pst I2. mu.L, 10 XKBuffer 5. mu.LL, vector 4. mu.g, ddH₂Supplementing O to 50 mu L, mixing uniformly and then heating to 37 ℃ for 3 h.

Corresponding primers (1390-OsSH3P2-F and 1390-OsSH3P2-R) are designed according to the enzyme cutting sites (BamH 1 and Pst I) to amplify, cut and recover the OsSH3P2 gene (the amplification procedure, the system and the recovery are the same as those in example 1).

The specific primer sequences are as follows:

1390-OsSH3P2-F：5’-TTCTGCACTAGGTACGGATTCATGGAGGCCATCCGGAAG-3’；SEQ ID NO.3；

1390-OsSH3P2-R：5’-CGGGGATCCGTCGACCTGCAGGAAGACCTGGGCGACTTTAC-3’；SEQ ID NO.4。

reference to

The MultiS One Step Cloning Kit ligation Kit was ligated to the corresponding overexpression vector by One-Step method using the following system: 5xCE MultiS Buffer 4. mu.L, linearized cloning vector fragment 6. mu.L, insert amplification product 3. mu.L,

MultiS 2μL，ddH₂o5 mu L; mixing, and reacting at 37 deg.C for 30 min. Transforming and sequencing to obtain an overexpression vector plasmid which is driven by a Ubiquitin strong promoter, is inserted into the complete CDS region of OsSH3P2 between enzyme cutting sites and is provided with hygromycin screening genes (the construction strategy schematic diagram of the OsSH3P2 gene overexpression vector is shown in figure 3).

2. Construction of knockout vectors

pHUE411 (a vector map is shown in figure 4) driven by OsU3p is used as a knockout vector, a CRISPR-PLANT (http:// www.genome.arizona.edu/CRISPR/CRISPRSEA rch. html) website is used for screening out specific targets, then the website is logged in CRISPR RGEN Tools (http:// www.rgenome.net/cas-offder /) for off-target analysis of the screened targets, and after the optimum targets are selected, two pairs of specific primers are designed as follows:

Cas9-OsSH3P2-F：5’-AATAATGGTCTCTGGCGGCCGTGATGAAGCAGTTCGGTTTTAGAGCTAGAAATAGC-3’；SEQ ID NO.5；

Cas9-OsSH3P2-R：5’-ATTATTGGTCTCTAAACCCACCCCGCGAACTATGTCCGCTTCTTGGTGCCGCATCAGTTTAACCAACACC-3’；SEQ ID NO.6。

according to the knockout target, the nucleotide sequence corresponding to g RNA 1 is GGCCGUGAUGAAGCAGUUCG, as shown in SEQ ID NO: 12 is shown in the specification; g RNA2 has the nucleotide sequence CCACCCCGCGAACUAUGUCC as shown in SEQ ID NO: shown at 13.

The target sequence of the ligated fragment was amplified using 100-fold diluted pCBC-MT1T2 plasmid (stored in the laboratory) as a template.

The amplification reaction system is as follows: primer Star 25. mu.L, ddH₂O21. mu.L, Cas9-OsSH3P 2-F1.5. mu.L, Cas9-OsSH3P 2-R1.5. mu.L and template 1. mu.L.

After adding the sample, mixing and centrifuging, and performing PCR amplification procedure as follows: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 60s, for a total of 34 cycles; extending for 10min at 72 ℃; keeping the temperature constant at 4 ℃.

Purifying and recovering PCR products, and establishing an enzyme digestion-connection system as follows: 2 μ L template, pHUE 4112 μ L vector, 1.5 μ L10 xNEB T4 Buffer, 1.5 μ L10 xBSA, 1 μ L BsaI (NEB), 1 μ L T4 Ligase (NEB), 1 μ L ddH₂O6. mu.L. After mixing uniformly, 5hours of 37 ℃, 5min of 50 ℃ and 10min of 80 ℃ are carried out to obtain the enzyme digestion ligation product. 5ul of this was added to Trans1-T1(DH 5. alpha.) competent cells for transformation.

Positive colonies were screened on ampicillin resistant solid medium. And (5) sending a sample for sequencing analysis. pHUE411 driven by OsU3P was obtained as a knockout vector, a knockout vector plasmid containing two knockout targets (see FIG. 5 for a schematic diagram of the OsSH3P2 gene knockout vector construction strategy).

The sequencing primer is as follows:

OsU3-FD 3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3', as shown in SEQ ID NO: 14 is shown in the figure;

TaU3-FD 2: 5'-TTGACTAGCGTGCTGATAATTTGTG-3', as shown in SEQ ID NO: shown at 15.

Example 3

Agrobacterium transformation (Freeze thawing method)

The constructed overexpression vector plasmid is transformed into an agrobacterium-infected competent cell EHA105 so as to facilitate a subsequent genetic transformation tissue infection experiment, and the specific steps are as follows:

(1) preparation of Agrobacterium-infected EHA105

1) Thawing glycerol strain EHA105 preserved at-80 ℃ on ice, streaking in solid medium containing rifampicin (Rif) resistance (50 μ g/mL) on a super clean bench, and culturing at 28 ℃ in the dark for 2-3 d;

2) selecting a monoclonal colony, adding the monoclonal colony into 700 mu L LB liquid culture medium containing Rif resistance (50 mu g/mL), performing shaking culture, performing dark culture at 150rpm and 28 ℃, and after the thalli are cultured to a certain concentration, placing the thalli into a 50mL triangular flask for continuous amplification culture;

3) to-be-cultured thallus OD₂₆₀/OD₂₈₀When the value is about 0.4-0.6, carrying out ice-bath treatment on the bacterial liquid for 30min, centrifuging at 4,000rpm at 4 ℃ for 10min, and removing supernatant;

4) adding 10mL of precooled NaCl solution (0.15mol/L), gently mixing and uniformly mixing the resuspended thalli, centrifuging at 4 ℃ and 4,000rpm for 10min, and removing supernatant;

5) 1mL of precooled CaCl was added₂The solution (0.02mol/L) is used for gently blowing and beating the suspended cells;

6) 1mL of pre-cooled 30% glycerol was added, mixed gently, and split-filled (50. mu.L per tube), then frozen with liquid nitrogen and stored in an ultra-low temperature freezer at-80 ℃ for further use.

(2) Transformation of recombinant vector plasmids

1) Freezing and melting the prepared EHA105 competent cells on ice, adding 2 mu g of recombinant vector plasmid, gently mixing uniformly, and then standing for 30min in an ice bath;

2) quickly freezing with liquid nitrogen for 3min, immediately placing into water bath kettle at 37 deg.C for 3min, and ice-cooling for 2 min;

3) adding 500 mu L of LB liquid culture medium, and performing recovery culture at 150rpm and 28 ℃ for 3-5 h;

4) coating the sample on LB solid culture medium containing 50 mu g/mL of Rif and 50 mu g/mL of Kan resistance, and carrying out dark culture treatment for 2-3 d at 28 ℃;

5) the monoclonal colony is picked and added into 700 mu L LB liquid culture medium containing Kan + Rif resistance (50 mu g/mL), shaking culture is carried out at 220rpm and 37 ℃ for about 4h, then the positive clone is amplified and cultured by bacteria liquid PCR identification, a certain amount of glycerol (50% glycerol concentration) is added to be mixed with the strain, and the mixture is frozen in a refrigerator at-80 ℃ for standby.

When bacteria liquid is identified by PCR, a primer detected by the overexpression vector is 1390-OsSH3P2-F/R, and a primer detected by the knockout vector is as follows:

OsU3-FD 3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3', as shown in SEQ ID NO: 14 is shown in the figure;

TaU 3-RD: 5'-CTCACAAATTATCAGCACGCTAGTC-3', as shown in SEQ ID NO: shown at 16.

The reaction system is as follows: 2 × mix 5 μ L, F0.5 μ L, R0.5 μ L, template 1 μ L (. apprxeq.100 ng), ddH₂And O is supplemented to 10 mu L.

PCR amplification procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 1min for 34 cycles; extending for 10min at 72 ℃; keeping the temperature at 4 ℃.

Agrobacterium mediated rice genetic transformation and transgenic seedling detection

(I) Induction and subculture of rice callus

(1) Selection of materials

The induction of the rice callus can be performed by selecting young embryos or fresh seeds in the season, the young embryos are preferably selected from the soft juice of the green and tender grains of the rice husk, and the mature embryos are preferably selected from the full seeds with good integrity.

(2) Disinfection

The method comprises the steps of firstly cleaning with sterile water for 3-5 times, removing surface impurities, carrying out surface disinfection treatment with a 75% ethanol solution for 2min, then directly soaking with a sodium hypochlorite solution containing 2.5% for 10min (a drop of Tween-20 can be added for better disinfection effect), placing on a shaking table to continuously shake to achieve better effect, cleaning with sterile water for a plurality of times, then placing in a dark place for 30min, and then spreading the grains after disinfection and cleaning on sterilized filter paper to blow dry on an ultra-clean workbench (about 10 min).

(3) Induction and subculture of callus

And taking the sterilized immature embryo off the embryo by using a dissecting needle, inoculating the embryo to an induction culture medium, directly inoculating the mature embryo to the induction culture medium, and performing dark culture at 28 ℃. And 7-10 days later, the new callus grown by induction is transferred to a subculture medium after being subjected to bud removal, and subculture is carried out once in about 2 weeks according to the growth condition of the callus.

(II) Agrobacterium transformation of Rice callus

(1) Activation of bacterial cells

And sucking a proper amount of bacteria liquid which is identified as positive, directly streaking on an LB solid culture medium containing Kan (50mg/L) and Rif (50mg/L) resistance, and inversely placing in a biochemical incubator at 28 ℃ for dark culture for 1-2 d.

(2) Infection of callus

1) Selecting embryonic callus with the diameter of about 2-3 mm, bright yellow color and compact structure, and culturing the embryonic callus in a pre-culture medium at 28 ℃ for 2-3 days;

2) washing activated thallus with AAM liquid culture medium containing Acetosyringone (AS) (100 μmol/L), adjusting OD concentration to OD₆₀₀In the range of 0.2-0.3, oscillating vigorously for 1min, standing for 1h to make the thalli form suspension and enhance the infection activity of the thalli;

3) selecting pre-cultured embryonic callus, pouring into suspension, slightly shaking, standing for 10min, air drying callus on sterile filter paper, placing on co-culture medium containing 100 μmol/L acetosyringone, and dark culturing at 28 deg.C for 2 d.

(3) Secondary selection of resistant callus

And transferring the callus after the co-culture for 2d to screening culture mediums (a screening culture medium I, a screening culture medium II and a screening culture medium III) with different carbenicillin concentrations for screening culture, and subculturing the newly grown callus for 2-3 times for 10-12 d each time.

(4) Differentiation and rooting

Selecting new callus growing after screening and subculture treatment, transferring the new callus into a pre-differentiation culture medium for regeneration, clustering, transferring the callus into the differentiation culture medium after one week to grow sprouts after about 2-3 w, wherein green spots appear on the callus. When the plant grows to a certain height, the plant is transferred to a rooting culture medium to be rooted until the seedling is formed.

(5) Hardening off seedlings

And after rooting for 10 days, uncovering, adding sterile water to soak the culture medium, after 2 days, washing the seedlings, transferring the seedlings to a nutrient solution for growth, and during the period, carrying out positive identification on the transgenic plants. Wherein, the physical form of the agrobacterium-mediated rice genetic transformation is shown in figure 6.

Positive detection of transgenic plant

Detecting T3 generation homozygous OsSH3P2 overexpression transgenic plants, extracting wild type and overexpression transgenic rice leaf RNA by a Trizol method, performing reverse transcription to obtain cDNA, and performing real-time fluorescence quantitative PCR to verify expression change. The primers used were as follows:

qOsSH3P2-F: 5'-TGCCACCACCACCTTCATAT-3' as shown in SEQ ID NO: shown at 17.

qOsSH3P2-R: 5'-TCACCTTCTGCCCATCCATT-3' as shown in SEQ ID NO: 18, respectively.

The internal reference adopts Ubiquitin gene, and the primers are as follows:

5'-AACCAGCTGAGGCCCAAGA-3' as shown in SEQ ID NO. 9;

5'-ACGATTGATTTAACCAGTCCATGA-3' as shown in SEQ ID NO. 10;

the enzyme used for real-time fluorescent quantitative PCR was FastStart Universal SYBR GreenMaster (ROX) supplied by ROCHE corporation, and cDNA diluted 20-fold was used as templates, each template having 4 replicates.

The real-time fluorescent quantitative PCR system comprises 10 mu L of SYBR, 0.37 mu L of Primer F, 0.37 mu L of Primer R, 1 mu L of cDNA template and ddH₂O 8.26μL。

The mixed sample is put into a fluorescent quantitative PCR instrument, and the program is set as follows: 10min at 95 ℃; at 95 ℃ for 15s and 60 ℃ for 1min for 40 cycles; the dissolution curve was obtained at 95 ℃ for 15s, 60 ℃ for 1min, 95 ℃ for 30s, and 60 ℃ for 15 s. After the program is finished, all data are analyzed and sorted, and a bar graph is drawn by using Excel.

The expression quantity of the Wild type and Over-expression transgenic plants OsSH3P2 is shown in figure 7, Wild-type (WT) is a Wild type japonica rice variety 'Yunzi', and Over-expression1.2.3(OE1, OE2 and OE3) is three different strains of Over-expression transgenic plants. The expression quantity of OsSH3P2 of the over-expression plants is 150-250 times of the up-regulation, so that three positive homozygous over-expression strains of OE1-OsSH3P2, OE2-OsSH3P2 and OE3-OsSH3P2 are used for carrying out subsequent tests.

The method is characterized in that CRISPR/Cas9 knockout plant transgenic plants of T3 generation homozygous OsSH3P2 are detected, DNA of wild type and knockout transgenic rice leaves is extracted by a CTAB method, OsSH3P2 genes are amplified from the DNA, and amplification primers, a system and a program are the same as those in the process of amplifying a target sequence.

Namely, the primers are as follows: cas9-OsSH3P2-F/R, amplification reaction system: primer Star 25. mu.L, dd H₂O21. mu.L, Cas9-OsSH3P 2-F1.5. mu.L, Cas9-OsSH3P 2-R1.5. mu.L and template 1. mu.L.

PCR amplification procedure: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 60s, for a total of 34 cycles; extending for 10min at 72 ℃; keeping the temperature constant at 4 ℃.

After purifying and recovering the DNA fragment, recombining the DNA fragment with a cloning vector of a blunt-end cloning kit, wherein a recombination reaction system comprises the following steps: pTOPO-Blunt Simple Vector 0.5. mu.L, 10 XEnhancer 0.5. mu.L, purified PCR product 100ng, ddH₂And O is supplemented to 5 mu L. Coli bacteria were transformed, the bacteria solution was sent to the company for sequencing (sequencing primer: OsU3-FD3/TaU3-FD2), and the sequencing results were compared with the OsSH3P2 genome sequence to obtain the specific base knockout results shown in FIG. 8.

All knockout plants cause codon frame shift and loss of OsSH3P2 function, so that three positive homozygous knockout lines, KO1-OsSH3P2, KO2-OsSH3P2 and KO3-OsSH3P2, are used for subsequent experiments.

Example 4

Phenotypic analysis of OsSH3P2 transgenic plant inoculated with rice blast fungus

(1) Cultivation of rice plants

1) 50 full rice seeds (overexpression OsSH3P2, knockout OsSH3P2 and Yunnui wild type seeds) per clone respectively

2) Soaking in a constant-temperature incubator at 37 ℃ for germination, and replacing water every 24 hours;

3) taking out the rice seeds when the rice seeds germinate (the length is about 2-5 mm);

4) sterilizing paddy field soil at 121 deg.C for 60min, and uniformly covering on black tray (25 × 50 cm);

5) uniformly sowing the rice seeds subjected to pregermination in prepared soil, and placing the soil in a rice artificial climate chamber for culture, wherein the climate condition of the artificial climate chamber is 28 ℃; the illumination is 16h, and the darkness is 8 h; the relative humidity is kept at 70%;

6) approximately 3w (3 leaf stage) was cultured and an artificially live inoculation test of Pyricularia oryzae was conducted.

Cultivation of Magnaporthe grisea

(2) Activation and spore production of rice blast strain Sichuan-43

1) Inoculating a 'Yunyuan' rice blast resistant compatible strain ('Sichuan-43') stored in a laboratory filter paper sheet to a prepared activation culture medium;

2) inverting and culturing in dark at 28 deg.C for about two weeks;

3) inoculating the activated strain to a rice bran culture medium;

4) after the light irradiation for 7d, scraping hyphae, and continuously placing the hyphae in a light irradiation incubator at 28 ℃ for culture;

5) after about 3 days, the spores are ready for testing after they have been produced.

(3) Live rice inoculated rice blast strain "Sichuan-43"

Carrying out a rice blast germ punching inoculation experiment on the cultured three-leaf stage rice seedlings:

1) cutting different cloned plant leaves, and punching holes on the leaves at equal intervals.

2) Inoculating bacteria culture medium to make the leaf in humid environment.

3) The prepared spore suspension was inoculated on leaves at 10. mu.L/well.

4) And observing the onset phenotype after 5-7 days.

(4) Phenotypic observations

After 5d, the lesion areas of the over-expressed plants (OE1, OE2 and OE3) were found to be significantly different compared to the knock-out plants (KO1, KO2 and KO3) and the Wild Type (WT). The phenotypic observations are shown in figure 9.

(5) Statistics of the lesion area

The length of the lesion is measured and the statistical results are shown in FIG. 10. The result shows that the lesion area of the over-expression plant is obviously higher than that of the knockout and wild plants, and the over-expression plant shows an infected phenotype. Since the wild type plants are resistant to the strain itself, there is no significant difference in lesion area between knockout and wild type.

(6) Detecting and counting the biomass of pathogenic bacteria

And measuring the expression quantity of pathogenic bacteria organisms in the leaves by a real-time fluorescent quantitative PCR method.

The reaction conditions and system were the same as for the transgenic plant detection in example 3.

The real-time fluorescent quantitative PCR system comprises 10 mu L of SYBR, 0.37 mu L of Primer F, 0.37 mu L of Primer R, 1 mu L of cDNA template and ddH₂O8.26. mu.L. The mixed sample is put into a fluorescent quantitative PCR instrument, and the program is set as follows: 10min at 95 ℃; at 95 ℃ for 15s and 60 ℃ for 1min for 40 cycles; the dissolution curve was obtained at 95 ℃ for 15s, 60 ℃ for 1min, 95 ℃ for 30s, and 60 ℃ for 15 s.

The specific primer sequences are as follows:

MoPot2-F: 5'-ACGACCCGTCTTTACTTATTTGG-3' as shown in SEQ ID NO. 7;

MoPot2-R: 5'-AAGTAGCGTTGGTTTTGTTGGAT-3' as shown in SEQ ID NO. 8;

OsUbq5-F: 5'-AACCAGCTGAGGCCCAAGA-3' as shown in SEQ ID NO. 9;

OsUbq5-R: 5'-ACGATTGATTTAACCAGTCCATGA-3' as shown in SEQ ID NO. 10.

The statistical results obtained are shown in fig. 11, and the results show that the pathogenic bacteria biomass of the over-expression plants is significantly higher than that of the knockout and wild plants.

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Rice research institute of agricultural science institute of Fujian province

<120> rice OsSH3P2 gene and application thereof

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggaggcca tccggaagca 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaagacctgg gcgactttac 20

<210> 3

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttctgcacta ggtacggatt catggaggcc atccggaag 39

<210> 4

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cggggatccg tcgacctgca ggaagacctg ggcgacttta c 41

<210> 5

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aataatggtc tctggcggcc gtgatgaagc agttcggttt tagagctaga aatagc 56

<210> 6

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

attattggtc tctaaaccca ccccgcgaac tatgtccgct tcttggtgcc gcatcagttt 60

aaccaacacc 70

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acgacccgtc tttacttatt tgg 23

<210> 8

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aagtagcgtt ggttttgttg gat 23

<210> 9

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aaccagctga ggcccaaga 19

<210> 10

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

acgattgatt taaccagtcc atga 24

<210> 11

<211> 1113

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atggaggcca tccggaagca ggcgtccaag ctccgggagc aggtcgcccg gcagcagcag 60

gccgtgatga agcagttcgg gggcgggtac ggcgcggacg gcgcgttcgc cgacgaggcc 120

gaggcgcagc agcactccaa gctcgagaag ctctacatct ccacgcgcgc cgctaagcac 180

ttccaaaggg acatagttcg cggggtggag ggatacattg tcacagggtc gaagcaggtc 240

gaaatcggta ataagttatg cgaggatggc aagaagtatg gagcggagaa cacttgcacc 300

agcggaagca cgctgtcgaa ggcggcgttg tgtttcgcca aagcacgctc actgatggag 360

aaggagagag ggaacctgct gaaagcactg ggtactcagg tggcagaacc gttgagggct 420

atggtgatgg gagctccttt ggaagatgct cgccatcttg cccaaagata cgacaggatg 480

cgtcaggaag ccgaagcaca ggctattgaa gtctcgaagc gccaaatgaa attaagagaa 540

acatctggga atggtgatat gatttcaaga ttagaggctg ctgaatcaaa gttgcaagag 600

ttaaagtcaa acatgggggt tctaggcaag gaagccgttg catcaatgac tgctgttgaa 660

gctcaacagc aaagactgac cttgcaacga ctaattgcaa tggtcgaatc tgagagaagt 720

tatcaccaga gggttctgca gattcttgat caacttgaaa gagagatggt atctgagcgc 780

caaagaattg aaggagcacc tcctccagct gttgagagtt ctatgccacc accaccttca 840

tatgaagaaa ttaacggtgt tttcatgagg aatccaacag tcgctgaatt ggtggaaact 900

gtggaattct tcttggctga ggccatccag tcttatcgtg ctgagagtga aactgagctc 960

aacctggcag ctggtgacta tatagttgtc cggaaggtgt caaacaatgg atgggcagaa 1020

ggtgaatgca gagggaaagc tggctggttc ccttacgact acatcgagaa aagggaccgt 1080

gtgcttgcaa gtaaagtcgc ccaggtcttc tag 1113

<210> 12

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggccgugaug aagcaguucg 20

<210> 13

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ccaccccgcg aacuaugucc 20

<210> 14

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gacaggcgtc ttctactggt gctac 25

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ttgactagcg tgctgataat ttgtg 25

<210> 16

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ctcacaaatt atcagcacgc tagtc 25

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tgccaccacc accttcatat 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tcaccttctg cccatccatt 20

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tgtgtaaaac gacggccag 19

<210> 20

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

caggaaacag ctatgacc 18

Claims (8)

1. The rice OsSH3P2 gene is characterized in that the nucleotide sequence is shown as SEQ ID NO: 11.

2. a primer for cloning rice OsSH3P2 gene is characterized by comprising the following sequence: OsSH3P2-F: 5'-ATGGAGGCCATCCGGAAGCA-3', as shown in SEQ ID NO: 1 is shown in the specification; OsSH3P2-R: 5'-GAAGACCTGGGCGACTTTAC-3', as shown in SEQ ID NO: 2, respectively.

3. A biomaterial containing the rice OsSH3P2 gene of claim 1 or the rice OsSH3P2 gene obtained by amplification with the primers of claim 2, wherein the biomaterial is an expression vector, a cloning vector or an engineering bacterium.

4. A vector for knocking out the OsSH3P2 gene of rice as claimed in claim 1, wherein pHUE411 driven by OsU3P is used as the knock-out vector, and the vector further comprises g RNA 1 and g RNA 2;

the nucleotide sequence of the g RNA 1 is GGCCGUGAUGAAGCAGUUCG, and is shown as SEQ ID NO: 12 is shown in the specification;

the nucleotide sequence of the g RNA2 is CCACCCCGCGAACUAUGUCC, and is shown as SEQ ID NO: shown at 13.

5. Use of the OsSH3P2 gene of claim 1, the primer of claim 2, the biomaterial of claim 3 or the vector of claim 4 for improving rice blast resistance.

6. Use of the OsSH3P2 gene of claim 1, the primer of claim 2, the biomaterial of claim 3 or the vector of claim 4 in rice breeding.

7. The use of claim 5 or 6, wherein OsSH3P2 gene expression is down-regulated or an OsSH3P2 gene is knocked out.

8. The use as claimed in claim 5 or claim 6, wherein the rice comprises the japonica rice variety "Yunzi".

Images