CN112501260B

CN112501260B - Bisphenol A detection method, fluorescence detection kit and application thereof

Info

Publication number: CN112501260B
Application number: CN202011356478.XA
Authority: CN
Inventors: 陈俊华; 潘家峰; 施晨璐
Original assignee: Institute of Eco Environmental and Soil Sciences of Guangdong Academy of Sciens
Current assignee: Institute of Eco Environmental and Soil Sciences of Guangdong Academy of Sciens
Priority date: 2020-11-27
Filing date: 2020-11-27
Publication date: 2021-06-29
Anticipated expiration: 2040-11-27
Also published as: CN112501260A

Abstract

The invention discloses a bisphenol A detection method, a fluorescence detection kit and application thereof. The method is based on an Aptamer, and realizes high-sensitivity detection of BPA through an Aptamer/Catalyst compound, an Initiator 1/Initiator 2/Assist compound, a chain displacement reaction mediated by a tandem cohesive end and a DNA self-assembly signal amplification strategy by relying on a fluorescence sensitive platform. The method is simple and easy to implement, low in cost and fast in reaction process. The linear range of detection can be from 100fM to 1 μ M, the effective detection limit can reach 50fM, and similar selectivity can be generated for other BPA analogues possibly existing, and the precision and the accuracy are better.

Description

Bisphenol A detection method, fluorescence detection kit and application thereof

Technical Field

The invention belongs to the field of analysis and detection, and particularly relates to a bisphenol A detection method, a fluorescence detection kit and application thereof.

Background

Bisphenol a (bpa) is widely used in the manufacture of food and beverage packaging, milk bottles, heat sensitive paper and other products as an environmental secretion interfering chemical. Low concentrations of BPA can not only cause environmental pollution, but can also be a health hazard. The European Food Safety Agency (EFSA) states that the maximum daily intake of BPA (TDI) in humans cannot exceed 4. mu.g/kg.

At present, the conventional BPA detection methods mainly comprise methods such as reversed-phase high performance liquid chromatography (RP-HPLC), gas chromatography-mass spectrometry (GC-MS), gas chromatography-tandem mass spectrometry (GC-MS/MS) and liquid chromatography-tandem mass spectrometry (LC-MS/MS). However, the existing methods need to separate and enrich BPA in a sample, and the methods have the defects of complex and time-consuming operation, inconvenience for rapid field detection and the like, so that the rapid detection of the BPA is greatly limited.

In recent years, methods for detecting a target substance using an aptamer (aptamer) have been attracting attention, and analytical techniques such as fluorescence, electrochemistry, and colorimetry have been established, but many of them have problems such as low sensitivity and difficulty in aptamer screening, and thus have limited the wide application of detection based on an aptamer.

Therefore, it is highly desirable to develop a highly sensitive detection method that can be specifically applied to BPA to achieve rapid and efficient detection of BPA.

Disclosure of Invention

The invention aims to provide a label-free fluorescence detection method of bisphenol A;

it is another object of the present invention to provide a detection kit;

another object of the present invention is to provide a biosensor based on the above detection method;

the invention also aims to provide the application of the label-free fluorescence detection method or the detection kit in detecting bisphenol A.

The technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, there is provided:

a label-free fluorescence detection method of bisphenol A (BPA) comprises the following steps:

(1) base complementation of an Aptamer (Aptamer) and a catalytic chain (Catalyst) is carried out to obtain a compound A, and base complementation of an Initiator (Initiator) and an auxiliary chain (Assist) is carried out to obtain a compound B;

(2) sequentially adding the compound A, the compound B and a Fuel chain (Fuel chain) into a sample to be detected, and then adding a DNA nuclease chain (DNAzymenzymenzymenzyme strand) and a DNA nuclease substrate chain (DNAzymenesubstrate strand) into the sample to be detected for carrying out an enzymatic cleavage reaction;

(3) and detecting the concentration and the fluorescence intensity of the substrate chain, and calculating to obtain the content of the bisphenol A in the sample to be detected.

Wherein, the steps (1) and (2) are both carried out in a buffer system, the buffer system contains Tris-HCl buffer solution (20mM), and the Tris-HCl buffer solution contains NaCl, KCl and MgCl₂Tris-HCl buffer solution at pH 8.0.

Further, the Tris-HCl buffer solution contains 150mM NaCl, 50mM KCl and 20mM MgCl₂Tris-HCl buffer solution at pH 8.0.

The principle of the label-free fluorescence detection method for bisphenol A (BPA) in the embodiment of the invention is as follows:

as shown in FIG. 1, the sample to be tested is first mixed and incubated with the complex A. During the incubation process, if the sample to be tested contains BPA, BPA can be combined with Aptamer (Aptamer) released by denaturation of the complex A to form a BPA/Aptamer complex. While the catalytic strand (Catalyst) released by the denaturation of the complex A can be combined with the complex B added later (5 regions of the Catalyst sequence are combined with 5 regions of the complex B sequence complementarily) to form an Intermediate complex 1(Intermediate 1, in this case, a four-strand complex), and then the Catalyst on Intermediate 1 can replace 4 regions of the Initiator 1(Initiator 1) sequence on Intermediate 1 through a strand displacement exchange reaction, so that the Initiator 1 is released from Intermediate 1, and the Intermediate 1 losing the Initiator 1 is changed into an Intermediate complex 2(Intermediate 2, in this case, a three-strand complex).

Region 3 of the intermedate 2 sequence binds to region 3 of the added Fuel chain (Fuel chain) sequence to form Intermediate complex 3 (intermedate 3, in this case a four chain complex). Subsequently, intermedate 3 moves through branch migration, releasing its bound initiating strand 2(Initiator 2), becoming Intermediate complex 4 (intermedate 4, in this case a three-strand complex).

Initiator 1 released from Intermediate 1 and Initiator2 released from Intermediate 3 initiate the process of self-assembly of DNA to self-assemble with the subsequently added DNAzymenzymenzymenzyme strand and DNAzymenesubstrate strand to form a "type I" DNAzyme (DNAzymenzyme). Under the enzyme cleavage conditions, DNAzymenzymenzymenzyme strand in DNAzyme cleaves the cleavage site in DNAzymenzymenzoate strand, which cleaves DNAzymenzymenzoate strand from the cleavage site to form Signal strand 1(Signal 1) and Signal strand 2(Signal 2). By adding a fluorescent group and a quenching group on two sides of a restriction enzyme cutting site in DNAzymeasubstrate strand, after DNAzymebstrate strand is broken from the restriction enzyme cutting site, the fluorescent group and the quenching group are separated and positioned in Signal 1 or Signal 2, and fluorescence can be generated in a Signal chain containing the fluorescent group due to the fact that no quenching group is connected.

And finally, detecting the concentration and the fluorescence intensity of DNAzymeasubstrate and obtaining the BPA content in the sample to be detected according to the linear relation of the concentration and the fluorescence intensity.

On the other hand, when Intermediate 4 is formed after Intermediate 3 releases Initiator2, the Catalyst is released from Intermediate 4 by the strand displacement exchange reaction of the Fuel strand in Intermediate 4, and a Waste double strand is formed (Waste). And the Catalyst released from Intermediate 4 is added into the reaction combined with the compound B again to realize the cyclic catalytic entropy-driven reaction (EDR) and complete the ring closure of the reaction.

If the sample to be detected does not contain BPA, the Aptamer does not have the condition of being combined with BPA, so that the Catalyst cannot be released, the subsequent reaction is blocked, DNAzyme cannot be generated, the situation that a fluorescent group and a quenching group are separated cannot occur, and the fluorescent reaction cannot occur.

Under the best condition, the linear range obtained by the label-free fluorescence detection method can be from 100fM to 1 mu M, and the effective detection limit of BPA can reach 50 fM. Moreover, the label-free fluorescence detection method can generate similar selectivity to other BPA analogues possibly existing, and has better precision and accuracy.

Further, the above Aptamer (Aptamer) is targeted to bind to either the catalytic chain or bisphenol a.

The nucleotide sequence of the Aptamer is as follows: 5'-CCGGTGGGTGGTCAGGTGGGATAGCGTTCCGCGT ATGGCCCAGCGCATCACGGGTTCGCACCA-3' (SEQ ID NO. 1).

Further, the catalytic chain (Catalyst) is targeted to bind to any one of the aptamer or the complex B.

The nucleotide sequence of the Catalyst is as follows: 5'-CCATACGCGGAACGCTATCCCA-3' (SEQ ID NO. 2).

Wherein, the 4 region of the Catalyst sequence is CATACGCGGAACGCT; region 5 of the Catalyst sequence is ATCCCA.

Furthermore, both

regions

4 and 5 of the Catalyst sequence are complementary to the Aptamer sequence, and region 5 of the Catalyst sequence is complementary to the sequence base in the complex B.

Further, the above complex a was prepared by Aptamer and catalysts at 1 nM: the mixing ratios of (1-10) nM are combined, wherein the inventor finds that different mixing ratios can generate different signal-to-noise ratios, and the effect on experimental results is better when the signal-to-noise ratio is larger.

Further, the reaction conditions for preparing the complex A described above were 95 ℃ for 7 minutes.

Further, the initiating strand (Initiator) includes initiating strand 1(Initiator 1) and initiating strand 2(Initiator 2).

The Initiator is targeted to bind to any one of the helper strand (Assist), the DNAzymeasubstrate strand (DNAzymenzeubstrate) and the DNAzymenzymenzymenzyme strand (DNAzymenzymenzymenzyme strand).

Further, the Initiator targets and binds the DNA nuclease substrate strand (DNAzymenzesubstrate strand) and the DNA nuclease enzyme chain (DNAzymenenzyme strand) simultaneously through a self-assembly reaction to form the DNA nuclease (DNAzyme) of type "I".

Further, the nucleotide sequence of the Initiator 1 is: 5'-CCACATACATCATATTCCCTCCATAC GCGGAACGCT-3' (SEQ ID NO. 3).

Further, region 3 of the Initiator 1 sequence is CCCT; region 4 of the Initiator 1 sequence is CCAT ACGCGGAACGCT; region 6 of the Initiator 1 sequence is CCACATACATCATATT.

Further, 3 and 4 regions of the Initiator 1 sequence are each base-complementary to the sequences of the above assay and the above DNAzymeasubstrate strand; region 6 of the Initiator 1 sequence is complementary to the base sequence of the DNAzymeenzymenzyme strand described above.

Further, the nucleotide sequence of the Initiator2 is: 5'-CTTTCCTACACCTACGTCTCCAACT AACTTACGG-3' (SEQ ID NO. 4).

Further, region 1 of the Initiator2 sequence is CTTTCCTACA; region 2 of the Initiator2 sequence is C CTACGTCTCCAACTAACTTACGG.

Furthermore, region 1 of the Initiator2 sequence is complementary to the base sequence of DNAzymessubstrat; region 2 of the Initiator2 sequence is complementary to the sequence bases of the above-mentioned Assist and the above-mentioned DNAzymenzymenzyme strand.

Further, the nucleotide sequence of the above Assist is: 5'-TGGGATAGCGTTCCGCGTATGGAGGGCC GTAAGTTAGTTGGAGACGTAGG-3' (SEQ ID NO. 5).

Further, the 2 × region of the above Assist sequence is CCGTAAGTTAGTTGGAGACGTAGG; region 3 of the Assist sequence is AGGG; the 4-fold region of the Assist sequence is AGCGTTCCGCGTATGG; the 5-region of the Assist sequence is T GGGAT. Wherein, 5 regions of the Assist sequence are 5 regions of the complex B sequence.

Further,

regions

2, 3 and 4 of the above Assist sequence are complementary to the sequence bases of the Fuel chain (Fuel chain).

Further, the above compound B is a compound formed by Initiator and Assist in a ratio of 2: (1-10) in a molar ratio.

Further, the compound B is a compound formed by Initiator 1, Initiator2 and Assist in a ratio of 1: 1: and (1-10), wherein the inventor finds that different mixing ratios can generate different signal-to-noise ratios, and the higher the signal-to-noise ratio is, the better the experimental result is.

Further, the reaction conditions for preparing the complex B are 95 ℃ for 5 to 10 minutes.

Further, the nucleotide sequence of the above Fuel chain (Fuel chain) is: 5'-CCTACGTCTCCAACTAACTTA CGGCCCTCCATACGCGGAACGCT-3' (SEQ ID NO. 6).

Further, region 2 of the above Fuel chain sequence is CCTACGTCTCCAACTAACTTACGG; CCCT is in the 3 region of Fuel chain sequence; region 4 of the Fuel chain sequence is CCATACGCGGAACGCT.

Furthermore,

regions

2, 3 and 4 of the Fuel strand sequence are all base-complementary to the Assist sequence.

Further, the above-mentioned DNA nuclease chain (DNAzymenzymenzyme strand) includes magnesium ion-dependent DNAzy meenzyme strand.

Furthermore, the nucleotide sequence of the magnesium ion-dependent dnazyme enzyme strand is: 5'-AGACGTA GGGACTCCGAGCCGGACGAAGTTAATATGATG-3' (SEQ ID NO. 7).

Further, the 2 region of the above magnesium ion-dependent dnazyme enzyme strand sequence is AGACGTAGG; the 7-region of the magnesium ion-dependent dnazyme strand sequence is GACTCCGAGCCGGACGAAGTT; the 6 region of the magnesium ion dependent dnazyme enzyme strand sequence is AATATGATG.

Further, 6 region of the above-mentioned magnesium ion-dependent dnazyme enzyme strand sequence is complementary to the base sequence of Initiator 1; the 2 region of the magnesium ion dependent dnazyme enzyme strand sequence is base complementary to the sequence of Initiator 2.

Further, the above-mentioned DNA nuclease substrate strand (DNAzymeasubstrate strand) contains an enzyme cleavage site corresponding to the above-mentioned DNAzyme enzyme strand and a fluorescent group and a quenching group which are located on both sides of the enzyme cleavage site, respectively.

Further, the cleavage site is rA.

Of course, those skilled in the art can select other alternative sites as equivalents according to the actual situation.

Still further, the above fluorescent group includes FAM, TET, CY3 or TAMRA; among them, FAM is preferable.

Further, the above-mentioned quenching group includes BHQ-1, BHQ-2 or Dabcyl; among them, Dabcyl is preferable.

The fluorescent group and the quenching group are respectively positioned at two sides of the enzyme cutting site, the position exchange of the fluorescent group and the quenching group does not influence the detection result, and the position exchange of the fluorescent group and the quenching group also belongs to the practical protection range of the invention.

Further, the dnazyme said strand comprises a magnesium ion dependent dnazyme said strand, and the nucleotide sequence of said magnesium ion dependent dnazyme said strand is:

5'-TATGGAGGGAACT(SEQ ID NO.8)[Dabcyl]rAGGT(SEQ ID NO.9)[FAM]CTGT AGGAAAG-3'(SEQ ID NO.10)。

further, the 4-fold region of the magnesium ion-dependent dnazyme said strand is TATGG; the 3 region of the magnesium ion dependent dnazyme substrate strand sequence is AGGG; the 8 region of the magnesium ion dependent DNAzymessubstrate stran d sequence is AACT [ Dabcyl ] rAGGT [ FAM ] C; the 1 region of the magnesium ion dependent dnazyme substrate strand sequence is TGTAGGAAAG.

Further, 3-fold region and 4-fold region of the above-mentioned magnesium ion-dependent dnazyme strand sequence are both base-complementary to the sequence of Initia tor 1; region 1 of the magnesium ion-dependent dnazyme strand sequence is complementary to the sequence base of Initiator 2.

Wherein, after the Initiator 1, the Initiator2, the magnesium ion dependent DNAzyme enzyme strand and the magnesium ion dependent DNAzyme substrate strand are self-assembled to form the DNA nuclease (DNAzyme) of type "I", under the magnesium ion environment, the magnesium ion dependent DNAzyme enzyme strand will cut the rA site in the magnesium ion dependent DNAzyme substrate strand, so that the DNAzyme substrate strand is broken from the rA site, thereby separating the fluorescent group and the quenching group in Signal 1 or Signal 2.

Further, the detection conditions for detecting the fluorescence intensity are as follows: excitation light wavelength (. lamda.ex) 488nm and emission light wavelength peak (. lamda.em) 520 nm.

In a second aspect of the present invention, there is provided:

a test kit, comprising: nucleic acid aptamer preparations, catalytic strand preparations, priming strand preparations, helper strand preparations, fuel strand preparations, DNA nuclease chain preparations, and DNA nuclease substrate chain preparations.

Further, the detection kit also comprises a buffer solution.

Further, the buffer solution is Tris-HCl buffer solution (20mM), and the Tris-HCl buffer solution contains NaCl, KCl and MgCl₂The pH value of the Tris-HCl buffer solution is 8.0-8.5; the pH value of the Tris-HCl buffer solution is preferably 8.0-8.1; more preferably 8.0.

Further, the Aptamer preparation contains an Aptamer with a sequence shown as SEQ ID NO. 1.

Further, the catalytic chain preparation contains Catalyst with a sequence shown in SEQ ID NO. 2.

Further, the above-mentioned primer chain preparation contains Initiator 1 and Initiator 2.

Further, the nucleotide sequence of the Initiator 1 is shown as SEQ ID NO. 3.

Further, the nucleotide sequence of the Initiator2 is shown as SEQ ID NO. 4.

Further, the above-described priming strand preparation is used to prime the DNA self-assembly process.

Further, the auxiliary chain preparation contains Assist shown in SEQ ID NO. 5.

Further, the Fuel chain preparation contains a Fuel chain shown in SEQ ID NO. 6.

Further, the above DNA nuclease chain preparation contains DNAzymenzymenzyme strand and shown in SEQ ID NO. 7.

Further, the above DNA nuclease substrate strand preparation comprises DNAzymeasubstrate strand; wherein the DNAzymenzymenzyme strand contains an enzyme cutting site corresponding to the DNAzymenzymenzyme strand, and a fluorescent group and a quenching group which are respectively positioned at two sides of the enzyme cutting site.

Further, the cleavage site is rA.

wherein, the primer chain preparation, the DNA nuclease chain preparation and the DNA nuclease substrate chain preparation are mixed and then self-assembled to form the DNA nuclease (DNAzyme) of the I type.

Further, the detection kit is based on the nucleic acid aptamer preparation, the catalytic strand preparation, the priming strand preparation and the auxiliary strand preparation, and realizes high-sensitivity detection of BPA by a fluorescence sensitive platform based on a tandem sticky end mediated strand displacement reaction and a DNA self-assembly signal amplification strategy.

Under the optimal condition, the detection kit provided by the invention can reach an effective detection limit of 50fM on BPA. Moreover, the detection kit can generate similar selectivity to other BPA analogues possibly existing, and has better precision and accuracy.

In a third aspect of the present invention, there is provided:

a biosensor based on the detection method.

The biosensor is prepared on the basis of the following principle:

(2) adding a sample to be tested, and mixing and incubating the sample to be tested with the compound A. During the incubation process, if the sample to be tested contains BPA, BPA can be combined with Aptamer (Aptamer) released by denaturation of the complex A to form a BPA/Aptamer complex. The catalytic strand (Catalyst) released by the denaturation of the complex A can be combined with the complex B added later (5 regions of the Catalyst sequence are complementarily combined with 5 regions of the complex B sequence) to form an Intermediate complex 1(Intermediate 1, in this case, a four-strand complex), and then the Catalyst on Intermediate 1 can displace 4 regions of the Initiator 1(Initiator 1) sequence on Intermediate 1 through a strand displacement exchange reaction, so that the Initiator 1 is released from Intermediate 1, and the Intermediate 1 losing the Initiator 1 is changed into an Intermediate complex 2(Intermediate 2, in this case, a three-strand complex). Region 3 of the intermedate 2 sequence binds to region 3 of the added Fuel chain (Fuel chain) sequence to form Intermediate complex 3 (intermedate 3, in this case a four chain complex). Subsequently, intermedate 3 moves through branch migration, releasing its bound initiating strand 2(Initiator 2), becoming Intermediate complex 4 (intermedate 4, in this case a three-strand complex). Initiator 1 released from Intermediate 1 and Initiator2 released from Intermediate 3 initiate the process of self-assembly of DNA to self-assemble with the subsequently added DNAzymenzymenzymenzyme strand and DNAzymenesubstrate strand to form a "type I" DNAzyme (DNAzymenzyme). Under the enzyme cleavage conditions, DNAzymenzymenzymenzyme strand in DNAzyme cleaves the cleavage site in DNAzymenzymenzoate strand, which cleaves DNAzymenzymenzoate strand from the cleavage site to form Signal strand 1(Signal 1) and Signal strand 2(Signal 2). By adding a fluorescent group and a quenching group on two sides of a restriction enzyme cutting site in DNAzymeasubstrate strand, after DNAzymebstrate strand is broken from the restriction enzyme cutting site, the fluorescent group and the quenching group are separated and positioned in Signal 1 or Signal 2, and fluorescence can be generated in a Signal chain containing the fluorescent group due to the fact that no quenching group is connected.

Thus, whether the sample to be tested contains BPA can be determined by the biosensor.

Wherein the steps (1) and (2) are both carried out in a Tris-HCl buffer solution containing 150mM NaCl, 50mM KCl and 20mM MgCl₂Tris-HCl buffer solution at pH 8.0.

Further, the above complex a was prepared by Aptamer and catalysts at 1 nM: (1-10) nM in the mixing ratio.

Further, the compound B is a compound formed by Initiator 1, Initiator2 and Assist in a ratio of 1: 1: (1-10) in a molar ratio.

Further, the cleavage site is rA.

In a fourth aspect of the present invention, there is provided:

the application of the label-free fluorescence detection method or the detection kit in the detection of bisphenol A.

The invention has the beneficial effects that:

1. the invention provides a label-free fluorescence detection method of bisphenol A, which takes an Aptamer as a sensing element, and realizes high-sensitivity detection of BPA by means of an Aptamer/Catalyst compound, an Initiator 1/Initiator 2/Assist compound, a chain displacement reaction mediated by a series adhesive end and a DNA self-assembly signal amplification strategy through a fluorescence sensitive platform.

2. The label-free fluorescence detection method disclosed by the invention is simple to operate, low in cost, quick in response in the whole detection process, capable of mastering the operation flow without professional training and convenient to rapidly popularize and use.

3. The detection linear range of the detection kit can be from 100fM to 1 mu M, the effective detection limit of BPA can reach 50fM, and the detection kit can also generate similar selectivity to other BPA analogues possibly existing, and has better precision and accuracy.

Drawings

FIG. 1 is a diagram of a design concept of a detection method in an embodiment of the present invention;

FIG. 2 is a diagram showing the results of specific detection by the detection method in the example of the present invention;

FIG. 3 is a graph showing the results of the detection method of the embodiment of the present invention for BPA with different concentrations, wherein A is a graph of the emission spectrum at different BPA concentrations under the condition of λ ex 488 nm; b is F under the condition that lambada ex is 488nm_λemStandard curve of fluorescence obtained at 520 nm.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.

Preparation of BPA detection kit

The BPA detection kit prepared in this example included:

nucleic acid aptamer preparations, catalytic strand preparations, priming strand preparations, helper strand preparations, fuel strand preparations, DNA nuclease enzyme strand preparations, DNA nuclease substrate strand preparations, and buffers.

The Aptamer preparation contains an Aptamer, and the nucleotide sequence of the Aptamer is as follows: 5'-CCGGTGGGTGGTCAGGTGGGATAGCGTTCCGCGTATGGCCCAGCGCATCACGGGTTC GCACCA-3' (SEQ ID NO. 1).

The catalytic chain preparation contains Catalyst, and the nucleotide sequence of the Catalyst is as follows: 5'-CCATACGCGGAACGCTATCCCA-3' (SEQ ID NO. 2).

Region 4 of the Catalyst sequence is CATACGCGGAACGCT; region 5 of the Catalyst sequence is ATCCCA.

Regions

4 and 5 of the Catalyst sequence are complementary to the base of the Aptamer sequence, and the Catalyst and the Aptamer are complementary to form a complex A.

Initiator 1 and Initiator2 are contained in the primer chain preparation.

Wherein, the nucleotide sequence of Initiator 1: 5'-CCACATACATCATATTCCCTCCATACGCGGAACGCT-3' (SEQ ID NO. 3);

the nucleotide sequence of Initiator2 is as follows: 5'-CTTTCCTACACCTACGTCTCCAACTAACTTACGG-3' (S EQ ID NO. 4).

The Initiator 1 sequence has a region 3 of CCCT, a region 4 of CCATACGCGGAACGCT and a region 6 of CCACATACA TCATATT.

The Initiator2 sequence has region 1 of CTTTCCTACA and region 2 of CCTACGTCTCCAACTAACTTACGG.

The auxiliary chain preparation contains Assist, and the nucleotide sequence of the Assist is as follows: 5'-TGGGATAGCGTTCCGCGTATGG AGGGCCGTAAGTTAGTTGGAGACGTAGG-3' (SEQ ID NO. 5).

The Assist sequence has region 2 of CCGTAAGTTAGTTGGAGACGTAGG, region 3 of AGGG, region 4 of AG CGTTCCGCGTATGG, and region 5 of TGGGAT.

After the initiating strand preparation and the auxiliary strand preparation are mixed, Initiator 1, Initiator2 and Assist in the preparation can form a compound B through base complementation. The resulting complex B had a 5-way cohesive end from the 5-way region of the a ssist sequence.

The Fuel chain preparation contains a Fuel chain, and the nucleotide sequence of the Fuel chain is as follows: 5'-CCTACGTCTCCAACTAACTTA CGGCCCTCCATACGCGGAACGCT-3' (SEQ ID NO. 6).

The Fuel chain sequence has region 2 of CCTACGTCTCCAACTAACTTACGG, region 3 of CCCT, and region 4 of CCAT ACGCGGAACGCT.

The Fuel strand sequence is complementary to the Assist sequence at

base

2, 3 and 4.

The DNA nuclease chain preparation contains magnesium ion dependent DNAzymenzymenzyme strand, and the nucleotide sequence of the magnesium ion dependent DNAzymenzymenzyme strand is as follows: 5'-AGACGTAGGGACTCCGAGCCGGACGAAGTTAATA TGATG-3' (SEQ ID NO. 7).

The magnesium ion dependent dnazyme enzyme strand sequence has region 2 at AGACGTAGG, region 7 at GACTCCG AGCCGGACGAAGTT, and region 6 at AATATGATG.

The DNA nuclease substrate strand preparation contains magnesium ion dependent DNAzymeasubstrate strand, and the magnesium ion dependent DNAzymeszeubstrate strand contains an enzyme cutting site rA corresponding to the magnesium ion dependent DNAzymenzymenzymenzyme strand and a fluorescent group and a quenching group which are respectively positioned at two sides of the enzyme cutting site.

The nucleotide sequence of the magnesium ion-dependent DNAzymeasubstrate strand is as follows:

the magnesium ion dependent DNAzymessubstrate strand has 4 region TATGG, 3 region AGGG, 8 region AAC T [ Dabcyl ] rAGGT [ FAM ] C, and 1 region TGTAGGAAAG.

The self-assembly process of DNA occurs in the environment of Initia 1 and Initia 2 by the magnesium ion dependent DNAzymenzymenzymenzymenzymenzyme strand and the magnesium ion dependent DNAzymeszymenzymenzymenzymenzyme strand, and the "I" form of DNAzyme is obtained by base complementation of four sequences (specifically, 3 and 4 regions of Initia 1 sequence bind to 3 and 4 regions of magnesium ion dependent DNAzymenzymenzymenzymenzymenzymenzyme strand sequence, 6 region of Initia 1 sequence binds to 6 region of magnesium ion dependent DNAzymenzymenzymenzymenzyme strand and sequence, 2 region of Initia 2 sequence binds to 2 region of magnesium ion dependent DNAzymenzymenzymenzymenzymenzyme strand and sequence, 1 region of Initia 2 sequence binds to 1 region of magnesium ion dependent DNAzymenzymenzymenzymenzymenzyme strand and sequence, respectively).

The buffer solution is a 20mM Tris-HCl buffer solution in which NaCl with a final concentration of 150m M, 50mM KCl and 20mM MgCl are mixed₂Wherein the pH value of the Tris-HCl buffer solution is 8.0.

Of course, MgCl in buffer₂Can be replaced by other Mg-containing materials²⁺The compound of (1).

DNAzymes self-assembled from the above-described magnesium ion-dependent DNAzymeenzymenzyme strand, magnesium ion-dependent DNAzymeszesubstrate strand, Initiator 1 and Initiator2 are produced In Mg²⁺The enzyme digestion reaction is carried out in the environment, and the DNAzyme subst is dependent on magnesium ionsThe rA site in the rate strand cleaves the magnesium ion-dependent DNAzyme substrate strand into Signal 1 or Signal 2, and the fluorophore and the quencher are located in Signal 1 or Signal 2 respectively along with the cleavage of the magnesium ion-dependent DNAzyme substrate strand and are no longer in the same single-stranded nucleotide, so that the Signal chain containing the fluorophore undergoes a fluorescence reaction.

BPA detection method

The design concept of the detection method is shown in FIG. 1.

The sample to be tested is first incubated with the above-mentioned complex A. During the incubation process, if the sample to be tested contains BPA, BPA can be combined with Aptamer (Aptamer) released by denaturation of the complex A to form a BPA/Aptamer complex. The catalytic strand (Catalyst) released by the denaturation of the complex a binds to the complex B added later (region 5 of the Catalyst sequence is complementary to region 5 of the complex B sequence) to form Intermediate complex 1(Intermediate 1, in this case a four-strand complex), and then the Catalyst on the Intermediate 1 displaces region 4 of the Initiator 1(Initiator 1) on the Intermediate 1 by a strand displacement exchange reaction, thereby releasing the Initiator 1 from the Intermediate 1, and the Intermediate 1 that has lost the Initiator 1 becomes Intermediate complex 2(Intermediate 2, in this case a three-strand complex).

The detection method comprises the following specific steps:

(1) preparation of Complex A:

at room temperature, Aptamer and catalysts were mixed at a final concentration of 1 nM: (1-10) nM (different mixing ratio can obtain different signal-to-noise ratio, the larger the signal-to-noise ratio is, the better the experiment result is, the optimal ratio is found by the inventor), 20mM Tris-HCl buffer solution (containing 150mM NaCl, 50mM KCl and 20mM MgCl in final concentration) is added₂pH 8.0), heated at 95 ℃ for 7 minutes, and cooled to room temperature to give complex a (a ptamer/Catalyst complex).

(2) Preparation of Complex B:

adding last (Initiator 1, Initiator2 and A) into Initiator 1 and Initiator2 with the concentration of 100-1000 nMThe molar ratio of ssist is 1: 1: (1-10), different mixing ratios can obtain different signal-to-noise ratios, the larger the signal-to-noise ratio is, the better the experiment result is, the ratio is the optimal ratio found by the research of the inventor), the mixture is mixed with a Tris-HCl buffer solution (containing 150mM NaCl, 50mM KCl and 20mM MgCl in the final concentration)₂And (4) heating at 97 ℃ for 5-10 minutes at a pH of 8.0), and cooling to room temperature to obtain a compound B (Initiator 1/Initiator 2/Assist compound).

The experimental conditions have great influence on the experimental results, the optimal conditions of each reaction condition, namely the corresponding signal-to-noise ratio, reach the maximum, and the experimental effect can reach the optimum only under the optimal conditions.

(3) Detection of BPA:

20uL of the solution to be tested is added into Tris-HCl buffer solution containing the compound A and incubated for 40 minutes. Complex B and Fuel chain were then added and incubated for 60 min at room temperature. Magnesium ion-dependent DNAzymenenzyme strand and magnesium ion-dependent DNAzymeasubstrate strand were added and the digestion was carried out for 45 minutes at room temperature.

Detecting the concentration of the magnesium ion-dependent DNAzymeasurerstand after enzyme digestion and the fluorescence intensity (excitation wavelength (lambda ex)488nm and emission wavelength peak value (lambda em)520nm) in a reaction system by adopting a conventional method in the field, and calculating to obtain the BP A content in the sample to be detected according to the linear relation between the concentration of the magnesium ion-dependent DNAzymeasurerstand and the fluorescence intensity.

Specificity verification test of the above-mentioned detection method

Standard solutions of 100nM different BPA analogs (as interfering agents for BPA) were prepared, including bisphenol B (BPB), bisphenol C (BPC), ethoxybisphenol A (BPE), bisphenol F (BPF), Diethylstilbestrol (DES), and 4,4' -bisphenol (4 BP).

100nM of the different interfering substance standard solution and 10nM of BPA solution were added to the reaction system of the above detection method, respectively, and color change was observed after sufficient reaction according to the procedure of the above detection method, and the results are shown in FIG. 2.

The results show that the fluorescence intensity detected by 100nM bisphenol B (BPB), bisphenol C (BPC), ethoxybisphenol A (BPE), bisphenol F (BPF), Diethylstilbestrol (DES) and 4,4' -bisphenol (4BP) is far lower than 10nM BPA, which proves that the method has better specificity for detecting BPA. It is also stated that the above detection method can be modified by conventional means for detection of BPA analogs.

Accuracy test of the above detection method

Preparing BPA standard solution with the concentration of 0 and 10 respectively²fM、10³fM、10⁴fM、10⁵fM、10⁶fM、10⁷fM、 10⁸fM、10⁹fM and 10¹⁰fM, stored at 4 ℃.

BPA solutions with different concentrations are respectively detected by the detection method, and color change is observed after full reaction, and the result is shown in FIG. 3.

In FIG. 3A, 50pM of BPA produced a significant change in fluorescence, indicating a detection limit of 50 fM. As can be seen from fig. 3B, the fluorescence intensity increases with increasing BPA concentration under the condition of λ ex 488nm and gradually saturates, indicating that the above detection method is extremely sensitive to trace detection of BPA (100fM to 1 μ M).

From the above, it can be found that under the optimal conditions of the above detection method, the linear range of detection by the method can be from 100fM to 1 μ M, and the effective detection limit of BPA can reach 50 fM. Moreover, the method can produce similar selectivity to other BPA analogues possibly existing, and has better precision and accuracy.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> institute for ecological environment and soil of academy of sciences of Guangdong province

<120> detection method of bisphenol A, fluorescence detection kit and application thereof

<130>

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 63

<212> DNA

<213> Artificial sequence

<400> 1

ccggtgggtg gtcaggtggg atagcgttcc gcgtatggcc cagcgcatca cgggttcgca 60

cca 63

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence

<400> 2

ccatacgcgg aacgctatcc ca 22

<210> 3

<211> 36

<212> DNA

<213> Artificial sequence

<400> 3

ccacatacat catattccct ccatacgcgg aacgct 36

<210> 4

<211> 34

<212> DNA

<213> Artificial sequence

<400> 4

ctttcctaca cctacgtctc caactaactt acgg 34

<210> 5

<211> 50

<212> DNA

<213> Artificial sequence

<400> 5

tgggatagcg ttccgcgtat ggagggccgt aagttagttg gagacgtagg 50

<210> 6

<211> 44

<212> DNA

<213> Artificial sequence

<400> 6

cctacgtctc caactaactt acggccctcc atacgcggaa cgct 44

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence

<400> 7

agacgtaggg actccgagcc ggacgaagtt aatatgatg 39

<210> 8

<211> 13

<212> DNA

<213> Artificial sequence

<400> 8

tatggaggga act 13

<210> 9

<211> 4

<212> DNA

<213> Artificial sequence

<400> 9

aggt 4

<210> 10

<211> 11

<212> DNA

<213> Artificial sequence

<400> 10

ctgtaggaaa g 11

Claims

1. A label-free fluorescence detection method for detecting bisphenol A comprises the following steps:

(1) complementary nucleic acid aptamer and catalytic chain base to obtain a compound A, and complementary priming chain and auxiliary chain base to obtain a compound B;

(2) sequentially adding the compound A, the compound B and the fuel chain into a sample to be detected, and then adding the DNA nuclease chain and the DNA nuclease substrate chain for enzyme digestion reaction;

(3) detecting the concentration and the fluorescence intensity of a substrate chain, and calculating to obtain the content of bisphenol A in a sample to be detected;

wherein the aptamer is targeted to bind to any one of a catalytic chain or bisphenol A;

the catalytic strand is targeted to bind to either the aptamer or the complex B;

the nucleotide sequence of the aptamer is as follows: 5'-CCGGTGGGTGGTCAGGTGGGATAGCGTTCCGCGTATGGCCCAGCGCATCACGGGTTCGCACCA-3' (SEQ ID NO. 1);

the nucleotide sequence of the catalytic chain is as follows: 5'-CCATACGCGGAACGCTATCCCA-3' (SEQ ID NO. 2);

the initiation chain comprises an initiation chain 1 and an initiation chain 2;

the nucleotide sequence of the priming strand 1 is as follows: 5'-CCACATACATCATATTCCCTCCATACGCGGAACGCT-3' (SEQ ID NO. 3);

the nucleotide sequence of the priming strand 2 is: 5'-CTTTCCTACACCTACGTCTCCAACTAACTTACGG-3' (SEQ ID NO. 4);

the trigger strands are each targeted to bind either the helper strand or the substrate strand;

the nucleotide sequence of the auxiliary chain is as follows: 5'-TGGGATAGCGTTCCGCGTATGGAGGGCCGTAAGTTAGTTGGAGACGTAGG-3' (SEQ ID NO. 5);

the nucleotide sequence of the fuel chain is: 5'-CCTACGTCTCCAACTAACTTACGGCCCTCCATACGCGGAACGCT-3' (SEQ ID NO. 6).

2. The label-free fluorescent detection method of claim 1, wherein the DNA nuclease substrate strand comprises a cleavage site corresponding to the DNA nuclease enzyme strand and a fluorophore and a quencher on both sides of the cleavage site.

3. The label-free fluorescent detection method of claim 1, wherein the dnazyme chain comprises a magnesium-ion-dependent dnazyme chain, wherein the magnesium-ion-dependent dnazyme chain has a nucleotide sequence of:

5'-TATGGAGGGAACT-Dabcyl-rAGGT-FAM-CTGTAGGAAAG-3'。

4. the label-free fluorescence detection method according to claim 1, wherein the mixed concentration ratio of the aptamer and the catalytic chain in step (1) is (1-10): 1.

5. a test kit, comprising: an aptamer, a catalytic strand, a priming strand, an accessory strand, a fuel strand, a dnase enzyme chain, and a dnase substrate chain;

the catalytic strand is targeted to bind to any one of the aptamer or complex B of claim 1;

the initiation chains are all targeted to combine with any one of the auxiliary chain or the substrate chain, and comprise an initiation chain 1 and an initiation chain 2;

the nucleotide sequence of the fuel chain is: 5'-CCTACGTCTCCAACTAACTTACGGCCCTCCATACGCGGAACGCT-3' (SEQ ID NO. 6);

the DNA nuclease substrate chain contains a restriction enzyme site corresponding to the DNA nuclease enzyme chain, and a fluorescent group and a quenching group which are respectively positioned at two sides of the restriction enzyme site;

the DNA nuclease chain includes a magnesium ion dependent DNA nuclease chain.

6. A biosensor using the detection method according to any one of claims 1 to 4.

7. Use of the test kit of claim 5 or the biosensor of claim 6 for the detection of bisphenol A.