CN112430596A - Application of small RNA molecules and analogs thereof in anti-aging - Google Patents

Abstract

The invention discloses application of a small RNA molecule and an analogue thereof in anti-aging. Specifically, the invention provides the use of microRNAs of the miR-302 family to prepare a pharmaceutical composition or preparation, which can be used for (i) delaying or reversing the senescence of normal somatic cells; (ii) promoting the in vitro amplification of normal somatic cells, and the like. Experiments have shown that said anti-aging is not dependent on pluripotent cell reprogramming nor increases the carcinogenic risk. Therefore, miR-302 is a safe anti-aging drug which is efficient and causes no pluripotent reprogramming and no carcinogenicity.

Description

Application of small RNA molecules and analogs thereof in anti-aging

Technical Field

The present invention is in the field of treatment of metabolic disorders. In particular to the anti-aging effect of a small RNA molecule and analogues thereof.

Background

Resistance or reversal of aging is one of the ultimate dreams in humans since ancient times. Previous studies have found that treatment methods such as metabolic intervention, senescent cell clearance, stem cell or fluid return, etc., can slow or improve the senescent phenotype of mammals to some extent. However, the goals of safely and efficiently combating or reversing human aging remain quite remote^[1]。

In recent years, it has been found that over-expressing four transcription factors (Oct4, Sox2, Klf4, c-Myc) capable of reprogramming somatic cells into pluripotent stem cells (pluripotent stem cells) in mice can significantly improve the lifespan of the mice with premature senility and improve the aging phenotype of the normal aging mice and human aging cells to some extent^[2]It is suggested that cell reprogramming directed to pluripotent stem cell fate (multipotent reprogramming) may be an effective anti-aging approach. However, pluripotent reprogramming techniques can also severely compromise the function of normal adult tissues and have strong potential carcinogenicity^[2]Safety is unsatisfactory, and clinical application in anti-aging therapy is therefore difficult.

Therefore, there is an urgent need in the art to develop new safe and effective anti-aging methods and pharmaceutical compositions.

Disclosure of Invention

The invention aims to provide a safe and effective anti-aging method and a pharmaceutical composition.

In a first aspect of the invention, there is provided the use of an active ingredient selected from the group consisting of:

(a) a microrna of the miR-302 family, comprising: miR-302 or a modified miR-302 derivative; or the core sequence is 5 '-AAGUGCU-3', the length is 16-28nt, the function is the same as or basically the same with miR-302 micro RNA or modified miRNA derivative;

(b) a precursor miRNA that is processable in a host to the miR-302 of (a);

(c) a polynucleotide capable of being transcribed by a host to form a precursor miRNA as described in (b) and processed to form a microrna as described in (a);

(d) an expression vector comprising the miR-302 of (a), or the precursor miRNA of (b), or the polynucleotide of (c);

(e) an agonist of the microrna described in (a);

wherein the active ingredient is used for the preparation of a pharmaceutical composition or formulation for one or more applications selected from the group consisting of:

(i) delaying or reversing normal somatic cell senescence;

(ii) promoting the in vitro amplification and/or in vivo amplification of normal somatic cells;

(iii) inhibiting the expression and/or activity of SA- β -Gal;

(iv) promoting the expression and/or activity of H3K9me 3;

(v) inhibiting the expression and/or activity of P16 protein;

(vi) promoting the expression and/or activity of collagen type III COL3A 1;

(vii) inhibit expression and/or activity of PAI-1.

In another preferred embodiment, the anti-aging is not dependent on pluripotent cell reprogramming, nor increases the risk of carcinogenesis.

In another preferred embodiment, the pharmaceutical composition or formulation is also used for inhibiting tumor cells.

In another preferred embodiment, the preparation comprises dietary supplements, food additives and test reagents.

In another preferred embodiment, the pharmaceutical composition comprises the active ingredient and a pharmaceutically acceptable carrier.

In another preferred embodiment, the core sequence in (a) is located within the first 8nt (e.g., positions 1-7 or 2-8) of the 5' end of the microRNA.

In another preferred embodiment, the length of the micro RNA is 16-28nt, and the sequence characteristics satisfy the following formula: 5 '- (N) AAGUGCUN … -3', wherein N represents any nucleotide, and (N) represents 1 or 0N.

In another preferred embodiment, the length of the micro RNA is 18-26 nt.

In another preferred example, the phrase "the function is the same or substantially the same as that of miR-302" means that the anti-aging function of miR-302 (e.g., hsa-miR-302c-3p) is maintained at 40% or more and 500% or less.

In another preferred embodiment, the anti-aging function comprises one or more functions selected from the group consisting of:

promoting the in vitro amplification and/or in vivo amplification of normal somatic cells;

inhibiting the expression and/or activity of SA- β -Gal;

promoting the expression and/or activity of H3K9me 3;

inhibiting the expression and/or activity of P16 protein; and

promoting the expression and/or activity of collagen type III COL3A 1.

In another preferred example, the sequence of the miR-302 is shown in SEQ ID NO. 1 (UAAGUGCUUCCAUGUUUCAGUG).

In another preferred example, said miR-302 is derived from a mammal, preferably, from a human, a rat, or a mouse.

In another preferred embodiment, the microRNA is UAAGUGCUUCCUACAAAGUCAC (SEQ ID No.: 11, i.e., mut1)

In another preferred embodiment, the pharmaceutical composition further comprises an additional anti-aging active ingredient.

In another preferred embodiment, the modified miRNA derivative is modified by one or more modifications selected from the group consisting of: sugar group modification of nucleotides, modification of linkage mode between nucleotides, cholesterol modification, locked nucleotide modification, peptide segment modification, lipid modification, halogen modification, alkyl modification and nucleic acid modification.

In another preferred example, the glycosyl modification of the nucleotide comprises 2-O-methyl glycosyl modification, 2-O-methoxyethyl glycosyl modification, 2-O-alkyl glycosyl modification, 2-fluoro glycosyl modification, sugar ring modification and locked nucleotide modification; and/or

The modification of the connection mode between the nucleotides comprises phosphorothioate modification and phosphate alkylation modification; and/or

Such nucleic acid modifications include "TT" modifications.

In another preferred embodiment, the modified miRNA derivative in (a) is a monomer of a compound having the structure shown in formula I or a multimer thereof:

(X)n-(Y)m

formula I

In the formula I, the compound is shown in the specification,

each X is the microRNA described in (a);

each Y is independently a modifier for promoting the drug delivery stability of the micro RNA;

y is connected to the left side, the right side or the middle of X;

n is a positive integer from 1 to 100 (preferably 1 to 20) (preferably n is 1, 2, 3, 4 or 5);

m is a positive integer of 1-1000 (preferably 1-200);

each "-" represents a linker, a chemical bond, or a covalent bond.

In another preferred embodiment, the linker is a nucleic acid sequence of 1-10 bases in length.

In another preferred embodiment, said Y includes (but is not limited to) cholesterol, steroids, sterols, alcohols, organic acids, fatty acids, esters, monosaccharides, polysaccharides, amino acids, polypeptides, mononucleotides, polynucleotides.

In another preferred embodiment, the polynucleotide of (c) has the structure of formula II:

Seq_{forward direction}-X-Seq_{Reverse direction}

Formula II

In the formula II, the reaction mixture is shown in the specification,

seq is forward to a nucleotide sequence that can be processed into said microRNA in a host;

seq reverse is a nucleotide sequence that is substantially complementary or fully complementary to Seq forward;

x is a spacer sequence located between the Seq forward direction and the Seq reverse direction, and the spacer sequence is not complementary to the Seq forward direction and the Seq reverse direction;

and the structure of formula II, when transferred into a host cell, forms a secondary structure of formula III:

in formula III, Seq Forward, Seq reverse and X are as defined above,

the base-complementary pairing relationship formed between the Seq forward direction and the Seq reverse direction is expressed.

In another preferred embodiment, the polynucleotide described in (c) has the amino acid sequence shown in SEQ ID Nos. 3 or 6:

in another preferred embodiment, the expression vector described in (d) comprises: viral vectors and non-viral vectors.

In another preferred embodiment, the agonist of miR-302 in (e) is selected from the group consisting of: a substance that promotes miR-302 expression, a substance that increases miR-302 activity, or a combination thereof.

In another preferred embodiment, the pharmaceutically acceptable carrier is selected from the group consisting of: water, saline, liposomes, lipids, proteins, protein-antibody conjugates, peptidic substances, cellulose, nanogels, or combinations thereof.

In a second aspect of the present invention, there is provided a pharmaceutical composition comprising an active ingredient, and a pharmaceutically acceptable carrier, wherein the active ingredient is selected from the group consisting of:

(a) a microrna of the miR-302 family, comprising: miR-302 or a modified miR-302 derivative; or the core sequence is 5 '-AAGUGCU-3', the length is 16-28nt, the function is the same as or basically the same with miR-302 micro RNA or modified miRNA derivative;

(b) a precursor miRNA that is processable in a host to the miR-302 of (a);

(c) a polynucleotide capable of being transcribed by a host to form a precursor miRNA as described in (b) and processed to form a microrna as described in (a);

(d) an expression vector comprising the miR-302 of (a), or the precursor miRNA of (b), or the polynucleotide of (c).

In a third aspect of the invention, there is provided a method of screening for a candidate compound that promotes miR-302, comprising the steps of:

(a) taking a cell culture system added with a test compound as an experimental group; the cell culture system without the test compound added was used as a control;

(b) testing the expression amount and/or activity of SA-beta-Gal protein and/or P16 protein in the experimental group and the control group; testing the expression amount and/or activity of the H3K9me3 protein and/or the collagen type III COL3A1 in the experimental group and the control group;

wherein, when the expression quantity and/or activity of SA-beta-Gal protein and/or P16 protein in the test group is lower than that of the control group, and the expression quantity and/or activity of H3K9me3 protein and/or type III collagen COL3A1 is significantly higher than that of the control group, the test compound is a candidate compound for promoting miR-302.

In another preferred example, step (b) further includes:

further testing the effect of the candidate compound on the production of miR-302 by cells in the experimental and control groups, with respect to the obtained candidate compound;

wherein, when the number of miR-302 in the experimental group is obviously higher than that in the control group, the candidate compound is the accelerant of miR-302.

In another preferred embodiment, the cell is a somatic cell.

In another preferred embodiment, the cell is selected from the group consisting of: fibroblasts, vascular endothelial cells, mesenchymal stem cells, epithelial cells (including skin epithelial cells), liver cells, or combinations thereof.

In a fourth aspect of the invention, there is provided an in vitro non-therapeutic method for inhibiting the expression and/or activity of SA-beta-Gal protein and/or P16 protein; promoting the expression and/or activity of H3K9me3 protein and/or type III collagen COL3A 1; and/or inhibiting PAI-1 expression and/or activity, the method comprising the steps of:

adding the pharmaceutical composition or the miR-302 active ingredient of the second aspect of the invention into a cell culture system so as to inhibit the expression amount and/or activity of the SA-beta-Gal protein and/or the P16 protein; and/or promoting the expression and/or activity of H3K9me3 protein and/or collagen type III COL3A 1.

In a fifth aspect of the invention, there is provided an in vitro non-therapeutic method of promoting normal somatic cell proliferation, comprising the steps of:

culturing a normal somatic cell in the presence of a miR-302 active ingredient and under conditions suitable for growth, thereby promoting proliferation of the normal somatic cell, wherein the miR-302 active ingredient is the active ingredient as described in the first aspect of the invention.

In another preferred embodiment, the cell is a eukaryotic cell, preferably a human or non-human mammalian cell.

In another preferred embodiment, the cell is a somatic cell.

In another preferred embodiment, the cell is selected from the group consisting of: normal cells, tumor cells.

In a sixth aspect of the present invention, there is provided a method for inhibiting the expression and/or activity of SA- β -Gal protein and/or P16 protein, and/or promoting the expression and/or activity of H3K9me3 protein and/or type iii collagen COL3a1, and/or anti-aging, comprising the steps of:

administering the pharmaceutical composition or the miR-302 active ingredient according to the second aspect of the invention to a subject in need thereof, thereby inhibiting the expression amount and/or activity of SA-beta-Gal protein and/or P16 protein, and/or promoting the expression and/or activity of H3K9me3 protein and/or type III collagen COL3A1, and/or resisting aging.

In another preferred embodiment, the subject in need thereof is a mammal, preferably a human or non-human mammal (e.g., mouse, or rat).

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows that overexpression of miR-302 family miRNA by transgenic means can reverse human cell senescence.

A.Q-RT-PCR detected the expression level of hsa-miR-302c-3p in HFF1-scr and HFF1-302 cells. **: p <0.01, n ═ 3, two-tailed t-test.

B. Left side: representative β -galactosidase staining photographs of HFF1-scr and HFF1-302 cells (upper panel, blue positive for SA- β -Gal staining) and H3K9me3 immunofluorescence staining photographs (lower panel, green positive for H3K9me3 staining). Right side: quantitative statistics of the two types of staining on the left. **: p <0.01, n ═ 5, two-tailed t-test.

C.Q-RT-PCR detected the mRNA expression levels of the p16 and Col3a1 genes in HFF1-scr and HFF1-302 cells. **: p <0.01, n ═ 3, two-tailed t-test.

D. The short-term proliferation rates of HFF1-scr and HFF1-302 cells were quantitatively counted. Cell proliferation was measured by the CCK-8 method. The vertical axis represents cell proliferation rate on the first day, and the horizontal axis represents days. **: p <0.01, n ═ 3, two-tailed t-test.

E. The long-term proliferation capacity of HFF1-scr and HFF1-302 cells was quantitatively evaluated. The number of cells was measured by counting. The vertical axis represents the relative magnification of the total number of cells per generation relative to the total number of starting cells. The horizontal axis represents the number of cell passages. **: p <0.01, n ═ 3, two-tailed t-test.

Western immunoblot assay of samples of total protein from HFF1-scr and HFF1-302 cells. Each column (lane) represents an independent repeat, 3 repeats per cell, as indicated in the figure. In addition, column H1 represents a total protein sample of the H1 line of human pluripotent stem cells. Each row represents a target protein detected herein, and the left label is the name of the target protein detected in each row.

G.Q-RT-PCR detected the expression level of hsa-miR-302c-3p in HFF1-Tonscr and HFF1-Ton302 cells. DOX-represents cells in normal culture conditions without DOX induction. DOX + represents cells 48 hours after induction with DOX. **: p <0.01, n ═ 3, two-tailed t-test.

H. Quantification statistics beta-galactosidase staining in HFF1-Tonscr and HFF1-Ton302 cells at different time points after DOX induction. The vertical axis represents the rate of staining-positive cells. The horizontal axis is the number of days after initiation of DOX induction. **: p <0.01, n ═ 9, two-tailed t-test.

I. Quantitative statistics H3K9me3 immunofluorescence staining results in HFF1-Tonscr and HFF1-Ton302 cells at different time points after DOX induction. The vertical axis represents the rate of staining-positive cells. The horizontal axis is the number of days after initiation of DOX induction. **: p <0.01, n ═ 5, two-tailed t-test.

FIG. 2 shows that human cell senescence can be reversed using artificially synthesized miR-302 family miRNA analogs.

A. Results of beta-galactosidase staining (SA-beta-Gal, n ═ 9) and H3K9me3 immunofluorescence staining (H3K9me3, n ═ 4) of HFF1 cells after transfection of hsa-miR-302c-3p mimic (+302mimic) and Scamble mimic (+ scr mimic) were quantitatively counted. Both mimic transfection concentrations were 200 nM. Staining time was 8 days post transfection. The vertical axis represents the rate of staining positive cells. **: p <0.01, two-tailed t-test.

Q-RT-PCR was used to measure the mRNA expression level of p16 gene in the two transfected cells in A above. **: p <0.01, n ═ 3, two-tailed t-test.

C. Results of beta-galactosidase staining (SA-beta-Gal, n-10) and H3K9me3 immunofluorescent staining (H3K9me3, n-4) of HFF1 cells at day 8 after transfection of hsa-miR-302c-3p mimic (+302mimic) and Scamble mimic (+ scr mimic) at different concentrations were quantitatively counted. The vertical axis represents the rate of staining positive cells. The horizontal axis represents the transfection concentration. Represents the difference P <0.01, two-tailed t-test of 200nM versus 0nM data points for each staining series.

D. The short-term proliferation rate of HFF1 cells after transfection of hsa-miR-302c-3p imic (+302 imic) and Scramble imic (+ scr imic) is quantitatively counted. Cell proliferation was measured by the CCK-8 method. The vertical axis represents cell proliferation rate on the first day, and the horizontal axis represents days. **: p <0.01, n ═ 3, two-tailed t-test. Both mimic transfection concentrations were 200 nM.

FIG. 3 shows that miR-302 family miRNA has broad-spectrum anticancer function.

A. Schematic diagram of principle of two-color fluorescent cell growth competition experiment. GFP-tagged lentiviruses overexpressing the scramble (scr) control or iRFP-tagged lentiviruses overexpressing candidate mirnas (mirs), respectively, infect target cells and mix in equal proportions (origin). The mixed cells were then serially passaged (end point). FACS analysis was finally used to quantitatively compare the relative enrichment rate of iRFP/GFP cell ratios at the endpoint relative to the starting point.

B. The statistics of the two-color fluorescent cell growth competition experiment are summarized in different human cells by using Scaramble (Scr) control or has-miR-302c-3p (302) as candidate miR respectively. Longitudinal axis: relative enrichment rates of candidate mirs. Horizontal axis: different cell lines. Indicated in parenthesis are various human tumor cell lines. **: p <0.01, n ═ 3, two-tailed t-test.

Statistics of nude mice subcutaneous transplantation tumor growth curves of Cal27-Scr and Cal27-302 cells. Tumor major diameter by Tumor minor diameter²/2。**：P<0.01, n is 5, two-tailed t-test.

FIG. 4 shows the establishment of a model for passaged senescence of human endothelial cells.

A. Left side: representative beta-galactosidase (SA-. beta. -Gal) staining photographs of HUVEC cells (upper panel, positive staining in blue) and representative PAI-1 immunofluorescent staining photographs (lower panel, positive staining in red fluorescence and staining in blue in all nuclei). Right side: quantitative statistics of the two types of staining on the left, calculated as% of all cells with positive staining. **: p <0.01, two-tailed t-test, n-7 and n-3 respectively above and below the left side. HUVEC-Y: early passage HUVEC cells, HUVEC-O: passage aged HUVEC cells, the same below.

B. Left side: representative H3K9me3 immunostaining photographs (upper panel) and representative Ki67 immunofluorescent staining photographs (lower panel) of HUVEC-Y and HUVEC-O cells. The green fluorescence in both upper and lower panels represents positive staining and the blue fluorescence represents nuclear staining of all cells. Right side: quantitative statistics of the two types of staining on the left. **: p <0.01, two-tailed t-test, left upper and lower panels n-5 and n-6, respectively.

FIG. 5 shows that miR-302 family miRNA is effective in reversing human endothelial cell senescence.

A. The positive proportion of the senescence marker beta-galactosidase (SA-beta-Gal) staining and the endothelial cell senescence marker PAI-1 immunofluorescence staining of the transgenic HUVEC-O cells was counted, and the positive staining accounted for% of all cells. **: p <0.01, two-tailed t-test, SA- β -Gal stained n-10, PAI-1 immunofluorescent stained n-7. HUVEC-O-302: HUVEC-O cells overexpressing miR-302, HUVEC-O-SCR: SCR-controlled HUVEC-O cells.

B. The statistics of the immunofluorescence staining positive proportion of the young cell marker H3K9me3 and the cell proliferation marker Ki67 of the transgenic HUVEC-O cells are carried out, and the positive staining accounts for% of all the cells. **: p <0.01, two-tailed t-test, H3K9me3 staining n-7, Ki67 immunofluorescence staining n-8.

Statistical statistics of the positive proportion of senescence marker beta-galactosidase (SA-beta-Gal) staining and senescence marker PAI-1 immunofluorescence staining of HUVEC-O cells transfected with miRNA analogs, calculated as% of all cells were positively stained. **: p <0.01, two-tailed t-test, SA- β -Gal stained n-11, PAI-1 immunofluorescent stained n-10. mimic-302: HUVEC-O cells transfected with miR-302 analogues, mimic-SCR: HUVEC-O cells transfected with SCR control analogs. The same applies below.

Counting the immunofluorescence staining positive proportion of the young cell marker H3K9me3 and the cell proliferation marker Ki67 of the HUVEC-O cells transfected by the miRNA analogs, wherein the positive staining accounts for% of all cells. **: p <0.01, two-tailed t-test, H3K9me3 staining n-10, Ki67 immunofluorescence staining n-10.

FIG. 6 shows that the senescence-antagonism of miR-302 is highly dependent on its 5' terminal seed sequence

RNA sequences of miR-302c-3p (302c) and serial mutants thereof. SCR was scramble negative control. The red color is the seed sequence at the 2-8nt position of the 5' end. Blue underline represents the mutated sequence.

B. And (3) summarizing statistical results of testing the anti-aging effect of the miR-302c series mutant in the passage aged HFF-1 cells through a two-color fluorescent cell growth competition experiment. **: p <0.01, two-tailed t-test, n ═ 3. The vertical axis represents the Log2 proliferation rate (FC) of the cells into which the 302 mutant was introduced relative to the control cells. The same applies below.

C. And (3) summarizing the statistical results of testing the anti-aging effect of the miR-302c series mutants in HUVEC-O cells through a two-color fluorescent cell growth competition experiment. **: p <0.01, two-tailed t-test, n ═ 3.

D. A summary of the relative anti-aging efficiency (% Eff) for each miR-302 mutant calculated based on the data for B and C above. The calculation method comprises the following steps: % Eff ═ (FC-100%)/(FC of 302 c). The columns and rows in the table represent cell types and the miR-302 mutant names. The left side of. + -. number is the mean value and the right side is the Standard Error.

The Error bars (Error Bar) in FIGS. 1-6 represent Standard errors (Standard Error).

Detailed Description

The inventor of the invention has conducted extensive and intensive research, and unexpectedly discovers for the first time that miR-302 can efficiently delay or reverse the aging process of normal somatic cells, so that the miR-302 has an anti-aging function. Furthermore, this anti-aging effect does not result in pluripotent reprogramming and is therefore not associated with pluripotent reprogramming. Further experiments also prove that miR-302 not only can not cause the carcinogenic risk of normal somatic cells to rise, but also can inhibit the growth of various tumor cells. Therefore, miR-302 is an extremely safe and effective anti-aging active ingredient. On the basis of this, the present invention has been completed.

Term(s) for

As used herein, "miR-302", "miRNA of the invention", "microrna of the invention" and the like are used interchangeably to refer to the miR-302 family miRNA, which is a small RNA molecule with a total length of 16-28nt characterized by a 5' end (N) AAGUGCU (where N represents any nucleotide (A, U, C, G), (N) represents 1 or 0N).

As used herein, the term "H3K 9me 3" refers to histone H3 lysine 9trimethylation (H3 lysine 9trimethylation, H3K9me 3).

As used herein, the term "SA- β -gal" refers to senescence-associated β -galactosidase (senescence-associated β -galactosidase).

As used herein, the term "P16 protein" refers to the protein expression product of the CDKN2A gene, which is a marker of cellular senescence.

Aging and anti-aging

As used herein, "aging" refers to the process of loss and degeneration of an organism in terms of constituent substances, tissue structure, physiological functions, etc., which occurs with time. In the present invention, aging refers to biological aging.

As used herein, "anti-aging" refers to delaying, retarding, reducing, stopping and/or reversing an aging effect or process.

Cell aging is a phenomenon that results in the inability of individual cells to divide continuously, arresting them after several divisions. To detect cellular senescence, a cell staining assay is typically used which detects senescence-associated markers (e.g., β -galactosidase activity). Senescent cells can interfere with important functions of the whole organism and thereby cause certain disorders. Aging of the whole organism is accompanied by an increased risk of certain disorders, such as diseases, complications and symptoms.

Some representative markers or markers of aging cells include (but are not limited to): SA-beta-galactosidase^[9](an increase in the expression level of P16 suggests an increase in the degree of senescence)^[11](an increase in the expression level indicates an increase in the degree of senescence), and cell proliferative capacity (a decrease in the expression level indicates an increase in the degree of senescence).

Some representative markers of young cells include (but are not limited to): H3K9me3^[10](high expression level thereof indicates low aging degree), type III collagen gene COL3A1^[12,13](for dermal fibroblasts, high expression levels indicate low levels of senescence).

MiRNA and its precursor

microRNA (micro RNA, abbreviated as miRNA) is an endogenous non-coding single-stranded small RNA with the length of about 22 nucleotides, which is found in eukaryotes such as nematodes, fruit flies, plants, mammals and the like in recent years. It has tissue and temporal specificity in expression, negatively regulates gene expression at the post-transcriptional level through base complementary pairing with target mRNA, resulting in degradation or translational inhibition of mRNA, and is an important regulatory molecule for regulating the expression of other functional genes. There is increasing evidence that mirnas, although small, play a crucial role in various life processes of organisms by forming complete or incomplete mismatches with target mrnas. As used herein, the term "miRNA" refers to a class of RNA molecules that are processed from a transcript that can form a precursor to a miRNA. Mature mirnas typically have 18-26 nucleotides (nt) (more particularly about 19-22nt), although miRNA molecules having other numbers of nucleotides are not excluded. mirnas are typically detectable by Northern blotting.

Human-derived mirnas can be isolated from human cells. As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in its native state in a living cell is not isolated or purified, the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in its native state.

mirnas can be processed from Precursor mirnas (precarsor mirnas), which can be folded into a stable stem-loop (hairpin) structure, typically between 50-100bp in length or longer. The precursor miRNA can fold into a stable stem-loop structure, and the two sides of the stem-loop structure comprise two basically complementary sequences. The precursor miRNA may be natural or synthetic.

A precursor miRNA can be cleaved to generate a miRNA that is substantially complementary to at least a portion of the sequence of the mRNA encoding the gene. As used herein, "substantially complementary" means that the sequences of nucleotides are sufficiently complementary to interact in a predictable manner, such as to form secondary structures (e.g., stem-loop structures). Typically, two "substantially complementary" nucleotide sequences are complementary to each other for at least 70% of the nucleotides; preferably, at least 80% of the nucleotides are complementary; more preferably, at least 90% of the nucleotides are complementary; further preferably, at least 95% of the nucleotides are complementary; such as 98%, 99% or 100%. Generally, two sufficiently complementary molecules may have up to 40 mismatched nucleotides between them; preferably, there are up to 30 mismatched nucleotides; more preferably, there are up to 20 mismatched nucleotides; further preferred, there are up to 10 mismatched nucleotides, such as 1, 2, 3, 4, 5, 8, 11 mismatched nucleotides.

As used herein, a "stem-loop" structure, also referred to as a "hairpin" structure, refers to a nucleotide molecule that forms a secondary structure comprising a double-stranded region (stem) formed by two regions (on the same molecule) of the nucleotide molecule flanking the double-stranded portion; it also includes at least one "loop" structure comprising non-complementary nucleotide molecules, i.e., a single-stranded region. The double-stranded portion of the nucleotide remains double-stranded even if the two regions of the nucleotide molecule are not completely complementary. For example, an insertion, deletion, substitution, etc., can result in the non-complementarity of a small region or the small region itself forming a stem-loop structure or other form of secondary structure, however, the two regions can still be substantially complementary and interact in a predictable manner to form a double-stranded region of the stem-loop structure. The stem-loop structure is well known to those skilled in the art, and usually, after obtaining a nucleic acid having a nucleotide sequence of a primary structure, those skilled in the art can determine whether the nucleic acid can form a stem-loop structure.

The miRNA in the invention refers to: the microRNA-302 (miR-302) family, said miR-302 family comprising: miR-302 or a modified miR-302 derivative, which has the same or basically the same function as miR-302-.

In another preferred embodiment, the microRNA is derived from a human or non-human mammal; preferably, the non-human mammal is a rat, a mouse, and the miR-302 family sequence of the rat and the human is completely consistent. The function is the same as or basically the same as that of miR-302, which means that the anti-aging function (for example, the expression and/or activity of SA-beta-Gal protein is inhibited) of more than or equal to 40%, more than or equal to 50%, more than or equal to 60%, more than or equal to 70%, more than or equal to 80% and more than or equal to 90% of miR-302c-3p is reserved.

The invention also includes miRNA variants and derivatives. In addition, miRNA derivatives in a broad sense may also include miRNA variants. One of ordinary skill in the art can modify miR-302 using general methods, including (but not limited to): methylation modification, alkyl modification, glycosylation modification (such as 2-methoxy-glycosyl modification, alkyl-glycosyl modification, sugar ring modification and the like), nucleic acid modification, peptide segment modification, lipid modification, halogen modification, nucleic acid modification (such as 'TT' modification) and the like.

One preferred class of miRNA molecules is the miRNA molecules listed in table 1.

An especially preferred example of miR-302 is hsa-miR-302c-3p (MirbaseAccess ═ MIMAT 0000717).

The RNA sequence is 5'-UAAGUGCUUCCAUGUUUCAGUG-3' (SEQ ID No:1)

The corresponding DNA sequences were: 5'-TAAGTGCTTCCATGTTTCAGTG-3' (SEQ ID No:2)

In the present invention, other suitable sequences of miR-302 can be found in public databases, for examplehttp:// www.mirbase.org/cgi-bin/mirna_summary.plfam＝MIPF0000071. Information on some representative miR-302 and its precursors is presented in tables 1 and 22 below.

TABLE 1

TABLE 2

Polynucleotide constructs

According to the miRNA sequences provided by the present invention, polynucleotide constructs can be designed which, after introduction, can be processed into mirnas that affect the expression of the corresponding mrnas, i.e. the polynucleotide constructs are capable of up-regulating the amount of the corresponding mirnas in vivo. Thus, the present invention provides an isolated polynucleotide (construct) that can be transcribed by human cells into a precursor miRNA, which can be cleaved by human cells and expressed as the miRNA.

In a preferred embodiment of the present invention, the polynucleotide construct comprises a structure of formula II:

Seq_{forward direction}-X-Seq_{Reverse direction}

Formula II

In the formula II, the reaction mixture is shown in the specification,

Seq_{forward direction}Is a nucleotide sequence capable of expressing the miRNA-27b in cells, Seq_{Reverse direction}Is and Seq_{Forward direction}A substantially complementary nucleotide sequence; alternatively, Seq_{Reverse direction}A nucleotide sequence capable of expressing the miRNA in cells, Seq_{Forward direction}Is and Seq_{Forward direction}A substantially complementary nucleotide sequence; x is at Seq_{Forward direction}And Seq_{Reverse direction}A spacer sequence therebetween, and the spacer sequence and Seq_{Forward direction}And Seq_{Reverse direction}Are not complementary;

the structure of formula I, when transferred into a cell, forms a secondary structure of formula III:

in formula III, Seq_{Forward direction}、Seq_{Reverse direction}And X is as defined above;

i is expressed in Seq_{Forward direction}And Seq_{Reverse direction}The base complementary pairing relationship is formed between the two.

Typically, the polynucleotide construct is located on an expression vector. Thus, the invention also includes a vector comprising said miRNA, or said polynucleotide construct. The expression vector usually further contains a promoter, an origin of replication, and/or a marker gene. Methods well known to those skilled in the art can be used to construct the expression vectors required by the present invention. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as kanamycin, gentamicin, hygromycin, ampicillin resistance.

In the present invention, the promoter may be constitutive, inducible, or a combination thereof.

Pharmaceutical compositions and methods of administration

As used herein, the term "active ingredient" or "miR-302 active ingredient" refers to miR-302, miR-302 derivatives or precursor sequences thereof, or expression vectors containing the same, which are useful in the present invention. Preferably, the active ingredient is selected from the group consisting of:

(a) a microrna of the miR-302 family, comprising: miR-302 or a modified miR-302 derivative; or the core sequence is 5 '-AAGUGCU-3', the microRNA with the length of 16-28nt and the same or basically same functions as miR-302 or modified miRNA derivatives (one preferred class of microRNAs is microRNAs with the total length of 16-28nt and the sequence characteristics meeting the following formula: 5 '- (N) AAGUGCUN … -3', wherein N represents any nucleotide (A/U/C/G), (N) represents 1 or 0N);

(b) a precursor miRNA that is processable in a host to the miR-302 of (a);

(c) a polynucleotide capable of being transcribed by a host to form a precursor miRNA as described in (b) and processed to form a microrna as described in (a);

(d) an expression vector comprising the miR-302 of (a), or the precursor miRNA of (b), or the polynucleotide of (c).

As used herein, the term "effective amount" or "effective dose" refers to an amount that produces a function or activity in, and is acceptable to, a human and/or an animal.

As used herein, an ingredient of the term "pharmaceutically acceptable" is one that is suitable for use in humans and/or mammals without undue adverse side effects (such as toxicity, irritation, and allergic response), i.e., at a reasonable benefit/risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents.

The pharmaceutical composition of the present invention contains a safe and effective amount of the active ingredient of the present invention and a pharmaceutically acceptable carrier. Such vectors include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical composition of the invention can be prepared into injections, oral preparations (tablets, capsules, oral liquids), transdermal agents and sustained-release agents. For example, by a conventional method using physiological saline or an aqueous solution containing glucose and other adjuvants. The pharmaceutical composition is preferably manufactured under sterile conditions.

The effective amount of the active ingredient of the present invention may vary depending on the mode of administration and the severity of the disease to be treated, etc. The selection of a preferred effective amount can be determined by one of ordinary skill in the art based on a variety of factors (e.g., by clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of the active ingredient such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated by the patient, the weight of the patient, the immune status of the patient, the route of administration, and the like. In general, satisfactory results are obtained when the active ingredient of the invention is administered at a daily dose of about 0.00001mg to 50mg per kg of animal body weight (preferably 0.0001mg to 10mg per kg of animal body weight). For example, divided doses may be administered several times per day, or the dose may be proportionally reduced, as may be required by the urgency of the condition being treated.

The pharmaceutically acceptable carrier of the present invention includes (but is not limited to): water, saline, liposomes, lipids, proteins, protein-antibody conjugates, peptidic substances, cellulose, nanogels, or combinations thereof. The choice of carrier should be matched with the mode of administration, which is well known to those skilled in the art.

In vitro anti-aging method

The invention provides an in vitro non-therapeutic anti-aging method and a method for inhibiting the expression and/or activity of SA-beta-Gal protein and/or P16 protein and/or promoting the expression and/or activity of H3K9me3 protein and/or type III collagen COL3A 1.

Typically, the method comprises: adding the pharmaceutical composition of the invention or the active ingredient of the invention to the cultured cell system, thereby retarding and/or reversing the aging process of the cells; inhibiting the expression amount and/or activity of SA-beta-Gal protein and/or P16 protein; and/or promoting the expression and/or activity of H3K9me3 protein and/or collagen type III COL3A 1.

In another preferred embodiment, the cells are somatic cells (physiological cells), particularly normal somatic cells.

The main advantages of the invention include:

(a) the invention unexpectedly discovers for the first time that miR-302 is an anti-aging active ingredient applicable to normal somatic cells.

(b) The anti-aging effect of miR-302 does not cause the appearance of pluripotent stem cell characteristics, so that the method is not related to pluripotent reprogramming, and the risk of damaging the normal function of target somatic cells and causing the target somatic cells to generate carcinogenicity due to the pluripotent reprogramming of the target somatic cells is avoided.

(c) miR-302 not only can not cause the carcinogenic risk of normal somatic cells to rise, but also can inhibit the growth of various tumor cells.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

Materials and general methods

In the examples, miR-302 is hsa-miR-302c-3p, and its RNA sequence is 5'-UAAGUGCUUCCAUGUUUCAGUG-3' (SEQ ID NO: 1); the corresponding DNA sequences were: 5'-TAAGTGCTTCCATGTTTCAGTG-3' (SEQ ID No: 2).

1) Plasmid construction

In order to construct an accurate miRNA over-expression vector, the invention adopts a design method of SA-miR (small accurate-miR) published by the inventor in the previous period^[8]. The principle of the method is that a corresponding DNA sequence of a target miRNA to be expressed is inserted into an SAmiR framework sequence which can ensure the accurate 5' end formation so as to achieve the purpose of accurate expression of the target miRNA.

The following SAmiR expression sequences are directly synthesized: (all DNA sequences default left side is 5 'end, right side is 3')

SA-miR302 c: (expression of hsa-miR-302c-3p, bold part is the DNA sequence corresponding to hsa-miR-302c-3p)

SA-SCR: (expression of scramble control miRNA, in bold the corresponding DNA sequence)

The SA-miR302c and SA-SCR are respectively cloned to a constitutive lentivirus expression vector plko.1-Puro, a doxycycline (Dox) inducible lentivirus expression vector pLVX-TetOne-Puro and a lentivirus vector carrying a fluorescent marker by a standard molecular cloning method.

The vector construction method comprises the following steps:

1.1 expression plasmid based on the constitutive lentiviral expression vector plko.1-puro

This is a general purpose small RNA expression vector from Addgene (available from Addgene; https:// www.addgene.org/8453 /). SA-miR302c and SA-SCR were cloned between its AgeI + EcoRI sites (AgeI sites destroyed after insertion), respectively, behind the U6 promoter. Two recombinant lentiviral expression plasmids, plko1-SA-miR302c and plko1-SA-SCR, were obtained.

1.2 expression plasmid based on Dox-inducible lentiviral expression vector pLVX-TetOne-Puro

The inducible lentiviral vector pLVX-TetOne-Puro was purchased from Excellent Bio Inc. (Cat. No. VT9002, http:// www.youbio.cn/product/VT 9002). The carrier is a tetracycline induction carrier integrating the functions of regulation and response.

The SA-miR302c, the SA-SCR and partial peripheral sequences are respectively amplified by PCR and cloned between EcoRI and BamHI in a multiple cloning site of the vector to obtain two Dox inducible lentivirus expression plasmids of pTeton-SA-miR302c and pTeton-SA-SCR.

1.3 plasmids plko1-SA-SCR-GFP, plko1-SA-SCR-iRFP, plko1-SA-miR302c-iRFP based on fluorescent-labeled constitutive lentiviral vectors

Constitutive lentiviral expression vector plko1-GFP carrying the H2BGFP green fluorescent marker was from Addgene (Addgene, Plasmid # 25999). Similar to method 1.1, synthetic SA-miR302c and SA-SCR were cloned between its AgeI + EcoRI sites, respectively (the AgeI sites were destroyed after insertion). Plko1-SA-SCR-GFP and plko1-SA-miR302c-GFP were obtained.

Constitutive lentiviral expression vector plko1-RFP carrying the H2BRFP green fluorescent marker was from Addgene (Addgene, Plasmid # 26001). Similar to method 1.1, synthetic SA-miR302c and SA-SCR were cloned between its AgeI + EcoRI sites, respectively (the AgeI sites were destroyed after insertion). Plko1-SA-SCR-RFP and plko1-SA-miR302c-RFP were obtained.

To facilitate flow cytometry, the far-red fluorescent protein iRFP expression sequence from pmiRFP670-N1(addge, Plasmid #79987) was obtained by PCR amplification and inserted between the AgeI + XbaI sites in the two plasmids described above in place of the RFP expression sequence. Plko1-SA-SCR-iRFP and plko1-SA-miR302c-iRFP were obtained.

2) Cell culture

HFF-1 human dermal fibroblasts were purchased from the stem cell bank of Chinese academy of sciences (accession number: SCSP-109). The cells were passaged for long periods to mimic the cell senescence phenotype.

Other cell sources were as follows (all cell cultures were performed according to standard procedures given in the manufacturer's instructions):

cal27 human squamous cell carcinoma of tongue, zhong qiao xin boat (ZQ 0606).

SCC9 human tongue squamous cell carcinoma cell, ATCC (CRL-1629)

SCC25 human tongue squamous cell carcinoma cell, ATCC (CRL-1628)

MEWO human melanoma cells, ATCC (HTB-65)

A431 human skin squamous cell carcinoma cell, ATCC (CRL-1555)

786-0 adenocarcinoma cell of renal clear cell, Stem cell Bank of Chinese academy of sciences (TCtu 186)

PC3 human prostate cancer cell, Chinese academy of sciences Stem cell Bank (TCTU 158)

5637 human bladder cancer cells, Chinese academy of sciences Stem cell Bank (TCtu 1),

PANC-1 human pancreatic cancer cell, Chinese academy of sciences Stem cell Bank (TCtu 98)

3) Lentiviral packaging and cell infection

3.1 Lentiviral packaging

Viral packaging was transfected with standard 293T packaging cells in combination with PEI plasmids: firstly, a virus packaging somatic plasmid psPAX2(Addgene:12260), a virus envelope plasmid pMD2.G (Addgene:12259) and a lentivirus expression plasmid are mixed into packaging DNA according to the DNA mass ratio of 4:2: 1. Subsequently, 200ul of serum-free DMEM + 3. mu.g of the packaging DNA + 9. mu.g of PEI (polyetherimide) were mixed to prepare a transfection solution. After incubation for 15min at room temperature, the transfection solution was added to 293T cell culture to transfect the cells. Cell culture supernatants containing virus were collected 48 hours after transfection. The virus suspension was obtained by filtration and cleaning with a 0.45 μm pore size filter.

3.2 Lentiviral transfection of target cells

To the target cell culture medium under normal growth conditions, 30% volume of the virus suspension and 0.1% final concentration of Polybrene (Polybrene) as a gene transfection enhancer were added and mixed, and timing was started. The normal medium was changed after 24 hours of timing. After 48 hours, puromycin (puro) (1ug/ml) was added to the sieve. Cells that survive stable under the drug-sieving conditions are stably transfected with lentiviruses (the lentivirus vectors used herein are puro-resistant.)

4) Total RNA extraction

Total RNA extraction of cells and animal tissues is carried out by using Trizol lysate and Direct-zol RNA MiniPrepPlus kit (R2070) of Zymo company. The method completely operates according to the standard steps of the specification.

5)Q-RT-PCR

Q-RT-PCR of mRNA was performed according to standard procedures. The total RNA samples were first Reverse transcribed with SuperScript III Reverse Transcriptase (ThermoFisher, 18080093) to obtain cDNA. Quantitative PCR reactions were then performed with BrightGreen 2X qPCRMastermix-ROX (abm, Mastermix-R).

Q-RT-PCR of miRNA total RNA samples were first reverse transcribed with a mixcript II RT Kitqigen (Qiagen, 218161) to give cDNA, and then subjected to quantitative PCR reaction with a mixcript SYBR Green PCR Kit (Qiagen, 218073). All the operations are carried out according to the steps of the specification.

6) CCK8 method cell proliferation assay

1000 cells per well were plated in 96-well plates. The activity of the cells in one of the wells was then determined daily using the Cell Counting Kit-8 Kit (CCK 8, product number C0038) from Biyuntian corporation as described.

7) Cell number determination by counting method

The target cells were digested into suspension by the standard Trypsin method, dead cells were distinguished by adding tepa blue, and then the number of viable cells was counted under a microscope using a hemocytometer.

8) Age marker SA-beta-Gal cell staining countAnalysis of

Cell Senescence beta-Galactosidase Staining Kit (40754ES60) was used, which was purchased from assist in san Francisco, Inc. and which was Cell Senescence beta-Galactosidase Staining Kit. The target cells were stained overnight as per the instructions. The photographs were then taken under a microscope. The number of positive cells and relative proportion were calculated by taking 9 fields randomly per group.

9) Immunofluorescence analysis of young cell marker H3K9me3

Cells were first fixed with 4% paraformaldehyde. Staining analysis was then performed according to standard cellular immunofluorescence staining procedures. The antibody used was primary antibody: H3K9me3 antibody (abcam, ab8898), secondary antibody: alexa

488 fluorescent secondary antibody (abcam, ab150077)

10) Cell transfection of miRNA analogs (mirnamatic)

The miRNA analogue is miRNA micic purchased from Shanghai Jima pharmaceutical technology company Limited. Based on miRNA database from sanger by this company: (http://microrna.sanger.ac.uk/sequences) And (5) designing.

Cell transfection was performed using Pitaya Lipo8000^TMTransfection reagent (product No. C0533-0.5 ml). Operating according to the instruction. The specific transfection concentration was 50-200 nM.

11) Western blot

The column-type animal tissue/cell total protein extraction kit (yase, PC201) was used to extract the cell protein, and the quantification was performed using the BCA protein quantification kit (yase, ZJ 101). The proteins were then denatured using SDS-PAGE protein loading buffer (5X, elease, LT 101). Using Omni-PAGE^TMThe gel was prepared by electrophoresis with 10% Hepes and 15 wells (Yazyme, LK209) and then transferred to a PVDF membrane (0.45 μm) (Yazyme, WJ002S) and a buffer for rapid membrane transfer (Yazyme, PS 101S). Blocking with protein-free rapid blocking solution (Asn, PS108) at room temperature for 15min, incubating primary anti-OCT 3/4(santacruz, sc-5279), NANOG (cst, 3580S) and GAPDH (Asn, LF206) overnight at 4 deg.C, incubating HRP-labeledThe secondary antibody (jazyme, LF102) was at room temperature for 1 h. Then using Omni-ECL^TMThe ultrasensitive chemiluminescent detection kit (yase, SQ201) was developed. All the operations are carried out according to the steps of the specification.

12) Nude mouse subcutaneous transplantation experiment of human tumor cells

100ul of the tumor cell suspension was injected subcutaneously into the axilla of 5-week-old nude mice, and 1X 10 cells per mouse were injected⁷Cal27 cells, Tumor size, Tumor volume (Tumor volume, mm) measured weekly starting on day 7³) Long diameter of tumor x short diameter of tumor²/2。

Example 1: overexpression of miR-302 family miRNA through transgenic means can reverse senescence of normal human cells

In this example, to demonstrate that overexpression of miR-302 family miRNA in cells can reverse human cell senescence, constitutive lentiviral expression plasmids plko1-SA-miR302c and plko1-SA-SCR, which can persistently overexpress hsa-miR-302c-3p (miR-302 c-3p for short), were constructed.

After packaging into lentivirus, the lentivirus is infected with subcultured human fibroblast HFF-1, and puromycin (puromycin) drug screening is carried out to obtain stable cell strains HFF1-302 and HFF 1-SCR. Q-RT-PCR analysis confirmed that miR-302c-3p expression levels in HFF1-302 cells were greatly upregulated relative to control HFF1-SCR cells (FIG. 1A).

Compared with a control cell, the aging phenomenon in the miR-302c-3p overexpression cell is remarkably reversed, and the method is specifically shown as follows: senescence cell marker beta-galactosidase^[9]The positive staining ratio is obviously reduced, and the young cell marker H3K9me3^[10]The positive staining ratio was significantly increased (FIG. 1B), and the senescence marker gene P16^[11]The expression level of the collagen III gene COL3A1 related to the young fibroblast state is obviously reduced^[12,13]The expression level of (A) was significantly increased (FIG. 1C), and the cell proliferation ability was greatly enhanced (FIG. 1D).

Unexpectedly, none of the human pluripotent stem cell marker proteins OCT3/4 and NANOG were detected in these HFF1-302 cells^[14]Is expressed atEvidence of regulation (fig. 1E), demonstrating that the anti-aging effects of miR-302 family mirnas are not associated with pluripotent reprogramming.

Example 2

The anti-aging effect of miR-302 is fast-acting and has cumulative effect

To determine the time of action required to reverse cellular senescence with miR-302c-3p, a Dox-inducible miR-302c-3p overexpression lentiviral vector pTeton-SA-miR302c and a control vector pTeton-SA-SCR were constructed. After packaging them into lentivirus and stably infecting HFF-1 human fibroblast, the corresponding stable transfectant cell strains HFF1-Ton302 and HFF1-tonSCR are obtained by drug screening.

Q-RT-PCR showed that tightly controlled miR-302c-3p induced overexpression can be achieved in these cells with Dox induction (FIG. 1F). The results obtained with these cells show that: miR-302c-3p overexpression can produce a significant reversal effect on cell senescence in as little as 4 days, and the effect is continuously enhanced with the prolongation of miR-302c-3p overexpression time (FIGS. 1G-H). These data suggest that the anti-aging effect of miR-302c-3p is rapidly effective and has a cumulative effect.

Example 3

The artificial synthesized miR-302 family miRNA analogue can reverse human cell aging.

miRNA therapeutics entering clinical applications are usually presented in the form of miRNA analogs (miRNA mimics). miRNA analogs are nucleic acid molecules or nucleic acid analog molecules that are artificially synthesized, mimicking the structure of a mature target miRNA or target miRNA precursor sequence. The action mechanism is that the miRNA is converted into mature target miRNA or target miRNA similar molecules in cells after being taken up by the cells so as to play the same or similar action with the target RNA.

In this example, to demonstrate that synthetic miR-302 family miRNA analogs can be used as anti-aging agents, commercial synthetic miR-302c-3p analogs or control analogs were transfected into passaged aged human fibroblast HFF1 using nano-transfection reagents.

The results indicate that miR-302c-3p analog transfection significantly reversed cellular senescence compared to the control analogs. The positive staining proportion of the senescence cell marker beta-galactosidase is remarkably reduced, the positive staining proportion of the young cell marker H3K9me3 is remarkably increased (FIG. 2A), the expression level of the senescence marker gene P16 is remarkably reduced (FIG. 2B), and the cell proliferation capacity is remarkably enhanced (FIG. 2D). Meanwhile, in a certain concentration range, the cell aging reversal effect of the miR-302C-3p analogue shows dose dependence (figure 2C), and the effect is similar to that of a typical medicament, so that the anti-aging medicinal potential of the miR-302 family miRNA analogue is further suggested.

Example 4

The anti-aging effect of miR-302 does not cause the increase of carcinogenic risk

It has been previously reported that miRNA-372 and miRNA-373 belonging to miR-302 family are capable of specifically inhibiting Oncogene-Induced cell Senescence caused by Ras gene mutants (Oncogene-Induced Senescence), and it is inferred that such miRNAs may have carcinogenicity^[15]。

In this example, in order to evaluate the potential carcinogenicity of the miR-302 family miRNA, the specific influence of the miR-302 family miRNA on the growth of various human tumor cells was systematically evaluated by a two-color fluorescence growth competition experiment (see fig. 3A for schematic diagram).

In distinct difference with the reports in the above documents, the results of the invention clearly show that the miR-302 family miRNA has strong and broad-spectrum anticancer effect. It significantly promoted the growth of senescent human fibroblasts on the one hand, but strongly inhibited the growth of all 10 different types of human tumor cells tested on the other hand (fig. 3B).

One of the tumor cells (Cal27) was subjected to in vivo transplantation experiments in nude mice. The results show that miR-302 family mirnas are also capable of strongly inhibiting tumor growth in animals (fig. 3C).

Therefore, the results of the in vitro and in vivo experiments show that the miR-302 family miRNA is a broad-spectrum anti-cancer factor in human cells and has good safety. This further illustrates that the function of miR-302 to reverse normal human cell senescence is significantly different from the two oncogenic functions previously reported (promoting pluripotent cell reprogramming and blocking oncogene-induced cell senescence).

Example 5miR-302 can effectively antagonize human endothelial cell senescence

miR-302 has been demonstrated to have senescence-antagonistic effects in HFF-1 cells of the human dermis (mesoderm). In this example, it was further examined whether this anti-aging effect is applicable to different tissues/cell types. HUVEC cells (human umbilical vein vascular endothelial cells) from human endothelial tissue (endoderm) were selected as models. HUVEC (human umbilical vein vascular endothelial cells) were cultured using endothelial cell growth medium type 2 (Promocell, C-22011). The culture, passage and freezing are carried out according to standard steps^[16]. PAI-1 antibody used in the experiments was purchased from Santa Cruz (sc-5297). Cell counting was performed using a hemocytometer.

5.1 establishment of senescence model of HUVEC cells

A senescence model of HUVEC cells was established by the passage senescence method. The early passage HUVEC cells (named HUVEC-Y) are serially passaged until 26 cell doublings (10)⁸Fold) senescent HUVEC cells (designated HUVEC-O) were obtained.

The results indicate that HUVEC-O cells exhibit a classical cellular senescence phenotype, as compared to HUVEC-Y, as detailed in:

1) senescence cell marker beta-galactosidase and the known senescence marker PAI-1^[17,18]The positive staining ratio of (a) was significantly increased (fig. 4A);

2) the staining positive proportion of the young cell marker H3K9me3 was significantly down-regulated (fig. 4B);

3) the staining positive proportion of the cell proliferation marker Ki67 was significantly down-regulated (fig. 4B).

These data indicate that HUVEC-O is a successful model of endothelial cell senescence.

5.2miR-302 has an anti-aging effect in HUVEC cells

Similarly, plko1-SA-miR302c and control plko1-SA-SCR lentivirus were introduced into HUVEC-cells, and then stable transgenic cell strains HUVEC-O-302 and HUVEC-O-SCR were obtained by drug screening.

The result shows that compared with the control cell, the aging phenomenon in the miR-302c-3p overexpression HUVEC-O cell is remarkably reversed, and the specific expression is as follows: 1) the positive staining ratio of the senescence cell marker β -galactosidase and the senescence marker PAI-1 decreased significantly (fig. 5A); 2) the positive staining proportion of the young cell marker H3K9me3 increased significantly (fig. 5B); 3) the positive staining ratio of the cell proliferation marker Ki67 increased significantly (fig. 5B).

5.3MiR-302 family miRNA analogs have anti-aging effect in endothelial cells

In order to prove that the artificially synthesized miR-302 family miRNA analogue can also play an anti-aging role in endothelial cells, the artificially synthesized miR-302c-3p analogue (mimic-302) or a control analogue (mimic-SCR) is transfected into the HUVEC-O cells.

Compared with the mimic-SCR control, the mimic-302 transfection significantly reversed endothelial cell senescence, which is shown in detail as:

1) the positive staining ratio of the senescence cell marker β -galactosidase and the known senescence marker PAI-1 decreased significantly (fig. 5C);

2) the positive staining ratio of the young cell marker H3K9me3 was significantly increased (fig. 5D);

3) the positive staining ratio of the cell proliferation marker Ki67 increased significantly (fig. 5D).

Example 6 senescence antagonism of miR-302 is highly dependent on its 5' terminal seed sequence

It is known that the function of miRNA is highly dependent on the seed sequence 2-8nt from 5' end. To confirm whether the senescence-antagonistic function of the miR-302 family miRNA was dependent on its 5' seed sequence. In this example, a series of mutant miRNAs were constructed based on hsa-miR-302c-3p (302c) (FIG. 6A).

The potential growth promoting ability of these mutant miRNAs in passaged aged HFF-1 and HUVEC cells was systematically tested using the previous two-color fluorescent cell growth competition assay technique. The method comprises the following steps:

two-color fluorescent cell growth competition assay was the same as example 4. The expression of the miR-302c mutant is realized by a method for constructing an SAmiR expression vector plko 1-SA-miRNA-iRFP. The specific synthesized SAmiR expression sequences are as follows (5' ends on the left side of all sequences):

mut0 (expression mut0, DNA sequence corresponding to mut0 in bold)

mut1 (expression mut1, DNA sequence corresponding to mut1 in bold)

mut2 (expression mut2, DNA sequence corresponding to mut2 in bold)

mut3 (expression mut3, DNA sequence corresponding to mut3 in bold)

mut5 (expression mut5, DNA sequence corresponding to mut5 in bold)

mut6 (expression mut6, DNA sequence corresponding to mut6 in bold)

Results

As shown in fig. 6B, 6C and 6D, pristine 302C showed significant growth promoting ability in both senescent cells compared to Scramble Control (SCR), correctly reflecting its senescence-antagonistic function.

After mutation including the 2-9nt position from the 5' end of the entire seed sequence (mut0), the senescence-antagonistic function was completely abolished. Mutation of only three bases at its 2-4nt position (mut6) or three bases at its 7-9nt position (mut5) is also sufficient to disrupt most of its senescence-antagonistic function. Mutation of the entire sequence at its 12nt-22nt positions had no significant effect on its senescence-antagonistic function (mut 1). Whereas the effects of the mutations at positions 10nt-22nt (mut2) and 9nt-22nt (mut3) are cell type-specific, the senescence-antagonistic function is significantly impaired in HFF-1 cells, whereas the effect is not significant in HUVEC cells.

Therefore, the above results confirm that the senescence-antagonistic function of the miR-302 family miRNA is highly dependent on its 5' terminal seed sequence, consistent with the classical miRNA functional characteristics.

Example 7: method for enhancing in-vivo transplantation capability and cell treatment effect of exogenous cells by using miR-302

It has been shown that the survival ability and the cellular effect of foreign cells transplanted into animals can be significantly improved by transferring genes expressing senescence-resistant proteins into the genome^[19]. However, this technique requires insertion of DNA fragments into a population of target cells, risks destruction of the genome, and is difficult to meet clinical safety requirements. miRNA and analogues thereof are used as small RNA molecules, can be introduced into cells by a simple physicochemical method and maintain the function for a long time, has no risk of inducing genome mutation by inserting DNA fragments, and has no risk of genome integration, so the miRNA has good clinical safety.

Based on the remarkable anti-aging capability of miR-302, in the embodiment, it is proposed that pre-introduction of miR-302 or an analogue thereof is a safe and effective novel technology for enhancing the in vivo transplantation capability of exogenous cells and the cell treatment effect.

One method includes the steps of: before the exogenous cells are transplanted into the body, miR-302 or an analogue thereof is transfected by an in vitro transfection method (similar to the method in examples 1-6), and then the transfected cells are transplanted into the body. If necessary, the effect can be evaluated.

Taking Mesenchymal Stem Cells (MSCs) commonly used in cell therapy as an example, the technical effectiveness evaluation method may include:

1) MSCs are fluorescently labeled and miR-302 or an analogue thereof and a control analogue are transfected, then transplanted into the body and the survival time and treatment effect thereof are measured.

2) Respectively labeling MSC by two fluorescent labels with different colors, respectively transfecting miR-302 analogues or control analogues, then mixing the two MSC with different colors in equal amount, injecting the mixture into a body, and observing the change of the proportion of the two colors along with time.

Discussion of the related Art

microRNA (miRNA) is a small RNA molecule with about 22nt, and is mainly used for regulating the expression level of other genes in a post-transcriptional step. The function of miRNA is heavily dependent on the seed sequence of about 8 nucleotides at its 5' end. A collection of different mirnas with the same seed sequence is called the miRNA family. miRNAs belonging to the same family are generally considered to have highly similar functions^[3]。

The miR-302 family miRNA is a conserved miRNA family taking AAGUGCU as a seed sequence, and the sequence characteristics of the miRNA family can be summarized into RNA molecules with the 5' end (N) AAGUGCU characteristic and the total length of 16-28nt (wherein N represents any nucleotide, and (N) represents 1 or 0N), or structural analogues thereof.

Endogenous miR-302 family mirnas are specifically highly expressed in pluripotent stem cells in both humans and mice, with minimal expression in adult tissues/cells^[3]。

Previous researches show that the miR-302 family has the function of assisting the pluripotent reprogramming of somatic cells, and the overexpression of the miR-302 family in the somatic cells can obviously promote the efficiency of the pluripotent reprogramming mediated by transcription factors or other miRNAs^[4-6]. However, the independent over-expression of the miR-302 family can only induce the expression of part of pluripotent stem cell characteristic genes in somatic cells under specific conditions^[7]. In addition, research reports that miRNA-372 and miRNA-373 belonging to miR-302 family can specifically inhibit Ras gene mutant in early yearsResulting in Oncogene-Induced Senescence of cells (Oncogene-Induced Senescence) and thus having an oncogenic function^[15]. However, the conclusion is contradictory with a plurality of documents and patents which indicate the anti-cancer effect of the miR-302 family miRNA in recent years. At present, no report is available on whether the miR-302 has a regulation effect in the normal cell aging process.

In the invention, miR-302 family miRNA is over-expressed in cells by a transgenic means, so that the aging of normal human cells can be remarkably reversed, and the sign of inducing pluripotent reprogramming is avoided, which shows that miR-302 family miRNA has an anti-aging effect independent of the pluripotent reprogramming process.

Meanwhile, in vitro and in vivo detection is carried out on a large number of human tumor cells of different types and sources, and the result clearly shows that the miR-302 family miRNA has strong and broad-spectrum anticancer function, and further shows that the miRNA has non-carcinogenic effect in the human cells.

In addition, the results also show that the introduction of the artificially synthesized miR-302 family miRNA analogue into the human cells can also generate obvious senescence reversal effect.

Therefore, the miR-302 family miRNA and the analogues thereof are high-efficiency safe anti-aging medicaments which do not cause multi-potential reprogramming and carcinogenicity, and have wide application values in the directions of human aging prevention/reversal, human life prolonging, aging-related human disease treatment, in-vitro passage aging resistance of human cells and the like.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Reference to the literature

1.Shetty AK,Kodali M,Upadhya R et al.Emerging Anti-Aging Strategies -Scientific Basis and Efficacy.Aging Dis 2018；9:1165-1184.

2.Ocampo A,Reddy P,Martinez-Redondo P et al.In Vivo Amelioration of Age-Associated Hallmarks by Partial Reprogramming.Cell 2016；167:1719-1733 e1712.

3.Suh MR,Lee Y,Kim JY et al.Human embryonic stem cells express a unique set of microRNAs.Dev Biol 2004；270:488-498.

4.Judson RL,Babiarz JE,Venere M et al.Embryonic stem cell-specific microRNAs promote induced pluripotency.Nat Biotechnol 2009；27:459-461.

5.Anokye-Danso F,Trivedi CM,Juhr D et al.Highly efficient miRNA-mediated reprogramming of mouse and human somatic cells to pluripotency. Cell Stem Cell 2011；8:376-388.

6.Sandmaier SE,Telugu BP.MicroRNA-Mediated Reprogramming of Somatic Cells into Induced Pluripotent Stem Cells.Methods Mol Biol 2015；1330:29-36.

7.Lin SL,Chang DC,Lin CH et al.Regulation of somatic cell reprogramming through inducible mir-302expression.Nucleic Acids Res 2011；39:1054-1065.

8.Ge Y,Zhang L,Nikolova M et al.Strand-specific in vivo screen of cancer-associated miRNAs unveils a role for miR-21(*)in SCC progression. Nat Cell Biol 2016；18:111-121.

9.Debacq-Chainiaux F,Erusalimsky JD,Campisi J et al.Protocols to detect senescence-associated beta-galactosidase(SA-betagal)activity,a biomarker of senescent cells in culture and in vivo.Nat Protoc 2009；4: 1798-1806.

10.Liu B,Wang Z,Zhang L et al.Depleting the methyltransferase Suv39h1 improves DNA repair and extends lifespan in a progeria mouse model. Nat Commun 2013；4:1868.

11.Rodier F,Campisi J.Four faces of cellular senescence.J Cell Biol 2011；192:547-556.

12.Surazynski A,Jarzabek K,Haczynski J et al.Differential effects of estradiol and raloxifene on collagen biosynthesis in cultured human skin fibroblasts.Int J Mol Med 2003；12:803-809.

13.Affinito P,Palomba S,Sorrentino C et al.Effects of postmenopausal hypoestrogenism on skin collagen.Maturitas 1999；33:239-247.

14.Lin SL,Chang DC,Chang-Lin S et al.Mir-302reprograms human skin cancer cells into a pluripotent ES-cell-like state.RNA 2008；14:2115-2124.

15.Voorhoeve PM,le Sage C,Schrier M et al.A genetic screen implicates miRNA-372and miRNA-373as oncogenes in testicular germ cell tumors.Cell 2006； 124:1169-1181.

16.Zhao,W.,et al.,Endothelial CDS2 deficiency causes VEGFA-mediated vascular regression and tumor inhibition.Cell Res,2019.29(11):p.895-910.

17.Douglas E.Vaughan et al,Plasminogen Activator Inhibitor-1Is a Marker and a Mediator of Senescence,Arteriosclerosis,Thrombosis,and Vascular Biology.2017；37:1446–1452；

18.Koji Yamamoto et al,Plasminogen activator inhibitor-1is a major stress-regulated gene:Implications for stress-induced thrombosis in aged individuals,PNAS January 22,2002 99(2)890-895.

19.Yan,P.,et al.,FOXO3-Engineered Human ESC-Derived Vascular Cells Promote Vascular Protection and Regeneration.Cell Stem Cell,2019.24(3): p.447-461 e8 。

Sequence listing

<110> Shanghai Life science research institute of Chinese academy of sciences

<120> application of small RNA molecules and analogs thereof in anti-aging

<130> P2020-0180

<150> CN2019107918411

<151> 2019-08-26

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> RNA

<213> Intelligent (Homo sapiens)

<400> 1

uaagugcuuc cauguuucag ug 22

<210> 2

<211> 22

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 2

taagtgcttc catgtttcag tg 22

<210> 3

<211> 142

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagta agtgcttcca 60

tgtttcagtg cttcctgtca gacactgaaa catggttgca ctatctgcgg cacgtgcctt 120

tgcatctcga caggaacttt tt 142

<210> 4

<211> 142

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagca acaagatgaa 60

gagcaccaat cttcctgtca gaattggtgc tcttctactt gtatctgcgg cacgtgcctt 120

tgcatctcga caggaacttt tt 142

<210> 5

<211> 142

<212> DNA

<213> Artificial sequence ()

<400> 5

ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagtt tcacgaacca 60

tgtttcagtg cttcctgtca gacactgaaa catggaacgt gattctgcgg cacgtgcctt 120

tgcatctcga caggaacttt tt 142

<210> 6

<211> 142

<212> DNA

<213> Artificial sequence ()

<400> 6

ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagta agtgcttcct 60

acaaagtcac cttcctgtca gagtgacttt gtaggttgca ctatctgcgg cacgtgcctt 120

tgcatctcga caggaacttt tt 142

<210> 7

<211> 142

<212> DNA

<213> Artificial sequence ()

<400> 7

ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagta agtgcttggt 60

acaaagtcac cttcctgtca gagtgacttt gtaccttgca ctatctgcgg cacgtgcctt 120

tgcatctcga caggaacttt tt 142

<210> 8

<211> 142

<212> DNA

<213> Artificial sequence ()

<400> 8

ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagta agtgctaggt 60

acaaagtcac cttcctgtca gagtgacttt gttccttgca ctatctgcgg cacgtgcctt 120

tgcatctcga caggaacttt tt 142

<210> 9

<211> 142

<212> DNA

<213> Artificial sequence ()

<400> 9

ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagta agtggaacca 60

tgtttcagtg cttcctgtca gacactgaaa catggaacca ctatctgcgg cacgtgcctt 120

tgcatctcga caggaacttt tt 142

<210> 10

<211> 142

<212> DNA

<213> Artificial sequence ()

<400> 10

ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagtt tctgcttcca 60

tgtttcagtg cttcctgtca gacactgaaa catggttgca gattctgcgg cacgtgcctt 120

tgcatctcga caggaacttt tt 142

<210> 11

<211> 22

<212> RNA

<213> Artificial sequence ()

<400> 11

uaagugcuuc cuacaaaguc ac 22

Claims (10)

1. Use of an active ingredient selected from the group consisting of:

(a) a microrna of the miR-302 family, comprising: miR-302 or a modified miR-302 derivative; or the core sequence is 5 '-AAGUGCU-3', the length is 16-28nt, the function is the same as or basically the same with miR-302 micro RNA or modified miRNA derivative;

(b) a precursor miRNA that is processable in a host to the miR-302 of (a);

(c) a polynucleotide capable of being transcribed by a host to form a precursor miRNA as described in (b) and processed to form a microrna as described in (a);

(d) an expression vector comprising the miR-302 of (a), or the precursor miRNA of (b), or the polynucleotide of (c);

(e) an agonist of the microrna described in (a);

wherein the active ingredient is used for the preparation of a pharmaceutical composition or formulation for one or more applications selected from the group consisting of:

(i) delaying or reversing normal somatic cell senescence;

(ii) promoting the in vitro amplification and/or in vivo amplification of normal somatic cells;

(iii) inhibiting the expression and/or activity of SA- β -Gal;

(iv) promoting the expression and/or activity of H3K9me 3;

(v) inhibiting the expression and/or activity of P16 protein;

(vi) promoting the expression and/or activity of collagen type III COL3A 1;

(vii) inhibit expression and/or activity of PAI-1.

2. The use according to claim 1, wherein said microrna has a length of 16 to 28nt and a sequence characteristic satisfying the following formula: 5 '- (N) AAGUGCUN … -3', wherein N represents any nucleotide, and (N) represents 1 or 0N.

3. The use of claim 1, wherein the sequence of miR-302 is as shown in SEQ ID No. 1 (UAAGUGCUUCCAUGUUUCAGUG).

4. The use of claim 1, wherein said polynucleotide of (c) has the structure of formula II:

Seq_{forward direction}-X-Seq_{Reverse direction}

Formula II

In the formula II, the reaction mixture is shown in the specification,

seq is forward to a nucleotide sequence that can be processed into said microRNA in a host;

seq reverse is a nucleotide sequence that is substantially complementary or fully complementary to Seq forward;

x is a spacer sequence located between the Seq forward direction and the Seq reverse direction, and the spacer sequence is not complementary to the Seq forward direction and the Seq reverse direction;

and the structure of formula II, when transferred into a host cell, forms a secondary structure of formula III:

in formula III, Seq Forward, Seq reverse and X are as defined above,

the base-complementary pairing relationship formed between the Seq forward direction and the Seq reverse direction is expressed.

5. The use of claim 1, wherein the polynucleotide of (c) has the amino acid sequence shown in SEQ ID No: 3:

CCGGCTGTCTCAAGAAAGAATGAaggaatcgtgtTgcgctagcctcagTAAGTGCTTCCATGTTTCAGTGcttcctgtcagaCACTGAAACATGGTTGCACTatctgcggcacgtgcctttgcatctcgacaggaacttttt(SEQ ID No:3)。

6. the use according to claim 1, wherein the expression vector in (d) comprises: viral vectors and non-viral vectors.

7. A pharmaceutical composition comprising an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is selected from the group consisting of:

(a) a microrna of the miR-302 family, comprising: miR-302 or a modified miR-302 derivative; or the core sequence is 5 '-AAGUGCU-3', the length is 16-28nt, the function is the same as or basically the same with miR-302 micro RNA or modified miRNA derivative;

(b) a precursor miRNA that is processable in a host to the miR-302 of (a);

(c) a polynucleotide capable of being transcribed by a host to form a precursor miRNA as described in (b) and processed to form a microrna as described in (a);

(d) an expression vector comprising the miR-302 of (a), or the precursor miRNA of (b), or the polynucleotide of (c).

8. A method for screening a candidate compound promoting miR-302, comprising the steps of:

(a) taking a cell culture system added with a test compound as an experimental group; the cell culture system without the test compound added was used as a control;

(b) testing the expression amount and/or activity of SA-beta-Gal protein and/or P16 protein in the experimental group and the control group; testing the expression amount and/or activity of the H3K9me3 protein and/or the collagen type III COL3A1 in the experimental group and the control group;

wherein, when the expression quantity and/or activity of SA-beta-Gal protein and/or P16 protein in the test group is lower than that of the control group, and the expression quantity and/or activity of H3K9me3 protein and/or type III collagen COL3A1 is significantly higher than that of the control group, the test compound is a candidate compound for promoting miR-302.

9. An in vitro non-therapeutic inhibition of the expression level and/or activity of SA-beta-Gal protein and/or P16 protein; and/or promoting the expression and/or activity of H3K9me3 protein and/or collagen type iii COL3a1, comprising the steps of:

adding the pharmaceutical composition or the miR-302 active ingredient of claim 7 to a cell culture system, thereby inhibiting the expression amount and/or activity of SA- β -Gal protein and/or P16 protein; and/or promoting the expression and/or activity of H3K9me3 protein and/or collagen type III COL3A 1.

10. An in vitro non-therapeutic method of promoting proliferation of normal somatic cells, comprising the steps of:

culturing a normal somatic cell in the presence of a miR-302 active ingredient under conditions suitable for growth, thereby promoting proliferation of the normal somatic cell, wherein the miR-302 active ingredient is as described in claim 1.

Images