CN112359043B

CN112359043B - CRISPR/Cas9 vector applicable to phomopsis FS508 and construction method and application thereof

Info

Publication number: CN112359043B
Application number: CN202011285033.7A
Authority: CN
Inventors: 叶伟; 章卫民; 刘珊; 张维阳; 刘桃妹; 李赛妮; 徐诗航; 李浩华
Original assignee: Guangdong Detection Center of Microbiology of Guangdong Institute of Microbiology
Current assignee: Institute of Microbiology of Guangdong Academy of Sciences
Priority date: 2020-11-17
Filing date: 2020-11-17
Publication date: 2022-05-10
Anticipated expiration: 2040-11-17
Also published as: CN112359043A

Abstract

The invention discloses a CRISPR/Cas9 vector applicable to phomopsis FS508 and a construction method and application thereof. The invention firstly utilizes CRISPR/Cas9 technology to construct a recombinant P.lithacarpus FS508 strain with a knocked-out polyketone new skeleton compound lithacarpus biosynthetic gene, and establishes a CRISPR/Cas9 gene knockout system suitable for deep sea fungi P.lithacarpus FS508, thereby laying a molecular biological foundation for the elucidation of the biosynthetic mechanism of the lithacarpus in the P.lithacarpus FS508 and the obtainment of more lithacarpus polyketone derivatives with remarkable anti-tumor activity.

Description

CRISPR/Cas9 vector applicable to phomopsis FS508 and construction method and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a CRISPR/Cas9 vector applicable to phomopsis FS508, and a construction method and application thereof.

Background

The deep sea fungus Phomopsis lithocarpus FS508 is a Phomopsis from deep sea, which produces a large number of novel skeletal polyketides lithocarpins of the tenolone-decamacrolide group with significant antitumor activity. At the early stage, 7 ten-membered macrolide hybrid teneellone polyketone new skeleton compounds, namely lithoacarpins A-G, are obtained from deep sea fungi, namely, Phomopsis lithoacarpus, and the new skeleton compounds have stronger cytotoxic activity on tumor cells, wherein lithoacarpin E has better selective cytotoxic effect, the cytotoxicity on hepatoma carcinoma cells HepG-2 is obviously stronger than that of other tumor cells, and the lithoacarpin E has the potential of being developed into a lead compound of a specific anti-liver cancer medicament. On this basis, p. lithacarpus FS508 was subjected to genome sequencing, and the biosynthetic gene cluster of lithacarpins was predicted. The lithocarpins polyketide backbone is predicted to be formed catalytically by PKS on cluster 41, where the KS (ketoacyl synthase) module is the starter module for PKS genes. It is therefore necessary to mutate or delete this module in order to verify its function in the process of biosynthesis of litocarpines. However, the biosynthesis mechanism of lithoacarpins has not been elucidated, since the gene knockout system of the deep sea fungus phomopsis p. The establishment of a gene knockout system of P.lithacarpus FS508 is beneficial to the analysis of a lithacarpus biosynthesis mechanism, so that more novel lithacarpus compounds and derivatives thereof can be obtained through a synthetic biology strategy.

CRISPR/Cas9 is a technology for specific DNA modification of targeted genes by sgRNA mediated Cas9 nuclease. Can cut the target gene under the guidance of gRNA. The CRISPR/dCas9 is obtained by mutating the active region to lose the cutting activity, and the transcription regulation of target gene is modified by fusing partial transcription regulation elements and methylation modification elements. The CRISPR/Cas9 system has very wide application in genome editing of eukaryotic cells such as mammalian cells, stem cells and plants due to the advantages of simple construction, relatively high gene knockout efficiency, low cost and the like, but the CRISPR/Cas9 system has relatively low knockout efficiency in filamentous fungi and needs further optimization due to the relatively complex genetic background caused by the unique habitat of the deep-sea fungi, and the CRISPR/Cas9 system is not applied to gene knockout of deep-sea fungus phomopsis.

Disclosure of Invention

The invention aims to overcome the current situation that the existing deep sea fungus P.lithocarpus FS508 lacks an effective genetic operation means, and provides a CRISPR/Cas9 vector suitable for phomopsis FS508 and a construction method and application thereof.

The first purpose of the invention is to provide a construction method of CRISPR/Cas9 vector suitable for Phomopsis FS508, which comprises the following steps:

designing a target sequence 5'-gagaaggcttacgctcaggt-3' of a KS module on the basis of a pFC332 vector, designing and respectively amplifying a 5S rRNA fragment and a sgRNA fragment containing the target sequence, and then carrying out fusion PCR by taking the 5S rRNA fragment and the sgRNA fragment containing the target sequence as mixed templates to obtain a 5S rRNA-KS-sgRNA fragment;

the pFC332 vector and the 5SrRNA-KS-sgRNA fragment are subjected to double digestion by restriction enzymes PacI and BglII, then the 5S rRNA-KS-sgRNA fragment is connected into the pFC332 vector by T4 DNA ligase, the connection product is transformed into a Trans5 alpha competent cell, Amp resistance selection is carried out, and the 5S rRNA-KS-sgRNA fragment is amplified for verification, so that the CRISPR/Cas9 vector suitable for the Phomopsis FS508 is obtained.

Preferably, the nucleotide sequence of the 5S rRNA fragment is shown in SEQ ID No.1, and the nucleotide sequence of the sgRNA fragment containing the target point sequence is shown in SEQ ID No. 2.

The invention also provides a CRISPR/Cas9 vector which is constructed according to the construction method and is suitable for the phomopsis FS 508.

The invention also provides a fungus containing the CRISPR/Cas9 vector applicable to the Phomopsis FS 508.

Preferably, the fungus is Phomopsis FS 508.

The invention also provides application of the CRISPR/Cas9 vector suitable for the phomopsis FS508 in gene knock-out of the phomopsis FS 508.

Preferably, the method comprises the following steps: introducing the CRISPR/Cas9 vector suitable for the Phomopsis FS508 into a Phomopsis FS508 protoplast by a protoplast-mediated method, screening by a hygromycin-resistant PDA plate, selecting a positive clone, extracting genome DNA to verify the introduction of a recombinant vector, and verifying the knockout of a target gene by sequencing.

The CRISPR/Cas9 vector suitable for deep sea fungi phomopsis p.lithachus FS508 is constructed, key biosynthesis genes of a new skeleton antitumor compound are knocked out, the function of a target gene is further verified through metabolite comparison analysis, a molecular biological basis is laid for analyzing the lithacarpine biological mechanism synthesis in p.lithachus FS508 in the later stage, and the development and utilization of the lithacarpine compounds in the aspect of antitumor drug lead compounds are promoted.

Compared with the prior art, the invention has the following beneficial effects:

at present, the gene knockout of fungi is generally carried out by adopting a method of introducing a target gene homology arm to generate homologous recombination, but two repair modes of non-homologous end repair and homologous recombination exist in filamentous fungi, and the generation efficiency of homologous recombination is low, so that the gene knockout of the filamentous fungi is slow in progress, and the genetic operation modification and the discovery of novel secondary metabolites of the filamentous fungi are seriously hindered. The CRISPR/Cas9 gene knockout system has the advantages of simple vector construction, relatively high gene knockout efficiency and the like, the Cas9 protein cuts the position of about 3bp near a target sequence NGG, and the deletion, mutation or insertion of a target gene is caused by NHEJ repair, so that the expression of the target gene is damaged, and therefore the CRISPR/Cas9 system can effectively promote the genetic engineering transformation of deep sea fungi P.lithocarpus FS508, and more lead compounds with biological activity are discovered.

Lithocarpus FS508, a deep sea fungus of the present invention, is disclosed in patent application No. CN201810974840.6, entitled: compound litocarpinol B, a preparation method thereof and application thereof in preparing antifungal medicaments.

Drawings

FIG. 1 shows the construction of pFC 332-sgRNA-KS; wherein, FIG. A shows the construction of 5S rRNA-KS-sgRNA fragment, lane 1 shows the 5S rRNA fragment, lane 2 shows the sgRNA fragment, and lane 3 shows the 5S rRNA-KS-sgRNA fragment; FIG. B is a PCR-verified plot of the bacterial solution of the recombinant vector pFC332-sgRNA-KS, wherein lane 1 is a blank control, and lanes 2-6 are PCR results of the bacterial solution;

fig. 2 is a hygromycin-resistant PDA plate of recombinant vector pFC332-sgRNA-KS introduced into p.

FIG. 3 shows the Cas9 gene amplification verification of recombinant vector KS-pFC332-sgRNA introduction; m is DNA marker, Lane 1 is blank control, Lane 2-11 is PCR product of bacterial liquid, Lane 12 is positive control;

figure 4 is a graph of the amplification of the target gene from the p. lithocarpus FS508 KS module; m is DNA marker, lanes 1-10 are target gene KS amplified by using recombinant bacterium genome DNA as a template;

figure 5 is a verification chart of sequencing of deletion mutations of the target gene of the p. lithocarpus FS508 KS module;

figure 6 is a graph comparing secondary metabolites of KS mut p. lithocarpus FS508 and wild p. lithocarpus FS508, with lithocarpin and teneellone as standards.

Detailed Description

The following examples are further illustrative of the present invention and are not intended to be limiting thereof.

Example 1: construction of targeted litocarpins biosynthesis gene knockout vector

Target sequences 5'-gagaaggcttacgctcaggt-3' for the KS module were designed.

On the basis of pFC332 plasmid, PacI and BglII sites are subjected to double digestion on pFC332, and a sequence is inserted: a 5S rRNA-KS-sgRNA fragment (i.e., 5S rRNA promoter-targeting sequence-sgRNA terminator, including a 5S rRNA promoter suitable for use in p.lithacarpus FS508, a sgRNA targeting sequence backbone gene functional in p.lithacus FS508, and its terminator) enables the recombinant plasmid to stably express Cas9 protein and transcribe sgRNA simultaneously after transformation into protoplasts (the plasmid is designated as pFC 332-sgRNA-KS). Wherein the primer 5S rRNA-sgRNA-F contains the target sequence gagaaggcttacgctcaggt in the KS module.

Primers designed for constructing the vector are shown in table 1, and a pFC332-sgRNA-KS vector is constructed by utilizing an enzyme digestion connection mode. The construction method is specifically as follows:

TABLE 1 primer sequences

PCR amplification was performed using Prime STAR MAX (TAKARA, Japan) high fidelity premix using P.lithocarpus FS508 genomic DNA as a template and primers 5SrRNA-promoter-F and 5S rRNA-promoter-R as primers and the like to obtain fragment 1 (the nuclear fragment thereof) of the 5S rRNA promoter containing a BglII cleavage siteThe nucleotide sequence is shown as SEQ ID NO.1, and figure 1A). Reaction system 50 μ L: 5S RNA-F0.5. mu.L, 5S RNA-R0.5. mu.L, 5S RNA 1. mu.L, 2 XPrime star 25. mu.L, ddH₂O23. mu.L. PCR procedure: pre-denaturation at 98 ℃ for 5min, denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 15s, extension at 72 ℃ for 10s, 35 cycles, and final extension at 72 ℃ for 10 min.

Artificially synthesizing sgRNA and a Terminator sequence thereof as a template, and carrying out PCR amplification by using primers 5SrRNA-sgRNA-F (containing KS target gRNA) and sgRNA-Terminator-R as front and rear primers to obtain a fragment 2 (the nucleotide sequence of which is shown in SEQ ID NO. 2) containing a PacI enzyme cutting site, the sgRNA and a Terminator thereof.

Using the

fragments

1 and 2 prepared above as a mixed template, fusion PCR was performed using Prime STAR MAX (TAKARA, Japan) high fidelity premix to obtain a 5S rRNA-KS-sgRNA fragment (FIG. 1A). PacI and BglII double enzyme digestion (Fermentas, USA) is carried out on pFC332 plasmid, PacI and BglII double enzyme digestion is carried out on the obtained 5S rRNA-KS-sgRNA fragment, the cut 5S rRNA-KS-sgRNA fragment is connected to the cut pFC332 by T4 DNA ligase, the connection product is transformed into Trans5 alpha competent cells, Amp resistance screening is carried out, bacterial liquid PCR verification is carried out by amplifying the fusion fragment (figure 1B), and the CRISPR/Cas9 vector of the KS module of the targeting P.lithacarpus FS508 is obtained and named as pFC 332-sgRNA-KS.

Example 2: knock-out of the lithacarpus FS508 lithacarpine biosynthetic gene:

introduction of foreign genes into p. lithocarpus FS508 protoplasts method was as follows:

(1) lithocarpus FS508 protoplasts were prepared as follows:

a suitable amount of P.lithocarpus FS508 mycelia was inoculated into 200mL of PDB liquid medium and cultured at 30 ℃ at 180r/min for 7 days. Filtering the bacterial liquid by two layers of gauze, selecting 2g (wet weight) of the bacterial balls with better growth in a 50mL centrifuge tube, and washing twice by PBS buffer solution to fully wash away the residual PDB culture medium. 0.10g of lyase was weighed out and dissolved in 20mL of KC buffer (0.6M KCl, 0.05M CaCl)₂) And filtered through a 0.22 μm filter membrane and added to the washed pellet. The cells were lysed at 28 ℃ and 68rpm for about 3 hours. Filtering the lysate with 200 mesh filter screen, filtering mycelium, and reusingThe 6 layers of the lens-wiping paper are filtered again, centrifuged at 4000 Xg for 5min at 4 ℃ and the supernatant is discarded. Add 5mL KC buffer solution, gently blow the precipitate with pipette, mix well, centrifuge at 4 deg.C at 4000 Xg for 5min, discard the supernatant. Adding 1mL of KC buffer solution, resuspending, namely finishing the preparation of the protoplast, performing microscopic examination, and observing the shape and the number of the P.lithocarpus FS508 protoplast;

prepared protoplast of P.lithocarpus FS508 (1X 10)⁸/mL) and 5 mu g pFC332-sgRNA-KS plasmid, placing on ice for 5min, then adding 200 mu L of PEG4000 with volume fraction of 30%, placing at 30 ℃ for 15min, then adding 400 mu L of PEG4000, placing at 30 ℃ for 15min, then adding 1.2mL of W5 solution to terminate the reaction, finally adding 4mL of WI buffer solution, placing on a 30 ℃ shaking table at 80rpm, and culturing overnight for later use;

(2) cooling the melted PDA solid culture medium to room temperature, taking 20mL each time, gently mixing with the overnight culture solution in the step (1), adding hygromycin with the final concentration of 100 mug/mL, uniformly coating the mixture, and culturing for 5d at 30 ℃;

(3) after a small mycelium grows out, picking a fungus colony to be transferred to a PDA culture medium containing hygromycin with the final concentration of 100 mu g/mL, and then screening;

(4) the positive clones (fig. 2) growing on the hygromycin PDA plate in step (3) are first preserved (i.e. part of the mycelia is picked and transferred to a new hygromycin PDA plate), then the remaining fungal mycelia are placed in a sterile EP tube, liquid nitrogen is added to the sterile EP tube to fully grind the mycelia, the mycelia are immediately placed in a 100 ℃ water bath for 5min, then placed in liquid nitrogen for 1min again, the process is repeated for 3 times, finally 50 mul of ultrapure water is added to dissolve the mycelia, the mycelia are centrifuged at the maximum speed for 5min, and the supernatant (i.e. total genomic DNA) is taken and placed at-20 ℃ for preservation. Cas9 gene front and back primers Cas9-F and Cas9-R (see Table 1) are designed to amplify a Cas9 gene sequence to verify whether the recombinant vector pFC332-sgRNA-KS is successfully introduced (figure 3); on the basis of successful introduction, KS front and back primers (KS-Ver F, KS-Ver R, see table 1) of the target gene KS are designed to amplify a KS fragment (figure 4), and sequencing, alignment and verification are carried out.

In total, 10 clones were selected for sequencing, of which 1#, 2#, 3#, 4# and 7# underwent gene mutation, 2 bases A near the target site were deleted (FIG. 5), and the KS module failed to work normally. The efficiency of gene mutation was 50%, and the successfully obtained gene-deleted strain was recombinant p. lithocarpus FS508(KS mut p. lithocarpus FS 508).

Example 3: comparative analysis of litocarpines in KS mutant and wild strains

Comparative analysis of the yield of novel lithoacarpins from wild p.lithoacarpus FS508 and recombinant p.lithoacarpus FS 508.

Recombinant p.lithacarpus FS508(KS mut p.lithacarpus FS508) and wild p.lithacarpus FS508 were inoculated, cultured in YPD medium, and cultured at 28 ℃ for 7 days. Fermentation broths of wild and recombinant p. lithocarpus FS508 were collected, extracted with equal volume of ethyl acetate and concentrated by rotary evaporation. Crude extracts of wild p.lithacarpus FS508 and recombinant p.lithacarpus FS508 ethyl acetate were analyzed by HPLC and Agilent 6430 HPLC and novel lithacarpin a and Tenellone B from p.lithacarpus FS508 were used as standards. With C₁₈The column (4.6X 250mm) was analyzed. The detection conditions are as follows: the eluent was increased from 30% methanol to 100% methanol in 50min at a flow rate of 1.0 mL/min. The HPLC detection analysis result shows that the wild P.lithocarpus FS508 can detect the chromatographic peak corresponding to lithocarpin A (42.5 min). Whereas in crude recombinant p.lithacarpus FS508(KS mut p.lithacus FS508) no chromatographic peaks corresponding to lithacarpin a and teneellone B could be detected at the corresponding positions (fig. 6). The results show that the KS module can not generate litocarpin A by mutational inactivation of the KS module by using the CRISPR/Cas9, so that the key effect of the KS module in the litocarpin biosynthesis process is proved, and the CRISPR/Cas9 system is also suitable for knocking out the target gene of the KS mut P. litocarpus FS508 and has high knocking-out efficiency.

Sequence listing

<110> Guangdong province institute for microbiology (Guangdong province center for microbiological analysis and detection)

<120> CRISPR/Cas9 vector applicable to Phomopsis FS508 and construction method and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 128

<212> DNA

<213> Phomopsis lithocarpus FS508)

<400> 1

cgcagatctc acatacgacc acagggtgtg gaaaacaggg cttcccgtcc gctcagccgt 60

acttaagcca cacgccggga ggttagtagt tgggtgggtg accaccagcg aatcccttct 120

gttgtatg 128

<210> 2

<211> 205

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgaatccctt ctgttgtatg gagaaggctt acgctcaggt gttttagagc tagaaatagc 60

aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtggtgct 120

ttttttgttt tttatgtctg aattctgcag atatccatca cactggcggc cgctcgagca 180

tgcatctaga gggccgctta attaa 205

Claims

1. A construction method of CRISPR/Cas9 vector of Phomopsis FS508 is characterized by comprising the following steps:

designing a target sequence 5'-gagaaggcttacgctcaggt-3' of a ketoacyl synthase module on the basis of a pFC332 vector, designing and respectively amplifying a 5S rRNA fragment and a sgRNA fragment containing the target sequence, and then carrying out fusion PCR by taking the 5S rRNA fragment and the sgRNA fragment containing the target sequence as mixed templates to obtain a 5S rRNA-KS-sgRNA fragment;

using restriction endonucleasesPacI andBglII, double enzyme digestion of pFC332 vector and 5S rRNA-KS-sgRNA fragment, then connecting the 5S rRNA-KS-sgRNA fragment into pFC332 vector by using T4 DNA ligase, transforming the connection product into Trans5 alpha competent cells, Amp resistance screening, and amplifying the 5S rRNA-KS-sgRNA fragment for verification, thereby obtaining the CRISPR/Cas9 vector of Phomopsis FS 508.

2. The construction method according to claim 1, wherein the 5S rRNA fragment has a nucleotide sequence shown in SEQ ID No.1, and the sgRNA fragment containing the target sequence has a nucleotide sequence shown in SEQ ID No. 2.

3. The CRISPR/Cas9 vector of the Phomopsis FS508, which is constructed according to the construction method of claim 1.

4. A fungus containing the CRISPR/Cas9 vector of Phomopsis FS508 of claim 3, which is Phomopsis FS 508.

5. Use of the CRISPR/Cas9 vector of Phomopsis FS508 of claim 3 for knock-out of Phomopsis FS508 gene.

6. Use according to claim 5, characterized in that it comprises the following steps: introducing the CRISPR/Cas9 vector of the phomopsis FS508 into a phomopsis FS508 protoplast by a protoplast-mediated method, screening by a hygromycin-resistant PDA plate, picking positive clones, extracting genome DNA to verify the introduction of the recombinant vector, and verifying the knockout of a target gene by sequencing.