CN112239506B - Small molecule bispecific antibody diabetes of anti-PD-1 and c-Met antigen - Google Patents

Abstract

The invention belongs to the technical field of biology, and relates to a bispecific antibody, a preparation method and application thereof, and a corresponding nucleic acid coding sequence. The present invention provides a bispecific antibody comprising a first domain specifically recognizing the PD-1 antigen of T lymphocytes and a second domain specifically recognizing the c-Met antigen of tumor cells. The bispecific antibody has a single-chain open dimerization structure, can be preferentially combined with c-Met antigen on the surface of a tumor cell, and then can recruit the T cell around the tumor by combining with negative costimulatory molecules PD-1 on the surface of the T cell, and meanwhile, the PD-L1 up-regulated on the surface of the tumor cell is prevented from playing a role in inhibiting, so that the activation of the T cell is promoted, and the tumor is continuously killed. The bispecific antibody has the characteristics of double target affinity difference and small molecules, can reach higher drug exposure level in solid tumors, and can reduce the toxicity to normal tissues while enhancing the killing effect.

Description

Small molecule bispecific antibody diabetes of anti-PD-1 and c-Met antigen

Technical Field

The invention belongs to the technical field of biology, and relates to a bispecific antibody. The invention also includes a preparation method and application of the bispecific antibody and a corresponding nucleic acid coding sequence.

Background

Traditional methods for treating tumors include surgery, radiotherapy and chemotherapy, the effect of surgical excision is often limited by spreading of cancer cell invasion to adjacent tissues or distant metastasis, and radiotherapy and chemotherapy have greater toxicity to other normal tissues in the body. The immunotherapy is a new direction of the existing tumor therapy, can strengthen the anti-tumor immunity of the tumor microenvironment by mobilizing the immune system of an organism, thereby effectively killing tumor cells, has the advantages of durable curative effect, wide indication, easier treatment mode, capability of preventing metastasis and recurrence and the like, and even brings long-term survival hope for patients with advanced tumors which are ineffective in conventional therapy. Currently, hot immunotherapy mainly includes immune checkpoint inhibitor therapy, adoptive immune cell therapy, cytokine therapy, immune vaccine, and the like.

PD-1 belongs to the immunoglobulin superfamily, is an immune checkpoint molecule capable of inhibiting T cell activation, and tumor cells can produce inhibition effect on T cells by up-regulating the expression of ligand PD-L1, so PD-1 inhibitor represents an important transition in tumor immunotherapy development strategy. The major dilemma encountered with current immune checkpoint inhibitors is the relatively low overall remission rate, and clinical data indicate that PD-1 monoclonal antibody single drug treatment of solid tumors has only a response rate of around 10-30%. The method for improving the curative effect of the medicine is to adopt combined medicines, such as combined radiotherapy, chemotherapy and targeted therapy, however, the research shows that the combined medicines can cause the side effect to be increased by more than 4 times.

The c-Met is a transmembrane receptor with autonomous phosphorylation activity encoded by the MET gene, belongs to the superfamily of tyrosine kinase receptors, and is a specific receptor of HGF. HGF over-expression, MET gene over-expression, mutation and amplification can activate downstream signal channels, so that growth, proliferation and migration of tumor cells are promoted, and the method plays a key role in the occurrence and development of tumors. At present, the medicine aiming at the target spot mainly comprises a c-Met small molecule inhibitor and a monoclonal antibody, wherein the small molecule inhibitor has excellent performance in the aspects of specificity and effectiveness of the medicine, but often has higher side effect and dose-limiting toxicity, and the toxicity of the c-Met monoclonal antibody is rarely reported, but the curative effect is limited due to a complex activation mechanism.

The bispecific antibody is a new direction of tumor immunotherapy, and can overcome the limitation of Fc to link T cells with tumor cells to intensively kill the T cells by targeting two different antigens, and theoretically, the bispecific antibody can play a role of '1+1 > 2'. Bispecific antibodies can be divided into two broad classes by structure: bispecific antibodies containing an Fc region (IgG-like bispecific antibodies) and bispecific antibodies not containing an Fc region (non-IgG-like bispecific antibodies). The IgG-like bispecific antibody with larger molecular weight has higher affinity and longer half-life, and the non-IgG-like bispecific antibody with small molecules has shorter half-life, but has extremely strong tissue permeability, larger distribution volume and higher safety because the effective dose is less than one percent of that of the common antibody.

Solid tumors and tangible tumors, the growth of tumor bodies is more concentrated than that of blood system tumors, and the tumor has a complex tumor microenvironment, for example, infiltration of immune cells can be inhibited by generating tumor blood vessels with special structures, and the like. The common activated bispecific antibody can be combined with peripheral T cells in advance after entering peripheral blood through transfusion, and can not effectively reach the surrounding of tumor to play a role due to immunosuppression microenvironment, and can also generate systemic immune factor release due to activation of peripheral T cells, so that the curative effect is reduced and the potential safety hazard is high. And their bifunctional nature also carries the risk of producing higher side effects. Therefore, the structure of the bispecific antibody needs to be modified while the selection of the bispecific antibody target point is determined, and a reasonable bispecific antibody structure is designed, so that the killing effect of the bispecific antibody is enhanced and the side effect of the bispecific antibody is reduced.

Analysis of protein structure is critical to understanding its function. However, due to technical limitations, the experimental method is large in investment, long in period and high in risk for analyzing the protein structure. The homology modeling technology can well solve the problems, and the conservation of the tertiary structure of the protein is far more than that of the primary structure, so that the information technology can be utilized to directly predict the higher structure of the protein from the primary structure. Molecular docking is a technique for predicting protein mutual recognition and interaction, and protein docking operation is realized based on energy optimization. The structure of the bispecific antibody can be designed in an assisted manner by protein homology modeling, optimization and docking techniques, and the structural rationality thereof can be evaluated.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a bispecific antibody capable of simultaneously recognizing c-Met and PD-1.

The invention aims to solve the other technical problem of applying the bispecific antibody to the preparation of antitumor drugs.

Based on the above problems, the present invention discloses a bispecific antibody capable of binding to the tumor associated antigen c-Met and the T cell immune checkpoint molecule PD-1. The bispecific antibody targets antigen c-Met on tumor cells, and the invention promotes the killing effect of the bispecific antibody by linking T cells based on the problem of c-Met monoclonal antibody medication limitation caused by a complex activation mechanism of c-Met. Experiments show that IFN-gamma can be secreted after T cells are activated to promote tumors to up-regulate PD-L1 to inhibit T cell activation, and the bispecific antibody can target PD-1 antigen on the T cells at the same time, so that further immunosuppression possibly caused by the existing activated bispecific antibody drug is effectively avoided, and tumor killing effect is reduced. Meanwhile, the c-Met functional domain also endows the PD-1 functional domain with tumor specificity, so that the response rate of the PD-1 antibody is improved. The present invention has been completed based on the above-described concept.

In one aspect, the invention provides a bispecific antibody comprising a first domain that specifically recognizes the PD-1 antigen of T lymphocytes and a second domain that specifically recognizes the c-Met antigen of tumor cells, also known as diabetes.

The bispecific antibody comprises an antibody light and heavy chain variable region and Gly4Ser connecting peptide.

The bispecific antibody contains a variable region unit of an anti-PD-1 antibody light chain, and the nucleotide sequence of the bispecific antibody is shown as SEQ ID NO. 1.

The bispecific antibody of the invention contains a heavy chain variable region unit of the anti-PD-1 antibody, and the nucleotide sequence of the bispecific antibody is shown as SEQ ID NO. 2.

The bispecific antibody of the invention contains a variable region unit of an anti-c-Met antibody light chain, and the nucleotide sequence of the bispecific antibody is shown as SEQ ID NO. 3.

The bispecific antibody of the invention contains a heavy chain variable region unit of an anti-c-Met antibody, and preferably has a nucleotide sequence shown in SEQ ID NO. 4.

The bispecific antibody contains Gly4Ser connecting peptide, and the nucleotide sequence of the bispecific antibody is shown as SEQ ID NO. 5.

In the bispecific antibody of the present invention, the light and heavy chain variable regions of the anti-PD-1 and c-Met antibodies are cross-paired and linked via Gly4Ser linking peptide.

In the bispecific antibody of the present invention, the N-terminus of anti-PD-1 VH is linked to the C-terminus of anti-C-Met VL, the N-terminus of anti-C-Met VH is linked to the C-terminus of anti-PD-1 VL, and finally the C-terminus of anti-PD-1 VH is linked to the N-terminus of its VL by a Gly4Ser linker peptide to form a flexible peptide.

In a preferred embodiment of the present invention, the Gly4Ser linker peptide has 3 units.

In the bispecific antibody of the present invention, the light and heavy chains of the anti-c-Met at both ends polymerize to form a dimeric anti-c-Met variable region, and the middle part forms an anti-PD-1 scFv.

Preferably, the bispecific antibody of the invention has an open type dimerization structure and higher binding capacity with a tumor antigen c-Met, so that a single-chain small molecule bispecific antibody Diabody with double-target affinity difference is formed.

The invention provides a preparation method of the bispecific antibody, which comprises the following steps:

designing the bispecific antibody;

the design is aided by computer protein homology modeling, optimization and docking techniques.

Preferably, the method of preparation further comprises assessing the structure and rationality of the bispecific antibody.

Modeling is continuously optimized on the basis of evaluation, and the bispecific antibody is finally obtained through circulation.

The structural design rationality of the present invention was evaluated by using computer molecular modeling software Discovery Studio. Searching a high-molecular homology template sequence in a DS database, comparing and overlapping a target sequence with the high-molecular homology template sequence, carrying out protein homology modeling and optimization on the structural bispecific antibody Diabody, and evaluating a model structure by using Ramanchandran Plot. And then performing butt joint operation on the bispecific antibody diabetes and c-Met antigen (PDB ID:2 RFS) and PD-1 extracellular domain (PDB ID:3 RRQ) crystal structures in a PDB database respectively by using ZDOCK, optimizing a butt joint configuration by using RDOCK, and scoring by using an energy scoring function. And finally, recognizing and annotating an antibody CDR region by using a preprocessed hidden Markov model, and evaluating the rationality and the characteristics of the bispecific antibody diabetes by analyzing the modified antigen-antibody interaction interface (RMSD) and the non-bond interaction change.

The invention provides application of the bispecific antibody, namely application in preparing a medicine for treating solid tumors.

Preferably, the solid tumor drug is directed against tumor bodies or tumor cells expressing c-Met antigen.

The invention mainly provides a basis for application treatment of solid tumors, and the bispecific antibody Diabody is a small-molecule non-IgG-like bispecific antibody which only contains an antibody light-heavy chain variable region, so that the invention has extremely strong tissue permeability, larger distribution volume and low effective dose. The bispecific antibody does not contain an Fc segment, and can prevent strong organism toxic reactions possibly caused by initiation of ADCC (ADCC) and CDC (CDC) through the Fc segment, mediation of type I hypersensitivity and the like while exerting continuous killing effect in combination with T cells.

Further, the bispecific antibody Diabody has double-target affinity difference, and has higher affinity with the tumor antigen c-Met, so that the bispecific antibody Diabody can preferentially target tumors, then recruit and activate T cells to play a killing role, so that a large amount of medicines entering the body are exposed to tumor parts, and the toxicity to normal tissues is reduced while the killing role is enhanced.

Specifically, the invention generates a single-chain small molecule bispecific antibody diabetes with a double-target affinity difference by forming antibody functional domains with different configurations. The light and heavy chain variable regions of the anti-PD-1 and C-Met antibodies of the bispecific antibody diabetes are cross-paired and connected through Gly4Ser connecting peptides, the light and heavy chain of the PD-1 variable region is formed into PD-1scFv at the middle part by 3 Gly4Ser connecting peptides, the light and heavy chain of the C-Met variable region connected at the N end and the C end of the PD-1scFv is dimerized, and finally the bispecific antibody diabetes of the high affinity targeted tumor antigen C-Met is formed.

In another aspect, the invention provides nucleic acid sequences of the bispecific antibodies.

The invention also provides expression vectors containing the nucleic acid coding sequences of the bispecific antibodies, for example, using the pCEP4 vector in one embodiment of the invention.

The present invention provides cells expressing the bispecific antibody antibodies.

In a preferred embodiment of the invention, the cell is an EBNA1 engineered human embryonic kidney 293 cell HEK293E.

The terms and abbreviations involved in the present invention are as follows:

PD-1: programmed death receptor 1 (programmed cell death protein 1).

c-Met: hepatocyte growth factor receptor (mesenchymal epithelial transition factor).

HGF: hepatocyte growth factor (hepatocyte growth factor).

scFv: single chain variable region antibody fragment (single-chain variable fragment).

VH: heavy chain variable region (heavy chain variable region).

VL: light chain variable region (light chain variable region).

EBNA1: EB virus nuclear antigen (Epstein-Barr virus nuclear antigen 1).

Fc: fragment (fragment crystallizable) can be crystallized.

CDR: complementarity determining regions (complementarity determining region).

ADCC antibody-dependent cellular cytotoxicity (anti-independent cell-mediated cytotoxicity).

CDC complement dependent cytotoxicity (complement-dependent cytotoxicity).

RMSD, root mean square deviation (root mean square deviation).

PBMCs: peripheral blood mononuclear cells (peripheral blood mononuclear cells).

TILs: tumor infiltrating lymphocytes (tumor infiltrating lymphocyte).

PEI: polyethyleneimine (Polyethylenimine).

FITC: fluorescein isothiocyanate (Fluorescein isothiocyanate).

PHA-L: phytohemagglutinin (phytohemagglutin-L).

SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis (sodium dodecyl sulfate polyacrylamide gel electrophoresis).

PBS: phosphate buffered saline (phosphate buffer saline).

LDH: lactate dehydrogenase (lactate dehydrogenase).

The invention provides a small molecule bispecific antibody diabetes of an anti-PD-1 antigen and an anti-c-Met antigen, and the structure and rationality of the bispecific antibody are designed and evaluated on the basis of homologous modeling, butt joint and optimization of computer proteins. The diabetes with the single-chain open dimerization structure can be preferentially combined with c-Met antigen on the surface of a tumor cell, then the negative costimulatory molecule PD-1 on the surface of the T cell is combined to recruit the T cell around the tumor, meanwhile, the PD-L1 up-regulated on the surface of the tumor cell is prevented from playing a role in inhibiting, the activation of the T cell is promoted, and the tumor is continuously killed. The bispecific antibody has the characteristics of double target affinity difference and small molecules, can reach higher drug exposure level in solid tumors, and can reduce toxicity to normal tissues while enhancing killing effect.

Drawings

FIG. 1 is a schematic diagram of the molecular structure of bispecific antibody Diabody against PD-1 and c-Met antigens.

FIG. 2 is a graph showing the results of a bispecific antibody Diabody protein simulation against PD-1 and c-Met antigens.

FIG. 3 is a plasmid map and primer sequences of bispecific antibody Diabody against PD-1 and c-Met antigens.

FIG. 4 is a SDS-PAGE analysis of bispecific antibody Diabody protein expression.

FIG. 5 is a SDS-PAGE analysis of bispecific antibody diabetes protein purification.

FIG. 6 is a flow chart showing the binding of bispecific antibody Diabody against PD-1 and c-Met antigen.

FIG. 7 is a CCK-8 assay for bispecific antibody diabetes to inhibit tumor cell proliferation in vitro.

FIG. 8 is a graph showing the results of a scratch assay for bispecific antibody diabetes to inhibit tumor cell migration in vitro.

FIG. 9 is a graph of the Transwell results of bispecific antibody diabetes in inhibiting tumor cell invasion in vitro.

FIG. 10 is a flow scattergram of CD4 and CD8T cells in diabetes in vitro activated TILs.

FIG. 11 is a measurement of the level of LDH release from tumor cells by diabetes at different effective target ratios.

FIG. 12 is a graph showing the detection of cytokine IL-2 and IFN-gamma secretion levels by T cells under the influence of diabetes.

Detailed Description

Preferred embodiments of the present invention will be described in further detail below with reference to the accompanying drawings. The experiments of the invention are generally carried out according to the molecular cloning laboratory guidelines and conventional experimental procedures of Cold spring harbor laboratories.

The invention relates to the sequence as follows:

SEQ ID NO.1 anti-PD-1 antibody light chain unit nucleotide sequence:

Gagattgtcctcacccagtcaccggcaaccctgtcactgtcacccggagagcgcgccactctgtcttgcagagcatcccagagcgtgtccagctacctggcatggtaccagcagaagccaggccaggccccacggttgctgatttacgacgcgtccaaccgagctacaggaatccctgcacggttctcaggctccggatccggcacagattttaccctcacaatttcaagcctcgagccagaagactttgcggtgtactactgtcagcagagtagcaattggccccgcacatttggacagggtacaaaagtggaaataaagcgcactgtggctgctccaagcgtgttcatctttccgcccagcgacgaacaactgaaaagcgggactgcctccgtggtttgtctgctcaacaatttctatccccgcgaggccaaagtgcagtggaaggtcgacaatgccctccagtccggcaattcccaggaatccgttaccgagcaagatagtaaggatagcacctacagcctgtcctctacgctgacgctttccaaggcagactacgagaagcacaaagtgtatgcttgcgaggtcactcaccaggggttgagtagcccagtaacaaaatcatttaaccggggagaatgt。

SEQ ID NO.2 heavy chain unit nucleotide sequence of anti-PD-1 antibody:

caggtgcagctggtcgagtcaggcggaggtgtcgttcaaccaggacgctccctgagactggactgcaaggcgtccggaataaccttctccaatagcggcatgcactgggttcgacaggcacctgggaaaggcctggaatgggtggccgtgatctggtatgacggcagcaagcgctactatgccgatagtgtgaagggtcgcttcacaatttcccgcgataatagcaagaacactctgttcctgcagatgaactctcttagagcggaggacacagccgtgtactattgcgcaactaatgacgattactggggccaaggtacgttggtcactgtcagctccgccagcacaaaaggacccagcgtgttccccttggccccctctagcaaaagcacatcagggggtaccgcagcgctggggtgcctcgtgaaagattactttcctgagccagtgaccgtctcttggaactcaggagcgctgacctctggtgtccacaccttccctgccgtgttgcagtccagcggactgtacagcttgagcagcgtcgtgacggttccctcttcatccctgggtacccagacctacatttgcaatgtcaaccataagccaagcaacacaaaggtggacaagaaggtcgaacccaaatcttgcgataagactcatacctgcccaccgtgcccggcccccgaattgctcggaggaccgagcgtttttttgttccccccaaagcccaaggatactctcatgatttcacgaaccccagaggtgacatgtgtcgtagtcgacgtgtcacatgaggatcctgaggtgaaattcaactggtatgtagacggtgtcgaggtgcacaacgcgaagaccaaaccccgcgaggaacagtacaatagcacgtatagagttgtttcagttctgaccgttctgcatcaggactggctgaatggcaaagaatacaaatgcaaggtttcaaataaagcactgcccgccccgatagagaagaccatctctaaggcaaagggccagcccagggaaccccaggtttatacgctccctccctcaagagaggaaatgactaaaaaccaggtttcactgtggtgcctggtcaaggggttttatccatctgatatcgctgtggaatgggagtccaatggccaacccgagaacaactataagactacgccgccagttctggattcagacgggtcctttttcctgtacagcaaactgacagtggataagtcccgatggcagcagggaaatgttttttcatgctctgtgatgcatgaggccctccacaaccattacacccagaagagtttgagcctcagcccaggcaag。

SEQ ID NO.3 anti-c-Met antibody light chain variable region nucleotide sequence:

Gacatccagatgacccagtccccatcaagcttgtcagccagcgttggcgaccgcgttacaatcacctgcaagagctctcagagcctcttgtatacatcaagccagaaaaactatctggcctggtatcaacagaaacctgggaaggcccccaagctgctgatctactgggcttccacacgagagagcggtgtccctagccgcttcagcggatccgggagcggcaccgattttacacttactatttccagtctccaaccagaggactttgcaacctattactgtcagcagtattacgcatatccctggactttcgggcagggcaccaaagtggagatcaagcga。

SEQ ID NO.4 anti-c-Met antibody heavy chain variable region nucleotide sequence:

Gaggttcaactggtcgagagcggaggaggactggtgcagccaggaggatcactgcgccttagctgtgctgcctccgggtacacttttaccagttactggctgcactgggtgcggcaggcaccaggcaagggtctggagtgggtaggtatgattgatccctcaaactccgacacgaggtttaatcctaatttcaaagaccgctttaccatatcagcggatacctccaagaatactgcctaccttcaaatgaacagccttcgcgccgaggatacagctgtttattactgcgccacctaccgatcatatgtgacacccttggattactggggccagggaaccctggtcacagtcagcagc。

SEQ ID NO.5Gly4Ser connecting peptide nucleotide sequence:

Ggaggaggcggcagtggaggagggggctccggagggggaggtagc。

example 1 structural design of bispecific antibody diabetes

In order to improve the binding force of the bispecific antibody to tumors, the variable region of the anti-tumor antigen C-Met antibody is bound in a dimerized form, so that the light and heavy chains thereof are respectively connected at the N-terminal end and the C-terminal end of the PD-1scFv to form the bispecific antibody with the difference of double-target affinity. A signal peptide is added to the N end of the diabetes, and a hexahistidine His-tag is carried on the C end of the diabetes for subsequent purification and identification.

Example 2 evaluation of design Structure rationality by protein Structure homology modeling

The method comprises the steps of firstly loading a diabetes amino acid sequence by using Discovery Studio software, searching a template sequence with highest homology with a target sequence in a DS database, comparing the selected high-resolution template sequence with the target sequence, then superposing, constructing a 3D model of the target sequence by using MODELEER, selecting an optimal model according to a PDF or DOPE value, and finally using a Ramanchandran Plot evaluation model, wherein the amino acid skeleton structure of more than 95% is reasonable.

EXAMPLE 3 construction of bispecific antibody Diabody expression plasmids

The c-Met and PD-1 antibody sequences screened in the early stage of a laboratory are used as templates, reasonable primers are designed, and a target gene is constructed through overlap extension PCR.

DB-ML-F:ctgtggttccccggctcgcgatgtgacatccagatgacccag，SEQ ID NO 6。

DB-ML-R:gcttcctcctccgcctcgcttgatctccacttt，SEQ ID NO 7。

DB-PH-F:ggcggaggaggaagccaggtgcagttggtcgaa，SEQ ID NO 8。

DB-PH-R:cacgatctctgagccgccgccaccggaacctccgcctccggaaccaccacctccacttgacaccg，SEQ ID NO 9。

DB-PL-F:gtgtcaagtggaggtggtggttccggaggcggaggttccggtggcggcggctcagagatcgtg，SEQ ID NO 10。

DB-PL-R:gcttcctcctccgcctctcttgatctccacctt，SEQ ID NO 11。

DB-MH-F:ggcggaggaggaagcgaggttcaactggtcgag，SEQ ID NO 12。

DB-MH-R:ccttgccggcctcgagcggccgcttaatggtgatggtgatgatggctgctgactgtgaccaggg，SEQ ID NO 13。

Primers DB-ML-F and DB-ML-R amplify C-Met VL, primers DB-MH-F and DB-MH-R amplify C-Met VH, primers DB-PL-F and DB-PL-R amplify PD-1VL, primers DB-PH-F and DB-PH-R amplify PD-1VH, primers DB-ML-F and DB-PH-R amplify C-Met VL-PD-1VH, primers DB-PL-F and DB-MH-R amplify PD-1VL-C-Met VH, primers DB-ML-F and DB-MH-R amplify full length diabetes, and signal peptide and His-tag are introduced at the N-terminal and C-terminal of the diabetes, respectively. The gene of interest was then ligated into the linearized eukaryotic expression vector pCEP4 using a recombinant reaction. And finally, transforming the escherichia coli, picking up positive monoclonal, amplifying and extracting plasmids, and sequencing and identifying.

Example 4 expression of bispecific antibody Diabody proteins

And (3) performing wall-attached domestication on HEK293E cells to form serum-free suspension culture, mixing a cationic transfection reagent PEI with an expression plasmid carrying a diabetes target gene in proportion when the logarithmic growth phase is reached, transfecting HEK293E cells by taking the same amount of PEI as a blank control, adding auxiliary materials after 24hr, and collecting 100 mu L of supernatant every other day for identification. Protein expression was analyzed by SDS-PAGE gel electrophoresis and Coomassie brilliant blue staining, and the experimental group showed significant protein production at the molecular weight position of the target protein compared to the control group. After the activity of the cells is reduced to below 75%, centrifuging to collect cell supernatant, filtering and sterilizing, and preserving at-20 ℃ for purification.

EXAMPLE 5 purification of bispecific antibody Diabody proteins

Connecting a pre-loaded nickel column to an AKTA protein purification system, flushing a storage buffer solution by using deionized water with the volume of 3-5 times of the column volume, balancing the column by using a binding buffer solution with the volume of at least 5 times of the column volume, passing a sample containing His-tag protein through the column, controlling the flow rate, collecting effluent liquid for subsequent analysis, flushing the column by using a washing buffer solution with the volume of 10 times of the column volume to remove the impurity protein until the A280 of the effluent liquid reaches the minimum and is stable, carrying out gradient elution by using an eluent containing imidazole with the volume of 5-10 times of the column volume, and collecting the eluent for identification. The expression level was measured by the BCA protein assay kit and was about 10mg/L.

Example 6 detection of Diabody antibody antigen binding specificity by flow cytometry

And taking the diabetes as a primary antibody, respectively co-incubating with CHO cells stably expressing the PD-1 extracellular section and gastric cancer cells MKN45 expressing the c-MET, taking PBS as a blank control, washing for 3 times, adding FITC-labeled anti-His-tag secondary antibody, washing for 3 times, and analyzing the fluorescence intensity change by using a flow cytometer. The increase in fluorescence intensity of the PD-1 and c-Met experimental groups indicates that diabetes is capable of binding to cell surface expressed PD-1 and c-Met, and has antibody antigen binding specificity.

Example 7 determination of inhibition of tumor cell proliferation by diabetes by detection of CCK-8

A549 was inoculated into 96-well plates, attached overnight, bispecific antibodies at different concentrations were added separately, PBS was used as a blank control, HGF stimulation was added simultaneously, and 3 days later, CCK-8 was used to detect a549 proliferation. With the increase of the Diabody concentration, the experimental group obviously can inhibit the proliferation of A549 caused by HGF stimulation. After A549 is attached, diabetes is added, PBS is used as a blank control, a c-Met small molecule inhibitor JNJ-38877605 is used as a positive control, and compared with the change of tumor cell proliferation within 5 days after dosing, the diabetes and JNJ-38877605 can effectively inhibit the proliferation of A549, and after 72 hours, the inhibition effect of the diabetes is obviously stronger than that of JNJ-38877605, so that the drug effect is more durable than that of the c-Met small molecule inhibitor.

Example 8 detection of inhibition of tumor cell migration by diabetes by scratch assay

Inoculating A549 cells into a six-hole plate, adhering for 24hr until the confluence rate reaches 100%, rapidly and uniformly scratching in a culture dish by using a 1ml gun head, washing for 2 times by using PBS, removing scratched cells, adding 1640 culture medium containing diabetes, taking equal volume of PBS as a blank control, taking JNJ-38877605 as a positive control, simultaneously adding HGF for stimulation, and recording the migration condition of the cells at 0, 24 and 48hr by photographing. Diabody can obviously inhibit the migration of A549 cells caused by HGF.

Example 9 inhibition of tumor cell invasion by diabetes by Transwell assay

The prepared matrigel ice bath was thawed and spread on a polycarbonate membrane in a Transwell chamber (24-well plate) in a volume of 50. Mu.L, and left to stand at 37℃for 1 hour to polymerize into a gel. In the lower chamber adding 20% serum in 1640 medium, logarithmic phase A549 digestion centrifugation, with 1640 medium, adjusting cell concentration, taking 200ul to the upper chamber, adding diabetes treatment, with equal volume PBS as control, JNJ-38877605 as positive control, simultaneously adding HGF stimulus, and culturing in 5% CO2 incubator at 37deg.C for 24 hr. After the incubation time was completed, the upper chamber liquid was discarded, cells on the membrane that did not pass through the membrane were wiped off with a wet cotton swab, 4% paraformaldehyde was fixed at room temperature, 0.1% crystal violet stained, washed 3 times with PBS, and after drying, cells that passed through the membrane were observed under an inverted microscope. Diabody can obviously inhibit A549 invasion movement promoted by HGF stimulation.

Example 10 flow cytometry determination of activation of tumor-infiltrating T lymphocytes in liver cancer by diabetes

The tumor hospital collects liver cancer tissues and peripheral blood of the liver cancer patient, PBMCs are separated through Ficoll, and TILs in the liver cancer tissues are separated through Percoll after digestion of the liver cancer tissues. Culturing TILs and primary liver cancer cells, adding diabetes for treatment, taking equal volume PBS as a reference, and finally analyzing CD69 expression by flow cytometry to detect activation of CD4 and CD8T cells in peripheral blood and tumor tissues. The diabetes activates CD4 and CD8T cells in TILs that are inhibited by tumor cells compared to control PBMCs and TILs.

Example 11 killing of tumor cells by diabetes at different effective target ratios

After MCC-97H cells were attached for 24hr, IFN-gamma was stimulated for 24hr to express PD-L1, T cells in peripheral blood of healthy people were isolated, and PHA-L was stimulated for 48hr to express PD-1. Then incubating the two with different target ratios, adding diabetes for treatment, taking equal volume PBS as a control, detecting the release level of LDH in the culture supernatant after 48hr, and calculating the killing rate. With the increase of the effective target ratio, the killing effect of T cells is enhanced, and the Diabody can enhance the killing effect.

Example 12 diabetes promotes secretion of cytokines IFN-gamma and IL-2 by T cells

MKN45 cells were attached for 24hr, ifn- γ stimulated for 24hr, isolated human T cells were stimulated with PHA-L for 48hr, and both were targeted at an effective target ratio of 64:1 co-incubation, adding diabetes treatments with different concentrations, incubating at 37deg.C in 5% CO2 incubator for 48hr with equal volume PBS as control, and finally detecting IFN-gamma and IL-2 secretion levels in cell supernatant by Elisa. Diabody promotes T cell activation and secretion of cytokines, and activation is enhanced with increasing concentration.

Sequence listing

<110> university of double denier

<120> a small molecule bispecific antibody Diabody against PD-1 and c-Met antigen

<130> 20190702

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 642

<212> DNA

<213> Artificial

<400> 1

gagattgtcc tcacccagtc accggcaacc ctgtcactgt cacccggaga gcgcgccact 60

ctgtcttgca gagcatccca gagcgtgtcc agctacctgg catggtacca gcagaagcca 120

ggccaggccc cacggttgct gatttacgac gcgtccaacc gagctacagg aatccctgca 180

cggttctcag gctccggatc cggcacagat tttaccctca caatttcaag cctcgagcca 240

gaagactttg cggtgtacta ctgtcagcag agtagcaatt ggccccgcac atttggacag 300

ggtacaaaag tggaaataaa gcgcactgtg gctgctccaa gcgtgttcat ctttccgccc 360

agcgacgaac aactgaaaag cgggactgcc tccgtggttt gtctgctcaa caatttctat 420

ccccgcgagg ccaaagtgca gtggaaggtc gacaatgccc tccagtccgg caattcccag 480

gaatccgtta ccgagcaaga tagtaaggat agcacctaca gcctgtcctc tacgctgacg 540

ctttccaagg cagactacga gaagcacaaa gtgtatgctt gcgaggtcac tcaccagggg 600

ttgagtagcc cagtaacaaa atcatttaac cggggagaat gt 642

<210> 2

<211> 1329

<212> DNA

<213> Artificial

<400> 2

caggtgcagc tggtcgagtc aggcggaggt gtcgttcaac caggacgctc cctgagactg 60

gactgcaagg cgtccggaat aaccttctcc aatagcggca tgcactgggt tcgacaggca 120

cctgggaaag gcctggaatg ggtggccgtg atctggtatg acggcagcaa gcgctactat 180

gccgatagtg tgaagggtcg cttcacaatt tcccgcgata atagcaagaa cactctgttc 240

ctgcagatga actctcttag agcggaggac acagccgtgt actattgcgc aactaatgac 300

gattactggg gccaaggtac gttggtcact gtcagctccg ccagcacaaa aggacccagc 360

gtgttcccct tggccccctc tagcaaaagc acatcagggg gtaccgcagc gctggggtgc 420

ctcgtgaaag attactttcc tgagccagtg accgtctctt ggaactcagg agcgctgacc 480

tctggtgtcc acaccttccc tgccgtgttg cagtccagcg gactgtacag cttgagcagc 540

gtcgtgacgg ttccctcttc atccctgggt acccagacct acatttgcaa tgtcaaccat 600

aagccaagca acacaaaggt ggacaagaag gtcgaaccca aatcttgcga taagactcat 660

acctgcccac cgtgcccggc ccccgaattg ctcggaggac cgagcgtttt tttgttcccc 720

ccaaagccca aggatactct catgatttca cgaaccccag aggtgacatg tgtcgtagtc 780

gacgtgtcac atgaggatcc tgaggtgaaa ttcaactggt atgtagacgg tgtcgaggtg 840

cacaacgcga agaccaaacc ccgcgaggaa cagtacaata gcacgtatag agttgtttca 900

gttctgaccg ttctgcatca ggactggctg aatggcaaag aatacaaatg caaggtttca 960

aataaagcac tgcccgcccc gatagagaag accatctcta aggcaaaggg ccagcccagg 1020

gaaccccagg tttatacgct ccctccctca agagaggaaa tgactaaaaa ccaggtttca 1080

ctgtggtgcc tggtcaaggg gttttatcca tctgatatcg ctgtggaatg ggagtccaat 1140

ggccaacccg agaacaacta taagactacg ccgccagttc tggattcaga cgggtccttt 1200

ttcctgtaca gcaaactgac agtggataag tcccgatggc agcagggaaa tgttttttca 1260

tgctctgtga tgcatgaggc cctccacaac cattacaccc agaagagttt gagcctcagc 1320

ccaggcaag 1329

<210> 3

<211> 342

<212> DNA

<213> Artificial

<400> 3

gacatccaga tgacccagtc cccatcaagc ttgtcagcca gcgttggcga ccgcgttaca 60

atcacctgca agagctctca gagcctcttg tatacatcaa gccagaaaaa ctatctggcc 120

tggtatcaac agaaacctgg gaaggccccc aagctgctga tctactgggc ttccacacga 180

gagagcggtg tccctagccg cttcagcgga tccgggagcg gcaccgattt tacacttact 240

atttccagtc tccaaccaga ggactttgca acctattact gtcagcagta ttacgcatat 300

ccctggactt tcgggcaggg caccaaagtg gagatcaagc ga 342

<210> 4

<211> 357

<212> DNA

<213> Artificial

<400> 4

gaggttcaac tggtcgagag cggaggagga ctggtgcagc caggaggatc actgcgcctt 60

agctgtgctg cctccgggta cacttttacc agttactggc tgcactgggt gcggcaggca 120

ccaggcaagg gtctggagtg ggtaggtatg attgatccct caaactccga cacgaggttt 180

aatcctaatt tcaaagaccg ctttaccata tcagcggata cctccaagaa tactgcctac 240

cttcaaatga acagccttcg cgccgaggat acagctgttt attactgcgc cacctaccga 300

tcatatgtga cacccttgga ttactggggc cagggaaccc tggtcacagt cagcagc 357

<210> 5

<211> 45

<212> DNA

<213> Artificial

<400> 5

ggaggaggcg gcagtggagg agggggctcc ggagggggag gtagc 45

<210> 6

<211> 42

<212> DNA

<213> Artificial

<400> 6

ctgtggttcc ccggctcgcg atgtgacatc cagatgaccc ag 42

<210> 7

<211> 33

<212> DNA

<213> Artificial

<400> 7

gcttcctcct ccgcctcgct tgatctccac ttt 33

<210> 8

<211> 33

<212> DNA

<213> Artificial

<400> 8

ggcggaggag gaagccaggt gcagttggtc gaa 33

<210> 9

<211> 65

<212> DNA

<213> Artificial

<400> 9

cacgatctct gagccgccgc caccggaacc tccgcctccg gaaccaccac ctccacttga 60

caccg 65

<210> 10

<211> 63

<212> DNA

<213> Artificial

<400> 10

gtgtcaagtg gaggtggtgg ttccggaggc ggaggttccg gtggcggcgg ctcagagatc 60

gtg 63

<210> 11

<211> 33

<212> DNA

<213> Artificial

<400> 11

gcttcctcct ccgcctctct tgatctccac ctt 33

<210> 12

<211> 33

<212> DNA

<213> Artificial

<400> 12

ggcggaggag gaagcgaggt tcaactggtc gag 33

<210> 13

<211> 64

<212> DNA

<213> Artificial

<400> 13

ccttgccggc ctcgagcggc cgcttaatgg tgatggtgat gatggctgct gactgtgacc 60

aggg 64

Claims (6)

1. A bispecific antibody comprising a first domain that specifically recognizes a T lymphocyte PD-1 antigen and a second domain that specifically recognizes a tumor cell c-Met antigen;

the bispecific antibody comprises an antibody light and heavy chain variable region and Gly4Ser connecting peptide; the nucleotide sequence of the Gly4Ser connecting peptide is shown as SEQ ID NO. 5;

the nucleotide sequence of the anti-PD-1 antibody light chain variable region unit is shown in positions 1-324 of SEQ ID NO. 1; the nucleotide sequence of the heavy chain variable region unit of the PD-1 antibody is shown in positions 1-339 of SEQ ID NO. 2;

the nucleotide sequence of the anti-c-Met antibody light chain variable region unit is shown as SEQ ID NO. 3; the nucleotide sequence of the variable region unit of the heavy chain of the anti-c-Met antibody is shown as SEQ ID NO. 4;

in the bispecific antibody, the light chain variable region and the heavy chain variable region of the anti-PD-1 antibody and the c-Met antibody are respectively crossed and paired and are connected through Gly4Ser connecting peptide; the N-terminus of anti-PD-1 VH was linked to the C-terminus of anti-C-Met VL, the N-terminus of anti-C-Met VH was linked to the C-terminus of anti-PD-1 VL, and finally the C-terminus of anti-PD-1 VH was linked to the N-terminus of its VL by a Gly4Ser linker peptide to form a flexible peptide.

2. The use of a bispecific antibody according to claim 1, for the preparation of a medicament for the treatment of solid tumors expressing the c-Met antigen.

3. An expression vector for a bispecific antibody, wherein the bispecific antibody expresses the bispecific antibody of claim 1.

4. The expression vector of claim 3, wherein the bispecific antibody expression vector is a pCEP4 vector expressing a bispecific antibody.

5. A cell expressing a bispecific antibody, wherein the cell expresses the bispecific antibody of claim 1.

6. The cell of claim 5, wherein the cell is an EBNA1 engineered human embryonic kidney 293 cell HEK293E.