CN112210592A - Method for screening heat shock response molecular label yebE of escherichia coli based on qRT-PCR technology - Google Patents
Method for screening heat shock response molecular label yebE of escherichia coli based on qRT-PCR technology Download PDFInfo
- Publication number
- CN112210592A CN112210592A CN202011109238.XA CN202011109238A CN112210592A CN 112210592 A CN112210592 A CN 112210592A CN 202011109238 A CN202011109238 A CN 202011109238A CN 112210592 A CN112210592 A CN 112210592A
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- qrt
- heat shock
- yebe
- screening
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for screening a heat shock response molecular label yebE of escherichia coli based on a real-time fluorescent quantitative PCR (qRT-PCR) technology, which comprises the following steps: after the escherichia coli is subjected to heat shock treatment at 42 ℃, a candidate molecular marker gene related to heat shock response regulation is screened by adopting a first round of qRT-PCR technology. And then, after heat shock treatment is carried out on the heat-resistant mutant strain at 45 ℃, carrying out second round qRT-PCR screening on the obtained candidate molecular marker gene, and finally obtaining the heat shock response molecular marker gene of the escherichia coli. The invention obtains an escherichia coli heat shock response molecular label yebE from wild type and heat-resistant mutant strains through two rounds of screening of qRT-PCR technology, and can provide a new way for evaluating and monitoring biological heat stress and stirring heat generation in the industrial fermentation process. The method has the characteristics of high sensitivity and strong specificity, and has good application prospect in microbial fermentation production and molecular breeding.
Description
Technical Field
The invention relates to the field of bioscience, in particular to a molecular label yebE which is used for evaluating heat shock response of escherichia coli and is screened and discovered based on qRT-PCR technology.
Background
Microbial fermentation is widely applied to the fields of agriculture, food, medicines, energy and the like, and has an extremely important role in human social life. Environmental changes in the fermentation process are important factors restricting the production and quality of products, and the stability of strains and the effective monitoring of the fermentation process are basic guarantees for the smooth proceeding of the fermentation industry. In the industrial fermentation production process, microbial cells are often subjected to the stress influence of various environmental factors, so that the physiological function of the cells is changed, the suitability of the whole production process is changed, and the efficiency and the product quality of the biotransformation process are further influenced. In the stress process, the microorganism responds to environmental change and adapts to stress, and the regulated key genes not only can be used as molecular labels for monitoring the fermentation process, but also can be applied to stress-resistant molecular breeding.
Among the molecular markers of microbial stress, the family of heat shock proteins has been studied more. The heat shock proteins DnaJ, DnaJ and GrpE of the escherichia coli jointly form a complete molecular chaperone chain of the heat shock protein Hsp40, participate in folding, unfolding, assembling and transporting of intracellular proteins, can effectively reduce and eliminate misassembly of cells to the proteins in adverse environments such as high temperature and the like, and improve the heat resistance of microorganisms. The biological label can effectively reflect the change of the environmental temperature in the abnormal fermentation process, and is one of the main development directions of the fermentation monitoring parameter selection application.
Disclosure of Invention
The invention aims to: the method for screening the heat shock response molecular label yebE for evaluating escherichia coli based on the qRT-PCR technology provides a basis for realizing fermentation control of a microbial factory.
The technical scheme adopted by the invention is an creating method for screening a heat shock response molecular label yebE for evaluating escherichia coli based on qRT-PCR technology, and the creating method comprises the following steps:
(1) taking out an escherichia coli strain DH5 alpha stored in a refrigerator at the temperature of-80 ℃, streaking the escherichia coli strain DH5 alpha by an LB solid culture medium flat plate, culturing the escherichia coli strain at the temperature of 37 ℃ for 12 to 16 hours until a single colony appears, and storing the escherichia coli strain DH5 alpha at the temperature of 4 ℃;
(2) selecting single colony of DH5 alpha on solid culture medium, transferring into 15ml centrifuge tube, performing shake culture at 37 deg.C and 180rpm/minLB liquid culture medium for 8-10h to OD600The value is between 0.6 and 0.8, then 20ul of fresh bacterial liquid is added into 20ml of LB liquid culture medium, and the mixture is subjected to shaking culture at 37 ℃ and 180rpm/min for 6 to 8 hours until the OD is reached600The value is between 0.6 and 0.8, and 200ul of fresh bacterial liquid is taken for LB flat plate coating;
(3) coating fresh bacterial liquid obtained by continuous two-time culture on an LB flat plate, and treating for 45s under the condition of heat shock at 42 ℃;
(4) selecting 9 heat shock response regulation related genes such as alx, fepD, yebE, yqaE, yeaY, yfaZ, ydgC, ydiY, yccV and the like, designing qRT-PCR detection primers by using Primer5 software, and adopting 16srRNA as a housekeeping gene;
(5) by using
qRT-PCR detection of differential gene expression was performed with the Select Master Mix (ThermoFisher Scientific) kit;
(6) carrying out shake flask fermentation on the heat-resistant mutant strain and the wild strain at 45 ℃ for 6h, extracting and preparing total RNA and cDNA, carrying out second round expression detection on 5 genes such as yebE, yeaY, yfaZ, ydgC, yccV and the like obtained in the first round by using a qRT-PCR technology, and screening a heat shock response molecular tag gene yebE.
The invention has the beneficial effects that:
compared with the traditional fermentation monitoring method, the molecular label obtained by screening by the method has the advantages of high sensitivity, strong specificity, short detection period and the like. Compared with the traditional fermentation production, the qRT-PCR technology based on the molecular label can obtain the detection result within 1d, even within several hours; compared with the traditional monitoring method, the molecular label has the advantages of sensitivity, high efficiency, capability of directly reflecting the physiological change of the microorganism and the like.
The molecular label obtained by the method has high sensitivity and strong specificity, and can be popularized in microbial fermentation production.
Drawings
FIG. 1 shows the results of qRT-PCR detection screening of the first round of molecular marker genes
FIG. 2 shows the results of RT-PCR detection screening of the second round of molecular marker genes
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below, and the described embodiments are only a part of the embodiments of the present invention, but not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1 was carried out: culturing of bacterial strains
Taking out an escherichia coli strain DH5 alpha stored in a refrigerator at the temperature of minus 80 ℃, streaking an LB solid culture medium plate by using an inoculating needle on a super clean workbench, and culturing for 12h-16h at the temperature of 37 ℃ until a single colony appears; selecting single colony of DH5 alpha on solid culture medium, transferring into 15ml centrifuge tube, performing shake culture at 37 deg.C and 180rpm/minLB liquid culture medium for 8-10h to OD600The value is between 0.6 and 0.8, 20ul of fresh bacterial liquid is added into 20ml of LB liquid culture medium, and the mixture is subjected to shaking culture at 37 ℃ and 180rpm/min for 6 to 8 hours until the OD is reached600The value is between 0.6 and 0.8, then 200ul of fresh bacterial liquid is taken to carry out LB plate coating, and the bacterial liquid is cultured until single colony appears;
example 2 was carried out: heat shock treatment
Placing the obtained single colony flat plate in a water bath environment at 42 ℃ for heat shock treatment for 45 s;
example 3 of implementation: extraction and preparation of total RNA and cDNA of escherichia coli
Escherichia coli RNA was extracted using a bacterial RNA extraction Kit (OMEGA), and cDNA was prepared using a High-Capacity cDNA Reverse Transcriptase Kit (ABI) Kit. (1) The 2 × RT Master Mix reaction system was prepared in RNase-free centrifuge tubes and all manipulations were performed on ice. The reaction components of the reverse transcription are as follows: 10 × RT Buffer 2.0 μ L, 25 × dNTP Mix (100mM)0.8 μ L, 10 × RT Random Primers 2.0 μ L, MultiScript Reverse Transcriptase Transcriptase 1.0 μ L, Nuclease-free H2O 4.2.2 μ L; (2) after mixing the 2 × RT Master Mix reaction solution uniformly, it was placed on ice for further use. (3) Add 10. mu.L of RNA sample to the above mentioned RNase-free centrifuge tube, mix well and then centrifuge instantaneously. The reverse transcription conditions were: at 25 ℃ for 10 min; at 37 ℃ for 120 min; 5min at 85 ℃; 4 ℃ and infinity.
Example 4 of implementation: primer design
qRT-PCR Primer design was performed by using Primer5 software according to 9 heat shock response regulation related genes such as alx, fepD, yebE, yqaE, yeaY, yfaZ, ydgC, ydiY, yccV reported in literature, and the Primer sequences are shown in Table 1.
TABLE 1 fluorescent quantitative PCR primers
Example 5 was carried out: fluorescence quantification
By using
The Select Master Mix (ThermoFisher Scientific) kit was used for qRT-PCR detection of differential gene expression.
Example 7 was carried out: expression change of heat-resistant mutant strain molecular label in high-temperature stress process
Carrying out shake flask fermentation on the heat-resistant mutant strain and the wild strain at 45 ℃ for 6h, extracting and preparing total RNA and cDNA, carrying out second round expression quantity detection on 5 genes such as yebE, yeaY, yfaZ, ydgC, yccV and the like obtained in the first round by using a qRT-PCR technology, and screening a heat shock response molecular tag gene yebE.
Results
Analyzing E.coli differential expression genes subjected to heat shock treatment at 42 ℃ by utilizing a qRT-PCR technology, and screening 5 genes of yebE, yeaY, yfaZ, ydgC and yccV (shown in figure 1), wherein the genes have obvious expression changes in a high-temperature stress environment; taking a wild strain as a control, taking a heat shock shake flask fermentation heat-resistant mutant strain at 45 ℃ as a template, carrying out two rounds of qRT-PCR detection on 5 genes of yebE, yeaY, yfaZ, ydgC and yccV, and screening a target molecular label yebE (figure 2), wherein the label can sensitively respond to heat stress in a conventional strain and the heat-resistant strain, and has the characteristics of good stability and high sensitivity.
Sequence listing
<110> Guizhou university
<120> method for screening heat shock response molecular tag yebE of escherichia coli based on qRT-PCR technology
<160> 18
<210> 1
<211>18
<212> DNA
<213> Artificial Synthesis
<400> 1
CGTAAGAATGGCTTGCTG
<210> 2
<211>18
<212> DNA
<213> Artificial Synthesis
<400> 2
AATGAACGGGTCAGTGGT
<210> 3
<211>20
<212> DNA
<213> Artificial Synthesis
<400> 3
CTGGTAGCCTCGTTGATTGT
<210> 4
<211>22
<212> DNA
<213> Artificial Synthesis
<400> 4
GTAGACGTCAGGATTAAGCAGG
<210> 5
<211>20
<212> DNA
<213> Artificial Synthesis
<400> 5
GGTACGGTGCTGTGGAATAA
<210> 6
<211>21
<212> DNA
<213> Artificial Synthesis
<400> 6
CCATCACTTTTAGCGGCAAAG
<210> 7
<211>20
<212> DNA
<213> Artificial Synthesis
<400> 7
TCATCACCATCATTCTGCCG
<210> 8
<211>20
<212> DNA
<213> Artificial Synthesis
<400> 8
ACCCAAGCAGTGTCAACAG
<210> 9
<211>21
<212> DNA
<213> Artificial Synthesis
<400> 9
GGAAAACTCGCCTGGAAATTG
<210> 10
<211>21
<212> DNA
<213> Artificial Synthesis
<400> 10
CTACCGTAACCAGTTGTCCAC
<210> 11
<211>21
<212> DNA
<213> Artificial Synthesis
<400> 11
AGCGGTAACTGGACACATAAC
<210> 12
<211>20
<212> DNA
<213> Artificial Synthesis
<400> 12
ACCTTCATCGCCGTAATTCG
<210> 13
<211>20
<212> DNA
<213> Artificial Synthesis
<400> 13
TGATTCCACTTTTCCCGACC
<210> 14
<211>20
<212> DNA
<213> Artificial Synthesis
<400> 14
AATACCACAGCGACACCAG
<210> 15
<211>22
<212> DNA
<213> Artificial Synthesis
<400> 15
GCTTATGCATGGCAGTTGAC
<210> 16
<211>22
<212> DNA
<213> Artificial Synthesis
<400> 16
AGTTCAGCGTTGTGTCTTCC
<210> 17
<211>22
<212> DNA
<213> Artificial Synthesis
<400> 17
CTGTTAGGTTATCTCGGAGTGG
<210> 18
<211>18
<212> DNA
<213> Artificial Synthesis
<400> 18
ATTCACCGCCAGCTCATC
Claims (8)
1. The method for screening the heat shock response molecular label yebE of the escherichia coli based on the qRT-PCR technology is characterized by comprising the following steps: comprises the following steps:
(1) taking out the escherichia coli strain stored at low temperature, and performing streak activation culture on the escherichia coli strain by an LB solid culture medium plate until a single colony appears;
(2) continuously culturing the single escherichia coli colony with a liquid culture medium to a logarithmic growth phase, coating the single escherichia coli colony on an LB solid culture medium, and culturing until a single escherichia coli colony appears;
(3) placing the single colony flat plate in a heat shock treatment, and extracting and preparing total RNA and cDNA;
(4) designing fluorescent quantitative primers of 9 heat shock response regulation related genes of alx, fepD, yebE, yqaE, yeaY, yfaZ, ydgC, ydiY and yccV;
(5) detecting the expression quantity of each gene under heat shock by utilizing a qRT-PCR technology, and carrying out a first round of thermal response target gene screening;
(6) after heat stress culture is carried out on the heat-resistant mutant strain, total RNA and cDNA are extracted and prepared, the heat response target gene expression quantity obtained by the first round of screening is detected by utilizing the qRT-PCR technology, the heat response target gene screening is carried out for the second round, and the heat response molecular label gene yebE is screened.
2. The qRT-PCR based method for screening the heat shock response molecular label yebE of Escherichia coli according to claim 1, wherein: the culture condition of the Escherichia coli DH5 alpha in the step (1) is 37 ℃, and the shaking culture is carried out on LB liquid culture medium at the speed of 180rpm/min for 8-10 h.
3. The qRT-PCR based method for screening the heat shock response molecular label yebE of Escherichia coli according to claim 1, wherein: in the step (2), the Escherichia coli strain is continuously cultured for 2 times to logarithmic growth phase through LB liquid culture medium, OD600The value is between 0.6 and 0.8.
4. The qRT-PCR based method for screening the heat shock response molecular label yebE of Escherichia coli according to claim 1, wherein: and (3) taking an LB flat plate coated with fresh bacterial liquid obtained by two continuous cultures, and treating for 45s under the condition of heat shock at 42 ℃.
5. The qRT-PCR based method for screening the heat shock response molecular label yebE of Escherichia coli according to claim 1, wherein: in the step (4), qRT-PCR detection primers are designed by using Primer5 software, and 16srRNA is used as a housekeeping gene.
6. The qRT-PCR based method for screening the heat shock response molecular label yebE of Escherichia coli according to claim 1, wherein: in the step (5), the primer obtained in the step (4) is utilized to carry out a first round of qRT-PCR detection on the escherichia coli cDNA template heat-shocked for 45s at 42 ℃, and 5 genes of yebE, yeaY, yfaZ, ydgC and yccV are screened according to the change of the expression quantity.
7. The qRT-PCR based method for screening the heat shock response molecular label yebE of Escherichia coli according to claim 1, wherein: and (6) carrying out heat stress shake flask culture on the mutant heat-resistant strain and the wild strain at 45 ℃ for 6h, extracting and preparing total RNA and cDNA, carrying out second round expression detection on 5 genes obtained in the first round by using a qRT-PCR technology, and screening a heat shock response molecular label gene yebE.
8. Use of the molecular tag yebE according to any one of claims 1 to 7 in the heat shock response of E.coli.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011109238.XA CN112210592A (en) | 2020-10-16 | 2020-10-16 | Method for screening heat shock response molecular label yebE of escherichia coli based on qRT-PCR technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011109238.XA CN112210592A (en) | 2020-10-16 | 2020-10-16 | Method for screening heat shock response molecular label yebE of escherichia coli based on qRT-PCR technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112210592A true CN112210592A (en) | 2021-01-12 |
Family
ID=74055479
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011109238.XA Pending CN112210592A (en) | 2020-10-16 | 2020-10-16 | Method for screening heat shock response molecular label yebE of escherichia coli based on qRT-PCR technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112210592A (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5447858A (en) * | 1984-04-13 | 1995-09-05 | Mycogen Plant Sciences, Inc. | Heat shock promoter and gene |
| US20060134640A1 (en) * | 2003-04-22 | 2006-06-22 | Institut Pasteur | Inhibiting the growth of bacterial biofilms |
| CN101203529A (en) * | 2005-02-18 | 2008-06-18 | 诺华疫苗和诊断公司 | Proteins and nucleic acids from meningitis/sepsis-associated escherichia coli |
| US20120225453A1 (en) * | 2010-07-30 | 2012-09-06 | Withers Iii Sydnor T | Systems and methods for the secretion of recombinant proteins in gram negative bacteria |
| CN102978214A (en) * | 2011-08-30 | 2013-03-20 | 贵州大学 | Chicken-gamma-interferon gene sequence, recombinant engineering bacteria and application thereof |
| EP3209795A1 (en) * | 2014-10-22 | 2017-08-30 | Danmarks Tekniske Universitet | A two-cassette reporter system for assessing target gene translation and target gene product inclusion body formation |
| WO2018083692A1 (en) * | 2016-11-01 | 2018-05-11 | Tamar Levin | Novel methods for modulating protein expression in microorganisms |
-
2020
- 2020-10-16 CN CN202011109238.XA patent/CN112210592A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5447858A (en) * | 1984-04-13 | 1995-09-05 | Mycogen Plant Sciences, Inc. | Heat shock promoter and gene |
| US20060134640A1 (en) * | 2003-04-22 | 2006-06-22 | Institut Pasteur | Inhibiting the growth of bacterial biofilms |
| CN101203529A (en) * | 2005-02-18 | 2008-06-18 | 诺华疫苗和诊断公司 | Proteins and nucleic acids from meningitis/sepsis-associated escherichia coli |
| US20120225453A1 (en) * | 2010-07-30 | 2012-09-06 | Withers Iii Sydnor T | Systems and methods for the secretion of recombinant proteins in gram negative bacteria |
| CN102978214A (en) * | 2011-08-30 | 2013-03-20 | 贵州大学 | Chicken-gamma-interferon gene sequence, recombinant engineering bacteria and application thereof |
| EP3209795A1 (en) * | 2014-10-22 | 2017-08-30 | Danmarks Tekniske Universitet | A two-cassette reporter system for assessing target gene translation and target gene product inclusion body formation |
| WO2018083692A1 (en) * | 2016-11-01 | 2018-05-11 | Tamar Levin | Novel methods for modulating protein expression in microorganisms |
Non-Patent Citations (5)
| Title |
|---|
| NANCY L. PRICE等: "Characterization of the Cpx Regulon in Escherichia coli Strain MC4100", 《JOURNAL OF BACTERIOLOGY》 * |
| PETER DE WULF等: "Cpx Two-Component Signal Transduction in Escherichia coli: Excessive CpxR-P Levels Underlie CpxA Phenotypes", 《JOURNAL OF BACTERIOLOGY》 * |
| TOM E. P. KIMKES等: "Reassessing the role of the Escherichia coli CpxAR system in sensing surface contact", 《PLOS ONE》 * |
| 乐易林: "大肠杆菌热激反应研究及其在重组蛋白表达中的应用", 《微生物学通报》 * |
| 周辉等: "大肠杆菌应激诱导基因表达谱芯片分析", 《基因组学与应用生物学》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rochex et al. | Role of shear stress on composition, diversity and dynamics of biofilm bacterial communities | |
| Jansen et al. | Prolonged selection in aerobic, glucose-limited chemostat cultures of Saccharomyces cerevisiae causes a partial loss of glycolytic capacity | |
| Nagel et al. | Glossary for chemists of terms used in biotechnology (IUPAC Recommendations 1992) | |
| WO2004022698A2 (en) | Method for isolating and culturing unculturable microorganisms | |
| Hewitt et al. | A comparison of high cell density fed‐batch fermentations involving both induced and non‐induced recombinant Escherichia coli under well‐mixed small‐scale and simulated poorly mixed large‐scale conditions | |
| CN108977890B (en) | Promoter library and method for constructing expression systems with different intensities in bacteria by using same | |
| Baez et al. | Simulation of dissolved CO2 gradients in a scale‐down system: A metabolic and transcriptional study of recombinant Escherichia coli | |
| CN112430601B (en) | Cold resistance related gene of non-heading Chinese cabbage and application thereof | |
| Hewson et al. | Characteristics of diazotrophs in surface to abyssopelagic waters of the Sargasso Sea | |
| Konopka | Microbial physiological state at low growth rate in natural and engineered ecosystems | |
| Gore et al. | Real-time molecular beacon NASBA reveals hblC expression from Bacillus spp. in milk | |
| CN105755143B (en) | A kind of kit and detection method for being used to detect bacterium | |
| Mensonides et al. | The metabolic response of Saccharomyces cerevisiae to continuous heat stress | |
| CN112210592A (en) | Method for screening heat shock response molecular label yebE of escherichia coli based on qRT-PCR technology | |
| CN106011185A (en) | Method for improving glycollic acid yield in escherichia coli through gene-free knockout | |
| CN103805548B (en) | A kind of preparation method of novel competent cell and step of converting thereof | |
| CN110863033A (en) | Standard substance for quantitatively detecting microcystis and preparation and detection methods thereof | |
| CN113583931B (en) | Citrobacter williamsii ansB gene knockout mutant strain and application thereof | |
| Qi et al. | Transcriptional profiling of protein expression related genes of Pichia pastoris under simulated microgravity | |
| BRPI0615980A2 (en) | method of identifying genes that increase yeast stress tolerance to improve yeast efficiency | |
| Wawro | Improvement of acetic acid tolerance in Saccharomyces cerevisiae by novel genome shuffling | |
| CN104975086A (en) | Fast detection kit of aquatic product bacterial diseases, and application thereof | |
| Zuo et al. | Establishment and optimization of continuous culture system and application in the competition between toxic and non-toxic Microcystis | |
| Wu et al. | Quantitative analysis of predominant yeasts and volatile compounds in the process of pickled wax gourd | |
| CN106414743A (en) | Method for increasing biomass synthesis capacity of microorganisms and modified microorganisms therefrom |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210112 |