CN112175056B

CN112175056B - OsABCG48 gene and application thereof in improving cadmium stress resistance of unicellular organisms and plants

Info

Publication number: CN112175056B
Application number: CN202010958900.2A
Authority: CN
Inventors: 王昌虎; 蔡兴喆; 区永祥
Original assignee: South China Botanical Garden of CAS
Current assignee: South China Botanical Garden of CAS
Priority date: 2020-09-14
Filing date: 2020-09-14
Publication date: 2022-03-25
Anticipated expiration: 2040-09-14
Also published as: CN112175056A

Abstract

The invention discloses an OsABCG48 gene and application thereof in improving cadmium stress resistance of single-cell organisms and plants, wherein a rice OsABCG48 protein sequence is shown as SEQ ID NO.1 or a sequence which is subjected to substitution, deletion and/or addition of one or more amino acids and/or terminal modification and has the function of improving cadmium stress resistance of single-cell organisms and plants, and a gene coding the rice OsABCG48 protein is shown as SEQ ID NO. 2. According to the invention, the OsABCG48 gene is introduced into the unicellular organism and the plant, so that the overexpression of the OsABCG48 gene in the unicellular organism and the plant is found, and the cadmium stress resistance is improved. The OsABCG48 gene has extremely high development potential in the cultivation of new cadmium-resistant unicellular organism strains and new cadmium-resistant crop strains.

Description

OsABCG48 gene and application thereof in improving cadmium stress resistance of unicellular organisms and plants

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to application of an OsABCG48 gene in improvement of cadmium resistance of unicellular organisms and higher plants including crops.

Background

Cadmium (Cd) is a toxic heavy metal and is one of the most environmentally threatening pollutants and the most toxic to living cells. As a biological non-essential metal, it can replace other essential metals, and causes the problems of imbalance of ion homeostasis in the body, protein dysfunction, DNA and plasma membrane damage, accumulation of active oxygen, and the like after entering the human body. Cadmium is also a carcinogen, and accumulation of cadmium in the human body can lead to bone fragility and renal failure. Cadmium is mainly dependent on food intake. Cadmium has a long biological half-life in the kidney (about 10-30 years) and even long-term low dose intake can lead to chronic poisoning.

Existing studies indicate that plant-derived dietary Cd is the major route of ingestion. Cd in the polluted soil is absorbed by plants and then transferred to human bodies and livestock bodies. The leaf vegetables and grain foods are the main sources of cadmium intake of people. Some important crops, such as staple food rice and wheat, have cadmium pollution incidents, so the problem of cadmium metal absorption in soil is not easy to solve. In the existing method, soil remediation is mainly used as a treatment method for treating cadmium pollution in soil, but no matter soil cleaning or soil replacement, the method is useless for large-scale pollution, and the engineering quantity and huge cost of the method make the method basically not operable. And low-cadmium crop breeding is a relatively feasible measure at present. Therefore, there is a need to find new products, such as new resistance genes, to control the uptake of cadmium metal in soil by plants to help guide crop breeding practices with low cadmium accumulation.

Disclosure of Invention

The invention aims to provide rice OsABCG48 protein;

the invention also aims to provide a gene for coding the OsABCG48 protein of the corn rice;

the invention also aims to provide a recombinant vector, a recombinant bacterium or a transgenic cell line and a transgenic plant line containing the gene sequence;

the invention also aims to provide application of the rice OsABCG48 protein and the coding gene thereof in improving the cadmium stress resistance of single-cell organisms and plants.

The technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, there is provided:

the rice OsABCG48 protein contains an amino acid sequence shown in any one of the following (1) to (2):

(1) an amino acid sequence shown as SEQ ID NO. 1;

(2) the amino acid sequence shown in SEQ ID NO.1 is subjected to substitution, deletion and/or addition of one or more amino acids and/or terminal modification, and has a sequence for improving the cadmium stress resistance of single-cell organisms and plants.

Wherein the amino acid sequence (with the sequence length of 1480aa) shown in the SEQ ID NO.1 is:

massaeaaaamaaapsasgrrsmswgssisqsfrqaeaddpfgraasqqghdddeenlrwaaleklptydrmrrgvirtallhhdgggdgggaaaaakdgrmelvdiqklaagnlgralldrvfqddserflrrlrdridmvgielptievryeqlsiqaevfvgsralptltnaatnvlqgligrfgssnkrtinilqdvsgiikpsrmtlllgppssgkstlmraltgkldknlkvsgditycghtfsefypertsayvsqydlhnaemtvretldfsgrclgigarydmlaelarrernagikpdpeidafmkatavqghktnittdvtlkalgldicadiiigdemirgisggqkkrvttgemltgparalfmdeistgldssstfeivkyighlvhvmnetvmisllqpppetynlfddiillsegyivyhgprenileffenagfrcperkgiadflqevtskkdqqqywyhdqeryryvsvpefaqrfksfhvgqkmqkemqipydkssthpaaltttkyglssweslravmsrewllmkrnsfiyifkvtqliilafmsmtvflrtkmpsgtisdgtkflgaltfslitilfngfaelqltikklpvfykhrdflffpawtfgvanillkvpvslveaavwvvltyyvmgfapsagrffrqfiaffvthqmamamfrflgailktmvvantfgmfvllivfifggflisrndikpwwiwgywaspmmysqqaisineflasrwaipntdatideptvgkailkskglitsdggfwisigaligflvvfnilyilaltylspggssntivsdedsedktdmktrneqqmsqivhnngasntsatssipmsgsrstnqqsrsqivlpfqplslcfnhvnyyvdmptemkeqgftesrlqllsdisgvfrpgvltalvgvsgagkttlmdvlagrktsgviegditlsgypkkqetfarisgyceqtdihspnvtvyesilysawlrlssdvdtntrkmfvdevmslveldvlrnalvglpgvsglsteqrkrltiavelvanpsvifmdeptsgldaraaaivmrtvrntvntgrtvvctihqpsidifesfdellllkrggqviyagelgrhshklveyfeavpgvpkitegynpatwmlevtspiaearlnvnfaeiyanselyrknqelikelstpppgyqdlsfptkysqnfysqcianfwkqyrsywknppynamrylmtllnglvfgtvfwqkgtkissqqdlfnllgatyaatfflgaancitvqpvvsiertvfyreraagmysslsyafaqacveviynilqgilytiiiyamigydwkadkffyfmffivasfnyftlfgmmlvactpsamlanilisfvlplwnlfagflvvrplipiwwrwyywanpvswtiygvvasqfgkngdvlsvpggsptvvkqflednlgmrhsflgyvvlthfgyiivfffifgyaikyfnfqkr(SEQ ID NO.1)。

as the gene is a transporter and is likely to relate to cadmium transportation, namely, the transgenic plant is likely to show high cadmium accumulation or low cadmium accumulation, the OsABCG48 gene has extremely high application value in the aspect of cultivating a new strain of a single cell species or a new strain of a plant. If the OsABCG48 gene can cause low cadmium accumulation, the method can be used for breeding a low cadmium single cell new strain or plant, such as a low cadmium accumulation new variety breeding of crops; if the OsABCG48 gene causes high cadmium accumulation, the gene can be used for culturing a new unicellular strain or a new plant strain for removing cadmium pollution of water or soil.

Of course, the sequences with improved cadmium stress resistance of unicellular organisms and plants after substitution, deletion and/or addition of one or more amino acids and/or terminal modification of the amino acid sequence shown in SEQ ID NO.1 by any means in the art are also within the scope of the present invention.

In a second aspect of the present invention, there is provided:

the gene of the rice OsABCG48 protein is coded.

In the embodiment of the invention, the nucleotide sequence (with the sequence length of 4443bp) of the gene for coding the rice OsABCG48 protein is as follows:

5’-atggcgtcgtcggcggaggcggctgcggcgatggcggcggcgccgtcggcgagcgggcggcggagcatgagctgggggtcgtcgatctcgcagtcgttccggcaggcggaggcggacgacccgttcggtcgcgcggcgtcgcagcaggggcacgacgacgacgaggagaacctccggtgggcggcgctcgagaagctccccacctacgaccgcatgcgccgcggcgtcatccgcaccgcgctcctccatcacgacggcggcggcgacggcggcggcgcggcggcggcggcgaaggacgggaggatggagctcgtcgacatccagaagctcgccgccggcaacctcggccgcgcgctcctcgaccgcgtgttccaggacgacagcgagcgcttcctccgccgcctccgggaccgcatcgacatggtggggatcgagctgccgacgatcgaggtgaggtacgagcagctgtcgatccaggcggaggtgttcgtcggcagccgtgcgctgcccacgctcaccaacgccgccaccaacgtcctccagggtctcattggacgatttggttcttcaaataagaggaccattaacatactgcaagatgttagtggcatcatcaagccatccaggatgacacttcttcttgggcctccatcctcgggaaagagcacactaatgcgagcacttacagggaagcttgataaaaacctcaaggtgtccggcgacatcacatactgtggacacacattttctgagttctaccctgagaggaccagtgcatatgtcagtcagtatgatcttcataatgcagagatgactgtgagagagacattggatttctctgggcggtgcttaggcattggtgcaagatatgacatgctcgcggaactcgcgagaagggagcgcaatgcaggcattaagccagatcctgagatcgatgctttcatgaaagctactgcagtgcaagggcataaaactaacatcactacagatgttactctcaaggcacttgggttggacatttgtgctgatattattattggggatgagatgattagaggaatttctggtgggcaaaagaagcgtgtgacaacaggggagatgttaacgggaccagcacgggcattgttcatggatgaaatatccaccggtctagatagctctagcacatttgagattgtcaagtatattgggcatttggtccatgtgatgaatgagactgtgatgatatccctcctgcagccaccaccggagacctacaatctttttgatgacataattctactatcagaaggatatatagtctatcacggaccacgtgagaacatcttggaattcttcgaaaatgctggtttccgatgccctgaaaggaaaggaatcgctgatttccttcaagaggtcacttccaagaaagaccagcagcagtactggtaccatgaccaagaacggtatcggtatgtgtcagttccagagtttgcacaacgtttcaagtcattccatgtaggtcagaaaatgcagaaggagatgcaaattccttatgacaagtccagcacacatcctgctgcattgacaactaccaagtatgggctatccagttgggagtcactcagggcagtgatgtcaagagagtggttattgatgaagcgcaactccttcatctacattttcaaggtcacccagttgatcatccttgccttcatgtccatgactgtgttcctcagaacaaagatgcctagtgggacaatctctgatggcactaaattccttggggctctcacctttagtttgatcaccatcttgttcaatggctttgctgagctacaactgaccataaagaagcttcctgtgttctacaaacatagagatttcttgttcttccctgcatggacctttggagtagcaaatatcctcttgaaagttcctgtttctcttgtagaggcggcggtatgggttgtgctcacatactatgtgatggggtttgcaccctctgcaggaaggttctttcgtcaatttatagctttctttgttactcaccaaatggcaatggctatgttccgatttcttggtgctattttgaaaacaatggttgtggccaatacttttgggatgtttgtgctgcttattgtcttcatttttggaggatttctcatatctagaaatgacatcaagccatggtggatttggggttactgggcatctcctatgatgtatagtcaacaagcaatatcaatcaatgagttccttgctagtagatgggctattccaaatactgatgcaacaattgatgagccaactgttggcaaggctattctcaaatccaaaggcttgattactagtgatggggggttttggatttccattggagcccttataggattccttgttgtgttcaatatcttatacattttggcccttacatacttgagtcctggtggcagctcaaacacaatagtttcagatgaagatagtgaagataagacggacatgaaaacaagaaatgaacaacaaatgtcccaaattgtacacaataatggagctagtaatacatctgcaacatcgtcaatccccatgagtggaagcagatcaacaaatcagcaaagtagatcacaaattgtcttgcctttccaacccctttcactttgtttcaaccatgtaaactactatgtggatatgccaacagaaatgaaagagcaaggattcacagaaagccgtctccagttactatctgatatcagtggagttttcagaccaggtgttttgacagcattagttggtgtaagtggagctggcaagaccaccctaatggatgtcttagcaggaaggaaaacaagtggagtaattgaaggagacatcaccctctctggttatccaaagaaacaagaaacttttgcacgcattagtggttactgtgaacagactgatattcattcaccaaatgttactgtctatgaatccattctctactctgcttggctacgtctttcgtcagatgttgacaccaatacgaggaagatgttcgtggatgaagtcatgtcccttgtagagcttgatgtgttacgtaatgctttggtgggtcttcctggagttagtggtttatcaactgaacagagaaagaggctcacaattgcagtggagttggtagcaaacccttcagtaatattcatggatgagccaacttctggacttgatgctagagctgcagcaattgtcatgcgaaccgtgagaaataccgtcaacacgggacgcactgtggtttgcacaattcatcaacccagcatcgatatttttgagtcttttgatgagcttttgctattgaaaaggggagggcaagttatttatgctggtgaactcggccgccactcccataaactagttgaatattttgaggcagttccaggtgttccaaagataacagaaggatataatcctgcaacatggatgctagaagtcacctcccctatagctgaggctcgtcttaatgtaaattttgctgaaatttatgctaattctgagctttataggaaaaaccaagagctaatcaaggaattgagcactcccccaccaggatatcaagatctctcatttcctacaaagtattctcaaaatttctatagtcaatgcattgcaaacttttggaagcaatatcgttcttattggaagaatccaccatacaatgccatgcgctatcttatgacattgctcaatggccttgtctttggcacggtattttggcaaaaaggaactaagatatcatcacaacaagatttgttcaatttgcttggagccacttatgctgcaactttcttccttggggctgccaattgtatcacagttcaacctgttgtttccatcgaaagaacagtcttctaccgcgaaagggcagcagggatgtactcttcattgtcctatgcatttgctcaggcatgcgtggaggtcatctacaacatcttacaggggattctatacactattatcatctatgcaatgattggatatgactggaaagccgacaaattcttctatttcatgttctttattgtagcaagtttcaactacttcacattgtttgggatgatgttggtggcatgcaccccatctgcaatgcttgcaaacattctcatatcctttgtacttcctctctggaatctttttgctgggttcctcgttgttaggccgttgataccgatttggtggaggtggtactactgggcaaaccccgtgtcatggaccatctatggtgttgtggcgtcacagtttggtaaaaatggtgatgttctttcggttcccggtgggagccctacggtagtgaagcaattcttggaggacaacctagggatgcggcatagtttcctaggatatgttgtgctcacacattttggctacatcatcgttttcttcttcatctttggctatgccatcaagtacttcaacttccagaaacgatag-3’(SEQ ID NO.2)。

the invention clones OsABCG48 gene from rice. When it is overexpressed in unicellular organisms and plants, resistance to cadmium stress can be specifically enhanced without altering resistance to other divalent metal elements (e.g., copper and manganese, etc.). Therefore, the gene has the capability of improving the cadmium stress resistance of single-cell organisms (yeast and the like) and plants, particularly crops, and is expected to be used for cadmium resistance research of the single-cell organisms and the plants and breeding of new varieties of the crops related to the increase of the cadmium resistance.

In a third aspect of the present invention, there is provided:

recombinant vector, recombinant bacteria or transgenic cell line, transgenic plant line containing the gene sequence.

In a fourth aspect of the present invention, there is provided:

application of rice OsABCG48 protein and coding gene thereof in improving cadmium stress resistance of unicellular organisms and plants.

Furthermore, the unicellular organism comprises engineering bacteria such as yeast and escherichia coli.

Overexpression of OsABCG48 can enhance the resistance of yeast to diamide diamides and cadmium. Because the chemical diamide is able to directly induce an oxidation reaction, it is likely that osacg 48 plays a role in an oxidative stress response mechanism and a cadmium stress response mechanism.

Further, the yeast is Schizosaccharomyces.

Further, the above plants include Arabidopsis thaliana and crops which are conventional in the art.

The invention has the beneficial effects that:

1. the OsABCG48 gene is overexpressed in single-cell organisms and plants, so that the cadmium stress resistance of the single-cell organisms and the plants is improved, the copper and manganese stress resistance is not changed, and the OsABCG48 gene has obvious specificity;

2. the sequence consistency of the OsABCG48 gene and other ABCG genes is low, and the invention provides a new cadmium-resistant strain of unicellular organisms and a new cadmium-resistant crop strain cultured by using the OsABCG48 gene for the first time;

ABC transporters (ATP-binding cassette transporters) are a class of membrane-integrated superfamily of transporters that occur widely in all organisms and function in substance transport across membranes during organism physiology and development. This superfamily can be subdivided into 8 subfamilies from ABCA to ABCH. The inventor screens an ABCG subfamily member OsABCG48 gene by using an RNAseq technology, and the overexpression of the gene in the fission yeast of the unicellular organism and the plant Arabidopsis can obviously improve the resistance to cadmium stress, which shows that the growth inhibition on the unicellular organism and the higher plant caused by the cadmium stress can be effectively removed.

Drawings

FIG. 1 is an agarose gel electrophoresis image of the OsABCG48 clone by PCR verification;

FIG. 2 is a WEBSEQUENCE TWHMM posterior probability chart of OsABCG48 protein;

FIG. 3 is a diagram of an ABCG subfamily developmental tree;

FIG. 4 is a graph showing the effect of OsABCG48 and the blank vector EV on the resistance to diamide diamides and cadmium in yeast;

FIG. 5 shows the growth under normal growth conditions (0. mu.M CdCl)₂) And with CdCl₂(50. mu.M) after 2 weeks of treatment, Col-0 wild type Arabidopsis and homozygote line growth status picture (A); under normal growth conditions (0. mu.M CdCl)₂) And with CdCl₂(50. mu.M) after 2 weeks of treatment, the root length of wild type Arabidopsis Col-0 and homozygote lines are compared in the histogram (B).

FIG. 6 is a picture of the growth of Col-0 wild type Arabidopsis and homozygote lines under different copper and manganese stress conditions 2 weeks after copper and manganese stress treatment.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.

Test materials

The unicellular organisms used in the examples below were all yeasts, in particular Schizosaccharomyces (Schizosaccharomyces pombe) JS 23; the plants used in the following examples were all wild type Arabidopsis thaliana (Arabidopsis thaliana) which all adopted Columbia (Col-0) ecotype; the wild rice (Oryza sativa sp Japonica) is adopted as "Zhonghua 11" of Japonica rice.

Cloning and primer design of rice OSABCG48 gene

Taking a japonica rice variety 'Zhonghua 11' as a material to extract total RNA, and carrying out reverse transcription to obtain cDNA. The cDNA is used as a template, and a primer is designed to obtain an OsABCG48 gene primer group.

The nucleotide sequence of the OsABCG48 gene primer group is as follows:

OsABCG48-F：5’-ATGGCGTCGTCGGCGGC-3’(SEQ ID NO.3)；

OsABCG48-R：5’-CTATCGTTTCTGGAAGTTGAAGTACTTGATG-3’(SEQ ID NO.4)。

and cloning to obtain the coding region OsABCG48 of the complete OsABCG48 gene by taking the cDNA obtained by the reverse transcription as a template.

The OsABCG48 amino acid sequence is as follows:

the corresponding OsABCG48 nucleotide sequence for coding the protein is as follows: 5'-atggcgtcgtcggcggaggcggctgcggcgatggcggcggcgccgtcggcgagcgggcggcggagcatgagctgggggtcgtcgatctcgcagtcgttccggcaggcggaggcggacgacccgttcggtcgcgcggcgtcgcagcaggggcacgacgacgacgaggagaacctccggtgggcggcgctcgagaagctccccacctacgaccgcatgcgccgcggcgtcatccgcaccgcgctcctccatcacgacggcggcggcgacggcggcggcgcggcggcggcggcgaaggacgggaggatggagctcgtcgacatccagaagctcgccgccggcaacctcggccgcgcgctcctcgaccgcgtgttccaggacgacagcgagcgcttcctccgccgcctccgggaccgcatcgacatggtggggatcgagctgccgacgatcgaggtgaggtacgagcagctgtcgatccaggcggaggtgttcgtcggcagccgtgcgctgcccacgctcaccaacgccgccaccaacgtcctccagggtctcattggacgatttggttcttcaaataagaggaccattaacatactgcaagatgttagtggcatcatcaagccatccaggatgacacttcttcttgggcctccatcctcgggaaagagcacactaatgcgagcacttacagggaagcttgataaaaacctcaaggtgtccggcgacatcacatactgtggacacacattttctgagttctaccctgagaggaccagtgcatatgtcagtcagtatgatcttcataatgcagagatgactgtgagagagacattggatttctctgggcggtgcttaggcattggtgcaagatatgacatgctcgcggaactcgcgagaagggagcgcaatgcaggcattaagccagatcctgagatcgatgctttcatgaaagctactgcagtgcaagggcataaaactaacatcactacagatgttactctcaaggcacttgggttggacatttgtgctgatattattattggggatgagatgattagaggaatttctggtgggcaaaagaagcgtgtgacaacaggggagatgttaacgggaccagcacgggcattgttcatggatgaaatatccaccggtctagatagctctagcacatttgagattgtcaagtatattgggcatttggtccatgtgatgaatgagactgtgatgatatccctcctgcagccaccaccggagacctacaatctttttgatgacataattctactatcagaaggatatatagtctatcacggaccacgtgagaacatcttggaattcttcgaaaatgctggtttccgatgccctgaaaggaaaggaatcgctgatttccttcaagaggtcacttccaagaaagaccagcagcagtactggtaccatgaccaagaacggtatcggtatgtgtcagttccagagtttgcacaacgtttcaagtcattccatgtaggtcagaaaatgcagaaggagatgcaaattccttatgacaagtccagcacacatcctgctgcattgacaactaccaagtatgggctatccagttgggagtcactcagggcagtgatgtcaagagagtggttattgatgaagcgcaactccttcatctacattttcaaggtcacccagttgatcatccttgccttcatgtccatgactgtgttcctcagaacaaagatgcctagtgggacaatctctgatggcactaaattccttggggctctcacctttagtttgatcaccatcttgttcaatggctttgctgagctacaactgaccataaagaagcttcctgtgttctacaaacatagagatttcttgttcttccctgcatggacctttggagtagcaaatatcctcttgaaagttcctgtttctcttgtagaggcggcggtatgggttgtgctcacatactatgtgatggggtttgcaccctctgcaggaaggttctttcgtcaatttatagctttctttgttactcaccaaatggcaatggctatgttccgatttcttggtgctattttgaaaacaatggttgtggccaatacttttgggatgtttgtgctgcttattgtcttcatttttggaggatttctcatatctagaaatgacatcaagccatggtggatttggggttactgggcatctcctatgatgtatagtcaacaagcaatatcaatcaatgagttccttgctagtagatgggctattccaaatactgatgcaacaattgatgagccaactgttggcaaggctattctcaaatccaaaggcttgattactagtgatggggggttttggatttccattggagcccttataggattccttgttgtgttcaatatcttatacattttggcccttacatacttgagtcctggtggcagctcaaacacaatagtttcagatgaagatagtgaagataagacggacatgaaaacaagaaatgaacaacaaatgtcccaaattgtacacaataatggagctagtaatacatctgcaacatcgtcaatccccatgagtggaagcagatcaacaaatcagcaaagtagatcacaaattgtcttgcctttccaacccctttcactttgtttcaaccatgtaaactactatgtggatatgccaacagaaatgaaagagcaaggattcacagaaagccgtctccagttactatctgatatcagtggagttttcagaccaggtgttttgacagcattagttggtgtaagtggagctggcaagaccaccctaatggatgtcttagcaggaaggaaaacaagtggagtaattgaaggagacatcaccctctctggttatccaaagaaacaagaaacttttgcacgcattagtggttactgtgaacagactgatattcattcaccaaatgttactgtctatgaatccattctctactctgcttggctacgtctttcgtcagatgttgacaccaatacgaggaagatgttcgtggatgaagtcatgtcccttgtagagcttgatgtgttacgtaatgctttggtgggtcttcctggagttagtggtttatcaactgaacagagaaagaggctcacaattgcagtggagttggtagcaaacccttcagtaatattcatggatgagccaacttctggacttgatgctagagctgcagcaattgtcatgcgaaccgtgagaaataccgtcaacacgggacgcactgtggtttgcacaattcatcaacccagcatcgatatttttgagtcttttgatgagcttttgctattgaaaaggggagggcaagttatttatgctggtgaactcggccgccactcccataaactagttgaatattttgaggcagttccaggtgttccaaagataacagaaggatataatcctgcaacatggatgctagaagtcacctcccctatagctgaggctcgtcttaatgtaaattttgctgaaatttatgctaattctgagctttataggaaaaaccaagagctaatcaaggaattgagcactcccccaccaggatatcaagatctctcatttcctacaaagtattctcaaaatttctatagtcaatgcattgcaaacttttggaagcaatatcgttcttattggaagaatccaccatacaatgccatgcgctatcttatgacattgctcaatggccttgtctttggcacggtattttggcaaaaaggaactaagatatcatcacaacaagatttgttcaatttgcttggagccacttatgctgcaactttcttccttggggctgccaattgtatcacagttcaacctgttgtttccatcgaaagaacagtcttctaccgcgaaagggcagcagggatgtactcttcattgtcctatgcatttgctcaggcatgcgtggaggtcatctacaacatcttacaggggattctatacactattatcatctatgcaatgattggatatgactggaaagccgacaaattcttctatttcatgttctttattgtagcaagtttcaactacttcacattgtttgggatgatgttggtggcatgcaccccatctgcaatgcttgcaaacattctcatatcctttgtacttcctctctggaatctttttgctgggttcctcgttgttaggccgttgataccgatttggtggaggtggtactactgggcaaaccccgtgtcatggaccatctatggtgttgtggcgtcacagtttggtaaaaatggtgatgttctttcggttcccggtgggagccctacggtagtgaagcaattcttggaggacaacctagggatgcggcatagtttcctaggatatgttgtgctcacacattttggctacatcatcgttttcttcttcatctttggctatgccatcaagtacttcaacttccagaaacgatag-3' (SEQ ID NO. 2).

The OsABCG48 gene obtained by cloning is amplified by using an OsABCG48 gene primer group and adopting a High-Fidelity DNA Polymerase PCR reaction system, 5 mu L of PCR amplification product is taken to be analyzed and detected in 1% agarose gel electrophoresis, the result is shown in figure 1, the OsABCG48 gene obtained by cloning is confirmed to be real and effective, a T vector (pMD-18) is transferred, and sequencing verification is carried out to confirm that the OsABCG48 gene is the OsABCG48 gene.

Rice OsABCG48 protein and characteristic comparison test with other ABCG genes

The OsABCG48 protein obtained by the cloning is compared with OsABCG43 and OsABCG36 genes.

As shown in a typical model of ABC protein in figure 2, OsABCG48 is a transmembrane protein and consists of two subunits, each subunit is provided with 6 transmembrane domains, the total number of the transmembrane domains is 12, the family characteristics of a typical ABC transporter are realized, the OsABCG48 gene belongs to an ABC superfamily gene and can be further divided into 8 subfamilies, and the OsABCG48 belongs to an ABCG subfamily, and as can be seen from figure 3, the OsABCG48 has relatively close homology with OsABCG43 and is far away from OsABCG 36. BLAST alignment shows that the sequence consistency among the three is less than 75 percent and can reach 56.6 percent at the lowest, and only OsABCG48 is found that the overexpression phenotype shows cadmium stress resistance, and other two genes lack related research data.

Test of influence of OsABCG48 gene on cadmium stress resistance of unicellular organism

The OsABCG48 is cloned into a yeast expression vector pART1, the fission yeast JS23 is transformed, after the transformation is successful, 3-5 fission yeast JS23 with consistent growth state and moderate size are selected to be singly cloned into 3ml EMM liquid screening culture Medium (Edinburgh Minimal Medium), and the mixture is fully dispersed and uniformly mixed. The culture was carried out overnight at 30 ℃ and 250 rpm. The Schizosaccharomyces cerevisiae JS23 mother liquor cultured overnight is diluted to OD₆₀₀To 0.15. Further culturing at 250rpm and 30 deg.C for 4-5 hr to obtain OD₆₀₀Up to about 0.3. Respectively diluting the Schizosaccharomyces cerevisiae JS23 mother liquor to concentration gradients of 1/10, 1/100 and 1/1000, and sequentially dripping 3 mu L of solution to the solution containing CdCl with different concentrations₂EMM solid screening media (0mM, 0.5mM) and diamide (0mM and 2.0mM) against the blank vector (EV). The culture was inverted at 30 ℃ for 5 to 7 days, and the results were observed and compared.

As shown in FIG. 4, overexpression of OsABCG48 in Schizosaccharomyces cerevisiae JS23 enhanced yeast resistance to diamide and cadmium. Because the chemical diamide is able to directly induce an oxidation reaction, it is likely that osacg 48 plays a role in an oxidative stress response mechanism and a cadmium stress response mechanism. Therefore, the OsABCG48 has the capability of improving the cadmium resistance of single-cell organisms (yeast, escherichia coli and the like), and is expected to be used for culturing new cadmium-resistant strains of the single-cell organisms.

Test of influence of OsABCG48 gene on cadmium stress resistance of plants

Wild type Arabidopsis seeds were washed 4 times with sterile water for 5 minutes each. Then putting the seeds into a refrigerator at 4 ℃ for vernalization for 3 days, and sowing the vernalized arabidopsis seeds in nutrient-containing soil: in a seedling pot of vermiculite (volume ratio 1: 1), watering and culturing periodically until flowering, and using the plant for subsequent gene transformation.

An expression vector pSUPER carrying the OsABCG48 gene was introduced into Agrobacterium tumefaciens GV3101 by electroporation. Agrobacterium colonies resistant to rifampicin and kanamycin were screened and colony PCR validation was performed using the primer set designed above to ensure successful introduction of the osabccg 48 gene. And (3) carrying out shake propagation to obtain a positive colony, carrying out dip-dyeing on the arabidopsis thaliana florets by using a dip-dyeing method, carrying out gene transformation, and using the transformed arabidopsis thaliana to obtain T0 generation seeds.

Planting T0 generation seeds on an 1/2-concentration MS culture medium containing 35 mu g/ml hygromycin, screening T1 generation seedlings, taking leaves of T1 generation and wild type arabidopsis Col-0 plants to extract DNA, carrying out PCR identification by taking wild type arabidopsis as negative control, selecting positive transgenic plants to obtain 10T 1 generation transgenic plants, and further breeding the 10T 1 generation transgenic plants to obtain progeny T2 and T3 groups. Screening to obtain the single-site insertion homozygote strain of the transgenic arabidopsis thaliana by analyzing segregation ratio of transgenes in T2 and T3 progeny populations. From these, 3 homozygote strains were randomly selected as materials for subsequent studies for cadmium-resistance detection.

And (3) carrying out RT-qPCR detection on randomly selected 3 homozygote strains, and confirming that the transgenic strains all realize the overexpression of the OsABCG43 gene. The homozygote line was subjected to cadmium stress treatment (with wild type Arabidopsis thaliana as control, 0. mu.M and 50. mu.M CdCl were applied, respectively₂). As shown in FIG. 5, under normal growth conditions (0. mu.M CdCl)₂) The growth conditions of Col-0 wild type Arabidopsis and the homozygote strain are consistent. When using CdCl₂After 2 weeks of treatment (50. mu.M), the roots of the homozygote lines were significantly longer than wild type, an increase of 42% over the wild type control. The stress treatment of copper and manganese was carried out using the same lines and using the same method, and the results showed that the homozygote lines were not different from the control (wild type) (FIG. 6).

The experimental results show that the cadmium stress resistance of the arabidopsis thaliana can be specifically enhanced by over-expressing the OsABCG48 gene in the arabidopsis thaliana. Therefore, the OsABCG48 gene has the capability of improving the cadmium resistance of plants, and is expected to be used for the molecular mechanism research of biological cadmium resistance and the breeding of related new crop lines.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> south China plant garden of Chinese academy of sciences

<120> OsABCG48 gene and application thereof in improving cadmium stress resistance of unicellular organisms and plants

<130>

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 1480

<212> PRT

<213> OsABCG48

<400> 1

Met Ala Ser Ser Ala Glu Ala Ala Ala Ala Met Ala Ala Ala Pro Ser

1 5 10 15

Ala Ser Gly Arg Arg Ser Met Ser Trp Gly Ser Ser Ile Ser Gln Ser

20 25 30

Phe Arg Gln Ala Glu Ala Asp Asp Pro Phe Gly Arg Ala Ala Ser Gln

35 40 45

Gln Gly His Asp Asp Asp Glu Glu Asn Leu Arg Trp Ala Ala Leu Glu

50 55 60

Lys Leu Pro Thr Tyr Asp Arg Met Arg Arg Gly Val Ile Arg Thr Ala

65 70 75 80

Leu Leu His His Asp Gly Gly Gly Asp Gly Gly Gly Ala Ala Ala Ala

85 90 95

Ala Lys Asp Gly Arg Met Glu Leu Val Asp Ile Gln Lys Leu Ala Ala

100 105 110

Gly Asn Leu Gly Arg Ala Leu Leu Asp Arg Val Phe Gln Asp Asp Ser

115 120 125

Glu Arg Phe Leu Arg Arg Leu Arg Asp Arg Ile Asp Met Val Gly Ile

130 135 140

Glu Leu Pro Thr Ile Glu Val Arg Tyr Glu Gln Leu Ser Ile Gln Ala

145 150 155 160

Glu Val Phe Val Gly Ser Arg Ala Leu Pro Thr Leu Thr Asn Ala Ala

165 170 175

Thr Asn Val Leu Gln Gly Leu Ile Gly Arg Phe Gly Ser Ser Asn Lys

180 185 190

Arg Thr Ile Asn Ile Leu Gln Asp Val Ser Gly Ile Ile Lys Pro Ser

195 200 205

Arg Met Thr Leu Leu Leu Gly Pro Pro Ser Ser Gly Lys Ser Thr Leu

210 215 220

Met Arg Ala Leu Thr Gly Lys Leu Asp Lys Asn Leu Lys Val Ser Gly

225 230 235 240

Asp Ile Thr Tyr Cys Gly His Thr Phe Ser Glu Phe Tyr Pro Glu Arg

245 250 255

Thr Ser Ala Tyr Val Ser Gln Tyr Asp Leu His Asn Ala Glu Met Thr

260 265 270

Val Arg Glu Thr Leu Asp Phe Ser Gly Arg Cys Leu Gly Ile Gly Ala

275 280 285

Arg Tyr Asp Met Leu Ala Glu Leu Ala Arg Arg Glu Arg Asn Ala Gly

290 295 300

Ile Lys Pro Asp Pro Glu Ile Asp Ala Phe Met Lys Ala Thr Ala Val

305 310 315 320

Gln Gly His Lys Thr Asn Ile Thr Thr Asp Val Thr Leu Lys Ala Leu

325 330 335

Gly Leu Asp Ile Cys Ala Asp Ile Ile Ile Gly Asp Glu Met Ile Arg

340 345 350

Gly Ile Ser Gly Gly Gln Lys Lys Arg Val Thr Thr Gly Glu Met Leu

355 360 365

Thr Gly Pro Ala Arg Ala Leu Phe Met Asp Glu Ile Ser Thr Gly Leu

370 375 380

Asp Ser Ser Ser Thr Phe Glu Ile Val Lys Tyr Ile Gly His Leu Val

385 390 395 400

His Val Met Asn Glu Thr Val Met Ile Ser Leu Leu Gln Pro Pro Pro

405 410 415

Glu Thr Tyr Asn Leu Phe Asp Asp Ile Ile Leu Leu Ser Glu Gly Tyr

420 425 430

Ile Val Tyr His Gly Pro Arg Glu Asn Ile Leu Glu Phe Phe Glu Asn

435 440 445

Ala Gly Phe Arg Cys Pro Glu Arg Lys Gly Ile Ala Asp Phe Leu Gln

450 455 460

Glu Val Thr Ser Lys Lys Asp Gln Gln Gln Tyr Trp Tyr His Asp Gln

465 470 475 480

Glu Arg Tyr Arg Tyr Val Ser Val Pro Glu Phe Ala Gln Arg Phe Lys

485 490 495

Ser Phe His Val Gly Gln Lys Met Gln Lys Glu Met Gln Ile Pro Tyr

500 505 510

Asp Lys Ser Ser Thr His Pro Ala Ala Leu Thr Thr Thr Lys Tyr Gly

515 520 525

Leu Ser Ser Trp Glu Ser Leu Arg Ala Val Met Ser Arg Glu Trp Leu

530 535 540

Leu Met Lys Arg Asn Ser Phe Ile Tyr Ile Phe Lys Val Thr Gln Leu

545 550 555 560

Ile Ile Leu Ala Phe Met Ser Met Thr Val Phe Leu Arg Thr Lys Met

565 570 575

Pro Ser Gly Thr Ile Ser Asp Gly Thr Lys Phe Leu Gly Ala Leu Thr

580 585 590

Phe Ser Leu Ile Thr Ile Leu Phe Asn Gly Phe Ala Glu Leu Gln Leu

595 600 605

Thr Ile Lys Lys Leu Pro Val Phe Tyr Lys His Arg Asp Phe Leu Phe

610 615 620

Phe Pro Ala Trp Thr Phe Gly Val Ala Asn Ile Leu Leu Lys Val Pro

625 630 635 640

Val Ser Leu Val Glu Ala Ala Val Trp Val Val Leu Thr Tyr Tyr Val

645 650 655

Met Gly Phe Ala Pro Ser Ala Gly Arg Phe Phe Arg Gln Phe Ile Ala

660 665 670

Phe Phe Val Thr His Gln Met Ala Met Ala Met Phe Arg Phe Leu Gly

675 680 685

Ala Ile Leu Lys Thr Met Val Val Ala Asn Thr Phe Gly Met Phe Val

690 695 700

Leu Leu Ile Val Phe Ile Phe Gly Gly Phe Leu Ile Ser Arg Asn Asp

705 710 715 720

Ile Lys Pro Trp Trp Ile Trp Gly Tyr Trp Ala Ser Pro Met Met Tyr

725 730 735

Ser Gln Gln Ala Ile Ser Ile Asn Glu Phe Leu Ala Ser Arg Trp Ala

740 745 750

Ile Pro Asn Thr Asp Ala Thr Ile Asp Glu Pro Thr Val Gly Lys Ala

755 760 765

Ile Leu Lys Ser Lys Gly Leu Ile Thr Ser Asp Gly Gly Phe Trp Ile

770 775 780

Ser Ile Gly Ala Leu Ile Gly Phe Leu Val Val Phe Asn Ile Leu Tyr

785 790 795 800

Ile Leu Ala Leu Thr Tyr Leu Ser Pro Gly Gly Ser Ser Asn Thr Ile

805 810 815

Val Ser Asp Glu Asp Ser Glu Asp Lys Thr Asp Met Lys Thr Arg Asn

820 825 830

Glu Gln Gln Met Ser Gln Ile Val His Asn Asn Gly Ala Ser Asn Thr

835 840 845

Ser Ala Thr Ser Ser Ile Pro Met Ser Gly Ser Arg Ser Thr Asn Gln

850 855 860

Gln Ser Arg Ser Gln Ile Val Leu Pro Phe Gln Pro Leu Ser Leu Cys

865 870 875 880

Phe Asn His Val Asn Tyr Tyr Val Asp Met Pro Thr Glu Met Lys Glu

885 890 895

Gln Gly Phe Thr Glu Ser Arg Leu Gln Leu Leu Ser Asp Ile Ser Gly

900 905 910

Val Phe Arg Pro Gly Val Leu Thr Ala Leu Val Gly Val Ser Gly Ala

915 920 925

Gly Lys Thr Thr Leu Met Asp Val Leu Ala Gly Arg Lys Thr Ser Gly

930 935 940

Val Ile Glu Gly Asp Ile Thr Leu Ser Gly Tyr Pro Lys Lys Gln Glu

945 950 955 960

Thr Phe Ala Arg Ile Ser Gly Tyr Cys Glu Gln Thr Asp Ile His Ser

965 970 975

Pro Asn Val Thr Val Tyr Glu Ser Ile Leu Tyr Ser Ala Trp Leu Arg

980 985 990

Leu Ser Ser Asp Val Asp Thr Asn Thr Arg Lys Met Phe Val Asp Glu

995 1000 1005

Val Met Ser Leu Val Glu Leu Asp Val Leu Arg Asn Ala Leu Val

1010 1015 1020

Gly Leu Pro Gly Val Ser Gly Leu Ser Thr Glu Gln Arg Lys Arg

1025 1030 1035

Leu Thr Ile Ala Val Glu Leu Val Ala Asn Pro Ser Val Ile Phe

1040 1045 1050

Met Asp Glu Pro Thr Ser Gly Leu Asp Ala Arg Ala Ala Ala Ile

1055 1060 1065

Val Met Arg Thr Val Arg Asn Thr Val Asn Thr Gly Arg Thr Val

1070 1075 1080

Val Cys Thr Ile His Gln Pro Ser Ile Asp Ile Phe Glu Ser Phe

1085 1090 1095

Asp Glu Leu Leu Leu Leu Lys Arg Gly Gly Gln Val Ile Tyr Ala

1100 1105 1110

Gly Glu Leu Gly Arg His Ser His Lys Leu Val Glu Tyr Phe Glu

1115 1120 1125

Ala Val Pro Gly Val Pro Lys Ile Thr Glu Gly Tyr Asn Pro Ala

1130 1135 1140

Thr Trp Met Leu Glu Val Thr Ser Pro Ile Ala Glu Ala Arg Leu

1145 1150 1155

Asn Val Asn Phe Ala Glu Ile Tyr Ala Asn Ser Glu Leu Tyr Arg

1160 1165 1170

Lys Asn Gln Glu Leu Ile Lys Glu Leu Ser Thr Pro Pro Pro Gly

1175 1180 1185

Tyr Gln Asp Leu Ser Phe Pro Thr Lys Tyr Ser Gln Asn Phe Tyr

1190 1195 1200

Ser Gln Cys Ile Ala Asn Phe Trp Lys Gln Tyr Arg Ser Tyr Trp

1205 1210 1215

Lys Asn Pro Pro Tyr Asn Ala Met Arg Tyr Leu Met Thr Leu Leu

1220 1225 1230

Asn Gly Leu Val Phe Gly Thr Val Phe Trp Gln Lys Gly Thr Lys

1235 1240 1245

Ile Ser Ser Gln Gln Asp Leu Phe Asn Leu Leu Gly Ala Thr Tyr

1250 1255 1260

Ala Ala Thr Phe Phe Leu Gly Ala Ala Asn Cys Ile Thr Val Gln

1265 1270 1275

Pro Val Val Ser Ile Glu Arg Thr Val Phe Tyr Arg Glu Arg Ala

1280 1285 1290

Ala Gly Met Tyr Ser Ser Leu Ser Tyr Ala Phe Ala Gln Ala Cys

1295 1300 1305

Val Glu Val Ile Tyr Asn Ile Leu Gln Gly Ile Leu Tyr Thr Ile

1310 1315 1320

Ile Ile Tyr Ala Met Ile Gly Tyr Asp Trp Lys Ala Asp Lys Phe

1325 1330 1335

Phe Tyr Phe Met Phe Phe Ile Val Ala Ser Phe Asn Tyr Phe Thr

1340 1345 1350

Leu Phe Gly Met Met Leu Val Ala Cys Thr Pro Ser Ala Met Leu

1355 1360 1365

Ala Asn Ile Leu Ile Ser Phe Val Leu Pro Leu Trp Asn Leu Phe

1370 1375 1380

Ala Gly Phe Leu Val Val Arg Pro Leu Ile Pro Ile Trp Trp Arg

1385 1390 1395

Trp Tyr Tyr Trp Ala Asn Pro Val Ser Trp Thr Ile Tyr Gly Val

1400 1405 1410

Val Ala Ser Gln Phe Gly Lys Asn Gly Asp Val Leu Ser Val Pro

1415 1420 1425

Gly Gly Ser Pro Thr Val Val Lys Gln Phe Leu Glu Asp Asn Leu

1430 1435 1440

Gly Met Arg His Ser Phe Leu Gly Tyr Val Val Leu Thr His Phe

1445 1450 1455

Gly Tyr Ile Ile Val Phe Phe Phe Ile Phe Gly Tyr Ala Ile Lys

1460 1465 1470

Tyr Phe Asn Phe Gln Lys Arg

1475 1480

<210> 2

<211> 4443

<212> DNA

<213> OsABCG48

<400> 2

atggcgtcgt cggcggaggc ggctgcggcg atggcggcgg cgccgtcggc gagcgggcgg 60

cggagcatga gctgggggtc gtcgatctcg cagtcgttcc ggcaggcgga ggcggacgac 120

ccgttcggtc gcgcggcgtc gcagcagggg cacgacgacg acgaggagaa cctccggtgg 180

gcggcgctcg agaagctccc cacctacgac cgcatgcgcc gcggcgtcat ccgcaccgcg 240

ctcctccatc acgacggcgg cggcgacggc ggcggcgcgg cggcggcggc gaaggacggg 300

aggatggagc tcgtcgacat ccagaagctc gccgccggca acctcggccg cgcgctcctc 360

gaccgcgtgt tccaggacga cagcgagcgc ttcctccgcc gcctccggga ccgcatcgac 420

atggtgggga tcgagctgcc gacgatcgag gtgaggtacg agcagctgtc gatccaggcg 480

gaggtgttcg tcggcagccg tgcgctgccc acgctcacca acgccgccac caacgtcctc 540

cagggtctca ttggacgatt tggttcttca aataagagga ccattaacat actgcaagat 600

gttagtggca tcatcaagcc atccaggatg acacttcttc ttgggcctcc atcctcggga 660

aagagcacac taatgcgagc acttacaggg aagcttgata aaaacctcaa ggtgtccggc 720

gacatcacat actgtggaca cacattttct gagttctacc ctgagaggac cagtgcatat 780

gtcagtcagt atgatcttca taatgcagag atgactgtga gagagacatt ggatttctct 840

gggcggtgct taggcattgg tgcaagatat gacatgctcg cggaactcgc gagaagggag 900

cgcaatgcag gcattaagcc agatcctgag atcgatgctt tcatgaaagc tactgcagtg 960

caagggcata aaactaacat cactacagat gttactctca aggcacttgg gttggacatt 1020

tgtgctgata ttattattgg ggatgagatg attagaggaa tttctggtgg gcaaaagaag 1080

cgtgtgacaa caggggagat gttaacggga ccagcacggg cattgttcat ggatgaaata 1140

tccaccggtc tagatagctc tagcacattt gagattgtca agtatattgg gcatttggtc 1200

catgtgatga atgagactgt gatgatatcc ctcctgcagc caccaccgga gacctacaat 1260

ctttttgatg acataattct actatcagaa ggatatatag tctatcacgg accacgtgag 1320

aacatcttgg aattcttcga aaatgctggt ttccgatgcc ctgaaaggaa aggaatcgct 1380

gatttccttc aagaggtcac ttccaagaaa gaccagcagc agtactggta ccatgaccaa 1440

gaacggtatc ggtatgtgtc agttccagag tttgcacaac gtttcaagtc attccatgta 1500

ggtcagaaaa tgcagaagga gatgcaaatt ccttatgaca agtccagcac acatcctgct 1560

gcattgacaa ctaccaagta tgggctatcc agttgggagt cactcagggc agtgatgtca 1620

agagagtggt tattgatgaa gcgcaactcc ttcatctaca ttttcaaggt cacccagttg 1680

atcatccttg ccttcatgtc catgactgtg ttcctcagaa caaagatgcc tagtgggaca 1740

atctctgatg gcactaaatt ccttggggct ctcaccttta gtttgatcac catcttgttc 1800

aatggctttg ctgagctaca actgaccata aagaagcttc ctgtgttcta caaacataga 1860

gatttcttgt tcttccctgc atggaccttt ggagtagcaa atatcctctt gaaagttcct 1920

gtttctcttg tagaggcggc ggtatgggtt gtgctcacat actatgtgat ggggtttgca 1980

ccctctgcag gaaggttctt tcgtcaattt atagctttct ttgttactca ccaaatggca 2040

atggctatgt tccgatttct tggtgctatt ttgaaaacaa tggttgtggc caatactttt 2100

gggatgtttg tgctgcttat tgtcttcatt tttggaggat ttctcatatc tagaaatgac 2160

atcaagccat ggtggatttg gggttactgg gcatctccta tgatgtatag tcaacaagca 2220

atatcaatca atgagttcct tgctagtaga tgggctattc caaatactga tgcaacaatt 2280

gatgagccaa ctgttggcaa ggctattctc aaatccaaag gcttgattac tagtgatggg 2340

gggttttgga tttccattgg agcccttata ggattccttg ttgtgttcaa tatcttatac 2400

attttggccc ttacatactt gagtcctggt ggcagctcaa acacaatagt ttcagatgaa 2460

gatagtgaag ataagacgga catgaaaaca agaaatgaac aacaaatgtc ccaaattgta 2520

cacaataatg gagctagtaa tacatctgca acatcgtcaa tccccatgag tggaagcaga 2580

tcaacaaatc agcaaagtag atcacaaatt gtcttgcctt tccaacccct ttcactttgt 2640

ttcaaccatg taaactacta tgtggatatg ccaacagaaa tgaaagagca aggattcaca 2700

gaaagccgtc tccagttact atctgatatc agtggagttt tcagaccagg tgttttgaca 2760

gcattagttg gtgtaagtgg agctggcaag accaccctaa tggatgtctt agcaggaagg 2820

aaaacaagtg gagtaattga aggagacatc accctctctg gttatccaaa gaaacaagaa 2880

acttttgcac gcattagtgg ttactgtgaa cagactgata ttcattcacc aaatgttact 2940

gtctatgaat ccattctcta ctctgcttgg ctacgtcttt cgtcagatgt tgacaccaat 3000

acgaggaaga tgttcgtgga tgaagtcatg tcccttgtag agcttgatgt gttacgtaat 3060

gctttggtgg gtcttcctgg agttagtggt ttatcaactg aacagagaaa gaggctcaca 3120

attgcagtgg agttggtagc aaacccttca gtaatattca tggatgagcc aacttctgga 3180

cttgatgcta gagctgcagc aattgtcatg cgaaccgtga gaaataccgt caacacggga 3240

cgcactgtgg tttgcacaat tcatcaaccc agcatcgata tttttgagtc ttttgatgag 3300

cttttgctat tgaaaagggg agggcaagtt atttatgctg gtgaactcgg ccgccactcc 3360

cataaactag ttgaatattt tgaggcagtt ccaggtgttc caaagataac agaaggatat 3420

aatcctgcaa catggatgct agaagtcacc tcccctatag ctgaggctcg tcttaatgta 3480

aattttgctg aaatttatgc taattctgag ctttatagga aaaaccaaga gctaatcaag 3540

gaattgagca ctcccccacc aggatatcaa gatctctcat ttcctacaaa gtattctcaa 3600

aatttctata gtcaatgcat tgcaaacttt tggaagcaat atcgttctta ttggaagaat 3660

ccaccataca atgccatgcg ctatcttatg acattgctca atggccttgt ctttggcacg 3720

gtattttggc aaaaaggaac taagatatca tcacaacaag atttgttcaa tttgcttgga 3780

gccacttatg ctgcaacttt cttccttggg gctgccaatt gtatcacagt tcaacctgtt 3840

gtttccatcg aaagaacagt cttctaccgc gaaagggcag cagggatgta ctcttcattg 3900

tcctatgcat ttgctcaggc atgcgtggag gtcatctaca acatcttaca ggggattcta 3960

tacactatta tcatctatgc aatgattgga tatgactgga aagccgacaa attcttctat 4020

ttcatgttct ttattgtagc aagtttcaac tacttcacat tgtttgggat gatgttggtg 4080

gcatgcaccc catctgcaat gcttgcaaac attctcatat cctttgtact tcctctctgg 4140

aatctttttg ctgggttcct cgttgttagg ccgttgatac cgatttggtg gaggtggtac 4200

tactgggcaa accccgtgtc atggaccatc tatggtgttg tggcgtcaca gtttggtaaa 4260

aatggtgatg ttctttcggt tcccggtggg agccctacgg tagtgaagca attcttggag 4320

gacaacctag ggatgcggca tagtttccta ggatatgttg tgctcacaca ttttggctac 4380

atcatcgttt tcttcttcat ctttggctat gccatcaagt acttcaactt ccagaaacga 4440

tag 4443

<210> 3

<211> 17

<212> DNA

<213> Artificial sequence

<400> 3

atggcgtcgt cggcggc 17

<210> 4

<211> 31

<212> DNA

<213> Artificial sequence

<400> 4

ctatcgtttc tggaagttga agtacttgat g 31

Claims

1. The application of the rice OsABCG48 protein or the gene coding the rice OsABCG48 protein in improving the cadmium stress resistance of unicellular organisms and plants;

the amino acid sequence of the rice OsABCG48 protein is shown in SEQ ID NO. 1;

the single-cell organism is yeast;

the plant is Arabidopsis thaliana.