CN112029800A - Methods for detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified - Google Patents

Abstract

The present invention provides methods for detecting and classifying AAV sequences from DNA in a sample derived from a tissue or cell. The invention also provides AAV sequences identified by the method and vectors constructed using these sequences.

Description

Methods for detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified

The present application is a divisional application of chinese patent application 201310326869.0.

Technical Field

The present invention provides methods for detecting and classifying AAV sequences from DNA in a sample derived from a tissue or cell. The invention also provides AAV sequences identified by the method and vectors constructed using these sequences.

Background

Adeno-associated virus (AVV) is a member of the parvovirus family, a small nonenveloped icosahedron whose genome is a single-stranded linear DNA molecule of 4.7kb to 6 kb. AVV was initially classified as dependent because this virus was found as a contaminant in purified adenovirus strains. The life cycle of AVV includes a latent phase during which the AVV genome integrates into the host chromosome in a site-specific manner following infection, and an infectious phase during which the integrated viral genome subsequently recovers, replicates and is packaged into infectious viral particles, accompanied by infection with adenovirus or herpes simplex virus. AVV is an attractive gene transfer tool because of its non-pathogenic, broad host range including non-dividing cells and site-specific integration.

Recent studies have shown that AVV vectors are a preferred gene therapy tool. To date, AVVs of 6 different serotypes have been isolated and identified in vivo from human or non-human primates (NHPs). Among them, human serum type 2 was first developed as a gene transfer tool and has now been widely used for gene transfer experiments in various target tissues and animal models. Clinical trials using AVV 2-derived vectors for the treatment of certain human diseases are also in progress, including cystic fibrosis and hemophilia B. What we want is an AAV-derived vector for gene transfer.

Disclosure of Invention

One aspect of the present invention relates to a novel method for detecting and identifying AVV sequences from cellular DNA of various human and non-human primate (NHP) tissues using bioinformatics analysis, PCR amplification and cloning techniques based on the latent and integration properties of AVV in the absence of helper virus co-infection.

Another aspect of the invention relates to a method for isolating AVV sequences detected using the above method of the invention. The invention also includes methods for making vectors using these novel AVV serotypes that can be used for serological and gene transfer studies based solely on the capsid gene sequence and the structure of the rep/cap gene junction.

Another aspect of the invention relates to the use of the reagents described herein, such as universal primer pairs/probes and quantitative real-time PCR, for serological, epidemiological, biodistribution and transmission patterns studies.

Another aspect of the invention relates to methods for isolating the complete and infectious genome of a novel AVV serotype from cellular DNA of different sources using RACE and other molecular techniques.

The invention also relates to methods for recovering the genome of a novel AVV serotype from a human or NHP cell line using helper adenoviruses of different origins.

Another aspect of the invention relates to novel AVV serotypes, vectors containing such serotypes, and methods of using such serotypes.

These and other aspects of the invention will be readily appreciated from the following detailed description of the invention.

Drawings

FIGS. 1A to 1AAAR depict an alignment of nucleic acid sequences encoding at least an AAV cap protein. These figures list the full-length sequences of the following novel AAV serotypes comprising ITRs, rep and capsid regions: novel AAV serotype 7[ SEQ ID NO:1], and previously reported AAV1[ SEQ ID NO:6], AAV2[ SEQ ID NO:7] and AAV3[ SEQ ID NO:8 ]. Novel AAV serotypes AAV8[ SEQ ID NO:4] and AAV9[ SEQ ID NO:5] are the subject of this co-filed application. Other novel clones of the invention involved in this alignment include 42-2[ SEQ ID NO:9], 42-8[ SEQ ID NO:27], 42-15[ SEQ ID NO:28], 42-5b [ SEQ ID NO:29], 42-1b [ SEQ ID NO:30 ]; 42-13[ SEQ ID NO:31], 42-3a [ SEQ ID NO:32], 42-4[ SEQ ID NO:33], 42-5a [ SEQ ID NO:34], 42-10[ SEQ ID NO:35], 42-3b [ SEQ ID NO:36], 42-11[ SEQ ID NO:37], 42-6b [ SEQ ID NO:38], 43-1[ SEQ ID NO:39], 43-5[ SEQ ID NO:40], 43-12[ SEQ ID NO:41], 43-20[ SEQ ID NO:42], 43-21[ SEQ ID NO:43], 43-23[ SEQ ID NO:44], 43-25[ SEQ ID NO:45], 44.1[ SEQ ID NO:47], 44.5[ SEQ ID NO:47], 223.10[ SEQ ID NO:48], 223.2[ SEQ ID NO:49], 223.4[ SEQ ID NO:50], 223.5[ SEQ ID NO:51], 223.6[ SEQ ID NO:52], 223.7[ SEQ ID NO:53], A3.4[ SEQ ID NO:54], A3.5[ SEQ ID NO:55], A3.7[ SEQ ID NO:56], A3.3[ SEQ ID NO:57], 42.12[ SEQ ID NO:58], 44.2[ SEQ ID NO:59 ]. The sequences of the characteristic regions of AAV10[ SEQ ID NO:117], AAV11[ SEQ ID NO:118] and AAV12[ SEQ ID NO:119] are also shown in the figure. Key markers in the AAV genomic structure are also identified in the figures. The space of the fracture is indicated by a black dot. The 3' ITR of AAV1[ SEQ ID NO:6] is represented by the same structure as the previously reported sequence. TRS stands for terminal evolution site. It is noted that AAV7 is the only AAV reported to utilize GTG as the initiation codon for VP 3.

FIGS. 2A to 2F show the previously reported alignments of the amino acid sequences of AAV serotype 1[ SEQ ID NO:64], AAV2[ SEQ ID NO:70], AAV3[ SEQ ID NO:71], AAV4[ SEQ ID NO:63], AAV5[ SEQ ID NO:114], AAV6[ SEQ ID NO:65], and the vp1 capsid protein of the novel AAV sequences of the invention, including C1[ SEQ ID NO:60], C2[ SEQ ID NO:61], C5[ SEQ ID NO:62], A3-3[ SEQ ID NO:66], A3-7[ SEQ ID NO:67], A3-4[ SEQ ID NO:68], A3-5[ SEQ ID NO:69], 3.3b [ SEQ ID NO:62], 223.4[ SEQ ID NO:73], 223-5[ SEQ ID NO:74], 223-10[ SEQ ID NO:75],75, 223-2[ SEQ ID NO:76], 223-7[ SEQ ID NO:77], 223-6[ SEQ ID NO:78], 44-1[ SEQ ID NO:79], 44-5[ SEQ ID NO:80], 44-2[ SEQ ID NO:81], 42-15[ SEQ ID NO:84], 42-8[ SEQ ID NO:85], 42-13[ SEQ ID NO:86], 42-3A [ SEQ ID NO:87], 42-4[ SEQ ID NO:88], 42-5A [ SEQ ID NO:89], 42-1B [ SEQ ID NO:90], 42-5B [ SEQ ID NO:91], 43-1[ SEQ ID NO:92], 43-12[ SEQ ID NO:93], 43-5[ SEQ ID NO:94], 43-21[ SEQ ID NO:96], 43-25[ SEQ ID NO:97], 43-20[ SEQ ID NO:99], 24.1[ SEQ ID NO:101], 42.2[ SEQ ID NO:102], 7.2[ SEQ ID NO:103], 27.3[ SEQ ID NO:104], 16.3[ SEQ ID NO:105], 42.10[ SEQ ID NO:106], 42-3B [ SEQ ID NO:107], 42-11[ SEQ ID NO:108], F1[ SEQ ID NO:109], F5[ SEQ ID NO:110], F3[ SEQ ID NO:111], 42-6B [ SEQ ID NO:112], 42-12[ SEQ ID NO:113 ]. New serological AAV8[ SEQ ID NO:95] and AAV9[ SEQ ID NO:100] are the subject of this co-filed patent application.

FIGS. 3A to 3C show the amino acid sequence of AAV7 rep protein [ SEQ ID NO:3 ].

Detailed Description

In the present invention, the inventors have discovered a method that can exploit the ability of adeno-associated virus (AVV) to integrate through the nucleus into cellular DNA and achieve latent infection in the absence of helper virus coinfection. The method makes it possible to detect, identify and/or isolate AVV sequences from tissue DNA of human and non-human primate origin or other origin using Polymerase Chain Reaction (PCR) -based techniques. In addition, the method is also suitable for detecting, identifying and/or isolating other integrated viral and non-viral sequences as described below.

The invention also relates to nucleic acid sequences identified using the methods of the invention. One such adeno-associated virus is a novel serotype, referred to herein as serotype 7(AVV 7). Other novel adeno-associated virus serotypes contemplated herein include AAV10, AVV11, and AVV 12. Other novel AVV serotypes identified using the methods of the invention are also included in the present specification. See the figures and sequences listed, which are incorporated herein by reference.

The invention also relates to fragments of these AAV sequences. Of particular interest are AAV fragments of cap proteins, including vp1, vp2, vp3, and hypervariable regions, rep proteins, including rep78, rep68, rep52, and rep40, and sequences encoding these proteins. These fragments can be used in a variety of vector systems and host cells. Such fragments may be used alone or in combination with other AAV sequences or fragments, or elements of other AAV or non-AAV viral sequences. In a particularly preferred embodiment, the vector contains the AAV cap and/or rep sequences of the present invention.

As described herein, nucleic acid sequences are aligned using any of a variety of public or commercial multiple sequence alignment programs, such as "Clustal W," which are downloaded from a server on the Internet. In addition, the Vector NTI program was used. The identity of nucleotide sequences can also be determined using a number of algorithms well known in the art, including those in the programs described above. In addition, polynucleotide sequences can be compared using Fasta, a procedure in GCG version 6.1. Fasta can align the best overlap region between the queried and retrieved sequences and calculate the percent sequence identity. For example, the percentage of identity between two nucleic acid sequences can be determined using Fasta software, with reference to the default parameters provided in GCG version 6.1 (word size 6, scoring matrix using NOPAM factor), which is incorporated herein by reference. Amino acid sequences can also be treated with similar programs, such as the "Clustal X" program. Typically, the settings for these programs are defaults, but those skilled in the art can also change these settings if necessary. In addition, other algorithms or computer programs may be used by those skilled in the art, provided that the programs are capable of estimating sequence identity or aligning nucleic acid sequences as are the reference algorithms and programs.

The term "substantial homology" or "substantial identity" when used with respect to nucleic acids or nucleic acid fragments means that the nucleotide sequence identity of at least 95% to 99% of the compared sequences is compared to one nucleic acid sequence following appropriate insertion or deletion of some nucleotides in the other nucleic acid sequence. When two sequences are said to be homologous, they must be compared over their full length, their open reading frames, or appropriate nucleic acid fragments of at least 15 nucleotides. Examples of suitable nucleic acid fragments are described herein.

The term "substantial homology" or "substantial identity" when used with respect to amino acids or fragments thereof means that amino acid sequence identity of at least 95% to 99% of the compared sequences is achieved when one amino acid fragment is compared to another amino acid fragment following appropriate insertion or deletion of some amino acids. When two sequences are said to be homologous, they must be compared over their full length, their proteins, such as the cap protein, the rep protein, or suitable fragments of at least 8 amino acids, preferably 15 amino acids. Examples of suitable fragments are described herein.

The term "highly conserved" refers to at least 80% sequence identity, preferably at least 90% sequence identity, more preferably more than 97% sequence identity. One skilled in the art can readily determine sequence identity by algorithms and computer programs well known in the art.

The term "percent sequence identity" or "identical" when used with respect to a nucleic acid sequence means that the nucleotide residues of the two sequences are identical when aligned together. The length of the sequence identity comparison may exceed the full length of the genome, the full length of the gene coding sequence, or a fragment of at least about 500-5000 nucleotides. However, it is also possible to compare the identity between smaller fragments, such as fragments of about 9 nucleotides, typically at least about 20-24 nucleotides, at least about 28-32 nucleotides, at least about 36 or more nucleotides. Similarly, "percent sequence identity" can also be used to determine amino acid sequence, to determine the identity of a full-length protein or fragment thereof. Suitable fragments are at least about 8 amino acids and may be up to 700 amino acids. Examples of suitable fragments are also described herein.

AAV sequence and its segment can be used to prepare rAAV, antisense transfer vector, gene therapy vector or vaccine vector. The invention also relates to nucleic acid molecules, gene transfer vectors, and host cells comprising the AAV sequences of the invention.

As described herein, the vectors of the invention comprising the AAV capsid proteins described herein are particularly useful for eliminating the effects of AAV serotype-derived vectors as well as other viral vectors using neutralizing antibodies. The rAAV vector of the present invention is particularly suitable for rAAV re-injection and repeated gene therapy.

These and other embodiments and advantages of the present invention are described in more detail below. As used in this specification and the appended claims, the terms "comprises" and "comprising," as well as any other similar words, mean that a particular element, integer, step, or the like, may be included. Conversely, the term "consisting of …" and similar words are intended to mean that no other parts, elements, integers, steps or the like are included.

I. Method of the invention

A. Detection of sequences by molecular cloning techniques

One aspect of the invention relates to methods for detecting and/or identifying a target nucleic acid sequence in a sample. The method is particularly suitable for detecting viral sequences integrated into the chromosome of cells, such as adeno-associated viruses (AAV), retroviruses and the like. The present specification refers to AAV by way of example. However, in light of the present disclosure, those skilled in the art can readily implement the present invention using retroviruses (e.g., feline leukemia virus ((FeLV), HTLVI and HTLVII), and lentiviruses (e.g., Human Immunodeficiency Virus (HIV), Simian Immunodeficiency Virus (SIV), Feline Immunodeficiency Virus (FIV), equine infectious anemia virus, and foamy virus), etc. additionally, the methods of the present invention can be used to detect other viral or non-viral sequences that are integrated into or not integrated into the host cell chromosome.

The sample described herein can be any nucleic acid-containing sample, such as tissues, tissue cultures, cells, cell cultures, and biological fluids, including but not limited to urine and blood. These nucleic acid sequences may be DNA or RNA of plasmid origin, natural DNA or RNA of any origin, including bacteria, yeasts, viruses, and higher organisms such as plants or animals. The extraction of DNA or RNA can be carried out by any method known to the person skilled in the art, such as the method described in Sambrook, written "Molecular Cloning: A Laboratory Manual" (New York: Cold spring harbor Laboratory). The source of the sample and the method of extracting the nucleic acid are not limitations of the present invention. Alternatively, the method of the present invention may be applied directly to a DNA-containing sample or to nucleic acids obtained (or extracted) from the sample.

The method of the invention comprises amplifying a sample containing DNA using Polymerase Chain Reaction (PCR) using a first set of primers specific for a first region of a double-stranded nucleic acid sequence, thereby obtaining an amplified sequence.

As described herein, each region is determined based on an alignment of nucleic acid sequences of at least two serotypes (i.e., AAV) or strains (i.e., lentiviruses), wherein each region contains sequences that are highly conserved at the 5 'end, preferably variable but not necessary in the middle, and also highly conserved at the 3' end, relative to the sequences of at least two aligned AAV serotypes. The 5 'and/or 3' highly conserved nucleotides are at least about 9, preferably at least 18 base pairs. For the variable regions, there need not be conserved sequences, and these sequences may be relatively conserved, i.e., less than 90%, 80%, or 70% identity between the aligned serotypes or strains.

Each region may span a length of about 100bp to 10kb base pairs, but it is particularly preferred that one of the regions is referred to as a signature region, i.e., that the region is sufficiently unique to be used to identify an amplified sequence derived from a target tissue. For example, in one embodiment, the first region is an approximately 250bp fragment, which is distinguishable from any known AAV sequence, which is a positively identified amplified region of AAV origin. Moreover, the various sequences within this region are sufficiently unique to be used to identify the serotype from which the amplified sequence is derived. Once amplified (and detected), the sequence can be identified using conventional restriction techniques, and can be identified by comparison with the restriction pattern of this region in AAV1, AAV2, AAV3, AAV4, AAV5 or AAV6 or AAV7, AAV10, AAV11, AAV12 or any other novel serotype identified by the present invention. The serotypes identified and referred to herein.

Such regions on other integrating viruses can be readily identified by those skilled in the art, and these sequences can be readily detected and identified, according to the methods described herein. Thus, an ideal pair of universal primers should be designed at the highly conserved ends, and this set of primers can be used to amplify a selected region in a sample. This aspect of the invention can be used to design diagnostic kits for detecting the presence of a target sequence (e.g., AAV) and for identifying AAV serotypes, and the criteria used can include restriction enzyme maps of serotypes described herein or isolated using the techniques described herein. For example, rapid identification of PCR products or determination of molecular serotypes can be accomplished by cleaving PCR products and comparing them to restriction enzyme maps.

Thus, in one embodiment, a "signature region" of an AAV may span about the 2800 to 3200 region of AAV1[ SEQ ID NO:6], as well as corresponding regions on AAV2, AAV3, AAV4, AAV5, and AAV 6. A preferred region is about 250bp, located in the 2886 to 3143 regions of AAV1[ SEQ ID NO:6], and the corresponding regions of AAV2[ SEQ ID NO:7], AAV3[ SEQ ID NO:8], and other AAV serotypes. See fig. 1. For rapid detection of AAV in a sample, primers specific for this characteristic region are used. However, the invention is not limited to sequences that match the AAV signature regions identified herein, and those skilled in the art can modify this region to become a short or long fragment of the signature region.

PCR primers are synthesized using methods well known to those skilled in the art. Each pair of PCR primers consists of a5 'primer and a 3' primer, see Sambrook et al, incorporated herein by reference. The term "primer" refers to an oligonucleotide fragment at which point synthesis of a primer extension product complementary to a nucleic acid strand begins under appropriate conditions. However, double-stranded primers may be used, and they may be treated to separate them before the preparation of the extension product. The primer contains about 15 to 25 or more nucleotides, preferably at least 18 nucleotides. But shorter, e.g., 7 to 15 nucleotides, may also be used in some cases.

The primers are selected to be sufficiently complementary to different strands of the particular sequence to be amplified and also to hybridize to their respective strands. Thus, the primer sequence need not be the exact sequence of the region to be amplified. For example, a non-complementary nucleotide fragment can be ligated to the 5' end of the primer, but the remaining primer portion is completely complementary to the strand. Alternatively, non-complementary bases or longer sequences may be interspersed within the primer, provided that the primer sequence is sufficiently complementary to the sequence to be amplified to hybridize therewith, and the strand can serve as a template for synthesis of primer extension products.

According to the invention, PCR primers for the characteristic region are designed based on highly conserved regions of two or more aligned sequences (i.e., two or more AAV serotypes). The sequence of the primer can be altered at the 5' end or in the middle, and need not be fully complementary to two or more aligned AAV serotypes. However, at least more than 5 nucleotides at the 3' end of the primer are fully complementary to two or more aligned AAV serotypes, preferably more than 9 base pairs, and more preferably 18 base pairs. Thus, the 3' end of the primer consists of at least 5 nucleotides that are 100% identical to the aligned sequences. However, it is also possible to add 1, 2, or more denatured nucleotides to the 3' -end of the primer.

For example, primer pairs for AAV characteristic regions are designed based on the following specific regions within the AAV capsid. The 5' primer is nt 2867-2891, 5' -GGTAATTCCTCCGGAAATTGGCATT3' based on AAV2[ SEQ ID NO:7], see FIG. 1. The 3' primer was nt 2867-2891, 5'-GACTCATCAACAACAACTGG GGATTC-3' based on AAV2[ SEQ ID NO:7 ]. However, one skilled in the art can design primer pairs based on the information provided by AAV1, AAV3, AAV4, AAV5, the corresponding regions of AAV6, or based on AAV7, AAV10, AAV11, AAV12, or other AAV of the invention. Alternatively, other primer pairs may be designed to amplify this region using methods well known to those skilled in the art.

B. Isolation of target sequences

As described herein, the first primer pair of the present invention is used to specifically amplify a target sequence, i.e., a characteristic region of an AAV serotype, to facilitate detection of the target sequence. If additional sequences need to be detected, i.e. if a new serotype needs to be identified, the signature region needs to be extended, and thus one or more additional primer pairs are required for the present invention. These primer pairs are suitably designed to comprise the 5 'primer or the 3' primer of the first primer pair and a second primer unique to that primer pair, such that the primer pair can amplify a5 'region or a 3' region of the characteristic region, which sequence is complementary to the 5 'end or the 3' end of the characteristic region. For example, the first primer pair consists of 5 'primer P1 and 3' primer P2 to amplify a characteristic region. To extend the 3 'end of the characteristic region, a second primer pair consisting of primer P1 and 3' primer P4 was used, which amplified the sequence of the characteristic region and downstream of it. To extend the 5 'end of the feature region, the third primer pair consists of 5' primer P5 and primer P2, which can amplify the sequence of the feature region and upstream of it. These extension steps may be repeated (or performed simultaneously), if desired. Thus, products from these amplification steps are ligated to products from conventional steps to yield independent sequences of the desired length.

The second and third primer pairs are used together with the primer pairs for the feature regions to amplify highly conserved regions on the aligned sequences. The term "second" or "third" primer pair as used herein is for convenience of description only and does not indicate the order in which the primers are added to the reaction mixture or used for amplification. The region amplified by the second primer pair is selected such that, once amplified, its 5 'end complementarily hybridizes to the 3' end of the characteristic region. Similarly, the region amplified by the third primer pair is selected so that once amplified its 3 'end will hybridise complementary to the 5' end of the characteristic region. Additional primer pairs can be designed that can hybridize complementary to the 5 'end or 3' end of the amplification product of the second or third primer pair and the underlying primer pair.

For example, if AAV is targeted, the first primer pair (P1 and P2) is used to amplify a characteristic region from a sample. In a preferred embodiment, the characteristic region is located within the AAV capsid. The second primer pair (P1 and P4) is used to extend the 3' end of the signature region to a region before the 3' ITR of the AAV sequences, i.e., the product containing the entire 3' end of the AAV capsid is amplified with the signature region as an anchor. In one embodiment, the P4 primer is located on nt 4435-4462 of AAV2[ SEQ ID NO:7], as well as on the corresponding sequences of other AAV serotypes. As a result, a product of about 1.6kb containing the characteristic region of 0.25kb was obtained. The third primer pair (P3 and P2) is used to extend the 5' end of the signature region to the 3' end of the rep gene of the AAV sequence, i.e., the product containing the entire 5' end of the AAV capsid is amplified with the signature region as an anchor. In one embodiment, the P3 primer is located at nt 1384-1409 of AAV2[ SEQ ID NO:7], as well as the corresponding sequences of other AAV serotypes. As a result, a product of about 1.7kb containing the characteristic region of 0.25kb was obtained. In addition, the fourth primer pair is used to further extend the extension product containing the entire 5' end of the AAV capsid to include the rep sequence. In one embodiment, the P5 primer is located at nt 108-133 of AAV2[ SEQ ID NO:7], as well as the corresponding sequence of other AAV serotypes, in combination with the P2 primer.

After the desired number of extension steps has been completed, the various extension products are ligated together using the characteristic regions as anchors or tags to obtain a complete sequence. In one embodiment described herein, AAV sequences comprising at least one complete AAV cap gene are amplified, although larger sequences can be amplified depending on the number of amplification steps performed.

Methods for assembling the extension products into a complete AAV sequence are well known to those skilled in the art. For example, digestion of the amplification product with DraIII can cleave at the DraIII site in the signature region to provide a restriction fragment, which is newly ligated to the gene product containing the entire AAV cap gene. However, other suitable techniques may be used to assemble the extension products into a complete sequence, see Sambrook et al, incorporated herein by reference.

In addition to the multi-step extension method described above, another embodiment of the present invention is directed to the amplification of a3.1 kb fragment containing the full-length cap sequence. In order to directly amplify a3.1 kb full-length cap fragment from NHP tissue or blood DNA, two other highly conserved regions in AAV genome need to be identified to facilitate PCR amplification of this large fragment. One primer in the conserved region is located in the middle of the rep gene (AV1ns:5'GCTGCGTCAACTGGACCAATGAGAAC 3', nt of SEQ ID NO:6), and the other primer is located in another conserved region downstream of the cap gene (AV2cas:5'CGCAGAGACCAAAGTTCAACTGAAACGA 3', SEQ ID NO:7), and this combination can amplify AAV sequences containing the full-length cap gene. Generally, after amplification is completed, the accuracy of the product can reach more than 99.9 through cloning and sequencing. Using this method, the inventors isolated and subsequently identified at least 50 capsid clones. Of which 37 clones were derived from macaques (rh.1-rh.37), 6 clones were derived from cynomolgus monkeys (cy.1-cy.6), 2 clones were derived from baboons (bb.1 and bb.2), and 5 clones were derived from chimpanzees (ch.1-ch.5). These clones were also identified elsewhere in the specification, along with the species from which they were derived and the animal tissues in which the novel sequences were present.

C. Additional methods for isolating novel AAV

Another aspect of the invention relates to additional methods for isolating novel AAV from cells. The method comprises infecting a cell with a vector having AAV helper virus function; isolating infectious clones containing AAV; sequencing of the isolated AAV; and comparing the isolated AAV sequences to known AAV serotypes, and indicating the presence of the novel AAV if the isolated AAV differs from the known AAV serotype sequences.

In one embodiment, the vector with helper functions provides the basic functions of an adenovirus, including, e.g., E1a, E1b, E2a, E4ORF 6. In one embodiment, the helper function is provided by an adenovirus. The adenovirus may be wild-type, of human or non-human origin, preferably of non-human primate (NHP) origin. DNA sequences for various adenoviruses are available from Genbank, including type Ad 5[ Genbank accession number M73260 ]. The adenoviral sequences can be obtained from any type of adenovirus known, such as serotypes 2, 3, 4, 7, 12 and 40, and also include any type of human origin that has been identified in the present invention [ see Horwitz, cited above ]. Similarly, adenoviruses known to infect non-human animals (e.g., chimpanzees) can also be used to construct vectors of the invention. See U.S. Pat. No.6,083,716. In addition to wild-type adenovirus, recombinant viruses or non-viral vectors (e.g., plasmids, episomes, etc.) with the necessary helper functions may be used. These recombinant viruses are well known in the art and can be prepared by published methods. See U.S. Pat. Nos. 5,871,982 and 6,251,677, which describe a hybrid Ad/AAV virus. The choice of adenovirus type is not intended to limit the scope of the invention described below. Various strains of adenovirus are available from the American Type Culture Collection, Manassas, Virginia, and are otherwise available from various commercial or research institutions. Moreover, the sequences of many such strains can be searched from various databases, such as PubMed and GenBank.

Alternatively, infectious AAV can be isolated using genome Walker techniques (Siebert et al, 1995, Nucleic Acid Research, 23:1087-1088, Friezner-Degen et al, 1986, J.biol.chem.261:6972-698, BD Biosciences Clontech, Palo Alto, Calif.). Genome walking techniques are particularly suitable for identifying and isolating sequences adjacent to the novel sequences identified by the methods of the present invention. For example, this technique can be used to isolate Inverted Terminal Repeats (ITRs) of novel AAV serotypes based on the capsid and/or rep sequences of the novel AAV identified by the methods of the invention. This technique can also be used to isolate sequences adjacent to other AAV or non-AAV sequences identified and isolated in the present invention. See examples 3 and 4.

The methods of the invention can be used for a variety of epidemiological studies, biodistribution studies, and detection of gene therapy by AAV vectors or other vectors of integrated viral origin. Thus, these methods can be used to prepare pre-packaged kits for use by clinicians, researchers, and epidemiologists.

II. diagnostic kit

Another aspect of the invention relates to detecting known or unknown adeno-associated virus (AAV) in a sample. Such kits include a first pair of 5 'and 3' PCR primers specific for a characteristic region of an AAV nucleic acid sequence. In addition, the kit can also include a first pair of 5 'and 3' PCR primers specific for a3.1 kb fragment containing the full-length AAV capsid nucleic acid sequences identified herein (i.e., AV1ns and AV2cas primers). The kit may also optionally include two or more pairs of 5 'and 3' primers, as well as PCR probes, as described herein. These primers and probes can be used according to the invention to amplify a characteristic region of each AAV serotype, e.g., by quantitative PCR methods.

The invention also relates to methods for identifying AAV serotypes detected by the methods of the invention, and/or for distinguishing new serotypes from known serotypes. Such kits may also include one or more restriction enzymes, standards for AAV serotypes for "tagged restriction analysis", and/or other reagents for determining the AAV serotype detected.

In addition, the kits of the invention may contain instructions, negative and/or positive controls, containers, dilutions and buffers of the sample, control tables for label comparison, disposable gloves, anti-contamination instructions, applicator sticks or containers, sample preparation tubes, and any other reagents required, such as media, washing reagents, and concentration reagents. These reagents may be selected from the reagents described herein, and the solution may be selected from conventional reagents. In a preferred embodiment, the wash reagent is an isotonic saline solution, useful for buffering physiological pH, such as Phosphate Buffered Saline (PBS); the elution reagent was PBS containing 0.4M NaCl, as well as the concentration reagent and equipment. For example, one skilled in the art will recognize that agents such as polyethylene glycol (PEG) or NH may be used₄SO₄Devices such as filtration apparatus. For example, a filtration device containing a 100K membrane can concentrate rAAV.

The kits of the invention can be used to carry out the methods described herein, as well as for the study of biodistribution, epidemiology, novel AAV viruses in human and NHP transmission patterns.

Thus, the methods and kits of the invention are useful for the detection, identification and isolation of target viral sequences. The methods and kits are particularly useful for detecting, identifying and isolating AAV sequences, including novel AAV serotypes.

In a noteworthy example, the inventors facilitated the analysis of cloned AAV sequences using the methods of the invention, and the results showed that the proviral sequences were heterogeneous between cloned fragments of different animal origin, all of which differed from the known 6 AAV serotypes, with the regions of variation being mainly concentrated in the hypervariable regions of the capsid proteins. Surprisingly, the dispersibility of AAV sequences was particularly evident in clones isolated from a single tissue of a cynomolgus monkey, such as lymph nodes. The best explanation for this heterogeneity is that there is significant evolution of AAV sequences in animal individuals, in part, possibly due to homologous recombination occurring between a limited number of co-infected parental viruses. These studies suggest that sequence evolution of a widespread virus during natural AAV infection may lead to the formation of a population of quasispecies that differ from each other in the alignment of the capsid hypervariable regions. This is an example of the first rapid molecular evolution of DNA viruses that was previously thought to occur only with RNA viruses.

Several novel AAV serotypes identified by the methods of the invention and their characteristics are described herein.

Novel AAV serotypes

A. Nucleic acid sequences

Nucleic acid sequences of novel AAV serotypes identified by the methods of the invention are described herein. See SEQ ID NO 1, 9-59, and 117-120, which are incorporated herein by reference. See also figure 1 and the sequences listed in the table.

The full length sequences of the novel serotype AAV7, including AAV 5'ITR, capsid, rep, and AAV 3' ITR are shown in SEQ ID NO. 1.

For other novel AAV serotypes of the invention, a fragment of about 3.1kb isolated according to the methods of the invention is described herein. The fragment contains a sequence encoding the full-length capsid protein and all or part of the sequence encoding the rep protein. These sequences include the clones identified below.

For other novel AAV serotypes, the characteristic regions encoding the capsid proteins are described herein. For example, the AAV10 nucleic acid sequence of the present invention comprises the sequence shown in FIG. 1[ see SEQ ID NO:117, 255bp long ]. The AAV11 nucleic acid sequence of the present invention comprises the sequence shown in FIG. 1[ see SEQ ID NO:118, 258bp long ]. The AAV12 nucleic acid sequence of the present invention comprises the sequence shown in FIG. 1[ see SEQ ID NO:119, 255bp long ]. AAV10, AAV11, and AAV12 sequences can be readily identified and used for a variety of purposes, such as for AAV7 and other novel serotypes described herein, using the methods described herein.

FIG. 1 shows a non-human primate (NHP) AAV nucleic acid sequence of the invention, to which AAV serotypes AAV1[ SEQ ID NO:6], AAV2[ SEQ ID NO:7] and AAV3[ SEQ ID NO:8] previously reported in the literature are aligned. These novel NHP sequences include the sequences listed in table 1 below, which were identified by the number of clones.

TABLE 1

Insertion of the capsid fragments of two chimpanzee adenoviruses into the AAV rep vector resulted in a novel NHP clone. This novel clone A3.1 is also referred to as Ch.5[ SEQ ID NO:20 ]. In addition, the present invention also includes two human AAV sequences, designated H6[ SEQ ID NO:25] and H2[ SEQ ID NO:26], respectively.

The AAV nucleic acid sequences of the invention also include the strand complementary to the sequence set forth in FIG. 1, the sequences [ SEQ ID NOS: 1, 9-59, 117-120] and the RNAs and cDNAs corresponding to the sequences set forth in FIG. 1, the sequences [ SEQ ID NOS: 1, 9-59, 117-120] and the complementary strands thereof. The nucleic acid sequences of the invention also include the sequences listed in FIG. 1, the sequences [ SEQ ID NO:1, 9-59, 117-120] and natural mutants of their complementary strands as well as genetically engineered modified sequences. Such modifications include labeling, methylation, and the replacement of one or more natural nucleotides with denatured nucleotides, as is well known in the art.

The nucleic acid sequences of the present invention also include sequences having greater than 85% identity or homology, preferably at least about 90%, more preferably at least about 95%, and most preferably at least about 98% -99% identity or homology to the sequences set forth in FIG. 1, SEQ ID NO 1, 9-59, 117-120. These terms have been defined herein.

The invention also includes fragments of the novel AAV sequences identified using the methods described herein. Suitable fragments are at least 15 nucleotides in length and comprise functional fragments, i.e.fragments of biological interest. In one embodiment, these fragments are fragments of the novel sequences set forth in FIG. 1, the sequences [ SEQ ID NOS: 1, 9-59, 117-120], the complementary strands thereof, and the complementary cDNAs and RNAs thereto.

Suitable fragments are those located on AAV1, AAV2 or AAV 7. However, the start and stop codons of the fragment of interest can be readily determined by one skilled in the art using the alignment methods described herein (alignment with the Clustal W program, default settings), or similar methods for alignment with other new serotypes.

Suitable fragments include sequences encoding the three variable proteins (vp) of the AAV capsid, which have different splicing mutations: vp1[ i.e., nt 825to 3049 of AAV7, SEQ ID NO:1 ]; vp2[ i.e., nt 1234-3049 of AAV7, SEQ ID NO:1 ]; and vp3[ i.e., nt 1434-3049 of AAV7, SEQ ID NO:1 ]. Notably AAV7 has an unusual start codon. DNA viruses with this start codon have been rarely reported previously except for a few housekeeping genes. This is believed to be true for the initiation codons of the other AAV serotypes vp1, vp2 and vp3, which make their intracellular production of vp1, vp2 and vp3 proteins in a proportion of 10% to 80%, respectively, efficient to assemble into viral particles. However, studies have shown that even this rare GTG start codon AAV7 virion can assemble efficiently. Thus, the inventors envision whether the initiation codon of other AAV serotypes vp3 can be altered to contain this rare GTG initiation codon to improve packaging efficiency, alter the structure of the virus particle, and/or alter the location of surface epitopes (i.e., neutralizing antibody epitopes) of other AAV serotypes. The initiation codon can be altered by conventional methods, such as direct site mutation. Thus, the invention includes AAV virions of any selected serotype comprising vp3 with a GTG to start codon and/or added vp1 and/or vp2 engineered into the virus.

Other suitable fragments of AAV include those containing the initiation codon for AAV capsid protein [ i.e., nt468-3090 of AAV7, SEQ ID NO: 1; nt 725to 3090 of AAV7, SEQ ID NO:1, and the corresponding regions of other AAV serotypes ]. AAV7 and other fragments of other novel AAV serotypes identified by the methods described herein include those encoding rep proteins, including rep78 [ i.e., initiation codon 334 of AAV7 in fig. 1], rep68[ initiation codon nt 334 of AAV7 in fig. 1], rep52 [ initiation codon 1006 of AAV7 in fig. 1], and rep40 [ initiation codon 1006 of AAV7 in fig. 1 ]. Additional fragments of interest are also the 5' inverted repeat ITR of AAV [ nt 1-107 of AAV7 in FIG. 1 ]; AAV 3' ITR [ nt 4704-4721 of AAV7 in FIG. 1], P19 sequence, AAV P40 sequence, rep binding site and Terminal Resolution Site (TRS). Other suitable fragments will be apparent to those skilled in the art. The corresponding regions on other novel serotypes of the invention can be readily determined by reference to FIG. 1 or by comparison to the sequences described herein using conventional alignment methods.

In addition to including the nucleic acid sequences set forth in the figures and in the sequence listing, the invention also includes nucleic acid molecules and sequences for expressing the amino acid sequences, proteins and polypeptides of the AAV serotypes of the invention. Thus, the invention includes nucleic acid sequences encoding the following novel AAV amino acid sequences: c1[ SEQ ID NO:60], C2[ SEQ ID NO:61], C5[ SEQ ID NO:62], A3-3[ SEQ ID NO:66], A3-7[ SEQ ID NO:67], A3-4[ SEQ ID NO:68], A3-5[ SEQ ID NO:69], 3.3b [ SEQ ID NO:62], 223.4[ SEQ ID NO:73], 223-5[ SEQ ID NO:74], 223-10[ SEQ ID NO:75], 223-2[ SEQ ID NO:76], 223-7[ SEQ ID NO:77], 223-6[ SEQ ID NO:78], 44-1[ SEQ ID NO:79], 44-5[ SEQ ID NO:80], 44-2[ SEQ ID NO:81], 42-15[ SEQ ID NO:84], 42-8[ SEQ ID NO:85], 42-13[ SEQ ID NO:86], 42-3A [ SEQ ID NO:87], 42-4[ SEQ ID NO:88], 42-5A [ SEQ ID NO:89], 42-1B [ SEQ ID NO:90], 42-5B [ SEQ ID NO:91], 43-1[ SEQ ID NO:92], 43-12[ SEQ ID NO:93], 43-5[ SEQ ID NO:94], 43-21[ SEQ ID NO:96], 43-25[ SEQ ID NO:97], 43-20[ SEQ ID NO:99], 24.1[ SEQ ID NO:101], 42.2[ SEQ ID NO:102], 7.2[ SEQ ID NO:103], 27.3[ SEQ ID NO:104], 16.3[ SEQ ID NO:105], 42.10[ SEQ ID NO:106], 42-3B [ SEQ ID NO:107],107,107,107,107, 42-11[ SEQ ID NO:108], F1[ SEQ ID NO:109], F5[ SEQ ID NO:110], F3[ SEQ ID NO:111], 42-6B [ SEQ ID NO:112], and/or 42-12[ SEQ ID NO:113], and artificial AAV serotypes prepared using these sequences and/or unique fragments thereof.

As described herein, artificial AAV serotypes include, without limitation, AAV having a non-native capsid protein. Such artificial capsids may be prepared by any suitable method, using the novel AAV sequences of the invention (i.e., a fragment of vp1 capsid protein) plus heterologous sequences, which may be from other AAV serotypes (known or new), discrete portions of the same AAV serotype, non-AAV viruses, or non-viral sequences. An artificial AAV serotype may be, without limitation, have a chimeric AAV capsid, a recombinant AAV capsid, or an "artificial" AAV capsid.

AAV amino acid sequences, proteins and polypeptides.

The present invention relates to proteins and fragments thereof encoded by the novel AAV serotype nucleic acid sequences identified herein, including AAV7[ nt 825-3049 of AAV7, SEQ ID NO:1] and other novel serotypes described herein. Thus, the novel serous capsid proteins of the present invention include: h6[ SEQ ID NO:25], H2[ SEQ ID NO:26], 42-2[ SEQ ID NO:9], 42-8[ SEQ ID NO:27], 42-15[ SEQ ID NO:28], 42-5b [ SEQ ID NO:29], 42-1b [ SEQ ID NO:30 ]; 42-13[ SEQ ID NO:31], 42-3a [ SEQ ID NO:32], 42-4[ SEQ ID NO:33], 42-5a [ SEQ ID NO:34], 42-10[ SEQ ID NO:35], 42-3b [ SEQ ID NO:36], 42-11[ SEQ ID NO:37], 42-6b [ SEQ ID NO:38], 43-1[ SEQ ID NO:39], 43-5[ SEQ ID NO:40], 43-12[ SEQ ID NO:41], 43-20[ SEQ ID NO:42], 43-21[ SEQ ID NO:43], 43-23[ SEQ ID NO:44], 43-25[ SEQ ID NO:45], 44.1[ SEQ ID NO:47], 44.5[ SEQ ID NO:47], 223.10[ SEQ ID NO:48], 223.2[ SEQ ID NO:49], 223.4[ SEQ ID NO:50], 223.5[ SEQ ID NO:51], 223.6[ SEQ ID NO:52], 223.7[ SEQ ID NO:53], A3.4[ SEQ ID NO:54], A3.5[ SEQ ID NO:55], A3.7[ SEQ ID NO:56], A3.3[ SEQ ID NO:57], 42.12[ SEQ ID NO:58], and 44.2[ SEQ ID NO:59], can be prepared from the open reading frames in the clones of the above list using conventional techniques.

The invention also includes AAV serotypes made using the sequences of the novel AAV serotypes of the invention, including synthetic, recombinant, and other techniques well known to those skilled in the art. The present invention is not limited to the novel AAV amino acid sequences, polypeptides and proteins expressed by the novel AAV nucleic acid sequences of the present invention, but also includes amino acid sequences, polypeptides and proteins prepared by other methods well known in the art, such as chemical synthesis techniques, other synthetic techniques or other methods. For example, any one of the following sequences: c1[ SEQ ID NO:60], C2[ SEQ ID NO:61], C5[ SEQ ID NO:62], A3-3[ SEQ ID NO:66], A3-7[ SEQ ID NO:67], A3-4[ SEQ ID NO:68], A3-5[ SEQ ID NO:69], 3.3b [ SEQ ID NO:62], 223.4[ SEQ ID NO:73], 223-5[ SEQ ID NO:74], 223-10[ SEQ ID NO:75], 223-2[ SEQ ID NO:76], 223-7[ SEQ ID NO:77], 223-6[ SEQ ID NO:78], 44-1[ SEQ ID NO:79], 44-5[ SEQ ID NO:80], 44-2[ SEQ ID NO:81], 42-15[ SEQ ID NO:84], 42-8[ SEQ ID NO:85], 42-13[ SEQ ID NO:86], 42-3A [ SEQ ID NO:87], 42-4[ SEQ ID NO:88], 42-5A [ SEQ ID NO:89], 42-1B [ SEQ ID NO:90], 42-5B [ SEQ ID NO:91], 43-1[ SEQ ID NO:92], 43-12[ SEQ ID NO:93], 43-5[ SEQ ID NO:94], 43-21[ SEQ ID NO:96], 43-25[ SEQ ID NO:97], 43-20[ SEQ ID NO:99], 24.1[ SEQ ID NO:101], 42.2[ SEQ ID NO:102], 7.2[ SEQ ID NO:103], 27.3[ SEQ ID NO:104], 16.3[ SEQ ID NO:105], 42.10[ SEQ ID NO:106], 42-3B [ SEQ ID NO:107],107,107,107,107, 42-11[ SEQ ID NO:108], F1[ SEQ ID NO:109], F5[ SEQ ID NO:110], F3[ SEQ ID NO:111], 42-6B [ SEQ ID NO:112], and/or 42-12[ SEQ ID NO:113], can be easily prepared using various techniques.

Suitable preparation techniques are well known to those skilled in the art. See Sambrook et al, molecular cloning, A laboratory Manual, Cold spring harbor Press (Cold spring harbor, NY). Alternatively, the polypeptide may be synthesized by well-known Solid Phase Peptide Synthesis methods (Merrifield, J.am. chem.Soc., 85:2149 (1962); Stewart and Young, Solid Phase Peptide Synthesis (Solid Phase Peptide Synthesis) (Freeman, san Francisco., 1969), pp.27-62). These and other suitable methods of preparation are well known to those skilled in the art and are not intended to limit the present invention.

Particularly preferred proteins include AAV capsid proteins encoded by the nucleotide sequences identified by the methods described above. The sequences of many of the capsid proteins of the present invention are set forth in SEQ ID NO 2 and 60-115 of FIG. 2 and/or the sequence Listing, which are incorporated herein by reference. The AAV capsid is composed of three proteins, vp1, vp2, and vp3, which are alternative splice mutants. The full-length sequence listed in these figures is the sequence of vp 1. Based on the numbering of the AAV7 capsid [ SEQ ID NO:2], the sequence of vp2 spans amino acids 138-737 of AAV7, and the sequence of vp3 spans amino acids 203-737 of AAV 7. From this information, one skilled in the art can readily determine the location of vp2 and vp3 on other novel serotypes of the invention.

Other preferred proteins and fragments of the capsid protein include the sequences of the constant and variable regions located between two hypervariable regions (HPV) as well as the HPV region itself. 12 hypervariable regions (HVRs) were detected using an algorithm that analyzed the sequence dispersion region on AAV2, 5 of which overlapped or were part of the previously described variable regions [ Chiorini et al, J.Virol, 73:1309-19 (1999); rutledge et al, J.Virol., 72:309-319 ]. Using this algorithm and/or the alignment methods described herein, HVRs of novel AAV serotypes can be determined. For example, for vp1[ SEQ ID NO:70] of AAV2, the positions of HVRs are as follows: HVR1, aa 146-; HVR2, aa 182-; HVR3, aa 262-; HVR4, aa 381-383; HVR5, aa 450-; HVR6, aa 490-495; HVR7, aa 500-504; HVR8, aa 514-; HVR9, aa 534-; HVR10, aa 581-594; HVR11, aa 658-; and HVR12, aa 705-. The location of HVRs on the novel AAV serotypes of the invention can be readily determined by conventional methods of alignment and the novel sequences described herein [ see figure 2 ]. For example, from FIG. 2, the location of the HVR on AAV7 can be readily determined, HVR1 being located at aa 146-; HVR2 is located at aa 182-187; HVR3 is located at aa 263-266, HVR4 is located at aa 383-385, and HVR5 is located at aa 451-475; HVR6 is located at aa 491-; HVR7 is located at aa 501-505; HVR8 is located at aa 513-521; HVR9 is located at aa 533-554; HVR10 was located at aa 583-; HVR11 is located at aa 660-669; HVR12 is located at aa 707-721. Based on the information provided herein, HVRs of other novel AAV serotypes are also readily determined.

In addition, amino acid expression cassettes with identity within the capsid have also been identified. These expression cassettes are of interest because they can be used to construct artificial serotypes, such as replacing the HVR1 expression cassette of one serotype with the HVR1 expression cassette of another serotype. The identity of these expression cassettes is shown in HVR2 of FIG. 1. See fig. 2. If the Clustal X alignment method is used, the method has a scale under the sequence, starting with the first residue and identified as 1. Lines on the scale are used to mark highly conserved regions. Three characters (, i, ") were used, representing a single, fully conserved position; "represents a" strong "group that is completely conserved," and "represents a" weak "group that is completely conserved. There are all positive packets in the Gonnet Pam250 matrix. The score of the strong group is greater than 0.5 and the score of the weak group is less than 0.5.

In addition, other suitable fragments of the AAV capsid include aa 24-42, aa 25-28 of AAV2[ SEQ ID NO:70 ]; aa 81-85; aa 133-165; aa 134-165; aa 137-143; aa 154-; aa 194-208; aa 261-; aa 262-274; aa 171-; aa 413-417; aa 449-478; aa 494-; aa 534-; aa 581-601; aa 660-; aa 709-. Other preferred fragments include aa 1-184, aa 199-259 on AAV 7; aa 274-446; aa 603-659; aa 670-706; aa 724-; aa 185-198; aa 260-273; aa 447-477; aa 495-; aa 660-; and aa 707-723. Other preferred regions may also comprise a set of helices comprising the following fragments according to the numbering of AAV7[ SEQ ID NO:2 ]: aa 185-198; aa 260-273; aa 447-477; aa 495-; aa 660-; and aa 707-723. The corresponding fragments in the novel AAV capsids of the invention can be readily determined from the sequences aligned herein using the Clustal X program for default settings or other commercial or public alignment software for default settings.

Other preferred proteins are AAV rep proteins [ aa 1-623 of AAV7 SEQ ID NO:3] and functional fragments thereof, including aa 1-171, aa 172-372, aa 373-444, aa 445-623 of SEQ ID NO: 3. Preferably such fragments are at least 8 amino acids in length. See fig. 3. Analogous regions on other novel AAV proteins of the invention can be determined using the techniques described herein and techniques well known in the art. In addition, fragments of other desired lengths may also be used. These fragments may be prepared by recombinant means or by other suitable means such as chemical synthesis.

The sequences, proteins or fragments of the invention may be prepared by any suitable method, including recombinant methods, chemical synthetic methods or other synthetic methods. These methods of preparation are well known to those skilled in the art and do not represent a limitation of the present invention.

Preparation of rAAV with novel AAV capsids

The invention includes novel wild-type AAV serotypes identified by the methods of the invention, which sequences do not contain the DNA and/or cellular components of the native virus. Another aspect of the invention relates to the use of the novel AAV sequences of the invention, including fragments thereof, for the preparation of molecules for the introduction of a heterologous gene or other nucleic acid sequence into a target cell.

The molecules of the invention comprise the novel AAV serotype sequences of the invention, including any genetic element (vector) that can be introduced into a host cell, such as naked DNA, plasmids, phages, transposons, cosmids, episomes, proteins in non-viral transfer vectors (i.e., lipid vectors), viruses, etc., and these molecules can transfer the sequences they carry. The vector may be transduced by any suitable method, including transfection, electroporation, liposome transfer, membrane fusion, high voltage DNA-coated particles, viral infection, and protoplast fusion. Methods for practicing any embodiment of the invention are well known to those skilled in the art of nucleic acid manipulation, including genetic engineering, recombinant engineering, and synthetic techniques, Sambrook et al, molecular cloning, A laboratory Manual, Cold spring harbor Press, Cold spring harbor, NY.

In one embodiment, the vectors of the invention contain sequences encoding the novel AAV capsids of the invention (i.e., the AAV7 capsid of the capsid, AAV 44-2(rh.10), AAV10 capsid, AAV11 capsid, AAV12 capsid), or fragments of one or more of these AAV capsids. In addition, the vector may also contain capsid proteins and fragments thereof.

The vectors of the invention may also contain sequences encoding AAV rep proteins. Such rep sequences can be from the same AAV serotype that harbors the rep sequence. In addition, the rep and cap sequences contained in the vectors of the invention may also be from different AAV serotypes. In one embodiment, the rep and cap sequences are of different expression origins (i.e., different vectors, or one host cell and one vector). In another embodiment, the rep and cap sequences are expressed from the same source. In this embodiment, the rep sequences can be fused in frame with cap sequences from different AAV serotypes to form a chimeric AAV vector. In addition, the vectors of the invention may contain a minigene comprising a selection gene flanked by AAV5 'ITRs and AAV 3' ITRs.

Thus, in one embodiment, the vectors described herein contain nucleic acid sequences encoding a complete AAV capsid, which may be from a single AAV serotype (i.e., AAV7 or other novel AAV). In addition, these vectors may contain sequences encoding artificial capsids fused from one or more fragments of the AAV7 (or other novel AAV) capsid with a heterologous AAV or non-AAV capsid protein (or fragment). These artificial capsid proteins are selected from the discontinuous portion of the AAV7 (or other novel AAV) capsid or the capsid of other AAV serotypes. For example, we may wish to modify the coding region on one or more AAV vp1, i.e. the coding region on one or more hypervariable regions (HPV1-12), or vp2, and/or vp 3. In another embodiment, we may wish to change the start codon of vp3 to GTG. Such modifications may be capable of increasing expression levels, throughput, and/or improving purification of the protein in a selective expression system, or for other purposes (e.g., altering inclusion bodies or altering neutralizing antibody epitopes).

The vectors, i.e., plasmids, described herein can be used for a variety of purposes, but are particularly useful for the preparation of rAAV comprising a capsid having AAV sequences or fragments thereof. These vectors, including rAAV, elements thereof, constructs, and uses thereof, are described in detail herein.

One aspect of the invention relates to the production of recombinant adeno-associated virus (AAV) having an AAV serotype 7 (or other novel AAV) capsid or fragment thereof. Such methods comprise culturing a host cell comprising a nucleic acid sequence encoding an adeno-associated virus (AAV) serotype 7 (or other novel AAV) capsid protein or fragment thereof as defined herein; a functional rep gene; a minigene comprising at least an AAV Inverted Terminal Repeat (ITR) and a transgene; and sufficient helper functions to facilitate packaging of the minigene into the capsid proteins of AAV7 (or other novel AAV).

The components that require culturing within the host cell and packaging of the AAV minigene into an AAV capsid can be provided to the host cell by means of transduction. Alternatively, any one or more of the desired components (i.e., minigene, rep sequence, cap sequence, and/or helper functions) can be provided by a stable host cell genetically engineered to contain one or more of the desired components, as is well known to those skilled in the art. Preferably such stable host cells contain the desired components under the control of an inducible promoter. However, the desired component may also be under the control of its own constitutive promoter. Suitable inducible promoters and promoters which themselves constitute suitable regulatory elements for the transgenes are described in the discussion section herein. Alternatively, a selectively stable host cell may also contain optional components under the control of its constitutive promoter as well as other optional components under the control of one or more inducible promoters. For example, a stable host cell may be derived from 293 cells (which contain the E1 helper functions and are under the control of their constitutive promoters), but which also contain rep and/or cap proteins under the control of inducible promoters. Other stable host cells may also be prepared by those skilled in the art.

The minigene, rep sequence, cap sequence and helper functions required for the production of the rAAV of the invention may be introduced into the packaging cell in the form of any genetic element that can introduce the sequences carried by the element into the cell. These selective genetic elements can be introduced by any suitable method, including those described herein. Methods for practicing any embodiment of the invention are well known to those skilled in the art of nucleic acid manipulation, including genetic engineering, recombinant engineering, and synthetic techniques, see Sambrook et al, molecular cloning, A laboratory Manual, Cold spring harbor Press, Cold spring harbor, NY. Likewise, methods for producing rAAV viral particles are well known in the art, and the selection of an appropriate method is not intended to limit the scope of the invention. See, e.g., Fisher et al,J.Virol.，70520-532(1993) and U.S. Pat. No.5,478,745.

A. Small gene

The minigene consists of at least the transgene and its regulatory sequences, AAV5 'and 3' Inverted Terminal Repeats (ITRs). It is this minigene that is packaged into the capsid protein and introduced into the selected host cell.

1. Transgenosis

A transgene is a nucleic acid sequence, different from the vector sequences flanking it, that encodes a polypeptide, protein or other product of interest. The nucleic acid coding sequence is operably linked to regulatory elements which allow the transcription, translation and/or expression of the transgene in the host cell.

The composition of the transgene will vary depending on the use of its vector. For example, one type of transgene sequence comprises a reporter gene sequence, which upon expression can produce a detectable signal. Such reporter genes include, but are not limited to, DNA sequences encoding the following proteins: beta-lactamase, beta-galactosidase (LacZ), alkaline phosphatase, thymokinase, Green Fluorescent Protein (GFP), Chloramphenicol Acetyltransferase (CAT), luciferase, membrane bound proteins such as CD2, CD4, CD8, influenza hemagglutinin protein, and other proteins known in the art to which high affinity antibodies, either directly present or prepared by conventional methods, can bind, comprise fusion proteins of membrane bound proteins appropriately fused to hemagglutinin or an antigen tag region of Myc origin.

These coding sequences, when combined with regulatory sequences that control their expression, provide signals that can be detected by conventional methods, including enzymatic assays, radioisotopic assays, colorimetric assays, fluorescent or other chemiluminescent assays, fluorescence activated cell sorting assays, immunoassays such as enzyme-linked immunosorbent assays (ELISA), Radioimmunoassays (RIA), and immunohistochemical assays. For example, when the marker sequence is the LacZ gene, a vector carrying this signal can be detected by assaying for beta galactosidase activity. When the transgene is green fluorescent protein or luciferase, the color or light signal emitted by the vector carrying the signal can be observed under a microscope.

However, the transgene may also be a non-marker sequence encoding a product for biological or pharmaceutical use, such as a protein, polypeptide, RNA, enzyme or catalytic RNA. Preferred RNA molecules include tRNA, dsRNA, ribosomal RNA, catalytic RNAs, and antisense RNAs. An example of a useful RNA sequence is an RNA that inactivates the expression of a target nucleic acid sequence in the treated animal.

Transgenes may be used to correct or ameliorate gene defects, including those with lower than normal levels of gene expression or those in which a functional gene product is not expressed. A preferred transgene sequence encodes a therapeutic protein or polypeptide that is expressed in a host cell. The invention also relates to the use of multiple genes to correct or ameliorate gene defects caused by multi-subunit proteins. In some cases, different transgenes are used to encode different subunits of a protein, or to encode different polypeptides or proteins. Preferably, the DNA encoding the protein subunit is larger, such as an immunoglobulin, a platelet-derived growth factor, or a dystrophin protein. In order for a cell to produce a multi-subunit protein, it is necessary to transfect the cell with a recombinant virus that is capable of expressing the different subunits simultaneously. Alternatively, different subunits of a protein may be encoded by the same transgene. In this case, the one transgene comprises DNA encoding the different subunits, the DNA encoding each subunit being separated by an internal ribosome binding site (IRES). It is also desirable that the DNA encoding each subunit be small, e.g., the total size of the DNA encoding the subunit and the IRES is within 5 kb. In addition to an IRES, the DNA may be separated by a sequence encoding a 2A polypeptide which is itself cleaved after translation. See m.l.donnelly et al, j.gen.virol., 78 (first part): 13-21 (1997.1); furler, S et al, Gene ther, 8(11):864-873 (2001.6); klump H et al, Gene ther., 8(10):811-817 (2001.5). This 2A polypeptide is much smaller than IRES and is therefore well suited when fragment size becomes a limiting factor. However, a selectable transgene may encode any product that is biologically active or other product, such as a product for study.

Suitable transgenes can be readily selected by those skilled in the art. The choice of transgene is not meant to limit the invention.

2. Adjusting element

In addition to the major elements of the minigene described above, the vector may contain conventional control elements necessary for artificial linkage to the transgene to control its transcription, translation and/or expression in cells transfected with the plasmid vector or infected with the virus of the invention. As described herein, the artificially linked sequences include expression control sequences adjacent to the transgene and trans-acting expression control sequences or expression control sequences that regulate the transgene at a remote location.

Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splice sites and poly a (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that increase translation efficiency (i.e., Kozak consensus sequence); sequences that improve the stability of the protein; if desired, may also contain sequences which increase the secretion of the encoded product. There are many expression control sequences, including native, self-assembled, inducible and/or tissue-specific promoters, well known in the art, that can be used.

Examples of constitutive promoters include, but are not limited to, the retroviral Rous Sarcoma Virus (RSV) LTR promoter (optionally with an enhancer), the Cytomegalovirus (CMV) promoter (optionally with an enhancer) [ see Boshart et al, Cell, 41: 521-.

Inducible promoters are capable of regulating the expression of genes and may themselves be regulated by exogenously added compounds, environmental factors including temperature, or specific physiological states such as acute phase, differentiation stage of the cell or only within the replicating cell. Inducible promoters and inducible systems are available from a number of companies, among which Invitrogen, Clontech and Ariad. Many other systems have been reported and are readily selected by those skilled in the art. Inducible promoters which can be regulated by exogenously added promoters include the zinc-inducible sheep Metallothionein (MT) promoter, the dexamethasone (Dex) -inducible murine mammary gland carcinogen (MMTV) promoter, the T7 polymerase promoter system [ WO 98/10088], the insect ecdysone promoter [ No. et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351(1996) ], the tetracycline inducible system [ Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551(1992) ], the tetracycline inducible system [ Gossen et al, Science, 268:1766-1769(1995), see also Harvey et al, curr. Opin. biol., 2:512-518(1998) ], the 486 inducible system [ Wang et al, Nat. Biotech., 15:239 (1997) and Wang et al, Ware. Biol., 2:512-518(1998) ], the tetracycline inducible system [ Wang et al, the Mare, J2872, 1997, the Mare.: 2872, the inducible system [ Gossen et al, J. 76, J., "Massa et al, 1997) ], the inducible system [. Other inducible promoters useful in the present invention are those regulated by specific physiological conditions, such as stable, acute phase, particular differentiation state or replication state of the cell.

In another embodiment, the native promoter of the transgene itself is used. A native promoter is preferred if it is only desired to achieve native expression levels of the transgene. A native promoter may also be used if expression of the transgene must be regulated transiently, developmentally, or in a tissue-specific manner, or by some specific transcriptional stimulatory signal. In another embodiment, other natural expression control elements such as enhancers, polyadenylation sites, or Kozak consensus sequences may also be used to mimic natural expression.

Another embodiment of the transgene is linked to a tissue specific promoter. For example, if expression in skeletal muscle is desired, a promoter active in muscle tissue should be used. These include promoters of genes encoding the following proteins: skeletal muscle β -actin, myosin light chain 2A, dystrophins, muscle creatine kinase, and synthetic muscle promoters with higher activity than the native promoter (see Li et al, nat. Biotech., 17: 241-. Known tissue-specific promoters are liver tissue-specific (albumin, Miyatake et al, J.Virol., 71:5124-32 (1997); hepatitis B nuclear promoter, Sandig et al, Gene ther., 3:1002-9 (1996); alpha-fetoprotein (AFP), Arbuthenot et al, hum.Gene ther., 7:1503-14(1996)), osteocalcin (Stein et al, mol.biol.Rep., 24:185-96 (1997)); bone sialoprotein (Chen et al, J.bone Miner. Res., 11:654-64(1996)), lymphocyte-specific (CD2, Hansal et al, J.Immunol., 161:1063-8 (1998); immunoglobulin heavy chain; T cell receptor alpha chain), Neuron-specific, e.g., Neuron-specific, enolase (NSE) promoter (Andersen et al, cell.mol.Neurobiol., 13:503-15(1993)), neurofilament light chain gene (Piccioli et al, Proc.Natl.Acad.Sci. USA, 88:5611-5(1991)), and Neuron-specific vgf gene (Piccioli et al, Neuron, 15:373-84 (1995)).

In addition, the plasmid carrying the therapeutic transgene may also contain a selectable marker gene or reporter gene, such as a sequence encoding geneticin, hygromycin or puromycin (puromycin) resistance. Such a selection reporter gene or marker gene (preferably located outside the genome to facilitate recovery by the method of the invention) can be used to indicate the presence of a plasmid, such as an ampicillin resistance gene, in the bacterial cell. Other elements of the plasmid may also include an origin of replication. The choice of these and other promoter and vector elements is conventional and many alternatives are available [ see Sambrook et al, herein incorporated by reference ].

Together, the transgene, promoter/enhancer, and 5 'and 3' ITRs are referred to as a "minigene" for ease of reference herein. According to the present invention, it is suggested that such minigenes can be designed by conventional techniques.

3. Introduction of minigenes into packaging host cells

The minigene may be inserted into any suitable vector, such as a plasmid, and then introduced into the host cell. Plasmids for use in the present invention may be genetically engineered to replicate and integrate in prokaryotic cells, or mammalian cells, or both. These plasmids (or carrying 5'AAV ITR-heterologous-3' ITRs) contain sequences that enable minigenes to replicate in eukaryotic and/or prokaryotic cells, as well as selectable markers for these systems. The selectable marker or reporter gene may include a sequence encoding geneticin, hygromycin or puromycin resistance. The plasmid may also contain a selection reporter gene or marker gene of some kind, such as an ampicillin resistance gene, which can be used to indicate the presence of the plasmid in the bacterial cell. Other elements of the plasmid include an origin of replication and an amplicon, such as the amplicon system of the Epstein Barr virus nuclear antigen. This amplicon system or other similar amplicon element allows for high copy replication of the vector in the form of episomes within the cell. The molecule carrying the minigene is preferably transfected into a cell, which may be transient within the cell. In addition, the minigene (carrying the 5'AAV ITR-derived molecule-3' ITR) can be stably integrated into the genome of the host cell, or integrated into the chromosome, or exist episomally. In certain embodiments, the minigenes are present in multiple copies, forming head-to-head, head-to-tail, or tail-to-tail concatemers. Suitable transfection techniques are well known and can be used to transfect minigenes into host cells.

When minigene-containing vectors are transduced by transfection, the Epstein Barr vector is generally present in an amount of about 5. mu.g to 100. mu.g DNA, preferably about 10 to 50. mu.g DNA, and the number of cells is about 1X10⁴To 1X10¹³Preferably about 10⁵And (4) cells. However, the relative amounts of vector DNA and host cell can be adjusted, primarily taking into account the vector chosen, the method of transduction, the host cell chosen, and the like.

Rep and cap sequences

In addition to the minigene, the host cell contains sequences that drive expression within the host cell of a novel AAV capsid protein (e.g., AAV7 or other novel AAV capsid, or an artificial capsid protein containing one or more fragments of such capsid), as well as rep sequences that are identical in origin to the serotype of the AAV ITRs within the minigene. The cap and rep sequences of the AAV can each be obtained independently from an AAV source and introduced into the host cell by any of the methods described above and known to those skilled in the art. In addition, when a novel class of AAV capsids of the invention is assumed, the sequences encoding each rep protein may be derived from the same AAV serotype, or may be derived from different serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, or a novel serotype identified herein). For example, the rep78/68 sequence may be from AAV2, while the rep52/40 sequence may be from AAV 1.

In one embodiment, the host cell stably expresses the capsid protein under the control of a suitable promoter, as described above. In this embodiment, the capsid protein is preferably under the control of an inducible promoter. In another embodiment, the capsid protein is provided to the host cell in trans. When introduced into a host cell in trans, the capsid protein may be introduced via a plasmid containing the necessary sequences to regulate the expression of the capsid protein in the host cell. When introduced into cells in trans, the plasmid carrying the capsid protein preferably also carries other sequences necessary for rAAV packaging, such as rep sequences.

In another embodiment, the host cell stably comprises a rep sequence under the control of a suitable promoter, as described above. In this embodiment, the rep protein is preferably under the control of an inducible promoter. In another embodiment, the rep protein is provided to the host cell in trans. When introduced into a host cell in trans, the rep protein may be introduced via a plasmid containing the sequences necessary to regulate expression of the rep protein in the host cell. When introduced into cells in trans, the plasmid carrying the capsid protein preferably also carries other sequences necessary for rAAV packaging, such as rep and cap sequences.

Thus, in one embodiment, the rep and cap sequences are transfected into the host cell on the same nucleic acid molecule and are stably present as episomes. In another embodiment, the rep and cap sequences are stably integrated into the genome of the host cell. In yet another embodiment, expression of the rep and cap sequences in the host cell is transient. For example, a nucleic acid molecule transfected in this manner contains a5 'to 3' promoter, optionally with an insert between the promoter and the start site of the rep gene, AAV rep gene and AAV cap gene.

In addition, the vector containing the rep and/or cap sequences may also contain other sequences that are desired to be introduced into the host cell. For example, the vector may include a rAAV construct with a minigene. The vector may contain one or more genes encoding helper functions, such as adenovirus proteins E1, E2a, and E4ORF6, as well as the VAI RNA gene.

The promoter used in this construct may be any of the constitutive, inducible or natural promoters well known to those skilled in the art or described above. In one embodiment, the AAV P5 promoter is used. The selection of which AAV to provide these sequences is not a limitation of the present invention.

In another preferred embodiment, the rep promoter is an inducible promoter, linked to a transgenic regulatory element as described above. One preferred promoter for controlling rep expression is the T7 promoter. T7 polymerase can be expressed by transfecting or transforming a vector containing the cap gene and the rep gene under the control of the T7 promoter into cells. See WO 98/10088, publication date 3/12/1998.

The insert is an optional element in the design of the vector. The insert is a DNA sequence inserted between the promoter and the start site of the rep gene ATG. It may be designed arbitrarily, that is, it may be a nucleotide of random sequence, or a sequence encoding a gene product such as a marker gene. The insert may contain a gene with an initiation/termination site and a polyA site. The insert may be a non-coding DNA sequence, a repetitive non-coding sequence, a coding sequence without transcriptional control or a coding sequence with transcriptional control derived from prokaryotic or eukaryotic cells. Two examples of sources of inserts are the lambda phage step sequence and the yeast step sequence, which are commercially available, e.g., from Gibco or Invitrogen. The insert may be of any length as long as it is sufficient to reduce the expression of the rep78 and rep68 genes to normal expression levels of the rep52, rep40 and cap genes. Thus, the length of the insert may range from about 10bp to about 10.0kb, preferably from about 100bp to about 8.0 kb. In order to reduce the possibility of recombination, the insert fragment is preferably smaller than 2kb, but the present invention is not limited thereto.

Although the molecules of rep and cap may be transiently present in the host cell (e.g., by transfection), it is preferred that one or both of the rep and cap proteins and the promoter controlling their expression be stably expressed in the host cell, i.e., as episomes in the host cell or integrated into the host cell chromosome. The method of constructing this embodiment of the invention is conventional genetic engineering techniques or recombinant engineering techniques, such as those described in the references above. Although specific constructs are illustrated herein, one skilled in the art can select and design other suitable constructs by selecting the insert, P5 promoter, and other elements, including at least a translation initiation signal and a termination signal, and optionally adding a polyadenylation site, based on the description herein.

In another embodiment of the invention, the host cell can stably provide a rep or cap protein.

C. Auxiliary functions

The packaging host cell also requires helper functions to package the rAAV of the invention. These functions may also be provided by the herpes virus. The necessary helper functions are preferably of human or non-human primate adenovirus origin, such as those described above and/or other sources, including American Type Culture Collection (ATCC), Manassas, VA (US). In a presently preferred embodiment, the host cell provides and/or contains an E1a, E1b, E2a and/or E4ORF6 gene product. The host cell may contain other adenoviral genes, such as VAI RNA, but these genes are not required. In a preferred embodiment, the host cell has no additional adenoviral genes or gene functions.

Adenoviral DNA expressing the E1a gene product refers to any adenoviral sequence encoding E1a or any functional E1a protein. The definition of adenoviral DNA expressing the E2a gene product and adenoviral DNA expressing the E4ORF6 gene product is the same. Additionally included are any alleles or other modifications of the adenoviral gene or functional fragments thereof. Such modifications may be deliberately introduced by conventional genetic engineering techniques or by mutagenesis techniques in order to enhance the function of the adenovirus in some way, and may also be naturally occurring allelic mutations. Such modified DNA and methods for its modification are well known to those skilled in the art.

The adenoviral E1a, E1b, E2a and/or E4ORF6 gene products and any other desired helper functions may be provided by any means that allows their expression in a cell. Each sequence encoding these products may be on a separate vector or may be one or more genes on the same vector. The vector may be any vector known in the art or described herein, including plasmids, cosmids, and viruses. Introduction of the vector into the host cell can be accomplished by any method known in the art or described herein, such as transfection, infection, electroporation, lipofection, membrane fusion techniques, high pressure DNA-coated particles, viral infection, and protoplast fusion, among others. One or more adenoviral genes can be stably integrated into the host cell genome, stably expressed episomally, or transiently expressed. The gene products may all be transiently expressed, may all be expressed episomally or stably integrated, or may have a portion of the gene products stably expressed and another portion transiently expressed. Furthermore, the promoter of each adenoviral gene is independently selected and can be a constitutive promoter, an inducible promoter or a native adenoviral promoter. Promoters may be regulated by a particular physiological state of an organism or cell (e.g., differentiation state or replication and quiescence state), or by exogenously added factors.

D. Host cells and packaging cell lines

The host cell itself may be derived from any organism, including prokaryotic cells (e.g., bacteria), eukaryotic cells, such as insect cells, yeast cells, and mammalian cells. Particularly preferred host cells are selected from any mammal, including but not limited to a549, WEHI, 3T3, 10T1/2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO, WI38, HeLa, 293 cells (which may express functional adenovirus E1), Saos, C2C12, L cells, HT1080, HepG2 and primary fibroblasts, hepatocytes and myoblasts derived from mammals, including humans, monkeys, mice, rats, rabbits and hamsters. The mammalian species in which the host cells are provided is not a limitation of the invention, nor is the type of mammalian cell, e.g., fibroblast, hepatocyte, tumor cell, etc. The host cell preferably does not contain any adenoviral genes other than E1, E2a, and/OR E4OR F6, nor any genes of any other virus that undergo homologous recombination with the contaminating virus during rAAV production; the host cell is capable of infecting or transfecting the DNA and of expressing the transfected DNA. In a preferred embodiment, the host cell is a cell stably transfected with rep and cap.

One cell useful in the present invention is a host cell stably transformed with rep and cap encoding sequences, transfected with E1, E2a and/OR E4OR F6 and constructs carrying the minigenes described above. Cell lines stably expressing rep and/or cap, such as those described in B-50(PCT/US98/19463) or those described in U.S. Pat. Nos. 5,658,785, are equally suitable. Another preferred host cell contains minimal adenoviral DNA sufficient to express E4OR F6. Other cell lines can also be constructed using the novel AAV rep and cap sequences of the invention.

The method of making the host cells of the invention involves the assembly of selective DNA sequences. Such assembly may utilize conventional techniques. Including cDNA and genomic cloning techniques, which are well known and described in Sambrook et al, utilize overlapping oligonucleotide sequences of adenovirus and AAV genomes, in conjunction with polymerase chain reaction, synthetic methods, and any other suitable method that provides the desired nucleotide sequence.

Introduction of the molecule (plasmid or virus) into the host cell can also be carried out using techniques well known to the skilled artisan and discussed throughout the specification. In a preferred embodiment, standard transfection techniques are used, such as CaPO₄Transfection or electroporation methods, and/or infection of cell lines such as the human embryonic kidney cell line HEK293 (a human kidney cell line containing a functional adenovirus E1 gene encoding the cis-acting E1 protein) by adenovirus/AAV vector hybrids.

These novel AAV-derived vectors prepared by those skilled in the art are useful for gene transfer into selected cells and for gene therapy of patients, since no neutralizing antibody against AAV7 has been found in the human population. Furthermore, early studies showed that there were no neutralizing antibodies in cynomolgus monkeys and chimpanzees, and that AAV7 cross-reactivity was less than 15% in cynomolgus monkeys, a serotype isolated from this species. Other rAAV viral vectors containing the AAV7 capsid proteins described herein can be readily prepared by those skilled in the art using techniques well known to those skilled in the art. Vectors produced using other novel AAV of the invention also have the same advantages.

Thus, those skilled in the art will readily appreciate that the AAV7 sequences of the present invention are suitable for the preparation of these and other viral vectors for gene transfer in vitro and in vivo. Likewise, other fragments of the novel AAV genomes of the present invention can be readily selected by those skilled in the art for use in various rAAV and non-rAAV vector systems. Such vectors include lentiviruses, retroviruses, poxviruses, vaccinia viruses, and the like. The choice of which viral system is not a limitation of the present invention.

Thus, the invention also relates to vectors prepared using the nucleic acid and amino acid sequences of the novel AAV of the invention. Such vectors have a variety of uses, including the transfer of therapeutic molecules and for the preparation of vaccines. The transfer therapeutic molecule is preferably a recombinant AAV comprising the novel AAV capsid of the present invention. These vectors, or other vectors containing the novel AAV sequences of the present invention, may also be used in vaccine treatment regimens, such as co-transfection with cytokines or transfection of the immunogen itself.

V. recombinant virus and uses thereof

Using the methods described herein, one skilled in the art can prepare rAAV comprising a novel serotype capsid of the invention or a novel capsid with one or more novel fragments of an AAV serotype identified using the methods of the invention. In one embodiment, the full-length capsid used is from one serotype, AAV7[ SEQ ID NO:2 ]. In another embodiment, full-length capsids are prepared by fusing one or more fragments of a novel serotype of the invention in frame with sequences of other AAV serotypes. For example, a rAAV may contain one or more novel hypervariable regions of an AAV serotype of the invention. In addition, the unique AAV serotypes of the present invention can also be used in vectors containing other viral or non-viral sequences.

One skilled in the art will readily appreciate that embodiments comprising a particular serotype of the present invention are particularly suited for a particular purpose. For example, the AAV7 capsid-derived vector of the present invention is particularly suitable for use in muscle, whereas the rh.10(44-2) capsid-derived vector of the present invention is particularly suitable for use in lung. The use of such vectors is not so limited and those skilled in the art can also use these vectors in other types of cells, tissues or organs. Moreover, other capsid-derived vectors of the invention may also be used to transfect these and other cells, tissues or organs.

A. Delivery of transgenes

Another aspect of the invention relates to methods for delivering a transgene to a host comprising transfecting or infecting a selected host cell with a vector prepared from an AAV sequence of the invention. Methods of gene transfer are well known to those skilled in the art and do not represent a limitation of the present invention.

In a preferred embodiment, the invention provides a method for introducing a transgene into a host using AAV-mediated transfer. The method comprises transfecting or infecting a selected host cell with a recombinant viral vector comprising a selected transgene under the control of control sequences which regulate the expression of the transgene and AAV capsid proteins.

The host-derived sample may also optionally be assayed for the presence of antibodies to the selected AAV serotype. Various methods of detecting neutralizing antibodies are well known to those skilled in the art. The choice of analytical method is not meant to limit the invention. See Fisher et al, Nature Med., 3(3): 306-. The results of the analysis can be used to determine whether an AAV vector containing a capsid protein of a particular serotype is suitable for gene transfer, i.e., whether there are no antibodies specific for the serotype capsid.

In one aspect of the method, transfer of the vector having the selected AAV capsid protein can occur before or after transfer of a gene by a vector containing a capsid protein of a different AAV serotype. Therefore, the gene transfer method by the rAAV vector can repeatedly transfer the gene into one host cell. The post-transferred rAAV vector may carry the same genes as the first rAAV vector, but may contain capsid proteins that are of different serotype origin from the capsid proteins of the first vector. For example, if the first vector has AAV7 capsid protein [ SEQ ID NO:2], the capsid protein contained in the post-transfer vector can be selected from other serotypes, such as AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV6, AAV10, AAV11, and AAV12, as well as any other novel AAV capsids identified herein, including, without limitation, A3.1, H2, H6, C1, C2, C5, A3-3, A3-7, A3-4, A3-5, 3.3B, 223.4, 223-5, 223-10, 223-2, 223-7, 223-6, 44-1, 44-5, 44-2, 42-15, 42-8, 42-13, 42-3A, 42-4, 42-5A, 42-1B, 42-5B, 43-1, 43-12, 43-5A, 43-21, 43-25, 43-20, 24.1, 42.2, 7.2, 27.3, 16.3, 42.10, 42-3B, 42-11, F1, F5, F3, 42-6B, and/or 42-12.

The recombinant vector can be introduced into a host cell by a method reported in the literature. RAAV is preferably gelled, suspended in a physiologically compatible medium, and then injected into a human or non-human mammal suffering from the disease. One skilled in the art can select an appropriate medium depending on the transferred virus. For example, suitable media include saline solutions, which can be mixed with various buffers (e.g., phosphate buffer) to form a formulation. Other media include sterile saline solutions, lactose solutions, sucrose solutions, calcium phosphate solutions, dextrose, agar, pectin, peanut oil, sesame oil, and water. The choice of medium is not meant to limit the invention.

In addition to the rAAV and vehicle, the compositions of the invention may contain other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers. Suitable preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerol, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

The viral vector should transfect the cells in sufficient quantities to achieve a sufficiently high transfection efficiency and expression level to achieve a therapeutic effect of the unintended side effects, or to achieve a predictable physiological effect, as can be determined by those skilled in the medical arts. Conventional and pharmaceutical routes of administration include, without limitation, direct injection into the selected organ (e.g., intravenous perfusion to the liver), oral, inhalation (including intranasal and intratracheal inhalation), eye drop, intravenous, intramuscular, subcutaneous, intradermal, and other systemic routes of administration. Several routes of administration may also be used in combination if desired.

The dosage of the viral vector is determined mainly by the kind of the disease, the age, weight and health condition of the patient, and the dosage varies from patient to patient. For example, an effective amount of viral vector for treating humans is generally between about 1ml and 100ml of solution, and contains about 1X10 viruses⁹-1×10¹⁶. The preferred dosage for humans is about 10¹³-1×10¹⁶AAV genome. The dosage can be adjusted according to the balance of therapeutic effect and side effects, and the dosage can be different according to the therapeutic purpose to be achieved by the recombinant virus. The expression level of the transgene can be monitored to determine the frequency of administration, preferably with AAV vectors containing a minigene. Immunization may also be carried out using the same dosage regimen as the treatment regimen.

Examples of transfection of AAV-containing vectors of the invention for therapy or immunization are described below. These vectors may be used in various therapeutic or vaccine immunization protocols, as described herein. In addition, these vectors may be administered with one or more other vectors or active components in a desired therapeutic and/or vaccine regimen.

B. Therapeutic transgenes

Transgenes encode therapeutic products including hormones and growth and differentiation factors including, but not limited to, insulin, glucagon, Growth Hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GFR), gonadotropin (FSH), Luteinizing Hormone (LH), human chorionic gonadotropin (hCG), Vascular Endothelial Growth Factor (VEGF), angiopoietin, angiostatin, Granulocyte Colony Stimulating Factor (GCSF), Erythropoietin (EPO), Connective Tissue Growth Factor (CTGF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), Epidermal Growth Factor (EGF), transforming growth factor alpha (TGF alpha), platelet-derived growth factor (PDGF), insulin-like growth factors I and I (IGF-I and IGF-II), any member of the transforming growth factor beta superfamily, insulin-like growth factors, and differentiation factors, Including TGF beta, Noslon phenylpropionate, inhibin, any of Bone Morphogenetic Protein (BMP) BMPs 1-15, any of the growth factor's regulin/neuregulin/ARIA/Neu Differentiation Factor (NDF) family, Nerve Growth Factor (NGF), brain derived nerve growth factor (BDNF), neurotrophic factors NT-3 and NT-4/5, ciliary neurotrophic factor (CNTF), glial cell derived neurotrophic factor (GDNF), neurturin, agrin, any member of the semaphorin/Waspawlin family, netrin-1 and netrin-2, Hepatocyte Growth Factor (HGF), ephrins, noggin, sonic hedgehog and tyrosine hydrolase.

Other useful transgene products include proteins that modulate the immune system, including but not limited to cytokines and lymphokines, such as Thrombopoietin (TPO), Interleukins (IL) IL-1 through IL-25 (including IL-2, IL-4, IL-12, and IL-18), monocyte chemotactic protein, leukemia inhibitory factor, granulocyte macrophage colony stimulating factor, Fas ligand, tumor necrosis factors alpha and beta, interferons alpha, beta, and gamma, stem cell factor, flk-2/flt3 ligand. Gene products produced by the immune system may also be used in the present invention. Including, but not limited to, immunoglobulins IgG, IgM, IgA, IgD, and IgE, chimeric immunoglobulins, humanized antibodies, single chain antibodies, T cell antibodies, class I and class II MHC molecules, and genetically engineered immunoglobulins and MHC molecules. Useful gene products also include complement regulatory proteins such as complement regulatory protein, Membrane Cofactor Protein (MCP), accelerated decay factor (DAF), CR1, CF2, and CD 59.

Other useful gene products also include any receptor for hormones, growth factors, cytokines, lymphokines, regulatory proteins, and immune system proteins. The present invention includes receptors for cholesterol regulin, including Low Density Lipoprotein (LDL) receptors, High Density Lipoprotein (HDL) receptors, Very Low Density Lipoprotein (VLDL) receptors, and scavenger receptors. The gene products encompassed by the present invention are also members of the steroid hormone receptor superfamily, including glucocorticoid receptors and estrogen receptors, vitamin D receptors, and other nuclear receptors. In addition, useful gene products also include transcription factors such as jun, fos, max, mad, Serum Response Factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C/EBP, SP1, CCAAT-box binding proteins, interferon regulatory factor (IRF-1), wilms' tumor protein, ETS-binding protein, STAT, GATA-box binding protein, i.e., GATA-3, and the forkhead family of winged helix proteins.

Other useful gene products include carbamoyl synthetase I, ornithine carbamoyltransferase, arginine succinyl synthetase, arginine succinyl lyase, arginase, fumarate acetoacetate hydrolase, phenylalanine hydrolase, alpha-1 antitrypsin, glucose-6-phosphatase, porphobilinogen deaminase, factor VIII, factor IX, cystathionine beta synthase, branched chain keto acid decarboxylase, albumin, isovaleryl-coa dehydrogenase, propionyl-coa carboxylase, methylmalonate monoacyl-coa mutase, glutaryl-coa dehydrogenase, insulin, beta-glucosidase, pyruvate carboxylase, liver phosphorylase, phosphorylase kinase, glycine decarboxylase, H-protein, T-, protein, Cystic Fibrosis Transmembrane Regulator (CFTR) sequence, and dystrophin cDNA sequence. Other useful gene products include enzymes such as those used in alternative therapies, and may be used for various diseases caused by a lack of enzymatic activity. For example, enzymes containing mannose-6-phosphate may be used to treat lysosomal storage diseases (e.g., encoding β -Glucuronidase (GUSB)).

Other useful gene products include non-native polypeptides, such as chimeric or hybrid polypeptides having a non-native amino acid sequence, with amino acid insertions, deletions, or substitutions. For example, artificial single chain immunoglobulins may be used to treat certain immunodeficient patients. Other types of non-native gene sequences, including antisense molecules and catalytic nucleic acids, such as ribozymes, can be used to reduce overexpression of a target gene.

Reducing and/or altering expression of a gene is particularly suitable for treating hyperproliferative diseases characterized by hyperproliferation of cells, such as tumors and ichthyosis. Target polypeptides include those that are overexpressed or highly expressed, and those that are expressed at much higher levels in hyperproliferative cells than in normal cells. Target antigens include polypeptides encoding oncogenes such as myb, myc, fyn, and translocation genes bcr/abl, ras, src, P53, neu, trk, and EGRF. In addition to oncogene products as target antigens, target polypeptides for anti-tumor gene therapy and protective therapeutic measures are the variable regions of various antibodies produced by B cell lymphomas and the variable regions of T cell receptors of T cell lymphomas, which in certain embodiments are also useful as target antigens for the treatment of autoimmune diseases. Other tumor-associated polypeptides may also be used as target polypeptides, such as polypeptides expressed at high levels in tumor cells, including polypeptides recognized by monoclonal antibody 17-A and folate binding polypeptides.

Other suitable therapeutic polypeptides and proteins include those useful in treating autoimmune patients and patients suffering from diseases caused by a broad protective immune response against a target associated with autoimmunity in cellular receptors and cells producing autoimmune antibodies. T cell mediated autoimmune diseases include Rheumatoid Arthritis (RA), Multiple Sclerosis (MS),

Syndromes, sarcoidosis, Insulin Dependent Diabetes Mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, ichthyosis, vasculitis, Wegener's granulomatosis, crohn's disease, and ulcerative colitis, each characterized by T-cell receptors that bind to endogenous antigens to activate the inflammatory cascade associated with autoimmune disease.

C. Immunogenic transgenes

In addition, the vectors of the invention also contain the AAV sequences of the invention and transgenes encoding peptides, polypeptides and proteins that are capable of inducing an immune response to a target immunogen. For example, the immunogen may be selected from a variety of virus families. Including picornavirus family, such as rhinoviruses, account for 50% of the causative factors of cold; enteroviruses, including poliovirus, coxsackievirus, echovirus, and human enteroviruses such as hepatitis a virus; and the genus aptovirus, which is the major virus causing foot-and-mouth disease in non-human animals. Target antigens within members of the picornavirus family include VP1, VP2, VP3, VP4, and VPG. Another family of viruses is the calcivirus family, which includes the Norwalk family of viruses, and is the major causative virus of epidemic gastroenteritis. Target antigens for inducing immune responses in human and non-human animals are also directed against the Togavirus family, which includes alphaviruses such as Sindbis virus, RossRiver virus, Venezuelan equine encephalitis virus, eastern equine encephalitis virus, Western equine encephalitis virus, and rubella virus of the genus rubella. The flavivirus family includes dengue virus, yellow fever virus, japanese encephalitis virus, st-louis encephalitis virus, and tick encephalitis virus. Additional target antigens can be prepared from the hepatitis B virus and coronavirus families, which include a variety of non-human viruses, such as infectious bronchitis virus (poultry), porcine transmissible gastrointestinal virus (pig), porcine thromboencephalomyelitis virus (pig), feline infectious peritonitis virus (cat), canine coronavirus (dog), and human respiratory coronavirus, which can cause the common cold and/or non-A, non-B non-C hepatitis. Target antigens from the coronavirus family include E1 (also known as M or matrix protein), E2 (also known as S or Spike protein), E3 (also known as HE or hemagglutin-enterose) glycoprotein (not all coronaviruses are present) or N (nucleocapsid). Other antigens may be targets of the rhabdovirus family, including the vesiculoviruses (e.g., vesicular stomatitis virus) and the rabies virus in general (e.g., rabies). Suitable antigens within the rhabdovirus family may be derived from either the G protein or the N protein. Filoviridae, including hemorrhagic fever viruses such as Marburg and Ebola, are also suitable sources of antigen. The paramyxovirus family includes parainfluenza virus type 1, parainfluenza virus type 3, bovine parainfluenza virus type 3, rubulaviruses (mumps virus, parainfluenza virus type 2, parainfluenza virus type 4), newcastle disease virus (chicken), rinderpest virus, measles virus, including measles and canine distemper, pneumovirus, including respiratory syncytial virus. Influenza viruses belong to the orthomyxovirus class and are also suitable sources of antigen (e.g., HA protein, N1 protein). The bunyavirus family includes the genus bunyavirus (California encephalitis virus, La Crosse), the genus phlebovirus (Rivastigrina), the genus Hantavirus (puremala is a hemahagin lever virus), the genus Enovirus (Nairobi sheep disease), and various unclassified bunaviruses. LCM and lasasa fever viruses of the arenavirus family are also one of the sources of antigens. The reovirus family includes the genus reovirus, rotavirus (causing acute gastroenteritis in children), orbivirus, cutivirus (colorado tick fever, Lebombo (human), equine encephalitis, blue tongue).

The retrovirus family includes the oncorivinic subfamily, among which are feline leukemia viruses, HTLVI and HTLVII, which cause human or veterinary disease, the lentivirus subfamily, which includes Human Immunodeficiency Virus (HIV), Simian Immunodeficiency Virus (SIV), Feline Immunodeficiency Virus (FIV), equine infectious anemia virus, and the foamy virus subfamily. There are many suitable antigens in HIV and SIV and alternatives have been described herein. Suitable HIV and SIV antigens include, but are not limited to, gag, pol, Vif, Vpx, VPR, Env, Tat and Rev proteins, and various fragments thereof. In addition, various modifications to these antigens are also described herein. Suitable antigens for this purpose are well known to those skilled in the art. For example, one sequence may be selected that encodes gag, pol, Vif, and Vpr, Env, Tat and Rev, as well as other proteins. See U.S. patent 5,972,596 for a modified gag protein. See also D.H. Barouch et al, J.Virol., 75(5):2462-2467(2001.3), and R.R. Amara et al, Science, 292:69-74 (2001.4.6). These proteins and their subunits can be transduced individually or in combination by different vectors or a single vector.

The papovavirus family includes the sub-family polyomaviruses (BKU and JCU viruses) and the sub-family papilloma viruses (associated with tumors or malignant changes in papilloma). The adenovirus family includes viruses (EX, AD7, ARD, o.b.) that primarily cause respiratory disease and/or enteritis. The parvovirus family includes feline parvovirus (feline enteritis), feline panleucophilus, canine parvovirus, and porcine parvovirus. The herpes virus family includes the sub-family of herpes viruses a, of which the genera herpes simplex (HSVI, HSVII), varicella (pseudorabies, varicella, shingles) and the sub-family of herpes beta, of which the genera cytomegalovirus (HCMV, murine cytomegalovirus) are included, and the sub-family of herpes viruses c, of which the sub-family of lymphoid follicular viruses, EBV (burkitt's lymphoma), infectious rhinotracheitis, Marek's disease virus and rhadinovirus are included. The poxvirus family includes the subgenus chordopoxvirinae, among which are the orthopoxvirus genera (smallpox and vaccinia), parapoxvirus, avipoxvirus, capripoxvirus, lagomopoxvirus, suipoxvirus, and entomopoxvirus subfamilies. The hepadnavirus family includes hepatitis b virus. One unclassified virus that can serve as a source of antigen is the hepatitis virus. Other viruses include avian infectious bursal disease virus and porcine respiratory and reproductive syndrome virus. The alphavirus family includes equine arterivirus and various encephalitis viruses.

The invention also includes immunogens which are useful for immunizing a human or non-human animal against a pathogen, such as a bacterium, a fungus, a parasitic microorganism or a parasite, which may infect a human or non-human vertebrate, or which may be derived from a cancer or tumor cell. Bacterial pathogens include pathogenic gram-positive cocci such as pneumococci, staphylococci and streptococci; pathogenic enteric gram-negative cocci such as enterobacteriaceae (enterobacteriaceae); meningococcus, gonococci. Pathogenic enteric gram-negative bacilli such as pseudomonas; acinetobacter; (ii) an Airkinje bacterium; melioidosis similar to nose; salmonella; shigella bacteria; haemophilus; moraxella; haemophilus ducreyi (h. ducreyi) (causing chancroid); brucella; franisella tularensis (tularemia); yersinia (pasteurella); streptococci, streptococci and spirochetes; gram-positive bacilli include listeria monocytogenes; erysipelothrix rhusiopathiae; corynebacterium diphtheriae (diphtheria); cholera; bacillus anthracis (anthrax); groin granuloma (groin granuloma); and bartonella bacilliform. Diseases caused by pathogenic anaerobic bacteria include tetanus; botulism; other clostridial diseases; tubercle bacillus; leprosy; and other mycobacteria. Diseases caused by pathogenic spirochetes include syphilis; treponematoses; indian pox; trypanosomiasis and endemic syphilis; and leptospirosis. Other infections caused by higher pathogenic bacteria and pathogenic fungi include actinomycosis; nocardiosis; cryptococcosis; bacterial wilt of the yeast; histoplasmosis capsulata; coccidioidomycosis; candidiasis; aspergillosis; mucormycosis; sporotrichosis; paracoccidioidomycosis, petriidiosis, torulopsosis, mycosis pedis and chromomycosis; and beriberi. Rickettsial infections include typhus, rocky mountain spotted fever, Q fever and rickettsial fever. Mycoplasma and chlamydial infections including mycoplasma pneumonia; lymphogranuloma venerum; parrot fever; and perinatal chlamydial infections. Pathogenic eukaryotes including pathogenic parasites and helminths and infections caused thereby, such as amebiasis; malaria; leishmaniasis; trypanosomiasis; toxoplasmosis; pneumocystis carinii disease; trichans; toxoplasma gondii (Toxoplasma gondii); babesiosis; giardiasis pyriformis; trichoderma; filariasis; schistosomiasis; nematode disease; trematosis or trematode; and tapeworm infections.

Many of these organisms and their produced toxins have been identified by the centers for disease control [ (CDC), Department of health and Human Services (Department of health and Human Services), USA ], and some of them have the potential to be used as agents for biological attack. For example, there are Bacillus anthracis (anthrax), Clostridium botulinum and its toxins (botulism), plague bacillus (plague), smallpox variola major (smallpox), Francisella tularensis (tularemia), and viral hemorrhagic fever, all of which are now classified as class A factors; coxiella berghei (Q fever), brucella (brucellosis), pseudomonas rhinomelis (gangrene), ricin and its toxin (ricin), clostridium perfringens and its toxin (toxin), staphylococcus and its toxin (enterotoxin B), all of which are now classified as class B factors; nipan and Hantaviruses are now classified as class C agents. In addition, other microorganisms so classified or not so classified may also be identified and used for this purpose in the future. It will be readily appreciated that viral vectors and other constructs described herein may be used to transfer antigens from these organisms, viruses, toxins or other by-products thereof, to prevent and/or treat infection or other side effects caused by these biological agents.

Delivery of immunogens against the variable region of T cells via the vectors of the present invention may elicit immune responses including CTLs to eliminate these T cells. Several specific variable regions have been identified on T Cell Receptors (TCRs) that function in Rheumatoid Arthritis (RA), including V-3, V-14, V-17 and V α -17. Thus, transduction of a nucleic acid sequence encoding at least one such polypeptide may elicit an immune response against T cells in RA. Several specific variable regions have been identified on T Cell Receptors (TCRs) that function in Multiple Sclerosis (MS), which comprise V-7 and V.alpha.10. Thus, transduction of a nucleic acid sequence encoding at least one such polypeptide may elicit an immune response against T cells in MS. Several specific variable regions have been identified on T Cell Receptors (TCRs) that function in scleroderma, including V-6, V-8, V-14, V α -16, V α -3C, V α -7, V α -14, V α -15, V α -16, V α -28, and V α -12. Thus, transduction of a nucleic acid sequence encoding at least one such polypeptide can elicit an immune response against T cells in scleroderma.

In addition, vectors of the invention containing AAV sequences can be transferred using prime-boost (prime-boost) protocols. Many such protocols have been reported in the art and are readily selected. See WO 00/11140, published as 2000, 3.2.d., which is incorporated herein by reference.

Such prime-boost regimens generally involve administration of a DNA (e.g., plasmid) vector to prime the immune system and then boosting the immune response by administering a conventional antigen, such as a protein or a recombinant virus carrying a sequence encoding the antigen. In one embodiment, the invention provides a prime-boost regimen to elicit an immune response against a selected antigen by first transferring a plasmid DNA vector carrying the antigen and then boosting, i.e., transferring a vector comprising an AAV sequence of the invention.

In one embodiment, the prime-boost regimen comprises priming and/or boosting the expression of the polyprotein within the vector. See R.R.Amara, Science, 292:69-74(6April 2001), which describes a multi-protein protocol for expressing protein subunits for eliciting immune responses against HIV and SIV. For example, a DNA base vector can transfer Gag, Pol, Vif, VPX and Vpr and Env, Tat, and Rev with one transcript. In addition, Gag, Pol and Env of HIV-1 from SIV were also transferred.

However, prime-boost regimens are not limited to immunization by HIV or transfer of these antigens. For example, the basic immunization is a transfer of a first chimpanzee vector of the invention followed by boosting with a second chimpanzee vector or a composition containing the antigen in protein form. In one example, a prime-boost regimen may provide a protective immune response to the virus, bacteria, or other microorganism from which the antigen is derived. In another preferred embodiment, the basic-booster regimen achieves a therapeutic effect that can be detected using conventional assays.

The base vaccine can be injected in a dose-dependent manner into various parts of the body, primarily depending on the target antigen of the immune response to be elicited. The present invention is not limited to the amount or site of injection and the pharmaceutically acceptable carrier. The treatment regimen for the basic immunization step may be a single dose, or may be an hourly, daily, weekly, monthly, or yearly dose. For example, the mammal may receive 1-2 injections at a dose of about 10. mu.g to 50. mu.g of plasmid containing vector. The preferred dose of the base immunization or base DNA vaccine composition is about 1. mu.g to about 10,000. mu.g of DNA vaccine. The dosage may also be about 1. mu.g to 1000. mu.g DNA per kg body weight. The amount or site of injection is selected based on the identity and physical condition of the immunized animal.

Described herein are dosage units suitable for transferring an antigen to a desired DNA vaccine in a mammal. The DNA vaccine for injection should be suspended or dissolved in a pharmaceutically or physiologically acceptable medium, such as isotonic saline, isotonic saline solution or other formulations, which are well known to those skilled in the art of drug injection. It will be clear to the skilled person which are suitable media, which is selected primarily according to the route of injection. The composition of the present invention can be injected by the above-mentioned routes, in the form of a sustained-release preparation made of biodegradable biocompatible polymer, or in the form of an in-situ injection preparation made of micelle, gel and liposome.

In addition, the primary immunization step of the invention further comprises the injection of the primary DNA vaccine composition, a suitable amount of an adjuvant, as defined herein.

For mammals, boosting is preferably performed about 2 to 27 weeks after injection of the primary DNA vaccine. The refraction of the boosting composition is by an effective amount of a boosting vaccine composition that contains or is capable of transferring the same antigen administered by the base DNA vaccine. The boosting composition consists of recombinant viral vectors derived from the same virus or different viruses. Alternatively, a "boosting composition" may contain the same antigen as that encoded by the base DNA vaccine, except that the antigen is present in the form of a protein or peptide, which composition may induce an immune response in the host. In another embodiment, the boosting composition comprises a composition comprising a DNA sequence encoding an antigen under the control of regulatory sequences which control its expression in mammalian cells, and a vector such as a known bacterial or viral vector. An essential requirement of a boosting composition is that the antigen in the vaccine composition is the same as or a cross-reactive antigen encoded by the DNA vaccine.

The vectors of the invention are also suitable for use in immunization protocols involving non-AAV vectors or proteins, peptides or other biological therapeutic or immunological compounds. These protocols are particularly suitable for therapy and immunization by gene transfer, including the induction of protective immunity. Such applications are well known to those skilled in the art.

The vectors of the invention are also useful gene therapy tools that can introduce a selected transgene into a selected host cell in vivo or in vitro, even if the organism contains neutralizing antibodies to one or more AAV serotypes. In one embodiment, the vector (i.e., rAAV) and the cell may be mixed in vitro; culturing the infected cells by conventional methods; the transduced cells are then injected into the patient. Furthermore, the vectors of the present invention can also be used to prepare desired gene products in vitro. For in vitro production, a host cell is transfected with a rAAV containing a molecule encoding a product of interest, the cell is cultured under conditions suitable for its expression, and the desired product (e.g., protein) is then obtained from the cell culture. Then purifying and separating the expression product. Suitable transfection, cell culture, purification and isolation techniques are well known to those skilled in the art.

The following examples illustrate several aspects and embodiments of the present invention.

Examples

Example 1: PCR amplification, cloning and characterization of novel AAV sequences

Primers were designed based on oligonucleotides of highly conserved regions of known AAV and PCR was used to screen for AAV sequences in non-human primate tissues. A segment of AAV sequences spanning AAV1[ SEQ ID NO:6]2886-3143bp, in which the hypervariable region on the capsid protein (Cap) differs from all other known AAV serotypes, designated herein as "signature region", flanked by conserved sequences, served as PCR amplicons. Subsequent analysis revealed that this characteristic region is located between conserved residues in hypervariable region 3.

The primate subclasses from which AAV could be detected were found to be rhesus monkey, cynomolgus monkey, chimpanzee and baboon by preliminary screening of a panel of non-human primate peripheral blood samples. However, AAV has not been found in some other subclasses of animals tested, including Japanese apes, porcine tailed monkeys, and squirrel monkeys. The overall distribution of AAV sequences in the tissues was found by performing a centralized analysis of vector distribution in tissues of macaques raised at the university of Pennsylvania and by deplaning animal carcasses.

Amplification of AAV characteristic regions

The DNA sequences of AAV1-6 and AAV isolated from goose and duck are aligned to each other with "Clustal W" in a default setting. FIG. 1 shows the alignment of AAV1-6 and AAV 7. The similarity of AAV sequences was compared.

In one set of studies, a 257bp region spanning AAV1[ SEQ ID NO:6]2886bp-3143bp and the corresponding region on the AAV2-6 genome [ see FIG. 1] were identified by the inventors. This region is located on the AAV capsid gene, and is highly conserved at both the 5 'and 3' ends, with the middle region being relatively variable. In addition, this region contains a DraIII restriction site (CACCACGTC, SEQ ID NO: 15). The inventors have found that this region can be used as a specific characteristic region of all known types of AAV DNA. In other words, this region can be used to define the amplified DNA as serotype 1, 2, 3, 4, 5, 6 or other serotypes, by PCR reactions, digestion with endonucleases of known serotype specificity and gel electrophoresis.

Primers were designed, validated and PCR conditions optimized using AAV1, 2 and 5DNA as controls. The design of the primers was based on the sequence of AAV 2:5 'primer, 2867-2891 and 3' primer of bp AAV2(SEQ ID NO:7), 18as, bp 3095-3121 of AAV2(SEQ ID NO: 7).

The result of analyzing cell DNA from different tissues of different macaques, such as blood, brain, liver, lung, testis, etc. by the method shows that strong PCR amplification products can be obtained from the DNA of different tissues of the monkeys. Restriction analysis of the PCR products revealed that these products were amplified from AAV sequences, unlike all published AAV sequences.

PCR products (about 255bp long) amplified from DNA of various monkey tissues were cloned and sequenced. Bioinformatic analysis of these novel AAV sequences revealed that they were capsid genes of the novel AAV sequences and were different from each other. FIG. 1 shows novel AAV signature regions of AAV10-12 [ SEQ ID NOS: 117, 118 and 119 ]. Multiple sequence alignment analysis was performed using the Clustal W (1.81) program. The percentage sequence identity between characteristic regions of the AAV1-7 and AAV10-12 genomes is given below.

TABLE 1 sequences analyzed

Serial number	AAV serotypes	Fragment size (bp)
			1	AAV1	258
2	AAV2	255
			3	AAV3	255
4	AAV4	246
			5	AAV5	258
6	AAV6	258
			7	AAV7	258
10	AAV10	255
			11	AAV11	258
12	AAV12	255

TABLE 3 pairwise alignment (percentage of identity)

	AAV2	AAV3	AAV4	AAV5	AAV6	AAV7	AAV10	AAV11	AAV12
										AAV1
	90	90	81	76	97	91	93	94	93
										AAV2		93	79	78	90	90	93	93	92
AAV3			80	76	90	92	92	92	92
										AAV4				76	81	84	82	81	79
AAV5					75	78	79	79	76
										AAV6						91	92	94	94
AAV7							94	92	92
										AAV10								95	93
AAV11									94

A total of 300 clones containing the novel AAV serotypes with a selected 257bp region were isolated and sequenced. Bioinformatics analysis of the 300 clones revealed that the 257bp region can be used as a superior marker sequence for the isolation and identification of novel AAV serotypes

B. PCR amplification using characteristic regions

The 257bp characteristic region can be used as a PCR anchor to extend a PCR amplicon to the 5 'end of the genome to cover the connection region of the rep gene and the cap gene (1398bp-3143bp, SEQ ID NO:6), and can also extend to the 3' end of the genome to obtain a complete cap gene sequence (2866bp-4600bp, SEQ ID NO: 6). PCR amplification is carried out by standard method, denaturation at 95 deg.C for 0.5-1min, annealing at 60-65 deg.C for 0.5-1min, extension at 72 deg.C for 1min/kb, and 28-42 cycles.

Using the alignment described in "A", two other relatively conserved regions were found in two sequences, one located at the 3' end of the rep gene, the 5' end of which points to the 257bp sequence, and the other located downstream of the 257bp fragment but before the AAV 3' ITR. To amplify the complete capsid sequence and partial rep sequence of a novel AAV serotype, two new primer pairs were designed and PCR conditions were optimized. To improve specificity, the 5' end amplification primer: the 5 'primer is AV1Ns, GCTGCGTCAACTGGACCAATGAGAAC [ nt1398-1423 of AAV1, SEQ ID NO:6], and the 3' primer is 18as described above. 3' amplification primer: the 5 'primer is the above-mentioned 1s, and the 3' primer is AV2Las, TCGTTTCAGTTGAACTTTGGTCTCTGCG [ nt 4435-4462 of AAV2, SEQ ID NO:7 ].

For these PCR amplifications, the 257bp region was used as a PCR anchor and landing marker to generate overlapping fragments to construct the complete capsid gene, which were fused via DraIII sites within the signature region after amplification of the 5 'and 3' extension fragments as described herein. In order to amplify the complete AAV7 cap gene more specifically, the characteristic region sequences of three amplification products (a) are respectively added according to the instruction; (b) a 5' extension sequence; (c) the 3' extension was cloned into pCR4-Topo [ Invitrogen ] plasmid. The plasmid was then digested with DraIII and recombined to form the entire cap gene.

In this set of experiments, about 80% of the capsid sequences of AAV7 and AAV8 were isolated and analyzed. Another new serological type, AAV9, was also found in monkey # 2.

Using the PCR conditions described above, the remainder of the AAV rep gene was isolated and cloned using primers that amplified a region of 108bp to 1461bp of the AAV genome (calculated based on SEQ ID NO:7 numbering of AAV 2). This clone was sequenced and used to construct the ITR-free complete AAV7 genome.

C. Direct amplification of 3.1kb Cap fragment

To amplify a3.1 kb full-length Cap fragment directly from NHP tissue and blood DNA, two additional highly conserved regions were identified in the AAV genome for PCR amplification of large fragments. A primer (AV1ns:5' GCTGCGTCAACTGGACCAATGAGAAC 3', nt1398-1423 of SEQ ID NO:6) located in the middle conserved region of the rep gene and a 3' primer (AV2cas:5' CGCAGAGACCAAAGTTCAACTGAAACGA 3', SEQ ID NO:7) located in another conserved region downstream of the Cap gene were selected to amplify the full-length Cap fragment. The PCR products were cloned into Topo according to the manufacturer's instructions (Invitrogen) and sequence analyzed using Qiagengenomics (Qiagengenomics, Seattle, WA) to show greater than 99.9% accuracy. In total 50 capsid sequence clones were isolated and identified, of which 37 clones were derived from macaques (rh.1-rh.37), 6 clones were derived from cynomolgus monkeys (cy.1-cy.6), 2 clones were derived from baboons (bb.1 and bb.2), and 5 clones were derived from chimpanzees (ch.1-ch.5).

To rule out the possibility that the sequence diversity within the novel AAV family is due to PCR errors, such as PCR-mediated gene splicing by overlap extension between different portions of the DNA template and homologous sequences, or bacterial recombination, a series of VP1 amplification experiments were performed under the same conditions, using the total cellular DNA as the template. First, complete AAV7 and AAV8 were mixed in equal proportion and serially diluted, and the serially diluted mixture was used as a template for PCR amplification of a3.1 kb VP1 fragment using the same primers and amplification conditions as those for DNA amplification, and it was observed whether any heterozygous PCR product was present. The mixture was transformed into bacteria, transformants were isolated and it was observed whether the heterozygous clone could have originated from a recombination process within the bacteria. In different experiments we restricted AAV7 and AAV8 with Msp I, Ava I and HaeI, all of which could be cut multiple times at different locations in the genome, mixed the digests in different combinations and used them as templates for PCR amplification of VP1 fragment under the same conditions, and observed whether any PCR product could be generated due to overlapping extension of part of the AAV sequence. In another experiment, gel-purified 1.5kb AAV7 VP 15 'and 1.7kb AAV8 VP 13' fragments overlapping the signature region were mixed, serially diluted for PCR amplification, with or without 200ng of cellular DNA from a monkey cell line, which was determined to be free of AAV sequences by TaqMan analysis. None of these experiments found PCR-mediated overlap generation under the conditions of genomic DNA Cap amplification (data not shown). To further confirm that 3 sets of primers were designed, located on different HVRs, and specific for clone 42 of macaque F953, a shorter fragment was amplified from the Mesenteric Lymph Node (MLN) of F953 using different primer combinations, and clone 42 was isolated from F953. All sequence mutants identified in the full-length Cap clone were present in these short fragments (data not shown).

Example 2: adeno-associated virus undergoes substantial evolution in primates during natural infection

Sequence analysis of the isolated AAV revealed that the entire genome was mainly dispersed in the variable region of the capsid protein. Epidemiological investigations have shown that all known serotypes are primate site-specific, although clinical isolates are limited to isolation of AAV2 and AAV3 from infant anal and pharyngeal swabs and AAV5 from human condylomata. No clinical complications have been found to be associated with AAV infection.

To better understand the biological properties of AAV, non-human primates were used as models to observe complications of natural infection. Oligonucleotide primers were designed based on the highly conserved regions of known AAV (see example 1), and the PCR method of the present invention was used to screen tissues of non-human primates for AAV sequences. A stretch of AAV sequences spanning AAV1[ SEQ ID NO:6]2886-3143bp, wherein conserved sequences flank a hypervariable region which is different from all other known AAV serotypes, and is designated herein as a "signature region", was used as a PCR amplicon.

The primate subclasses from which AAV could be detected were found to be rhesus monkey, cynomolgus monkey, chimpanzee and baboon by preliminary screening of a panel of non-human primate peripheral blood samples. The overall distribution of AAV sequences in the tissues was found by performing a centralized analysis of vector distribution in tissues of macaques raised at the university of Pennsylvania and by deplaning animal carcasses.

The amplified signature region sequences were subcloned into plasmids and each transformant was sequenced. The results showed substantial variation in the nucleotide sequence of clones of different animal origin. Variations in the sequences of the characteristic regions are also apparent in different clones of an animal. Tissues were removed from two animals with different marker sequences for further analysis and the extended fragments were amplified by PCR using oligonucleotides of highly conserved regions as primers. Two tissue-derived viral genomes were newly constructed using this method. These proviruses are significantly different from other AAV known in the sequence dispersibility of cap gene

The next trial was used to confirm that the AAV sequences in the non-human simian animal tissues represent the proviral genomes of the infecting virus and that these proviral genomes can be restored to form viral particles. AAV8 signature sequences were detected from the genomic DNA of animal 98E056 liver tissue, digested with an endonuclease lacking the site in the AAV sequence, and transfected into 293 cells together with a plasmid containing the E1 deleted human adenovirus serotype 5 genome as a source of helper functions. The obtained lysate is passed through 293 cells once, the lysate is recovered, the existence of AAV Cap protein is detected by using polyclonal antibody of Cap protein with multivalent reactivity, and AAV provirus derived from AAV8 is amplified by using PCR method to detect the abundance of DNA sequence. Detection of Cap protein by Western blotting method can demonstrate restriction enzyme digested cardiac DNA and adenopathyCo-transfection of viral helper plasmids produces high titers of AAV8 virus, 10 per 293 cell⁴AAV8 vector genome. Cell lysates were prepared on a large scale and purified therefrom by cesium chloride centrifugation precipitation techniques. The purified product contained 26nm icosahedral (icosohedral) structures that appeared to be identical to AAV serotype 2. Transfection with adenoviral helper vectors alone does not produce AAV proteins or genomes, which precludes the possibility of recovered AAV as a source of contamination.

To further determine variation of the AAV marker sequences in and between animal species, tissues were selected for extended PCR to amplify the open reading frame of the entire Cap protein.

The resulting fragments were cloned into bacterial plasmids, individual transformants were isolated and sequenced. The tissues taken included the blood of 3 macaques mesenteric lymph nodes (clone Tulane/V223-6; clone Tulane/T612-7; clone Tulane/F953-14), 2 macaque livers (clone Tulane/V251-3; clone Penn/00E 033-3), 1 macaque spleen (clone Penn/97E 043-3), 1 macaque heart (clone IHGT/98E 046-1), 1 chimpanzee (clone New Iberia/X133-5), 6 cynomolgus monkeys (Charles River/A1378, A3099, A3388, A3442, A2821, A3242-6) and 1 baboon (clone SFRB/8644-2). Of the 15 animal-derived 50 clones, 30 were considered to be non-redundant, since at least 7 amino acids were found to be different from each other. The non-overlapping VP1 clones are numbered in the order in which they were isolated, with the prefix indicating the species of non-human primate from which they were derived. The structural relationship between these 30 non-severe clones and the 8 AAV serotypes described previously was analyzed using the split decomposition method plus the split decomposition program [ Huson, d.h. split tree: analysing and visualizing evolution data.bioinformatics 14, 68-73(1998) ]. The analysis results show that there is similarity between a set of sequences in a tree network rather than a branched tree network. This has the advantage of detecting the packets formed by convergence and displaying their phylogenetic relationship, even though this relationship may be reversed by events occurring in parallel. Thus, extensive phylogenetic studies are also required to elucidate the evolution of AAV, and the present invention simply groups different clones to show sequence similarity.

To determine that the novel VP1 sequence was derived from the genome of the infecting virus, cellular DNA was extracted from tissues with abundant viral genomes, 293 cells were digested and transfected with restriction enzymes that lack enzymatic cleavage sites within AAV, and 293 cells were then infected with adenovirus. This allowed recovery and amplification of AAV genomes from tissue DNA from two different animal sources (data not shown).

The VP1 sequence of the novel AAV was further analyzed to determine the nature and location of the amino acid variation. All 30 VP1 clones that differ from each other by more than 1% in amino acid sequence were aligned together to evaluate the score of variation at each residue. The 12 hypervariable regions (HVRs) were obtained according to an algorithm which analyzed the regions of sequence dispersion, 5 of which overlapped with or were part of the previously described variable regions [ Kotin, cited above; rutledge, cited above ]. The triplet proximal peak (three-fold-proximal peaks) contains the majority of the variability (HVR5-10). Ann the 2-fold axis and 8-fold axis of interest is also a region of more variation. The capsid protein has HVR1 and 2 at the N-terminal, and the two regions can not be found by X-ray diffraction, which indicates that the N-terminal of the VP1 protein is exposed on the surface of the virus particles.

Real-time PCR was used to quantitatively detect AAV sequences from tissues of 21 macaques using primers and probes directed against highly conserved regions of known AAV Rep (1 pair) and Cap (2 pair). Each data point represents data amplified from one tissue of one animal. The AAV sequences were found to have a wide distribution, although the amount of AAV contained varied among animals. The origin of the animal and its background and treatment do not affect the distribution of AAV sequences within the macaque. The highest level of AAV expression was found in mesenteric lymph nodes, with an average of 0.01 copies per diploid gene in 13 positive animals. The liver and spleen also contain high abundance of viral DNA. There are tissues containing very high copies of AAV, such as heart tissue of cynomolgus monkey 98E056, spleen tissue of cynomolgus monkey 97E043, and liver tissue of cynomolgus monkey rq4407, which contain 1.5, 3, and 20 copies of AAV sequence per diploid genome, respectively. The level of viral DNA in peripheral blood mononuclear cells was relatively low, indicating that the data in the tissue was not due to residual blood in the tissue (data not shown). It should be noted that this method does not detect all AAV in non-primates because the detected sequence requires a high degree of homology to oligonucleotides and real-time PCR probes. Animal tissues with high abundance AAV DNA were further analyzed by DNA hybridization techniques to determine the status of the DNA, and their distribution within the cell was analyzed by in situ hybridization.

The sequence variation of the AAV proviral fragment between different animals and between different tissues of the same animal has suggested that many RNA viruses will evolve during an epidemic, even when infecting an individual. In many cases it has been found that wild-type viruses are replaced by a population of quasispecies that have evolved by rapid replication and mutation in the presence of selective pressure. One example is HIV infection, which has evolved due to immune or drug stress. There are several mechanisms for the high incidence of mutations in RNA viruses, including low fidelity and lack of error correction capability of reverse transcriptase, as well as non-homologous and homologous recombination.

The reason for AAV quasispecies formation can be illustrated in this study by systematic sequencing of multiple proviral fragment clones. In fact, no completely identical sequences could be found in any extended clones isolated from different animals or within the same animal. The mechanism of this sequence evolution may be a high frequency of homologous recombination between the parental viruses. The result is frequent exchange of the hypervariable regions of the Cap proteins, leading to a set of chimeras with different small tropisms and different serotype specificities (i.e.the ability to evade the immune response, in particular the attack of neutralizing antibodies, is obtained). The mechanism by which homologous recombination occurs is not known. One possibility is that the + and-strands of different single-stranded AAV genomes hybridize upon replication, as previously reported when infected with a number of AAV recombinants. It is not clear whether other mechanisms exist that lead to sequence evolution upon AAV infection. The total frequency of mutations that occur during AAV replication is relatively low, and experimental data also does not support the occurrence of high frequency replication errors. However, it has been reported that rearrangement of the AAV genome during lytic infection can lead to the formation of interfering defective particles. Regardless of the mechanism leading to sequence variation, the quasispecies vp1 structure remained intact without frameshift mutations and nonsense mutations, indicating that competing choices allow the virus to have the best combination of structure and morphology for population dynamics reasons.

These studies are useful in several areas of biology and medicine. The concept of rapid viral evolution was previously thought to be characteristic of RNA viruses only, and it has now been found that DNA viruses may also occur, as demonstrated by serological analysis. It is important for parvoviruses to develop a new method for the characterization of viral isolates, which should cover the complexity of their structure and biological characteristics, such as HIV, a general family classified as having the same structure and function, called Clades. Other strategies are now being sought to classify isolates by serotype specificity and to propose criteria describing variation within serological groups.

Example 3: the AAV2 rep gene and the new AAV cap gene containing chimeric plasmid are used in constructing recombinant AAV genome vector carrying AAV2 ITR for serology and gene transfer research of different animal models

AAV2 rep was fused to cap sequences of a novel AAV serotype to construct a chimeric packaging vector. These chimeric packaging vectors were originally used to pseudotype (pseudotyping) recombinant AAV genomes carrying AAV2 ITRs by triple transfection of 293 cells with Ad5 helper plasmids. These pseudotype vectors were used to evaluate the feasibility of transduction-based serological studies and the gene transfer efficiency of novel AAV serotypes in different animal models, including NHP and rodents, before isolating intact infectious viruses of these novel serotypes.

A.pAAV2GFP

The AAV2 plasmid contains AAV2 ITRs and a green fluorescent protein under the control of a constitutive promoter. This plasmid contains the following elements: AAV2 ITRs, CMV promoter and GFP coding sequences.

B. Cloning of the Trans plasmid

To construct a chimeric trans plasmid to prepare a recombinant pseudotyped AAV7 vector, the p5E18 plasmid (Xiao et al, 1999, J.Virol 73:3994-4003) was partially digested with Xho I to linearize the plasmid, which had only one Xho I site at 3169 bp. Xho I was then blunt-ended and ligated freshly. This engineered p5E18 plasmid was completely digested with Xba I and Xho I to remove AAV2 cap gene sequences and replaced with an 2267bp Spe I/Xho I fragment containing AAV7 cap gene, which was excised from pCRAAV 76-5 +15-4 plasmid.

The resulting plasmid contains the AAV2 Rep sequence Rep78/68 under the control of the AAV 2P 5 promoter and the AAV2 Rep sequence Rep52/40 under the control of the AAV 2P 19 promoter. The AAV7 capsid sequences are located under the control of the AAV 2P 40 promoter, which sequences are located within the Rep sequences. This plasmid also contains the insert 5' rep ORF.

C. Preparation of pseudotyped rAAV

rAAV particles (AAV 2 vector containing AAV7 capsid) were prepared in an adenovirus-free manner. The main steps are that cis plasmid (pAAV2.1 lacZ plasmid containing AAV2 ITR), trans plasmid pCRAAV 76-5 +15-4 (containing AAV2 rep and AAV7 cap) and auxiliary plasmid are used to transfect 293 cell simultaneously in the ratio of 1:1:2, and the transfection method is calcium phosphate precipitation method.

To construct the pAd helper plasmid, plasmid pBG10 was purchased from microbiox (canada). An RsrII fragment containing L2 and L3 was excised from pBHG10 to give the first helper plasmid, pAd Δ F13. An Asp700/SalI fragment containing the PmeI/Sgfl deletion was excised from pBHG10 and cloned into Bluescript to obtain plasmid Ad Δ F1. MLP, L2, L2 and L3 were deleted from pAd Δ F1. Then, a 2.3kb NruI fragment and a 0.5kb RsrII/NruI fragment were deleted to obtain helper plasmids pAd. DELTA.F 5 and pAd. DELTA.F 6, respectively. The helper plasmid designated p Δ F6 has the helper functions necessary for E2a and E4ORF6, which are not present in E1 expressing helper cells, but this plasmid does not contain the adenoviral capsid protein and the functional E1 region.

50. mu.g of DNA (cis plasmid: trans plasmid: helper plasmid) are usually transfected into a 150mm tissue culture dish. 293 cells were harvested 72 hours post transfection, sonicated and treated with 0.5% sodium deoxycholate (37, 10 min.). Cell lysates were pelleted by two CsCl centrifugations. The peak containing the rAAV vector was collected and placed in a container for dialysis against PBS.

Example 4: preparation of infectious clones carrying the entire novel AAV serotype were investigated for its basic virological properties in human and NHP-derived cell lines and evaluated for pathogenicity of the novel AAV serotype in NHP and other animal models.

To achieve this, the genome walker system was used to obtain 5 'and 3' end Sequences (ITRs) and to construct clones containing the entire novel AAV serotype genome.

Briefly, Genome DNA derived from monkey tissues and cell lines, which had been confirmed to contain AAV7 sequences, was digested with Dra I, EcoR V, Pvu II and Stu I restriction enzymes and ligated to Genome Walker Adaptor to obtain 4 individuals of Genome Walker Libraries (GWLs), using a commercial Universal Genome Walker Kit [ Clontech ]. AAV7 and adjacent genomic sequences thereof are amplified by PCR using DNA of GWLs as a template, and primers used are an adaptor primer 1(AP1 provided by the kit) and an AAV7 specific primer 1, and then nested PCR is carried out by using an adaptor primer 2(AP2) and another AAV7 specific primer 2, wherein the two primers are in the first group of primers. The main products from nested PCR were cloned and sequence analyzed.

In this assay, primers encompassing a 257bp fragment or other marker fragment of the AAV genome were used to PCR amplify cellular DNA extracted from human and NHP cell lines to identify and identify the presence of AAV sequences. This latent AAV genome can be recovered from positive cell lines using helper adenoviruses of different species and strains.

To classify infectious AAV clones from NHP-derived cell lines, the desired cell line was obtained from ATCC and then screened by PCR to identify 257bp amplicons, the characteristic regions of the invention. The 257bp PCR product was cloned and its serotype analyzed by sequencing. These cell lines containing the AAV7 sequences were infected with simian adenovirus SV-15, human Ad5, purchased from ATCC, or transfected with plasmids containing the human Ad gene encoding AAV helper functions. Monkeys were infected or transfected for 48 hours, cells harvested, and Hirt DNA prepared for cloning of the AAV7 genome as described by Xiao et al, 1999, J.Virol, 73: 3994-.

Example 5: construction of AAV vectors

The same pseudotyping strategy as adopted for AAV1/7 in example 3 was used to construct AAV2 vectors packaged with AAV1, AAV5 and AAV8 capsid proteins. Briefly described, recombinant AAV genomes carrying AAV2 ITRs are packaged by triple transfection of 293 cells with a cis plasmid, an adenoviral helper plasmid, and a chimeric packaging vector, in which the AAV2 rep gene is fused to the cap gene of a novel AAV serotype. To construct the chimeric packaging vector, the Xho I site at 3169bp on plasmid p5E18 was removed, the modified plasmid was further completely digested with Xba I and Xho I to remove AAV2 cap gene, and replaced with an 2267bp Spe I/Xho I fragment containing AAV8 cap gene [ Xiao, W, et al, (1999) J Virol 73, 3994-4003-]. The same strategy was used to construct chimeric packaging plasmids for AAV2/1 and AAV 2/5. All recombinant vectors except AAV2/2 were used with standard CsCl₂The AAV2/2 was purified by sedimentation in one step using a heparin column.

The copy (GC) titre of AAV vectors in the genome was determined by TaqMan analysis using probes and primers specific for the AV40 polyA region, as previously reported [ Gao, G., et al, (2000) Hum Gene Ther 11, 2079-91 ].

Vectors were constructed for each serotype to facilitate in vivo and in vitro experiments. The 8 different transgene expression cassettes were inserted into the vector and recombinant viral particles of each serotype were then prepared. The recovered virus counts, based on their genome copy number, are listed in table 4 below. Vector production was high for each serotype, but the differences between serotypes were different. The data presented in the table are mean plus minus standard deviation x10 of the copy number of the genome transfected by multiple 50 plates (150mm)¹³。

TABLE 4 preparation of recombinant viruses

Example 6: serological analysis of pseudotyped vectors

C57BL/6 mice were injected intramuscularly with different serotypes of the AAVCBA1AT vector (5X10¹¹GC), samples were collected after 34 days. To detectSerum was analyzed by transduction-based neutralizing antibody assay [ Gao, G.P., et al, (1996) J Virol 70, 8934-43]. To improve specificity, the presence of neutralizing antibodies was determined by assessing the ability of sera to inhibit transduction of 84-31 cells by different serotypes of reporter viruses (AAVCMVEGFP). Each serotype of reporter virus AAVCMVEGFP [ multiplicity of infection (MOI) enables 90% of the indicator cells to infect]Incubated with heat-inactivated sera from animals receiving different AAV serotypes or from control mice. After 1 hour incubation at 37 ℃, the virus was added to a 96-well plate containing 84-31 cells and incubated for 48 or 72 hours, depending on the virus serotype. Expression of GF P was determined using FluoroImagin (molecular dynamics) and quantified using Image Quant Software. The titer of neutralizing antibodies was defined as the highest serum dilution that inhibited transduction to below 50%.

The use of GFP expression vectors simplifies the assay of neutralizing antibodies based on the inhibition of transduction by a permissive cell line, i.e., 293 cells stably expressing E4 of Ad 5. Antisera to AAV serotypes are prepared by intramuscular injection of recombinant viruses into animals. Neutralizing effects of AAV transduction by antisera at dilutions 1:20 and 1:80 were analyzed (see Table 5 below). Antisera to AAV1, AAV2, AAV5, and AAV8 can inhibit transduction of the serotype from which the antisera is derived (AAV5 and AAV8 inhibit less than AAV1 and AAV 2), but do not inhibit transduction of other serotypes (i.e., there is no indication of cross-neutralization, suggesting that AAV8 is a truly unique serotype).

TABLE 5 serological analysis of novel AAV serotypes

Sera from 52 normal persons were screened for samples that neutralized the selected serotype. As a result, no samples were found which could neutralize AAV2/7 and AAV2/8 sera, whereas 20% and 10% sera neutralized AAV2/2 and AAV2/1 vectors, respectively. A pooled IgG represented a collected serum sample of 60000 human, which was unable to neutralize AAV2/7 and AAV2/8, but AAV2/2 and AAV2/1 vectors were neutralized by 1/1280 and 1/640 titres, respectively.

Example 7: in vivo evaluation of different serotypes of AAV vectors

In this experiment, 7 recombinant AAV genomes, AAV2CBhA1AT, AAV2AlbhA1AT, AAV2CMVrhCG, AAV2TBGrhCG, AAV2TBGcFIX, AAV2CMVLacZ and AAV2TBGLacZ, were packaged with capsid proteins of different serotypes. In all 7 vectors, the minigene expression cassette was flanked by AAV2 ITRs. Human alpha-antitrypsin (A1AT) [ Xiao, W., et al, (1999) J Virol 73, 3994-. For direct liver gene transfer, the murine albumin gene promoter (Alb) [ Xiao, W. (1999), cited above ] or the human thyroid hormone-binding globulin gene promoter (TBG) [ Wang (1997), cited above ] was used to drive tissue-specific expression of the reporter gene in the liver. For direct muscle gene transfer, the cytomegalovirus early promoter (CMV) or the chicken β -actin promoter plus the CMV enhancer (CB) was used to control the expression of the reporter gene.

If gene transfer is performed by direct intramuscular injection, the vector is injected into the right tibioanterior calf muscle of 4-6 week old NCR nude mice or C57BL/6 mice (Taconnic, Germantown, NY). In the case of direct hepatic gene transfer, the vector is injected into the liver of 7-9 week old NCR nude mice or C57BL/6 mice (Taconnic, Germanown, NY) via the portal vein. Serum samples were collected at different time points after vehicle injection. At different time points, mice injected with LacZ vector were harvested for muscle and liver tissue, cryosections were made and Xgal histochemical staining was performed. In a repeat experiment, C56BL/6 mice were first intramuscularly injected with AAV2/1, 2/2, 2/5, 2/7 and 2/8CBA1AT vectors and tested for expression of the A1AT gene for 7 weeks. AAV2/8TBGcFIX was then injected intraportally and the expression of the cFIX gene was examined.

ELISA assay was used to quantify serum levels of the above hA1AT, rhCG and cFIX proteins [ Gao, g.p. et al, (1996) J Virol 70, 8934-43; zoltick, P.W, & Wilson, J.M, (2000) Mol Ther 2, 657-9; wang, L, et al, Proc Natl Acad Sci U S A94, 11563-6 ]. At the end of the experiment, the animals were sacrificed, muscle and liver tissues were harvested, DNA was extracted therefrom, and the number of copies of the vector of the present invention present in the genome of the target tissue was quantitatively analyzed by TaqMan method using a set of primers and probes identical to those used for determining the titer of the prepared vector [ Zhang, Y, et al, (2001) Mol Ther 3, 697-707 ].

Novel serotype derived vectors were evaluated in a direct murine model of muscle and liver gene transfer and compared to known serotype AAV1, AAV2 and AAV5 derived vectors. Vectors expressing secreted proteins (alpha-antitrypsin (A1AT) and Chorionic Gonadotropin (CG)) were used as indicators to quantify the relative transduction efficiency between different serotypes by ELISA analysis of sera. Intracellular distribution of transduction vectors in target organs was evaluated using LacZ expression vector and X-gal histochemical methods.

The role of AAV vectors in skeletal muscle was analyzed by direct injection of the vectors into the tibiofibular muscle of mice. The vector contained the same AAV2 genome and the early immediate gene for CMV, whose expression was controlled by the AMC-enhanced β -actin promoter. Previous studies have shown that C57BL/6 mice with full immunocompetence are able to elicit a limited humoral immune response against the human A1AT protein when the AAV vector expresses this protein [ Xiao, W., et al, (1999) J Virol 73, 3994-4003 ].

Among the various vectors, AAV2/1 vector produced the highest level of A1AT, AAV2/2 vector, and AAV2/7 and AAV2/8 vectors. The expression level of CG peaked 28 days after nu/nu NCR mice injected with the vector, with AAV2/7 being the highest, AAV2/2 being the lowest, and AAV2/8 and AAV2/1 being located in between. Gene expression was produced in all muscle fibers at the injection site following injection of AAV2/1 and AAV2/7lacZ vectors, whereas much lower lacZ-positive muscle fibers were observed following injection of AAV2/2 and AAV2/8 vectors. These data indicate that AAV2/7 vector transduces in skeletal muscle as efficiently as AAV2/1 and is the most efficient skeletal muscle transduction of the previously reported serotypes [ Xiao, W. (1999), cited above; chao, H, et al, (2001) Mol Ther 4, 217-22; chao, H, et al, (2000) Mol Ther 2, 619-23 ].

The same murine model was used to evaluate direct liver gene transfer. The same dose of vector from which the genomic copy was derived was injected into the mouse portal vein. And then the expression of the transgene is analyzed. Each vector contains the AAV2 genome, with liver-specific promoters (i.e., promoters for albumin or thyroid hormone binding globulin) as described above being used to drive expression of the transgene. More specifically, direct muscle and liver gene transfer was performed using the CMVCG and TBGCG minigene expression cassettes, respectively. Expression level of RhCG in relative units (RUs X10)³) To indicate. Data were from serum samples (4 animals per group) 28 days after vehicle injection. As shown in Table 3, the effect of capsid protein on the transduction efficiency of A1AT vector in nu/nu and C57BL/6 mice and the transduction efficiency of CG vector in C57BL/6 mice was consistent (see Table 6).

TABLE 6 expression of macaque chorionic gonadotropin (rhCG) beta-subunit

Not tested in this test

In all cases, the AAV2/8 vector produced the highest level of transgene expression, 16-110, higher than AAV2/2 vector; AAV2/5 and AAV2/7 vectors are in between, but AAV2/7 is higher than AAV 2/5. Liver tissue sections from animals injected with the corresponding lacZ vector were stained with X-gal to find a correlation between the number of transduced cells and the total level of transgene expression. The abundance of vector DNA in DNA extracted from liver tissue of C57BL/6 mice that received A1AT vector was analyzed by real-time PCR.

The amount of vector DNA in liver tissue was correlated with the expression level of transgene 56 days after injection (see Table 7). In this experiment, a set of probes and primers specific to the SV40 polyA region of the vector genome were designed for TaqMan PCR. The values presented are the mean of three animals plus minus the standard deviation. Animals were sacrificed 56 days after injection and liver tissue was collected to extract their DNA. These experiments indicate that AAV8 is the most efficient vector for direct hepatic gene transfer because it transduces the largest number of hepatocytes.

TABLE 7 injection 1X10¹¹Vector for genome copy then real-time PCR analysis of abundance of AAV vector in liver tissue of nu/nu mice

The above serological data indicate that AAV2/8 vector in vivo cannot be neutralized after immunization with other serotypes. Canine factor IX (10) was expressed by intramuscular injection of C57BL/6 mice with A1AT vector of a different serotype 56 days later and into the portal vein¹¹Genomic copies) of AAV2/8 vector. The highest level of factor IX expression occurs in the AAV2/8 vector (17)+2 μ g/ml, n ═ 4) 14 days after injection into the blank animals, there was no significant difference from the animals injected with AAV2/1(31+23 μ g/ml, n ═ 4), AAV2/2(16 μ g/ml, n ═ 2) and AAV2/7(12 μ g/ml, n ═ 2). This result is in contrast to that observed in AAV2/8 factor IX vector injected AAV2/8 immunized animals, in which no factor IX was detected: (<0.1μg/ml，n＝4)。

Indeed, sequences representing unique AAV can be amplified from macaques using cap gene conserved region specific oligonucleotides. The consensus cap signature region sequence can be detected in multiple tissues of at least two different cloned macaques. Full-length rep and cap open reading frames were isolated from one source and sequenced. It is only necessary to evaluate the ability of the cap open reading frame of the novel AAV as a vector because vectors containing AAV7 or AAV8 capsids are prepared with ITRs and reps of AAV2. This may also simplify the comparison of different vectors, since the actual vector genomes of different vector serotypes are identical. In fact, the production of recombinant vectors prepared using this method does not differ between different serotypes.

AAV7 and AAV8 vectors have unique immunological features (i.e., they are not neutralized by antibodies against other serotypes). Furthermore, human serum is unable to neutralize transduction by AAV7 and AAV8 vectors, and they are therefore more than those currently being investigated [ Chirmule, N., et al, (1999) Gene Ther 6, 1574-83 ].

The tropism of each of the novel vectors is suitable for in vivo use. The transduction efficiency of AAV2/7 vector into skeletal muscle was similar to that of AAV2/1, which was the highest transduction efficiency of primate AAV in skeletal muscle detected so far [ Xiao, W., cited above; chou (2001), referenced above, and Chou (2000), referenced above ]. However, it is noteworthy that the efficiency of AA2/8 in gene transfer in liver is higher than that of other serotypes, and so far, no satisfactory vector has been found for stable transfection of hepatocytes. Compared with other vectors, the gene transfer efficiency of AAV2/8 can be increased by 10-to 100-fold. The mechanism of high transduction efficiency of AAV2/8 is unclear, although it is speculated that this receptor has higher activity on the basolateral surface of hepatocytes, possibly due to the receptor on which its uptake is dependent, unlike other vectors. This highly efficient vector is quite useful for direct hepatic gene transfer, as the number of transduced cells is critical in the treatment of urea cycle disorders and familial hypercholesterolemia.

Thus, the present invention provides a novel method for isolating novel AAV by searching genomic sequences by PCR. The amplified sequences are easily cloned into vectors and detected in animals. Since there is no immunity to AAV7 in humans and the tropism of this vector is suitable for transfecting muscle tissue, AAV7 is well suited as a vector for gene therapy and other in vivo applications in humans. Likewise, the lack of immunity and tropism for the AAV serotypes of the invention makes these AAV useful for the transfer of therapeutic or other useful molecules.

Example 9 tissue tropism study

In designing high throughput functional screening protocols to construct novel AAV vectors, non-tissue specific and highly active promoters, CB promoters (CMV-enhanced chicken β actin promoter) were selected to drive an easily detectable and quantitatively detectable reporter gene, human α antitrypsin gene. Each novel AAV clone only needs to construct a vector for gene transfer research, and the tropism of a specific AAV vector to three different target tissues, namely liver, lung and muscle is detected. The following table summarizes the data obtained for the 4 novel AAV vectors in the tissue tropism study (AAVCBA1 AT). Among them, novel AAV capsid clone 44.2 was found to be an excellent gene transfer tool in all 3 tissues, especially in lung tissue. Table 8 reports data on day 14 of the experiment (μ g A1AT/mL serum).

TABLE 8

Additional experiments were also performed to further confirm the superior tropism of AAV 44.2 in lung tissue. First, an AAV vector carrying a CC10hA1AT minigene specifically expressed in lung tissue was pseudotyped with a capsid of a novel AAV and then injected into immunodeficient animals (NCR nude mice) as shown in the following table, and equal amounts of the vector were infused through the trachea (50. mu.l stock solution per animal without dilution). In Table 9, 50. mu.l of stock solution per NCR nude mouse had a lower detection limit of 0.033. mu.g/ml and a detection time of day 28.

TABLE 9

The vectors were also injected into fully immunocompetent animals (C57BL/6) using the same gene copy number (1X 10)¹¹GC) as shown in table 10. (1X10 per animal¹¹GC, C57BL/6, 14 days, with a lower detection limit of 0.033. mu.g/ml).

Watch 10

The data from both experiments confirm the superior tropism of clone 44.2 in direct lung gene transfer.

Interestingly, clone 44.2 also performed very prominently in direct hepatic and muscle gene transfer, approaching the levels achieved by the optimal hepatic transduction vector AAV8 and the optimal muscle transduction vector AAV1, suggesting that this novel AAV has extremely dramatic biological significance.

To investigate the serological properties of these novel serotypes, pseudotyped AAVGFP vector immunized rabbits were prepared and 84-31 cells were transduced in vitro in the presence or absence of different capsid antisera. The data are summarized below.

TABLE 11 Cross-NAB analysis and Adv Co-infection in cells a.8431

8431 cells were infected with the following vectors (coinfected with Adv):

TABLE 11b.8431 intracellular Cross-NAB analysis and Adv Co-infection

8431 cells were infected with the following vectors (coinfected with Adv):

TABLE 12

TABLE 13a infection of 8431 cells with GFP vector (Adv Co-infection)

TABLE 13b infection of 8431 cells with GFP vector (Co-infection Adv)

Example 10 murine model of familial hypercholesterolemia

The following experiments were conducted to demonstrate that the AAV2/7 vector of the present invention can transfer LDL receptors and can express an effective amount of LDL receptors to lower plasma cholesterol levels and triglyceride levels in a familial hypercholesterolemia animal model.

A. Construction of vectors

AAV vectors with AAV7 or AAV8 capsid proteins were constructed using a pseudotyping strategy [ Hildinger M et al, j.virol 2001; 75:6199-6203]. Recombinant AAV genomes carrying an Inverted Terminal Repeat (ITR) of AAV2 were packaged by triple transfection of 293 cells with a cis plasmid, an adenovirus helper plasmid, and a chimeric packaging vector fused from the capsid of the novel AAV serotype and the rep gene of AAV2. The chimeric packaging plasmid was constructed by the methods previously described [ Hildinger et al, cited above]. Standard CsCl for recombinant vectors₂Purifying by precipitation method. To determine the amount of virus produced, TaqMan (applied biosystems) analysis was performed using probes and primers specific for the poly A region of vector SV40 [ Gao GP et al, Hum Gene Ther.2000Oct 10; 11(15):2079-91]. The obtained vector expresses a transgene under the control of a human thyroid hormone-binding globulin gene promoter (TBG).

B. Animal(s) production

C57Bl/6 derived LDL receptor deficient mice were purchased from Jackson laboratories (Bar Harbor, ME, USA) and raised as reproductive clones. Mice were not restricted to drinking water and high-fat Western Diet (high percentage of cholesterol) was started 3 weeks before vehicle injection. Blood samples were collected at 0 and 7 days by retroorbital bleeding to determine the blood lipid content. The mice were randomly divided into 7 groups. Vectors were injected via portal vein as described previously [ Chen SJ et al, Mol Therapy 2000; 2(3),256-261]. Briefly, mice were anesthetized with ketamine and xylazine and a30 g syringe was used to aspirate the appropriate dose of vehicle diluted with 100ul PBS and injected directly into the portal vein. The injection site was pressed to stop bleeding. Skin wounds were sutured and mice were carefully examined for the next time. Blood was collected weekly starting 14 days after direct liver gene transfer to determine the blood lipid content. At 6 and 12 weeks post-injection, 2 animals per group were sacrificed and the size of atherosclerosis and receptor expression were determined. The remaining mice were sacrificed at 20 weeks and the size of atherosclerosis and receptor expression were determined.

TABLE 14

	Carrier	Dosage form	n
				Group
1	AAV2/7-TBG-hLDLr	1x	1012gc		12
				Group 2		AAV2/7-TBG-hLDLr	3x	1011gc	12
Group 3	AAV2/7-TBG-hLDLr	1x	1011gc		12
				Group 4		AAV2/8-TBG-hLDLr	1x	1012gc	12
Group 5	AAV2/8-TBG-hLDLr	3x	1011gc		12
				Group 6		AAV2/8-TBG-hLDLr	1x	1011gc	12
Group 7	AAV2/7-TBG-LacZ	1x	1011gc		16

C. Serum lipoproteins and liver function analysis

Blood samples were collected from the retroorbital plexus after 6 hours of fasting. Serum was prepared from plasma by centrifugation. Plasma levels of lipoproteins and hepatic transaminase in serum were determined using a clinical biochemical automatic analyzer (ACE, Schiapparelli Biosystems, Alpha Wassermann).

D. Detection of transgene expression

The expression of LDL receptors was analyzed by immunofluorescence staining and Western blotting. Frozen liver homogenates were used for Western blot analysis using lysis buffer (20mM Tris, pH7.4, 130mM NaCl, 1% Triton X100, protease inhibitors (complete, EDTA-free, Roche, Mannheim, Germany)). Protein concentration was determined using the Micro BCA Protein Assay Reagent Kit (Pierce, Rockford, IL). Mu.g of protein were dissolved in 4-15% Tris-HCl Ready Gels (Biorad, Hercules, Calif.) and transferred to nitrocellulose membrane (Invitrogen). To prepare anti-hLDL receptor antibodies, rabbits were injected intravenously with AdhLDLr prep (1X 10)¹³GC). Rabbit sera were collected after 4 weeks for Western blotting. Serum diluted 1:100 was used as the primary antibodyHRP-linked anti-rabbit IgG followed by ECL chemiluminescence detection (ECL Western blot detection kit, Amersham, Arlington Heights, IL).

E. Immunohistochemistry

The expression of LDL receptors in frozen liver tissue sections was analyzed by immunohistochemical staining. The 10um frozen sections were either fixed with acetone for 5 minutes or not. Incubated with 10% goat serum for 1 hour. The sections were then incubated with primary antibody for 1 hour at room temperature, and rabbit anti-human LDL polyclonal antibody (Biomedical Technologies Inc., Stoughton, Mass.) was diluted according to the manufacturer's instructions and then added to the sections. Sections were washed with PBS and then incubated with fluorescently labeled goat anti-rabbit IgG (Sigma, St Louis, Mo.) diluted 1: 100. Finally, the sections were observed on a fluorescence microscope Nikon Microphot-FXA. In all cases, each incubation step was followed by a thorough wash with PBS. Negative control preincubation was performed with PBS, and primary antibody was replaced with isotype matched non-immune control antibody. Each test was set up with the three types of controls mentioned above on the same day.

F. Efficiency of Gene transfer

The liver tissue was harvested after sacrifice at the predetermined time point and the tissue was snap frozen in liquid nitrogen and stored at-80 ℃ until use. DNA was extracted from liver tissue using the QIAamp DNA Mini Kit (QIAGEN GmbH, Germany) according to the instructions. Genomic copy number of AAV vectors in liver tissue was determined by Taqman analysis using AV40 poly (a) tail specific primers and probes as described above.

G. Measurement of atherosclerotic plaques

To measure the size of the atherosclerotic plaque in the mouse arteries, the serous mice were anesthetized (10% ketamine and xylazine, i.v.), the chest was opened, and the arterial system was perfused with frozen phosphate buffered saline from the left ventricle. The artery was then carefully dissected, dissected along the ventral midline from the aortic arch to the femoral artery, and then fixed with formaldehyde. Lipid-rich atherosclerotic plaques were stained with Sudan IV (Sigma, Germany), arteries pinned to a black paraffin surface with a pin, and photographed with a Sony DXC-960MD color camera. The area of atheroma and its proportion of the whole arterial surface were analyzed by Phase 3Imaging Systems (Media Cybernetics).

H.I ¹²⁵Clearance of LDL

Two animals were tested per group. Every 30 seconds, I is passed through the tail vein¹²⁵Labeled LDL (generally supplied by Dan Rader, U Penn) was slowly injected into mice (1,000,000 counts of [ I ] per animal diluted with 100. mu.l sterile PBS¹²⁵]-LDL). Blood samples were collected from the retro-orbital plexus 3min, 30min, 1.5hr, 3hr, 6hr post-injection, respectively. Plasma was separated from whole blood and 10 μ l of plasma was counted on a gamma counter. The final fractional metabolic rate was calculated from lipoprotein clearance data.

I. Evaluation of liver lipid accumulation

Liver sections were stained with oil red to determine the extent of lipid accumulation. Frozen liver sections were rinsed with distilled water and then incubated in anhydrous propylene glycol for 2 minutes. Sections were stained in oil red solution (0.5% in propylene glycol) for 16 hours and then counterstained with Mayer hematoxylin solution for 30 seconds and fixed in heated glycerol gel solution.

To determine the cholesterol and triglyceride content of liver tissue, liver tissue sections were homogenized and then incubated overnight in chloroform/methanol (2: 1). 0.05% H was added₂SO₄Post-centrifugation for 10 minutes, the lower layer of each sample was collected, divided into two tubes, and lyophilized in liquid nitrogen. To determine cholesterol content, the lyophilized lipids in the first tube were dissolved in 1% Triton X-100 dissolved in chloroform. After dissolution, freeze-drying with liquid nitrogen. The lipids were dissolved in hydrogen peroxide and incubated at 37 ℃ for 30 minutes, after which the concentration of Total Cholesterol was determined using Total Cholesterol Kit (Wako Diagnostics). The second tube of lyophilized lipids was dissolved in ethanol KOH and incubated at 60 ℃ for 30 minutes. Then 1M MgCl was added₂Incubated on ice for 10 minutes and then centrifuged at 14,000 rpm for 30 minutes. The triglyceride content of the supernatant was determined (Wako Diagnostics).

All vectors of pseudotype in AAV2/8 or AAV2/7 reduced total cholesterol, LDL and triglyceride levels compared to controls. These tested vectors were able to correct the hypercholesterolemia phenotype, the atheromatous area in AAV2/8 and AAV2/7 mice in a dose-dependent manner, was also observed to shrink in the first trial (2 months), and this effect continued throughout the trial (6 months).

Example-expression of functional factor IX and correction of haemophilia

A. Gene knockout mice

The expression of functional canine Factor IX (FIX) was examined in hemophilia B mice. Constructing a vector carrying AAV1, AAV2, AAV5, AAV7 or AAV8 capsid sequences, wherein the vector has the structure of AAV 25 'ITR-liver tissue specific promoter [ LSP ] -canine FIX-North American woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) -AAV 23' ITR. Such vectors were constructed using appropriate capsids as described by Wang et al, 2000, Molecular Therapy 2: 154-158).

Gene knockout mice are prepared as described by Wang et al, 1997, Proc. Natl. Acad. Sci. USA 94: 11563-11566. This model most closely approximates the phenotype of hemophilia B.

Vectors of different serotypes (AAV1, AAV2, AAV5, AAV7 and AAV8) were injected into adult hemophilia C57Bl/6 mice in a single portal vein, wherein the injection dose of 5 different serotypes was 1x10¹¹GC/mouse, AAV8 vector group injected at lower doses, 1X10¹⁰GC/mouse. Control group injected with 1x10¹¹AAV2/8TBG LacZ3 from GC. Each group contained 5-10 male and female mice. Blood samples were collected every two weeks after vehicle injection.

1.ELISA

Canine FIX concentrations of murine plasma species were determined by a canine factor IX specific ELISA assay as described by Axelrod et al, 1990, proc.natl.acad.sci.usa, 87: 5173-. Goat anti-canine factor IX antibody (Enzyme Research Laboratories) was used as the primary antibody and rabbit anti-canine factor IX antibody (Enzyme Research Laboratories) was used as the secondary antibody. cFIX plasma levels were determined for all test vehicle groups starting two weeks after injection. The plasma levels were found to be elevated and maintained at therapeutic levels throughout the duration of the experiment, i.e., by 12 weeks. The therapeutic level is considered to be 5% of the normal level, i.e. about 250 ng/mL.

Highest expression levelAppear in AAV2/8 (10)¹¹) And AAV2/7 vector group, to achieve supra-physiological cFIX concentrations (10-fold higher than normal). AAV2/8 (10)¹¹) The expression level of the polypeptide is about more than that of AAV2/2 and AAV2/8 (10)¹⁰) Groups were 10 times higher. The lowest expression level was found in the AAV2/5 group, although within the therapeutic range.

2. Detection of in vitro activated partial thromboplastin time (aPTT)

The activity of functional factor IX in the plasma of FIX knockout mice was determined by the in vitro activated partial thromboplastin time (aPTT) assay-a blood sample from mice collected from the retro-orbital plexus was added to 1/10 volumes of citrate buffer. The aPTT assay method is described in Wang et al, 1997, Proc. Natl. Acad. Sci. USA 94: 11563-11566.

The clotting times of all vehicle-injected murine plasma samples were found to be within the normal range (about 60 seconds) at 2 weeks post-injection by the aPTT assay, with normal clotting times and slightly shorter than normal clotting times lasting the entire experimental cycle (12 weeks).

The shortest duration of clotting occurred upon receiving AAV2/8 (10)¹¹) And AAV2/7. By 12 weeks, AAV2/2 also induced clotting times similar to those of AAV2/8 and AAV2/7 groups. However, this shorter clotting time was not observed in the AAV2/2 group at 12 weeks, whereas shorter clotting times (between 25-40 seconds) were observed in the AAV2/8 and AAV2/7 groups starting at 2 weeks.

Liver tissues were collected from some treated mice for immunohistochemical staining. About 70-80% of the hepatocytes in mouse liver tissue injected with AAV2/8.cFIX vector were canine FIX positive.

B. Dog with hemophilia B

It was found by model studies that point mutations in the catalytic region of the canine F.IX gene could destabilize the protein expressed by the gene, leading to hemophilia B [ Evans et al, 1989, Proc. Natl. Acad. Sci. USA, 86: 10095-. In the University of North Carolina, Chapel Hill has a population of such dogs that have been reared for over 20 years. The homeostatic parameters of these dogs have been described in detail including the lack of plasma f.ix antigen, a whole blood clotting time of over 60 minutes (6-8 minutes in normal dogs) and an extended activated partial thromboplastin time of 50-80 seconds (13-28 seconds in normal dogs). These dogs experience repeated spontaneous bleeding. Generally, the spontaneous hemorrhage can be stopped by injecting 10ml/kg of normal canine plasma by one time of intravenous injection; occasionally repeated infusions are required to stop bleeding.

Aav. cfix was administered to 4 dogs via the portal vein according to the following protocol. The first dog had a single injection of 3.7X10¹¹Genomic Copy (GC)/kg of AAV2/2. cFIX. A second dog was injected first with AAV2/2.cFIX (2.8X 10)¹¹GC/kg), followed by a second injection of AAV2/7.cFIX (2.3x 10) on day 1180¹³GC/kg). The third dog had a single injection of 4.6X10¹²AAV2/2.cFIX at GC/kg. The fourth dog was first injected with AAV2/2.cFIX (2.8X 10)¹²GC/kg), reinjection of AAV2/7.cFIX (5x 10) on day 995¹² GC/kg)。

After general anesthesia of hemophilia dogs, the abdominal hair was cut off, the abdomen was surgically opened, and the vehicle was injected into the portal vein at one time. To prevent bleeding during surgery, animals were pre-injected with normal canine plasma. After the dogs were sedated, general anesthesia was induced by intubation, and the abdomen was shaved and preserved. The spleen was moved to the surgical field after the abdomen was opened, the splenic vein was located, a suture was loosely placed in the proximal end, a small incision was made at the distal end of the vein, the needle was quickly inserted into the vein, and the suture was released and a 5F cannula was tied to the vein near the bifurcation of the portal vein. After hemostasis was complete, the catheter balloon was inflated and approximately 5.0ml of vehicle diluted in PBS was injected into the portal vein within 5 minutes. Then the air sac is deflated, the catheter is removed, and venous hemostasis is completed. The spleen was then repositioned, the bleeding vessels were cauterized, and the wound was sutured closed. Animals were fully tolerant to post-operative removal of the cannula. Analysis of blood samples was as described previously [ Wang et al, 2000, Molecular Therapy 2:154-158 ].

The results indicate that AAV2/7 can correct and partially correct the symptoms of hemophilia as expected.

All documents cited in this specification are herein incorporated by reference. While the invention has been described with reference to a particularly preferred embodiment, it will be appreciated that modifications may be made without departing from the spirit of the invention. Such modifications are intended to be included within the scope of the appended claims.

Sequence listing

<110> Pennsylvania University Hotel Act (The Trustees of The University of Pennsylvania)

<120> method for detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified

<130> UPN-02735PCT

<150> US 60/350,607

<151> 2001-11-13

<150> US 60/341,117

<151> 2001-12-17

<150> US 60/377,066

<151> 2002-05-01

<150> US 60/386,675

<151> 2002-06-05

<160> 120

<170> PatentIn version 3.1

<210> 1

<211> 4721

<212> DNA

<213> adeno-associated Virus serotype 7

<400> 1

ttggccactc cctctatgcg cgctcgctcg ctcggtgggg cctgcggacc aaaggtccgc 60

agacggcaga gctctgctct gccggcccca ccgagcgagc gagcgcgcat agagggagtg 120

gccaactcca tcactagggg taccgcgaag cgcctcccac gctgccgcgt cagcgctgac 180

gtaaatcacg tcatagggga gtggtcctgt attagctgtc acgtgagtgc ttttgcgaca 240

ttttgcgaca ccacgtggcc atttgaggta tatatggccg agtgagcgag caggatctcc 300

attttgaccg cgaaatttga acgagcagca gccatgccgg gtttctacga gatcgtgatc 360

aaggtgccga gcgacctgga cgagcacctg ccgggcattt ctgactcgtt tgtgaactgg 420

gtggccgaga aggaatggga gctgcccccg gattctgaca tggatctgaa tctgatcgag 480

caggcacccc tgaccgtggc cgagaagctg cagcgcgact tcctggtcca atggcgccgc 540

gtgagtaagg ccccggaggc cctgttcttt gttcagttcg agaagggcga gagctacttc 600

caccttcacg ttctggtgga gaccacgggg gtcaagtcca tggtgctagg ccgcttcctg 660

agtcagattc gggagaagct ggtccagacc atctaccgcg gggtcgagcc cacgctgccc 720

aactggttcg cggtgaccaa gacgcgtaat ggcgccggcg gggggaacaa ggtggtggac 780

gagtgctaca tccccaacta cctcctgccc aagacccagc ccgagctgca gtgggcgtgg 840

actaacatgg aggagtatat aagcgcgtgt ttgaacctgg ccgaacgcaa acggctcgtg 900

gcgcagcacc tgacccacgt cagccagacg caggagcaga acaaggagaa tctgaacccc 960

aattctgacg cgcccgtgat caggtcaaaa acctccgcgc gctacatgga gctggtcggg 1020

tggctggtgg accggggcat cacctccgag aagcagtgga tccaggagga ccaggcctcg 1080

tacatctcct tcaacgccgc ctccaactcg cggtcccaga tcaaggccgc gctggacaat 1140

gccggcaaga tcatggcgct gaccaaatcc gcgcccgact acctggtggg gccctcgctg 1200

cccgcggaca ttaaaaccaa ccgcatctac cgcatcctgg agctgaacgg gtacgatcct 1260

gcctacgccg gctccgtctt tctcggctgg gcccagaaaa agttcgggaa gcgcaacacc 1320

atctggctgt ttgggcccgc caccaccggc aagaccaaca ttgcggaagc catcgcccac 1380

gccgtgccct tctacggctg cgtcaactgg accaatgaga actttccctt caacgattgc 1440

gtcgacaaga tggtgatctg gtgggaggag ggcaagatga cggccaaggt cgtggagtcc 1500

gccaaggcca ttctcggcgg cagcaaggtg cgcgtggacc aaaagtgcaa gtcgtccgcc 1560

cagatcgacc ccacccccgt gatcgtcacc tccaacacca acatgtgcgc cgtgattgac 1620

gggaacagca ccaccttcga gcaccagcag ccgttgcagg accggatgtt caaatttgaa 1680

ctcacccgcc gtctggagca cgactttggc aaggtgacga agcaggaagt caaagagttc 1740

ttccgctggg ccagtgatca cgtgaccgag gtggcgcatg agttctacgt cagaaagggc 1800

ggagccagca aaagacccgc ccccgatgac gcggatataa gcgagcccaa gcgggcctgc 1860

ccctcagtcg cggatccatc gacgtcagac gcggaaggag ctccggtgga ctttgccgac 1920

aggtaccaaa acaaatgttc tcgtcacgcg ggcatgattc agatgctgtt tccctgcaaa 1980

acgtgcgaga gaatgaatca gaatttcaac atttgcttca cacacggggt cagagactgt 2040

ttagagtgtt tccccggcgt gtcagaatct caaccggtcg tcagaaaaaa gacgtatcgg 2100

aaactctgcg cgattcatca tctgctgggg cgggcgcccg agattgcttg ctcggcctgc 2160

gacctggtca acgtggacct ggacgactgc gtttctgagc aataaatgac ttaaaccagg 2220

tatggctgcc gatggttatc ttccagattg gctcgaggac aacctctctg agggcattcg 2280

cgagtggtgg gacctgaaac ctggagcccc gaaacccaaa gccaaccagc aaaagcagga 2340

caacggccgg ggtctggtgc ttcctggcta caagtacctc ggacccttca acggactcga 2400

caagggggag cccgtcaacg cggcggacgc agcggccctc gagcacgaca aggcctacga 2460

ccagcagctc aaagcgggtg acaatccgta cctgcggtat aaccacgccg acgccgagtt 2520

tcaggagcgt ctgcaagaag atacgtcatt tgggggcaac ctcgggcgag cagtcttcca 2580

ggccaagaag cgggttctcg aacctctcgg tctggttgag gaaggcgcta agacggctcc 2640

tgcaaagaag agaccggtag agccgtcacc tcagcgttcc cccgactcct ccacgggcat 2700

cggcaagaaa ggccagcagc ccgccagaaa gagactcaat ttcggtcaga ctggcgactc 2760

agagtcagtc cccgaccctc aacctctcgg agaacctcca gcagcgccct ctagtgtggg 2820

atctggtaca gtggctgcag gcggtggcgc accaatggca gacaataacg aaggtgccga 2880

cggagtgggt aatgcctcag gaaattggca ttgcgattcc acatggctgg gcgacagagt 2940

cattaccacc agcacccgaa cctgggccct gcccacctac aacaaccacc tctacaagca 3000

aatctccagt gaaactgcag gtagtaccaa cgacaacacc tacttcggct acagcacccc 3060

ctgggggtat tttgacttta acagattcca ctgccacttc tcaccacgtg actggcagcg 3120

actcatcaac aacaactggg gattccggcc caagaagctg cggttcaagc tcttcaacat 3180

ccaggtcaag gaggtcacga cgaatgacgg cgttacgacc atcgctaata accttaccag 3240

cacgattcag gtattctcgg actcggaata ccagctgccg tacgtcctcg gctctgcgca 3300

ccagggctgc ctgcctccgt tcccggcgga cgtcttcatg attcctcagt acggctacct 3360

gactctcaac aatggcagtc agtctgtggg acgttcctcc ttctactgcc tggagtactt 3420

cccctctcag atgctgagaa cgggcaacaa ctttgagttc agctacagct tcgaggacgt 3480

gcctttccac agcagctacg cacacagcca gagcctggac cggctgatga atcccctcat 3540

cgaccagtac ttgtactacc tggccagaac acagagtaac ccaggaggca cagctggcaa 3600

tcgggaactg cagttttacc agggcgggcc ttcaactatg gccgaacaag ccaagaattg 3660

gttacctgga ccttgcttcc ggcaacaaag agtctccaaa acgctggatc aaaacaacaa 3720

cagcaacttt gcttggactg gtgccaccaa atatcacctg aacggcagaa actcgttggt 3780

taatcccggc gtcgccatgg caactcacaa ggacgacgag gaccgctttt tcccatccag 3840

cggagtcctg atttttggaa aaactggagc aactaacaaa actacattgg aaaatgtgtt 3900

aatgacaaat gaagaagaaa ttcgtcctac taatcctgta gccacggaag aatacgggat 3960

agtcagcagc aacttacaag cggctaatac tgcagcccag acacaagttg tcaacaacca 4020

gggagcctta cctggcatgg tctggcagaa ccgggacgtg tacctgcagg gtcccatctg 4080

ggccaagatt cctcacacgg atggcaactt tcacccgtct cctttgatgg gcggctttgg 4140

acttaaacat ccgcctcctc agatcctgat caagaacact cccgttcccg ctaatcctcc 4200

ggaggtgttt actcctgcca agtttgcttc gttcatcaca cagtacagca ccggacaagt 4260

cagcgtggaa atcgagtggg agctgcagaa ggaaaacagc aagcgctgga acccggagat 4320

tcagtacacc tccaactttg aaaagcagac tggtgtggac tttgccgttg acagccaggg 4380

tgtttactct gagcctcgcc ctattggcac tcgttacctc acccgtaatc tgtaattgca 4440

tgttaatcaa taaaccggtt gattcgtttc agttgaactt tggtctcctg tgcttcttat 4500

cttatcggtt tccatagcaa ctggttacac attaactgct tgggtgcgct tcacgataag 4560

aacactgacg tcaccgcggt acccctagtg atggagttgg ccactccctc tatgcgcgct 4620

cgctcgctcg gtggggcctg cggaccaaag gtccgcagac ggcagagctc tgctctgccg 4680

gccccaccga gcgagcgagc gcgcatagag ggagtggcca a 4721

<210> 2

<211> 737

<212> PRT

<213> capsid protein of adeno-associated virus serotype 7

<400> 2

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asn Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Ala Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro

180 185 190

Pro Ala Ala Pro Ser Ser Val Gly Ser Gly Thr Val Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn

210 215 220

Ala Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Ser Glu Thr Ala Gly Ser Thr Asn Asp Asn

260 265 270

Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg

275 280 285

Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn

290 295 300

Asn Trp Gly Phe Arg Pro Lys Lys Leu Arg Phe Lys Leu Phe Asn Ile

305 310 315 320

Gln Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn

325 330 335

Asn Leu Thr Ser Thr Ile Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu

340 345 350

Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro

355 360 365

Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn

370 375 380

Gly Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe

385 390 395 400

Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Ser

405 410 415

Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu

420 425 430

Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala

435 440 445

Arg Thr Gln Ser Asn Pro Gly Gly Thr Ala Gly Asn Arg Glu Leu Gln

450 455 460

Phe Tyr Gln Gly Gly Pro Ser Thr Met Ala Glu Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Phe Arg Gln Gln Arg Val Ser Lys Thr Leu Asp

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asn Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile

530 535 540

Phe Gly Lys Thr Gly Ala Thr Asn Lys Thr Thr Leu Glu Asn Val Leu

545 550 555 560

Met Thr Asn Glu Glu Glu Ile Arg Pro Thr Asn Pro Val Ala Thr Glu

565 570 575

Glu Tyr Gly Ile Val Ser Ser Asn Leu Gln Ala Ala Asn Thr Ala Ala

580 585 590

Gln Thr Gln Val Val Asn Asn Gln Gly Ala Leu Pro Gly Met Val Trp

595 600 605

Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro

610 615 620

His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly

625 630 635 640

Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro

645 650 655

Ala Asn Pro Pro Glu Val Phe Thr Pro Ala Lys Phe Ala Ser Phe Ile

660 665 670

Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu

675 680 685

Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser

690 695 700

Asn Phe Glu Lys Gln Thr Gly Val Asp Phe Ala Val Asp Ser Gln Gly

705 710 715 720

Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn

725 730 735

Leu

<210> 3

<211> 623

<212> PRT

<213> rep protein of adeno-associated virus serotype 7

<400> 3

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Val Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Glu Lys Leu Val Gln Thr Ile Tyr Arg Gly Val Glu Pro Thr Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

260 265 270

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

275 280 285

Leu Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

485 490 495

Pro Asp Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

500 505 510

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

515 520 525

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Ile Gln Met

530 535 540

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

545 550 555 560

Cys Phe Thr His Gly Val Arg Asp Cys Leu Glu Cys Phe Pro Gly Val

565 570 575

Ser Glu Ser Gln Pro Val Val Arg Lys Lys Thr Tyr Arg Lys Leu Cys

580 585 590

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

595 600 605

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

610 615 620

<210> 4

<211> 4393

<212> DNA

<213> adeno-associated Virus serotype 8

<400> 4

cagagaggga gtggccaact ccatcactag gggtagcgcg aagcgcctcc cacgctgccg 60

cgtcagcgct gacgtaaatt acgtcatagg ggagtggtcc tgtattagct gtcacgtgag 120

tgcttttgcg gcattttgcg acaccacgtg gccatttgag gtatatatgg ccgagtgagc 180

gagcaggatc tccattttga ccgcgaaatt tgaacgagca gcagccatgc cgggcttcta 240

cgagatcgtg atcaaggtgc cgagcgacct ggacgagcac ctgccgggca tttctgactc 300

gtttgtgaac tgggtggccg agaaggaatg ggagctgccc ccggattctg acatggatcg 360

gaatctgatc gagcaggcac ccctgaccgt ggccgagaag ctgcagcgcg acttcctggt 420

ccaatggcgc cgcgtgagta aggccccgga ggccctcttc tttgttcagt tcgagaaggg 480

cgagagctac tttcacctgc acgttctggt cgagaccacg ggggtcaagt ccatggtgct 540

aggccgcttc ctgagtcaga ttcgggaaaa gcttggtcca gaccatctac ccgcggggtc 600

gagccccacc ttgcccaact ggttcgcggt gaccaaagac gcggtaatgg cgccggcggg 660

ggggaacaag gtggtggacg agtgctacat ccccaactac ctcctgccca agactcagcc 720

cgagctgcag tgggcgtgga ctaacatgga ggagtatata agcgcgtgct tgaacctggc 780

cgagcgcaaa cggctcgtgg cgcagcacct gacccacgtc agccagacgc aggagcagaa 840

caaggagaat ctgaacccca attctgacgc gcccgtgatc aggtcaaaaa cctccgcgcg 900

ctatatggag ctggtcgggt ggctggtgga ccggggcatc acctccgaga agcagtggat 960

ccaggaggac caggcctcgt acatctcctt caacgccgcc tccaactcgc ggtcccagat 1020

caaggccgcg ctggacaatg ccggcaagat catggcgctg accaaatccg cgcccgacta 1080

cctggtgggg ccctcgctgc ccgcggacat tacccagaac cgcatctacc gcatcctcgc 1140

tctcaacggc tacgaccctg cctacgccgg ctccgtcttt ctcggctggg ctcagaaaaa 1200

gttcgggaaa cgcaacacca tctggctgtt tggacccgcc accaccggca agaccaacat 1260

tgcggaagcc atcgcccacg ccgtgccctt ctacggctgc gtcaactgga ccaatgagaa 1320

ctttcccttc aatgattgcg tcgacaagat ggtgatctgg tgggaggagg gcaagatgac 1380

ggccaaggtc gtggagtccg ccaaggccat tctcggcggc agcaaggtgc gcgtggacca 1440

aaagtgcaag tcgtccgccc agatcgaccc cacccccgtg atcgtcacct ccaacaccaa 1500

catgtgcgcc gtgattgacg ggaacagcac caccttcgag caccagcagc ctctccagga 1560

ccggatgttt aagttcgaac tcacccgccg tctggagcac gactttggca aggtgacaaa 1620

gcaggaagtc aaagagttct tccgctgggc cagtgatcac gtgaccgagg tggcgcatga 1680

gttttacgtc agaaagggcg gagccagcaa aagacccgcc cccgatgacg cggataaaag 1740

cgagcccaag cgggcctgcc cctcagtcgc ggatccatcg acgtcagacg cggaaggagc 1800

tccggtggac tttgccgaca ggtaccaaaa caaatgttct cgtcacgcgg gcatgcttca 1860

gatgctgttt ccctgcaaaa cgtgcgagag aatgaatcag aatttcaaca tttgcttcac 1920

acacggggtc agagactgct cagagtgttt ccccggcgtg tcagaatctc aaccggtcgt 1980

cagaaagagg acgtatcgga aactctgtgc gattcatcat ctgctggggc gggctcccga 2040

gattgcttgc tcggcctgcg atctggtcaa cgtggacctg gatgactgtg tttctgagca 2100

ataaatgact taaaccaggt atggctgccg atggttatct tccagattgg ctcgaggaca 2160

acctctctga gggcattcgc gagtggtggg cgctgaaacc tggagccccg aagcccaaag 2220

ccaaccagca aaagcaggac gacggccggg gtctggtgct tcctggctac aagtacctcg 2280

gacccttcaa cggactcgac aagggggagc ccgtcaacgc ggcggacgca gcggccctcg 2340

agcacgacaa ggcctacgac cagcagctgc aggcgggtga caatccgtac ctgcggtata 2400

accacgccga cgccgagttt caggagcgtc tgcaagaaga tacgtctttt gggggcaacc 2460

tcgggcgagc agtcttccag gccaagaagc gggttctcga acctctcggt ctggttgagg 2520

aaggcgctaa gacggctcct ggaaagaaga gaccggtaga gccatcaccc cagcgttctc 2580

cagactcctc tacgggcatc ggcaagaaag gccaacagcc cgccagaaaa agactcaatt 2640

ttggtcagac tggcgactca gagtcagttc cagaccctca acctctcgga gaacctccag 2700

cagcgccctc tggtgtggga cctaatacaa tggctgcagg cggtggcgca ccaatggcag 2760

acaataacga aggcgccgac ggagtgggta gttcctcggg aaattggcat tgcgattcca 2820

catggctggg cgacagagtc atcaccacca gcacccgaac ctgggccctg cccacctaca 2880

acaaccacct ctacaagcaa atctccaacg ggacatcggg aggagccacc aacgacaaca 2940

cctacttcgg ctacagcacc ccctgggggt attttgactt taacagattc cactgccact 3000

tttcaccacg tgactggcag cgactcatca acaacaactg gggattccgg cccaagagac 3060

tcagcttcaa gctcttcaac atccaggtca aggaggtcac gcagaatgaa ggcaccaaga 3120

ccatcgccaa taacctcacc agcaccatcc aggtgtttac ggactcggag taccagctgc 3180

cgtacgttct cggctctgcc caccagggct gcctgcctcc gttcccggcg gacgtgttca 3240

tgattcccca gtacggctac ctaacactca acaacggtag tcaggccgtg ggacgctcct 3300

ccttctactg cctggaatac tttccttcgc agatgctgag aaccggcaac aacttccagt 3360

ttacttacac cttcgaggac gtgcctttcc acagcagcta cgcccacagc cagagcttgg 3420

accggctgat gaatcctctg attgaccagt acctgtacta cttgtctcgg actcaaacaa 3480

caggaggcac ggcaaatacg cagactctgg gcttcagcca aggtgggcct aatacaatgg 3540

ccaatcaggc aaagaactgg ctgccaggac cctgttaccg ccaacaacgc gtctcaacga 3600

caaccgggca aaacaacaat agcaactttg cctggactgc tgggaccaaa taccatctga 3660

atggaagaaa ttcattggct aatcctggca tcgctatggc aacacacaaa gacgacgagg 3720

agcgtttttt tcccagtaac gggatcctga tttttggcaa acaaaatgct gccagagaca 3780

atgcggatta cagcgatgtc atgctcacca gcgaggaaga aatcaaaacc actaaccctg 3840

tggctacaga ggaatacggt atcgtggcag ataacttgca gcagcaaaac acggctcctc 3900

aaattggaac tgtcaacagc cagggggcct tacccggtat ggtctggcag aaccgggacg 3960

tgtacctgca gggtcccatc tgggccaaga ttcctcacac ggacggcaac ttccacccgt 4020

ctccgctgat gggcggcttt ggcctgaaac atcctccgcc tcagatcctg atcaagaaca 4080

cgcctgtacc tgcggatcct ccgaccacct tcaaccagtc aaagctgaac tctttcatca 4140

cgcaatacag caccggacag gtcagcgtgg aaattgaatg ggagctgcag aaggaaaaca 4200

gcaagcgctg gaaccccgag atccagtaca cctccaacta ctacaaatct acaagtgtgg 4260

actttgctgt taatacagaa ggcgtgtact ctgaaccccg ccccattggc acccgttacc 4320

tcacccgtaa tctgtaattg cctgttaatc aataaaccgg ttgattcgtt tcagttgaac 4380

tttggtctct gcg 4393

<210> 5

<211> 4385

<212> DNA

<213> adeno-associated Virus serotype 9

<400> 5

cagagaggga gtggccaact ccatcactag gggtaatcgc gaagcgcctc ccacgctgcc 60

gcgtcagcgc tgacgtagat tacgtcatag gggagtggtc ctgtattagc tgtcacgtga 120

gtgcttttgc gacattttgc gacaccacat ggccatttga ggtatatatg gccgagtgag 180

cgagcaggat ctccattttg accgcgaaat ttgaacgagc agcagccatg ccgggcttct 240

acgagattgt gatcaaggtg ccgagcgacc tggacgagca cctgccgggc atttctgact 300

cttttgtgaa ctgggtggcc gagaaggaat gggagctgcc cccggattct gacatggatc 360

ggaatctgat cgagcaggca cccctgaccg tggccgagaa gctgcagcgc gacttcctgg 420

tccaatggcg ccgcgtgagt aaggccccgg aggccctctt ctttgttcag ttcgagaagg 480

gcgagagcta ctttcacctg cacgttctgg tcgagaccac gggggtcaag tccatggtgc 540

taggccgctt cctgagtcag attcgggaga agctggtcca gaccatctac cgcgggatcg 600

agccgaccct gcccaactgg ttcgcggtga ccaagacgcg taatggcgcc ggcgggggga 660

acaaggtggt ggacgagtgc tacatcccca actacctcct gcccaagact cagcccgagc 720

tgcagtgggc gtggactaac atggaggagt atataagcgc gtgcttgaac ctggccgagc 780

gcaaacggct cgtggcgcag cacctgaccc acgtcagcca gacgcaggag cagaacaagg 840

agaatctgaa ccccaattct gacgcgcccg tgatcaggtc aaaaacctcc gcgcgctaca 900

tggagctggt cgggtggctg gtggaccggg gcatcacctc cgagaagcag tggatccagg 960

aggaccaggc ctcgtacatc tccttcaacg ccgcctccaa ctcgcggtcc cagatcaagg 1020

ccgcgctgga caatgccggc aagatcatgg cgctgaccaa atccgcgccc gactacctgg 1080

taggcccttc acttccggtg gacattacgc agaaccgcat ctaccgcatc ctgcagctca 1140

acggctacga ccctgcctac gccggctccg tctttctcgg ctgggcacaa aagaagttcg 1200

ggaaacgcaa caccatctgg ctgtttgggc cggccaccac gggaaagacc aacatcgcag 1260

aagccattgc ccacgccgtg cccttctacg gctgcgtcaa ctggaccaat gagaactttc 1320

ccttcaacga ttgcgtcgac aagatggtga tctggtggga ggagggcaag atgacggcca 1380

aggtcgtgga gtccgccaag gccattctcg gcggcagcaa ggtgcgcgtg gaccaaaagt 1440

gcaagtcgtc cgcccagatc gaccccactc ccgtgatcgt cacctccaac accaacatgt 1500

gcgccgtgat tgacgggaac agcaccacct tcgagcacca gcagcctctc caggaccgga 1560

tgtttaagtt cgaactcacc cgccgtctgg agcacgactt tggcaaggtg acaaagcagg 1620

aagtcaaaga gttcttccgc tgggccagtg atcacgtgac cgaggtggcg catgagtttt 1680

acgtcagaaa gggcggagcc agcaaaagac ccgcccccga tgacgcggat aaaagcgagc 1740

ccaagcgggc ctgcccctca gtcgcggatc catcgacgtc agacgcggaa ggagctccgg 1800

tggactttgc cgacaggtac caaaacaaat gttctcgtca cgcgggcatg cttcagatgc 1860

tgcttccctg caaaacgtgc gagagaatga atcagaattt caacatttgc ttcacacacg 1920

gggtcagaga ctgctcagag tgtttccccg gcgtgtcaga atctcaaccg gtcgtcagaa 1980

agaggacgta tcggaaactc tgtgcgattc atcatctgct ggggcgggct cccgagattg 2040

cttgctcggc ctgcgatctg gtcaacgtgg acctggatga ctgtgtttct gagcaataaa 2100

tgacttaaac caggtatggc tgccgatggt tatcttccag attggctcga ggacaacctc 2160

tctgagggca ttcgcgagtg gtgggcgctg aaacctggag ccccgaagcc caaagccaac 2220

cagcaaaagc aggacgacgg ccggggtctg gtgcttcctg gctacaagta cctcggaccc 2280

ttcaacggac tcgacaaggg ggagcccgtc aacgcggcgg acgcagcggc cctcgagcac 2340

ggcaaggcct acgaccagca gctgcaggcg ggtgacaatc cgtacctgcg gtataaccac 2400

gccgacgccg agtttcagga gcgtctgcaa gaagatacgt cttttggggg caacctcggg 2460

cgagcagtct tccaggccaa gaagcgggtt ctcgaacctc tcggtctggt tgaggaaggc 2520

gctaagacgg ctcctggaaa gaagagaccg gtagagccat caccccagcg ttctccagac 2580

tcctctacgg gcatcggcaa gaaaggccaa cagcccgcca gaaaaagact caattttggt 2640

cagactggcg actcagagtc agttccagac cctcaacctc tcggagaacc tccagcagcg 2700

ccctctggtg tgggacctaa tacaatggct gcaggcggtg gcgcaccaat ggcagacaat 2760

aacgaaggcg ccgacggagt gggtaattcc tcgggaaatt ggcattgcga ttccacatgg 2820

ctgggggaca gagtcatcac caccagcacc cgaacctggg cattgcccac ctacaacaac 2880

cacctctaca agcaaatctc caatggaaca tcgggaggaa gcaccaacga caacacctac 2940

tttggctaca gcaccccctg ggggtatttt gacttcaaca gattccactg ccacttctca 3000

ccacgtgact ggcagcgact catcaacaac aactggggat tccggccaaa gagactcaac 3060

ttcaagctgt tcaacatcca ggtcaaggag gttacgacga acgaaggcac caagaccatc 3120

gccaataacc ttaccagcac cgtccaggtc tttacggact cggagtacca gctaccgtac 3180

gtcctaggct ctgcccacca aggatgcctg ccaccgtttc ctgcagacgt cttcatggtt 3240

cctcagtacg gctacctgac gctcaacaat ggaagtcaag cgttaggacg ttcttctttc 3300

tactgtctgg aatacttccc ttctcagatg ctgagaaccg gcaacaactt tcagttcagc 3360

tacactttcg aggacgtgcc tttccacagc agctacgcac acagccagag tctagatcga 3420

ctgatgaacc ccctcatcga ccagtaccta tactacctgg tcagaacaca gacaactgga 3480

actgggggaa ctcaaacttt ggcattcagc caagcaggcc ctagctcaat ggccaatcag 3540

gctagaaact gggtacccgg gccttgctac cgtcagcagc gcgtctccac aaccaccaac 3600

caaaataaca acagcaactt tgcgtggacg ggagctgcta aattcaagct gaacgggaga 3660

gactcgctaa tgaatcctgg cgtggctatg gcatcgcaca aagacgacga ggaccgcttc 3720

tttccatcaa gtggcgttct catatttggc aagcaaggag ccgggaacga tggagtcgac 3780

tacagccagg tgctgattac agatgaggaa gaaattaaag ccaccaaccc tgtagccaca 3840

gaggaatacg gagcagtggc catcaacaac caggccgcta acacgcaggc gcaaactgga 3900

cttgtgcata accagggagt tattcctggt atggtctggc agaaccggga cgtgtacctg 3960

cagggcccta tttgggctaa aatacctcac acagatggca actttcaccc gtctcctctg 4020

atgggtggat ttggactgaa acacccacct ccacagattc taattaaaaa tacaccagtg 4080

ccggcagatc ctcctcttac cttcaatcaa gccaagctga actctttcat cacgcagtac 4140

agcacgggac aagtcagcgt ggaaatcgag tgggagctgc agaaagaaaa cagcaagcgc 4200

tggaatccag agatccagta tacttcaaac tactacaaat ctacaaatgt ggactttgct 4260

gtcaatacca aaggtgttta ctctgagcct cgccccattg gtactcgtta cctcacccgt 4320

aatttgtaat tgcctgttaa tcaataaacc ggttaattcg tttcagttga actttggtct 4380

ctgcg 4385

<210> 6

<211> 4718

<212> DNA

<213> adeno-associated Virus serotype 1

<400> 6

ttgcccactc cctctctgcg cgctcgctcg ctcggtgggg cctgcggacc aaaggtccgc 60

agacggcaga gctctgctct gccggcccca ccgagcgagc gagcgcgcag agagggagtg 120

ggcaactcca tcactagggg taatcgcgaa gcgcctccca cgctgccgcg tcagcgctga 180

cgtaaattac gtcatagggg agtggtcctg tattagctgt cacgtgagtg cttttgcgac 240

attttgcgac accacgtggc catttagggt atatatggcc gagtgagcga gcaggatctc 300

cattttgacc gcgaaatttg aacgagcagc agccatgccg ggcttctacg agatcgtgat 360

caaggtgccg agcgacctgg acgagcacct gccgggcatt tctgactcgt ttgtgagctg 420

ggtggccgag aaggaatggg agctgccccc ggattctgac atggatctga atctgattga 480

gcaggcaccc ctgaccgtgg ccgagaagct gcagcgcgac ttcctggtcc aatggcgccg 540

cgtgagtaag gccccggagg ccctcttctt tgttcagttc gagaagggcg agtcctactt 600

ccacctccat attctggtgg agaccacggg ggtcaaatcc atggtgctgg gccgcttcct 660

gagtcagatt agggacaagc tggtgcagac catctaccgc gggatcgagc cgaccctgcc 720

caactggttc gcggtgacca agacgcgtaa tggcgccgga ggggggaaca aggtggtgga 780

cgagtgctac atccccaact acctcctgcc caagactcag cccgagctgc agtgggcgtg 840

gactaacatg gaggagtata taagcgcctg tttgaacctg gccgagcgca aacggctcgt 900

ggcgcagcac ctgacccacg tcagccagac ccaggagcag aacaaggaga atctgaaccc 960

caattctgac gcgcctgtca tccggtcaaa aacctccgcg cgctacatgg agctggtcgg 1020

gtggctggtg gaccggggca tcacctccga gaagcagtgg atccaggagg accaggcctc 1080

gtacatctcc ttcaacgccg cttccaactc gcggtcccag atcaaggccg ctctggacaa 1140

tgccggcaag atcatggcgc tgaccaaatc cgcgcccgac tacctggtag gccccgctcc 1200

gcccgcggac attaaaacca accgcatcta ccgcatcctg gagctgaacg gctacgaacc 1260

tgcctacgcc ggctccgtct ttctcggctg ggcccagaaa aggttcggga agcgcaacac 1320

catctggctg tttgggccgg ccaccacggg caagaccaac atcgcggaag ccatcgccca 1380

cgccgtgccc ttctacggct gcgtcaactg gaccaatgag aactttccct tcaatgattg 1440

cgtcgacaag atggtgatct ggtgggagga gggcaagatg acggccaagg tcgtggagtc 1500

cgccaaggcc attctcggcg gcagcaaggt gcgcgtggac caaaagtgca agtcgtccgc 1560

ccagatcgac cccacccccg tgatcgtcac ctccaacacc aacatgtgcg ccgtgattga 1620

cgggaacagc accaccttcg agcaccagca gccgttgcag gaccggatgt tcaaatttga 1680

actcacccgc cgtctggagc atgactttgg caaggtgaca aagcaggaag tcaaagagtt 1740

cttccgctgg gcgcaggatc acgtgaccga ggtggcgcat gagttctacg tcagaaaggg 1800

tggagccaac aaaagacccg cccccgatga cgcggataaa agcgagccca agcgggcctg 1860

cccctcagtc gcggatccat cgacgtcaga cgcggaagga gctccggtgg actttgccga 1920

caggtaccaa aacaaatgtt ctcgtcacgc gggcatgctt cagatgctgt ttccctgcaa 1980

gacatgcgag agaatgaatc agaatttcaa catttgcttc acgcacggga cgagagactg 2040

ttcagagtgc ttccccggcg tgtcagaatc tcaaccggtc gtcagaaaga ggacgtatcg 2100

gaaactctgt gccattcatc atctgctggg gcgggctccc gagattgctt gctcggcctg 2160

cgatctggtc aacgtggacc tggatgactg tgtttctgag caataaatga cttaaaccag 2220

gtatggctgc cgatggttat cttccagatt ggctcgagga caacctctct gagggcattc 2280

gcgagtggtg ggacttgaaa cctggagccc cgaagcccaa agccaaccag caaaagcagg 2340

acgacggccg gggtctggtg cttcctggct acaagtacct cggacccttc aacggactcg 2400

acaaggggga gcccgtcaac gcggcggacg cagcggccct cgagcacgac aaggcctacg 2460

accagcagct caaagcgggt gacaatccgt acctgcggta taaccacgcc gacgccgagt 2520

ttcaggagcg tctgcaagaa gatacgtctt ttgggggcaa cctcgggcga gcagtcttcc 2580

aggccaagaa gcgggttctc gaacctctcg gtctggttga ggaaggcgct aagacggctc 2640

ctggaaagaa acgtccggta gagcagtcgc cacaagagcc agactcctcc tcgggcatcg 2700

gcaagacagg ccagcagccc gctaaaaaga gactcaattt tggtcagact ggcgactcag 2760

agtcagtccc cgatccacaa cctctcggag aacctccagc aacccccgct gctgtgggac 2820

ctactacaat ggcttcaggc ggtggcgcac caatggcaga caataacgaa ggcgccgacg 2880

gagtgggtaa tgcctcagga aattggcatt gcgattccac atggctgggc gacagagtca 2940

tcaccaccag cacccgcacc tgggccttgc ccacctacaa taaccacctc tacaagcaaa 3000

tctccagtgc ttcaacgggg gccagcaacg acaaccacta cttcggctac agcaccccct 3060

gggggtattt tgatttcaac agattccact gccacttttc accacgtgac tggcagcgac 3120

tcatcaacaa caattgggga ttccggccca agagactcaa cttcaaactc ttcaacatcc 3180

aagtcaagga ggtcacgacg aatgatggcg tcacaaccat cgctaataac cttaccagca 3240

cggttcaagt cttctcggac tcggagtacc agcttccgta cgtcctcggc tctgcgcacc 3300

agggctgcct ccctccgttc ccggcggacg tgttcatgat tccgcaatac ggctacctga 3360

cgctcaacaa tggcagccaa gccgtgggac gttcatcctt ttactgcctg gaatatttcc 3420

cttctcagat gctgagaacg ggcaacaact ttaccttcag ctacaccttt gaggaagtgc 3480

ctttccacag cagctacgcg cacagccaga gcctggaccg gctgatgaat cctctcatcg 3540

accaatacct gtattacctg aacagaactc aaaatcagtc cggaagtgcc caaaacaagg 3600

acttgctgtt tagccgtggg tctccagctg gcatgtctgt tcagcccaaa aactggctac 3660

ctggaccctg ttatcggcag cagcgcgttt ctaaaacaaa aacagacaac aacaacagca 3720

attttacctg gactggtgct tcaaaatata acctcaatgg gcgtgaatcc atcatcaacc 3780

ctggcactgc tatggcctca cacaaagacg acgaagacaa gttctttccc atgagcggtg 3840

tcatgatttt tggaaaagag agcgccggag cttcaaacac tgcattggac aatgtcatga 3900

ttacagacga agaggaaatt aaagccacta accctgtggc caccgaaaga tttgggaccg 3960

tggcagtcaa tttccagagc agcagcacag accctgcgac cggagatgtg catgctatgg 4020

gagcattacc tggcatggtg tggcaagata gagacgtgta cctgcagggt cccatttggg 4080

ccaaaattcc tcacacagat ggacactttc acccgtctcc tcttatgggc ggctttggac 4140

tcaagaaccc gcctcctcag atcctcatca aaaacacgcc tgttcctgcg aatcctccgg 4200

cggagttttc agctacaaag tttgcttcat tcatcaccca atactccaca ggacaagtga 4260

gtgtggaaat tgaatgggag ctgcagaaag aaaacagcaa gcgctggaat cccgaagtgc 4320

agtacacatc caattatgca aaatctgcca acgttgattt tactgtggac aacaatggac 4380

tttatactga gcctcgcccc attggcaccc gttaccttac ccgtcccctg taattacgtg 4440

ttaatcaata aaccggttga ttcgtttcag ttgaactttg gtctcctgtc cttcttatct 4500

tatcggttac catggttata gcttacacat taactgcttg gttgcgcttc gcgataaaag 4560

acttacgtca tcgggttacc cctagtgatg gagttgccca ctccctctct gcgcgctcgc 4620

tcgctcggtg gggcctgcgg accaaaggtc cgcagacggc agagctctgc tctgccggcc 4680

ccaccgagcg agcgagcgcg cagagaggga gtgggcaa 4718

<210> 7

<211> 4675

<212> DNA

<213> adeno-associated Virus serotype 2

<400> 7

ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60

cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120

gccaactcca tcactagggg ttcctggagg ggtggagtcg tgacgtgaat tacgtcatag 180

ggttagggag gtcctgtatt agaggtcacg tgagtgtttt gcgacatttt gcgacaccat 240

gtggtcacgc tgggtattta agcccgagtg agcacgcagg gtctccattt tgaagcggga 300

ggtttgaacg cgcagccgcc atgccggggt tttacgagat tgtgattaag gtccccagcg 360

accttgacgg gcatctgccc ggcatttctg acagctttgt gaactgggtg gccgagaagg 420

aatgggagtt gccgccagat tctgacatgg atctgaatct gattgagcag gcacccctga 480

ccgtggccga gaagctgcag cgcgactttc tgacggaatg gcgccgtgtg agtaaggccc 540

cggaggccct tttctttgtg caatttgaga agggagagag ctacttccac atgcacgtgc 600

tcgtggaaac caccggggtg aaatccatgg ttttgggacg tttcctgagt cagattcgcg 660

aaaaactgat tcagagaatt taccgcggga tcgagccgac tttgccaaac tggttcgcgg 720

tcacaaagac cagaaatggc gccggaggcg ggaacaaggt ggtggatgag tgctacatcc 780

ccaattactt gctccccaaa acccagcctg agctccagtg ggcgtggact aatatggaac 840

agtatttaag cgcctgtttg aatctcacgg agcgtaaacg gttggtggcg cagcatctga 900

cgcacgtgtc gcagacgcag gagcagaaca aagagaatca gaatcccaat tctgatgcgc 960

cggtgatcag atcaaaaact tcagccaggt acatggagct ggtcgggtgg ctcgtggaca 1020

aggggattac ctcggagaag cagtggatcc aggaggacca ggcctcatac atctccttca 1080

atgcggcctc caactcgcgg tcccaaatca aggctgcctt ggacaatgcg ggaaagatta 1140

tgagcctgac taaaaccgcc cccgactacc tggtgggcca gcagcccgtg gaggacattt 1200

ccagcaatcg gatttataaa attttggaac taaacgggta cgatccccaa tatgcggctt 1260

ccgtctttct gggatgggcc acgaaaaagt tcggcaagag gaacaccatc tggctgtttg 1320

ggcctgcaac taccgggaag accaacatcg cggaggccat agcccacact gtgcccttct 1380

acgggtgcgt aaactggacc aatgagaact ttcccttcaa cgactgtgtc gacaagatgg 1440

tgatctggtg ggaggagggg aagatgaccg ccaaggtcgt ggagtcggcc aaagccattc 1500

tcggaggaag caaggtgcgc gtggaccaga aatgcaagtc ctcggcccag atagacccga 1560

ctcccgtgat cgtcacctcc aacaccaaca tgtgcgccgt gattgacggg aactcaacga 1620

ccttcgaaca ccagcagccg ttgcaagacc ggatgttcaa atttgaactc acccgccgtc 1680

tggatcatga ctttgggaag gtcaccaagc aggaagtcaa agactttttc cggtgggcaa 1740

aggatcacgt ggttgaggtg gagcatgaat tctacgtcaa aaagggtgga gccaagaaaa 1800

gacccgcccc cagtgacgca gatataagtg agcccaaacg ggtgcgcgag tcagttgcgc 1860

agccatcgac gtcagacgcg gaagcttcga tcaactacgc agacaggtac caaaacaaat 1920

gttctcgtca cgtgggcatg aatctgatgc tgtttccctg cagacaatgc gagagaatga 1980

atcagaattc aaatatctgc ttcactcacg gacagaaaga ctgtttagag tgctttcccg 2040

tgtcagaatc tcaacccgtt tctgtcgtca aaaaggcgta tcagaaactg tgctacattc 2100

atcatatcat gggaaaggtg ccagacgctt gcactgcctg cgatctggtc aatgtggatt 2160

tggatgactg catctttgaa caataaatga tttaaatcag gtatggctgc cgatggttat 2220

cttccagatt ggctcgagga cactctctct gaaggaataa gacagtggtg gaagctcaaa 2280

cctggcccac caccaccaaa gcccgcagag cggcataagg acgacagcag gggtcttgtg 2340

cttcctgggt acaagtacct cggacccttc aacggactcg acaagggaga gccggtcaac 2400

gaggcagacg ccgcggccct cgagcacgta caaagcctac gaccggcagc tcgacagcgg 2460

agacaacccg tacctcaagt acaaccacgc cgacgcggag tttcaggagc gccttaaaga 2520

agatacgtct tttgggggca acctcggacg agcagtcttc caggcgaaaa agagggttct 2580

tgaacctctg ggcctggttg aggaacctgt taagacggct ccgggaaaaa agaggccggt 2640

agagcactct cctgtggagc cagactcctc ctcgggaacc ggaaaggcgg gccagcagcc 2700

tgcaagaaaa agattgaatt ttggtcagac tggagacgca gactcagtac ctgaccccca 2760

gcctctcgga cagccaccag cagccccctc tggtctggga actaatacga tggctacagg 2820

cagtggcgca ccaatggcag acaataacga gggcgccgac ggagtgggta attcctccgg 2880

aaattggcat tgcgattcca catggatggg cgacagagtc atcaccacca gcacccgaac 2940

ctgggccctg cccacctaca acaaccacct ctacaaacaa atttccagcc aatcaggagc 3000

ctcgaacgac aatcactact ttggctacag caccccttgg gggtattttg acttcaacag 3060

attccactgc cacttttcac cacgtgactg gcaaagactc atcaacaaca actggggatt 3120

ccgacccaag agactcaact tcaagctctt taacattcaa gtcaaagagg tcacgcagaa 3180

tgacggtacg acgacgattg ccaataacct taccagcacg gttcaggtgt ttactgactc 3240

ggagtaccag ctcccgtacg tcctcggctc ggcgcatcaa ggatgcctcc cgccgttccc 3300

agcagacgtc ttcatggtgc cacagtatgg atacctcacc ctgaacaacg ggagtcaggc 3360

agtaggacgc tcttcatttt actgcctgga gtactttcct tctcagatgc tgcgtaccgg 3420

aaacaacttt accttcagct acacttttga ggacgttcct ttccacagca gctacgctca 3480

cagccagagt ctggaccgtc tcatgaatcc tctcatcgac cagtacctgt attacttgag 3540

cagaacaaac actccaagtg gaaccaccac gcagtcaagg cttcagtttt ctcaggccgg 3600

agcgagtgac attcgggacc agtctaggaa ctggcttcct ggaccctgtt accgccagca 3660

gcgagtatca aagacatctg cggataacaa caacagtgaa tactcgtgga ctggagctac 3720

caagtaccac ctcaatggca gagactctct ggtgaatccg gccatggcaa gccacaagga 3780

cgatgaagaa aagttttttc ctcagagcgg ggttctcatc tttgggaagc aaggctcaga 3840

gaaaacaaat gtgaacattg aaaaggtcat gattacagac gaagaggaaa tcggaacaac 3900

caatcccgtg gctacggagc agtatggttc tgtatctacc aacctccaga gaggcaacag 3960

acaagcagct accgcagatg tcaacacaca aggcgttctt ccaggcatgg tctggcagga 4020

cagagatgtg taccttcagg ggcccatctg ggcaaagatt ccacacacgg acggacattt 4080

tcacccctct cccctcatgg gtggattcgg acttaaacac cctcctccac agattctcat 4140

caagaacacc ccggtacctg cgaatccttc gaccaccttc agtgcggcaa agtttgcttc 4200

cttcatcaca cagtactcca cgggacacgg tcagcgtgga gatcgagtgg gagctgcaga 4260

aggaaaacag caaacgctgg aatcccgaaa ttcagtacac ttccaactac aacaagtctg 4320

ttaatcgtgg acttaccgtg gatactaatg gcgtgtattc agagcctcgc cccattggca 4380

ccagatacct gactcgtaat ctgtaattgc ttgttaatca ataaaccgtt taattcgttt 4440

cagttgaact ttggtctctg cgtatttctt tcttatctag tttccatggc tacgtagata 4500

agtagcatgg cgggttaatc attaactaca aggaacccct agtgatggag ttggccactc 4560

cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc cgacgcccgg 4620

gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg gccaa 4675

<210> 8

<211> 4726

<212> DNA

<213> adeno-associated virus serotype 3

<400> 8

ttggccactc cctctatgcg cactcgctcg ctcggtgggg cctggcgacc aaaggtcgcc 60

agacggacgt gctttgcacg tccggcccca ccgagcgagc gagtgcgcat agagggagtg 120

gccaactcca tcactagagg tatggcagtg acgtaacgcg aagcgcgcga agcgagacca 180

cgcctaccag ctgcgtcagc agtcaggtga cccttttgcg acagtttgcg acaccacgtg 240

gccgctgagg gtatatattc tcgagtgagc gaaccaggag ctccattttg accgcgaaat 300

ttgaacgagc agcagccatg ccggggttct acgagattgt cctgaaggtc ccgagtgacc 360

tggacgagcg cctgccgggc atttctaact cgtttgttaa ctgggtggcc gagaaggaat 420

gggacgtgcc gccggattct gacatggatc cgaatctgat tgagcaggca cccctgaccg 480

tggccgaaaa gcttcagcgc gagttcctgg tggagtggcg ccgcgtgagt aaggccccgg 540

aggccctctt ttttgtccag ttcgaaaagg gggagaccta cttccacctg cacgtgctga 600

ttgagaccat cggggtcaaa tccatggtgg tcggccgcta cgtgagccag attaaagaga 660

agctggtgac ccgcatctac cgcggggtcg agccgcagct tccgaactgg ttcgcggtga 720

ccaaaacgcg aaatggcgcc gggggcggga acaaggtggt ggacgactgc tacatcccca 780

actacctgct ccccaagacc cagcccgagc tccagtgggc gtggactaac atggaccagt 840

atttaagcgc ctgtttgaat ctcgcggagc gtaaacggct ggtggcgcag catctgacgc 900

acgtgtcgca gacgcaggag cagaacaaag agaatcagaa ccccaattct gacgcgccgg 960

tcatcaggtc aaaaacctca gccaggtaca tggagctggt cgggtggctg gtggaccgcg 1020

ggatcacgtc agaaaagcaa tggattcagg aggaccaggc ctcgtacatc tccttcaacg 1080

ccgcctccaa ctcgcggtcc cagatcaagg ccgcgctgga caatgcctcc aagatcatga 1140

gcctgacaaa gacggctccg gactacctgg tgggcagcaa cccgccggag gacattacca 1200

aaaatcggat ctaccaaatc ctggagctga acgggtacga tccgcagtac gcggcctccg 1260

tcttcctggg ctgggcgcaa aagaagttcg ggaagaggaa caccatctgg ctctttgggc 1320

cggccacgac gggtaaaacc aacatcgcgg aagccatcgc ccacgccgtg cccttctacg 1380

gctgcgtaaa ctggaccaat gagaactttc ccttcaacga ttgcgtcgac aagatggtga 1440

tctggtggga ggagggcaag atgacggcca aggtcgtgga gagcgccaag gccattctgg 1500

gcggaagcaa ggtgcgcgtg gaccaaaagt gcaagtcatc ggcccagatc gaacccactc 1560

ccgtgatcgt cacctccaac accaacatgt gcgccgtgat tgacgggaac agcaccacct 1620

tcgagcatca gcagccgctg caggaccgga tgtttgaatt tgaacttacc cgccgtttgg 1680

accatgactt tgggaaggtc accaaacagg aagtaaagga ctttttccgg tgggcttccg 1740

atcacgtgac tgacgtggct catgagttct acgtcagaaa gggtggagct aagaaacgcc 1800

ccgcctccaa tgacgcggat gtaagcgagc caaaacggga gtgcacgtca cttgcgcagc 1860

cgacaacgtc agacgcggaa gcaccggcgg actacgcgga caggtaccaa aacaaatgtt 1920

ctcgtcacgt gggcatgaat ctgatgcttt ttccctgtaa aacatgcgag agaatgaatc 1980

aaatttccaa tgtctgtttt acgcatggtc aaagagactg tggggaatgc ttccctggaa 2040

tgtcagaatc tcaacccgtt tctgtcgtca aaaagaagac ttatcagaaa ctgtgtccaa 2100

ttcatcatat cctgggaagg gcacccgaga ttgcctgttc ggcctgcgat ttggccaatg 2160

tggacttgga tgactgtgtt tctgagcaat aaatgactta aaccaggtat ggctgctgac 2220

ggttatcttc cagattggct cgaggacaac ctttctgaag gcattcgtga gtggtgggct 2280

ctgaaacctg gagtccctca acccaaagcg aaccaacaac accaggacaa ccgtcggggt 2340

cttgtgcttc cgggttacaa atacctcgga cccggtaacg gactcgacaa aggagagccg 2400

gtcaacgagg cggacgcggc agccctcgaa cacgacaaag cttacgacca gcagctcaag 2460

gccggtgaca acccgtacct caagtacaac cacgccgacg ccgagtttca ggagcgtctt 2520

caagaagata cgtcttttgg gggcaacctt ggcagagcag tcttccaggc caaaaagagg 2580

atccttgagc ctcttggtct ggttgaggaa gcagctaaaa cggctcctgg aaagaagggg 2640

gctgtagatc agtctcctca ggaaccggac tcatcatctg gtgttggcaa atcgggcaaa 2700

cagcctgcca gaaaaagact aaatttcggt cagactggag actcagagtc agtcccagac 2760

cctcaacctc tcggagaacc accagcagcc cccacaagtt tgggatctaa tacaatggct 2820

tcaggcggtg gcgcaccaat ggcagacaat aacgagggtg ccgatggagt gggtaattcc 2880

tcaggaaatt ggcattgcga ttcccaatgg ctgggcgaca gagtcatcac caccagcacc 2940

agaacctggg ccctgcccac ttacaacaac catctctaca agcaaatctc cagccaatca 3000

ggagcttcaa acgacaacca ctactttggc tacagcaccc cttgggggta ttttgacttt 3060

aacagattcc actgccactt ctcaccacgt gactggcagc gactcattaa caacaactgg 3120

ggattccggc ccaagaaact cagcttcaag ctcttcaaca tccaagttag aggggtcacg 3180

cagaacgatg gcacgacgac tattgccaat aaccttacca gcacggttca agtgtttacg 3240

gactcggagt atcagctccc gtacgtgctc gggtcggcgc accaaggctg tctcccgccg 3300

tttccagcgg acgtcttcat ggtccctcag tatggatacc tcaccctgaa caacggaagt 3360

caagcggtgg gacgctcatc cttttactgc ctggagtact tcccttcgca gatgctaagg 3420

actggaaata acttccaatt cagctatacc ttcgaggatg taccttttca cagcagctac 3480

gctcacagcc agagtttgga tcgcttgatg aatcctctta ttgatcagta tctgtactac 3540

ctgaacagaa cgcaaggaac aacctctgga acaaccaacc aatcacggct gctttttagc 3600

caggctgggc ctcagtctat gtctttgcag gccagaaatt ggctacctgg gccctgctac 3660

cggcaacaga gactttcaaa gactgctaac gacaacaaca acagtaactt tccttggaca 3720

gcggccagca aatatcatct caatggccgc gactcgctgg tgaatccagg accagctatg 3780

gccagtcaca aggacgatga agaaaaattt ttccctatgc acggcaatct aatatttggc 3840

aaagaaggga caacggcaag taacgcagaa ttagataatg taatgattac ggatgaagaa 3900

gagattcgta ccaccaatcc tgtggcaaca gagcagtatg gaactgtggc aaataacttg 3960

cagagctcaa atacagctcc cacgactgga actgtcaatc atcagggggc cttacctggc 4020

atggtgtggc aagatcgtga cgtgtacctt caaggaccta tctgggcaaa gattcctcac 4080

acggatggac actttcatcc ttctcctctg atgggaggct ttggactgaa acatccgcct 4140

cctcaaatca tgatcaaaaa tactccggta ccggcaaatc ctccgacgac tttcagcccg 4200

gccaagtttg cttcatttat cactcagtac tccactggac aggtcagcgt ggaaattgag 4260

tgggagctac agaaagaaaa cagcaaacgt tggaatccag agattcagta cacttccaac 4320

tacaacaagt ctgttaatgt ggactttact gtagacacta atggtgttta tagtgaacct 4380

cgccctattg gaacccggta tctcacacga aacttgtgaa tcctggttaa tcaataaacc 4440

gtttaattcg tttcagttga actttggctc ttgtgcactt ctttatcttt atcttgtttc 4500

catggctact gcgtagataa gcagcggcct gcggcgcttg cgcttcgcgg tttacaactg 4560

ctggttaata tttaactctc gccatacctc tagtgatgga gttggccact ccctctatgc 4620

gcactcgctc gctcggtggg gcctggcgac caaaggtcgc cagacggacg tgctttgcac 4680

gtccggcccc accgagcgag cgagtgcgca tagagggagt ggccaa 4726

<210> 9

<211> 3098

<212> DNA

<213> novel AAV serotype, clone 42.2

<400> 9

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgcgtgga ccaaaagtgc aagtcttccg 180

cccagatcga tcccaccccc gtgatcgtca cttccaacac caacatgtgc gctgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttaca agaccggatg ttcaaatttg 300

aactcacccg ccgtctggag cacgactttg gcaaggtgac aaagcaggaa gtcaaagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttctac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggataa aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

agacatgcga gagaatgaat cagaatttca acatttgctt cacgcacggg accagagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt cgtcagaaag aggacgtatc 720

ggaaactctg tgccattcat catctgctgg ggcgggctcc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggatgacc gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggctcgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaagggag agccggtcaa cgaggcagac gccgcggccc tcgagcacga caaggcctac 1080

gacaagcagc tcgagcaggg ggacaacccg tacctcaagt acaaccacgc cgacgccgag 1140

tttcaggagc gtcttcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagacccat agaatccccc gactcctcca cgggcatcgg caagaaaggc 1320

cagcagcccg ctaaaaagaa gctcaacttt gggcagactg gcgactcaga gtcagtgccc 1380

gacccccaac ctctcggaga acctcccgcc gcgccctcag gtctgggatc tggtacaatg 1440

gctgcaggcg gtggcgcacc aatggcagac aataacgaag gcgccgacgg agtgggtaat 1500

gcctccggaa attggcattg cgattccaca tggctgggcg acagagtcat caccaccagc 1560

acccgcacct gggccctgcc cacctacaac aaccacctct acaagcagat atcaagtcag 1620

agcggggcta ccaacgacaa ccacttcttc ggctacagca ccccctgggg ctattttgac 1680

ttcaacagat tccactgcca cttctcacca cgtgactggc agcgactcat caacaacaac 1740

tggggattcc ggcccagaaa gctgcggttc aagttgttca acatccaggt caaggaggtc 1800

acgacgaacg acggcgttac gaccatcgct aataacctta ccagcacgat tcaggtcttc 1860

tcggactcgg agtaccaact gccgtacgtc ctcggctctg cgcaccaggg ctgcctccct 1920

ccgttccctg cggacgtgtt catgattcct cagtacggat atctgactct aaacaacggc 1980

agtcagtctg tgggacgttc ctccttctac tgcctggagt actttccttc tcagatgctg 2040

agaacgggca ataactttga attcagctac acctttgagg aagtgccttt ccacagcagc 2100

tatgcgcaca gccagagcct ggaccggctg atgaatcccc tcatcgacca gtacctgtac 2160

tacctggccc ggacccagag cactacgggg tccacaaggg agctgcagtt ccatcaggct 2220

gggcccaaca ccatggccga gcaatcaaag aactggctgc ccggaccctg ttatcggcag 2280

cagagactgt caaaaaacat agacagcaac aacaacagta actttgcctg gaccggggcc 2340

actaaatacc atctgaatgg tagaaattca ttaaccaacc cgggcgtagc catggccacc 2400

aacaaggacg acgaggacca gttctttccc atcaacggag tgctggtttt tggcgaaacg 2460

ggggctgcca acaagacaac gctggaaaac gtgctaatga ccagcgagga ggagatcaaa 2520

accaccaatc ccgtggctac agaagaatac ggtgtggtct ccagcaacct gcaatcgtct 2580

acggccggac cccagacaca gactgtcaac agccaggggg ctctgcccgg catggtctgg 2640

cagaaccggg acgtgtacct gcagggtccc atctgggcca aaattcctca cacggacggc 2700

aactttcacc cgtctcccct gatgggcgga tttggactca aacacccgcc tcctcaaatt 2760

ctcatcaaaa acaccccggt acctgctaat cctccagagg tgtttactcc tgccaagttt 2820

gcctcattta tcacgcagta cagcaccggc caggtcagcg tggagatcga gtgggaactg 2880

cagaaagaaa acagcaaacg ctggaatcca gagattcagt acacctcaaa ttatgccaag 2940

tctaataatg tggaatttgc tgtcaacaac gaaggggttt atactgagcc tcgccccatt 3000

ggcacccgtt acctcacccg taacctgtaa ttgcctgtta atcaataaac cggttaattc 3060

gtttcagttg aactttggtc tctgcgaagg gcgaattc 3098

<210> 10

<211> 3098

<212> DNA

<213> novel AAV serotype, clone 16.3

<400> 10

gaattcgccc ttcgcagaga ccaaagttca actgaaacga atcaaccggt ttattgatta 60

acaagtaatt acaggttacg ggtgaggtaa cgggtgccaa tggggcgagg ctcagtataa 120

accccttcgt tgttgacagc aaattccaca ttattagact tggcataatt tgaggtgtac 180

tgaatctctg gattccagcg tttgctgttt tctttctgca gttcccactc gatctccacg 240

ctgacctggc cggtgctgta ctgcgtgata aatgaggcaa actaggcagg agtaaacacc 300

cctggaggat tagcaggtac cggggtgttt ttgatgagaa tttgaggagg cgggtgtttg 360

agtccaaatc cgcccatcag gggagacggg tgaaagttgc cgtccgtgtg aggaattttg 420

gcccagatgg gaccctgcag gtacacgtcc cggttctgcc agaccatgcc gggcagagcc 480

ccctggctgt tgacagtctg tgtctggggt ccggccgtag acgattgcag gttgctggag 540

accacaccgt attcttctgt agccacggga ttggtggttt tgatctcctc ctcgctggtc 600

attagcacgt tttccagcgt tgtcttgttg gcagcccccg ttttgccaaa aaccagcact 660

ccgttgatgg gaaagaactg gccctcgtcg tccttgttgg tggccatggc tacgcccggg 720

ttggttaatg aatttctacc attcagatgg tatttagtgg ccccggtcca ggcaaagtta 780

ctgttgttgt tgctgtctat gttttttgac agtctctgct gccgataaca gggtccgggc 840

agccagttct ttgattgctc ggccatggtg ttgggcccag cctgatggaa ctgcagctcc 900

cttgtggacc ccgtagtgct ctgggtccgg gccaggtagt acaggtactg gtcgatgagg 960

ggattcatca gccggtccag gctctggctg tgcgcatagc tgctgtggaa aggcacttcc 1020

tcaaaggtgt agctgaattc aaagttattg cccgttctca gcatctgaga aggaaagtac 1080

tccaggcagt agaaggagga acgtcccata gactgactgc cgttgtttag agtcagatat 1140

ccgtactgag gaatcatgaa cacgtccgca gggaacggag ggaggcagcc ctggtgcgca 1200

gagccgagga cgtacggcag ttggtactcc gagtccgaga agacctgaat cgtgctggta 1260

aggttattag cgatggtcgt aacgccgtcg ttcgtcgtga cctccttgac ctggatgttg 1320

aacaacttga accgcagctt tctgggccgg aatccccagt tgttgttgat gagtcgctgc 1380

cagtcacgtg gtgagaagtg gcagtggaat ctgttgaagt caaaatagcc ccagggggtg 1440

ctgtagccga agaagtggtt gtcgttggta gccccgctct gacttgatat ctgcttgtag 1500

aggtggttgt tgtaggtggg cagggcccag gtgcgggtgc tggtggtgat gactctgtcg 1560

cccagccatg tggaatcgca atgccaattt ccggaggcat tacccactcc gtcggcgcct 1620

tcgttattgt ctgccattgg tgcgccaccg cctgcagcca ttgtaccaga tcccagacct 1680

gagggcgcgg cgggaggttc tccgagaggt tgggggtcgg gcactgactc tgagtcgcca 1740

gtctgcccaa agttgagctt ctttttagcg ggctgctggc ctttcttgcc gatgcccgtg 1800

gaggagtcgg gggattctat gggtctcttc tttccaggag ccgtcttagc gccttcctca 1860

accagaccga gaggttcgag aacccgcttc ttggcctgga agactgctcg cccgaggttg 1920

cccccaaaag acgtatcttc ttgaagacgc tcctgaaact cagcgtcggc gtggttgtac 1980

ttgaggtacg ggttgtcccc ctgctcgagc tgcttgtcgt aggccttgtc gtgctcgagg 2040

gccgcggcgt ctgcctcgtt gaccggctct cccttgtcga gtccgttgaa gggtccgagg 2100

tacttgtagc caggaagcac cagaccccgg ccgtcgtcct gcttttgctg gttggctttg 2160

ggtttcgggg ctccaggttt caagtcccac cactcgcgaa tgccctcaga gaggttgtcc 2220

tcgagccaat ctggaagata accatcggca gccatacctg gtttaagtca tttattgctc 2280

agaaacacag tcatccaggt ccacgttgac cagatcgcag gccgagcaag caatctcggg 2340

agcccgcccc agcagatgat gaatggcaca gagtttccga tacgtcctct ttctgacgac 2400

cggttgagat tctgacacgc cggggaaaca ttctgaacag tctctggtcc cgtgcgtgaa 2460

gcaaatgttg aaattctgat tcattctctc gcatgtcttg cagggaaaca gcatctgaag 2520

catgcccgcg tgacgagaac atttgttttg gtacctgtcg gcaaagtcca ccggagctcc 2580

ttccgcgtct gacgtcgatg gatccgcgac tgaggggcag gcccgcttgg gctcgctttt 2640

atccgcgtca tcgggggcgg gcctcttgtt ggctccaccc tttctgacgt agaactcatg 2700

cgccacctcg gtcacgtgat cctgcgccca gcggaagaac tctttgactt cctgctttgt 2760

caccttgcca aagtcctgct ccagacggcg ggtgagttca aatttgaaca tccggtcttg 2820

taacggctgc tggtgctcga aggtggtgct gttcccgtca atcacggcgc acatgttggt 2880

gttggaagtg acgatcacgg gggtgggatc gatctgggcg gacgacttgc acttttggtc 2940

cacgcgcacc ttgctgccgc cgagaatggc cttggcggac tccacgacct tggccgtcat 3000

cttgccctcc tcccaccaga tcaccatctt gtcgacgcaa tcgttgaagg gaaagttctc 3060

attggtccag ttgacgcagc cgtagaaagg gcgaattc 3098

<210> 11

<211> 3121

<212> DNA

<213> novel AAV serotype, clone 29.3

<400> 11

gaattcgccc ttcgcagaga ccaaagttca actgaaacga atcaaccggt ttattgatta 60

acaagcaatt acagattacg ggtgaggtaa cgggtgccga tggggcgagg ctcagaataa 120

gtgccatctg tgttaacagc aaagtccaca tttgtagatt tgtagtagtt ggaagtgtat 180

tgaatctctg ggttccagcg tttgctgttt tctttctgca gctcccattc aatttccacg 240

ctgacctgtc cggtgctgta ctgcgtgatg aacgacgcca gcttagcttg actgaaggta 300

gttggaggat ccgcgggaac aggtgtattc ttaatcagga tctgaggagg cgggtgtttc 360

agtccaaagc cccccatcag cggcgaggga tgaaagtttc cgtccgtgtg aggaatcttg 420

gcccagatag gaccctgcag gtacacgtcc cggttctgcc agaccatgcc aggtaaggct 480

ccttgactgt tgacggcccc tacaatagga gcggcgtttt gctgttgcag gttatcggcc 540

accacgccgt actgttctgt ggccactggg ttggtggttt taatttcttc ctcactggtt 600

agcataacgc tgctatagtc cacgttgcct tttccagctc cctgtttccc aaacattaag 660

actccgctgg acggaaaaaa tcgctcttcg tcgtccttgt gggttgccat agcgacaccg 720

ggatttacca gagagtctct gccattcaga tgatacttgg tggcaccggt ccaggcaaag 780

ttgctgttgt tattttgcga cagtgtcgtg gagacgcgtt gctgccggta gcagggcccg 840

ggtagccagt ttttggcctg agccgacatg ttattaggcc cggcctgaga aaatagcaac 900

tgctgagttc ctgcggtacc tcccgtggac tgagtccgag acaggtagta caggtactgg 960

tcgatgaggg ggttcatcag ccggtccagg ctttggctgt gcgcgtagct gctgtgaaaa 1020

ggcacgtcct caaactggta gctgaactca aagttgttgc ccgttctcag catttgagaa 1080

ggaaagtact ccaggcagta gaaggaggaa cggcccacgg cctgactgcc attgttcaga 1140

gtcaggtacc cgtactgagg aatcatgaag acgtccgccg ggaacggagg caggcagccc 1200

tggcgcgcag agccgaggac gtacgggagc tggtattccg agtccgtaaa gacctgaatc 1260

gtgctggtaa ggttattggc gatggtcttg gtgccttcat tctgcgtgac ctccttgacc 1320

tggatgttga agagcttgaa gttgagtctc ttgggccgga atccccagtt gttgttgatg 1380

agtcgctgcc agtcacgtgg tgagaagtgg cagtggaatc tgttaaagtc aaaatacccc 1440

cagggggtgc tgtagccgaa gtaggtgttg tcgttggtgc ttcctcccga agtcccgttg 1500

gagatttgct tgtagaggtg gttgttgtag gtggggaggg cccaggttcg ggtgctggtg 1560

gtgatgactc tgtcgcccag ccatgtggaa tcgcaatgcc aatttcctga ggaactaccc 1620

actccgtcgg cgccttcgtt attgtctgcc attggagcgc caccgcctgc agccattgta 1680

ccagatccca gaccagaggg gcctgcgggg ggttctccga ttggttgagg gtcgggcact 1740

gactctgagt cgccagtctg cccaaagttg agtctctttt tcgcgggctg ctggcctttc 1800

ttgccgatgc ccgtagtgga gtctggagaa cgctggggtg atggctctac cggtctcttc 1860

tttccaggag ccgtcttagc gccttcctca accagaccga gaggttcgag aacccgcttc 1920

ttggcctgga agactgctcg tccgaggttg cccccaaaag acgtatcttc ttgcagacgc 1980

tcctgaaact cggcgtcggc gtggttatac cgcaggtacg gattgtcacc cgctttgagc 2040

tgctggtcgt aggccttgtc gtgctcgagg gccgctgcgt ccgccgcgtt gacgggctcc 2100

cccttgtcga gtccgttgaa gggtccgagg tacttgtagc caggaagcac cagaccccgg 2160

ccgtcgtcct gcttttgctg gttggctttg ggcttcgggg ctccaggttt cagcgcccac 2220

cactcgcgaa tgccctcaga gaggttgtcc tcgagccaat ctggaagata accatcggca 2280

gccatacctg atctaaatca tttattgttc aaagatgcag tcatccaaat ccacattgac 2340

cagatcgcag gcagtgcaag cgtctggcac ctttcccatg atatgatgaa tgtagcacag 2400

tttctgatac gcctttttga cgacagaaac gggttgagat tctgacacgg gaaagcactc 2460

taaacagtct ttctgtccgt gagtgaagca gatatttgaa ttctgattca ttctctcgca 2520

ttgtctgcag ggaaacagca tcagattcat gcccacgtga cgagaacatt tgttttggta 2580

cctgtccgcg tagttgatcg aagcttccgc gtctgacgtc gatggctgcg caactgactc 2640

gcgcacccgt ttgggctcac ttatatctgc gtcactgggg gcgggtcttt tcttggctcc 2700

accctttttg acgtagaatt catgctccac ctcaaccacg tgatcctttg cccaccggaa 2760

aaagtctttg acttcctgct tggtgacctt cccaaagtca tgatccagac ggcgggtgag 2820

ttcaaatttg aacatccggt cttgcaacgg ctgctggtgt tcgaaggtcg ttgagttccc 2880

gtcaatcacg gcgcacatgt tggtgttgga ggtgacgatc acgggagtcg ggtctatctg 2940

ggccgaggac ttgcatttct ggtccacgcg caccttgctt cctccgagaa tggctttggc 3000

cgactccacg accttggcgg tcatcttccc ctcctcccac cagatcacca tcttgtcgac 3060

acagtcgttg aagggaaagt tctcattggt ccagttgacg cagccgtaga agggcgaatt 3120

c 3121

<210> 12

<211> 3121

<212> DNA

<213> novel AAV serotype, clone 29.4

<400> 12

gaattcgccc ttctacggct gcgtcaactg gaccaatgag aactttccct tcaacgactg 60

tgtcgacaag atggtgatct ggtgggagga ggggaagatg accgccaagg tcgtggagtc 120

ggccaaagcc attctcggag gaagcaaggt gcgcgtggac cagaaatgca agtcctcggc 180

ccagatagac ccgactcccg tgatcgtcac ctccaacacc aacatgtgcg ccgtgattga 240

cgggaactca acgaccttcg aacaccagca gccgttgcaa gaccggatgt tcaaatttga 300

actcacccgc cgtctggatc atgactttgg gaaggtcacc aagcaggaag tcaaagactt 360

tttccggtgg gcaaaggatc acgtggttga ggtggagcac gaattctacg tcaaaaaggg 420

tggagccaag aaaagacccg cccccagtga cgcagatata agtgagccca aacgggtgcg 480

cgagtcagtt gcgcagccat cgacgtcaga cgcggaagct tcgatcaact acgcagacag 540

gtaccaaaac aaatgttctc gtcacgcggg catgaatctg atgctgtttc cctgcagaca 600

atgcgagaga atgaatcaga attcaaatat ctgcttcact cacggacaga aagactgttt 660

agagtgcttt cccgtgtcag aatctcaacc cgtttctgtc gtcaaaaagg cgtatcagaa 720

actgtgctac attcatcata tcatgggaaa ggtgccagac gcttgcactg cctgcgatct 780

ggtcgatgtg gatttggatg actgcatctt tgaacaataa atgatttaaa tcaggtatgg 840

ctgccgatgg ttatcttcca gattggctcg aggacaacct ctctgagggc attcgcgagt 900

ggtgggcgct gaaacctgga gccccgaagc ccaaagccaa ccagcaaaag caggacggcg 960

gccggggtct ggtgcttcct ggctacaagt acctcggacc cttcaacgga ctcgacaagg 1020

gggagcccgt caacgcggcg gacgcagcgg ccctcgagca cgacaaggcc tacgaccagc 1080

agctcaaagc gggtgacaat ccgtacctgc ggtataacca cgccgacgcc gagtttcagg 1140

agcgtctgca agaagatacg tcttttgggg gcaacctcgg gcgagcagtc ttccaggcca 1200

agaagcgggt tctcgaacct ctcggtctgg ttgaggaagg cgctaagacg gctcctggaa 1260

agaagagacc ggtagagcca tcaccccagc gttctccaga ctcctctacg ggcatcggca 1320

agaaaggcca gcagcccgcg aaaaagagac tcaactttgg gcagactggc gactcagagt 1380

cagtgcccga ccctcaacca atcggagaac cccccgcagg cccctctggt ctgggatctg 1440

gtacaatggc tgcaggcggt ggcgctccaa tggcagacaa taacgaaggc gccgacggag 1500

tgggtagttc ctcaggaaat tggcattgcg attccacatg gctgggcgac tgagtcatca 1560

ccaccagcac ccgaacctgg gccctcccca cctacaacaa ccacctctac aagcaaatct 1620

ccaacgggac ttcgggagga agcaccaacg acaacaccta cttcggctac agcaccccct 1680

gggggtattt tgactttaac agattccact gccacttctc accacgtgac tggcagcgac 1740

tcatcaacaa caactgggga ttccggccca agagactcaa cttcaagctc ttcaacatcc 1800

aggtcaagga ggtcacgcag aatgaaggca ccaagaccat cgccaataac cttaccagca 1860

cgattcaggt ctttacggac tcggaatacc agctcccgta cgtcctcggc tctgcgcacc 1920

agggctgcct gcctccgttc ccggcggacg tcttcatgat tcctcagtac gggtacctga 1980

ctctgaacaa tggcagtcag gccgtgggcc gttcctcctt ctactgcctg gagtactttc 2040

cttctcaaat gctgagaacg ggcaacaact ttgagttcag ctaccagttt gaggacgtgc 2100

cttttcacag cagctacgcg cacagccaaa gcctggaccg gctgatgaac cccctcatcg 2160

accagtacct gtactacctg tctcggactc agtccacggg aggtaccgca ggaactcagc 2220

agttgctatt ttctcaggcc gggcctaata acatgtcggc tcaggccaaa aactggctac 2280

ccgggccctg ctaccggcag taacgcgtct ccacgacact gtcgcaaaat aacaacagca 2340

actttgtctg gaccggtgcc accaagtatc atctgaatgg cagagactct ctggtagatc 2400

ccggtgtcgc tatggcaacc cacaaggacg acgaagagcg attttttccg tccagcggag 2460

tcataatgtt tgggaaacag ggagctggaa aagacaacgt ggactatagc agcgtcatgc 2520

taaccagtga ggaagaaatt aaaaccacca acccagtggc cacagaacag tacggcgtgg 2580

tggccgataa cctgcaacag caaaacgccg ctcctattgt aggggccgtc aacagtcaag 2640

gagccttacc tggcatggtc tggcagaacc gggacgtgta cctgcagggt cctacctggg 2700

ccaagattcc tcacacggac ggaaactttc atccctcgcc gctgatggga ggctttggac 2760

tgaaacaccc gcctcctcag atcctgatta agaatacacc tgttcccgcg gatcctccaa 2820

ctaccttcag tcaagctaag ctggcgtcgt tcatcacgca gtacagcacc ggacaggtca 2880

gcgtggaaat tgaatgggag ctgcaggaag aaaacagcaa acgctggaac ccagagattc 2940

aatacacttc caactactac aaatctacaa atgtggactt tgctgttaac acagatggca 3000

cttattctga gcctcgcccc atcggcaccc gttacctcac ccgtaatctg taattgcttg 3060

ttaatcaata aaccggttga ttcgtttcag ttgaactttg gtctctgcga agggcgaatt 3120

c 3121

<210> 13

<211> 3121

<212> DNA

<213> novel AAV serotype, clone 29.5

<400> 13

gaattcgccc ttcgcgagac caaagttcaa ctgaaacgaa tcaaccggtt tattgattaa 60

caagcaatta cagattacgg gtgaggtaac gggtgccgat ggggcgaggc tcagaataag 120

tgccatctgt gttaacagca aagtccacat ttgtagattt gtagtagttg gaagtgtatt 180

gaatctctgg gttccagcgt ttgctgtttt ctttctgcag ctcccattca atttccacgc 240

tgacctgtcc ggtgctgtac tgcgtgatga acgacgccag cttagcttga ctgaaggtag 300

ttggaggatc cgcgggaaca ggtgtattct taatcaggat ctgaggaggc gggtgtttca 360

gtccaaagcc tcccatcagc ggcgagggat gaaagtttcc gtccgtgtga ggaatcttgg 420

cccagatagg accctgcagg tacacgtccc ggttctgcca gaccatgcca ggtaaggctc 480

cttgactgtt gacggcccct acaataggag cggcgttttg ctgttgcagg ttatcggcca 540

ccacgccgta ctgttctgtg gccactgggt tggtggtttt aatttcttcc tcactggtta 600

gcataacgct gctatagtcc acgttgtctt ttccagctcc ctgtttccca aacattaaga 660

ctccgctgga cggaaaaaat cgctcttcgt cgtccttgtg ggttgccata gcgacaccgg 720

gatttaccag agagtctctg ccattcagat gatacttggt ggcaccggtc caggcaaagt 780

tgctgttgtc attttgcgac agtgtcgtgg agacgcgttg ctgccggtag cagggcccgg 840

gtagccagtt tttggcctga gccgacatgt tattaggccc ggcctgagaa aatagcaact 900

gctgagttcc tgcggtacct cccgtggact gagtccgaga caggtagtac aggtactggt 960

cgatgagggg gttcatcagc cggtccaggc tttggctgtg cgcgtagctg ctgtgaaaag 1020

gcacgtcctc aaactggtag ctgaactcaa agttgttgcc cgttctcagc atttgagaag 1080

gaaagtactc caggcagtag aaggaggaac ggcccacggc ctgactgcca ttgttcagag 1140

tcaggtaccc gtactgagga atcatgaaga cgtccgccgg gaacggaggc aggcagccct 1200

ggtgcgcaga gccgaggacg tacgggagct ggtattccga gtccgtaaag acctgaatcg 1260

tgctggtaag gttattggcg atggtcttgg tgccttcatt ctgcgtgacc tccttgacct 1320

ggatgttgaa gagcttgaag ttgaggctct tgggccggaa tccccagttg ttgttgatga 1380

gtcgctgcca gtcacgtggt gagaagtggc agtggaatct gttaaagtca aaataccccc 1440

agggggtgct gtagccgaag taggtgttgt cgttggtgct tcctcccgaa gtcccgttgg 1500

agatttgctt gtagaggtgg ttgttgtagg tggggagggc ccaggttcgg gtgctggtgg 1560

tgatgactcc gtcgcccagc catgtggaat cgcaatgcca atttcctgag gaactaccca 1620

ctccgtcggc gccttcgtta ttgtctgcca ttggagcgcc accgcctgca gccattgtac 1680

cagatcccag accagagggg cctgcggggg gttctccgat tggttgaggg tcgggcactg 1740

actctgagtc gccagtctgc ccaaagttga gtctcttttt cgcgggctgc tggcctttct 1800

tgccgatgcc cgtagaggag tctggagaac gctggggtga tggctctacc ggtctcttct 1860

ttccaggagc cgtcttagcg ccttcctcaa ccagaccgag aggttcgaga acccgcttct 1920

tggcctggaa gactgctcgc ccgaggttgc ccccaaaaga cgtatcttct tgcagacgct 1980

cctgaaactc ggcgtcggcg tggttatacc gcaggtacgg attgtcaccc gctttgagct 2040

gctggtcgta ggccttgtcg tgctcgaggg ccgctgcgtc cgccgcgttg acgggctccc 2100

ccttgtcgag tccgttgaag ggtccgaggt acttgtagcc aggaagcacc agaccccggc 2160

cgtcgtcctg cttttgctgg ttggctttgg gcttcggggc tccaggtttc agcgcccacc 2220

actcgcgaat gccctcagag aggttgtcct cgagccaatc tggaagataa ccatcggcag 2280

ccatacctga tttaaatcat ttattgttca aagatgcagt catccaaatc cacattgacc 2340

agatcgcagg cagtgcaagc gtctggcacc tttcccatga tatgatgaat gtagcacagt 2400

ttctgatacg cctttttgac gacagaaacg ggttgagatt ctgacacggg aaagcactct 2460

aaacagtctt tctgtccgtg agtgaagcag atatttgaat tctgattcat tctctcgcat 2520

tgtctgcagg gaaacagcat cagattcatg cccacgtgac gagaacattt gttttggtac 2580

ctgtctgcgt agttgatcga agcttccgcg tctgacgtcg atggctgcgc aactgactcg 2640

cgcacccgtt tgggctcact tatatctgcg tcactggggg cgggtctttt cttggctcca 2700

ccctttttga cgtagaattc atgctccacc tcaaccacgt gatcctttgc ccaccggaaa 2760

aagtctttga cttcctgctt ggtgaccttc ccaaagtcat gatccagacg gcgggtgagt 2820

tcaaatttga acatccggtc ttgcaacggc tgctggtgtt cgaaggtcgt tgagttcccg 2880

tcaatcacgg cgcacatgtt ggtgttggag gtgacgatca cgggagtcgg gtctatctgg 2940

gccgaggact tgcatttctg gtccacgcgc accttgcttc ctccgagaat ggctttggcc 3000

gactccacga ccttggcggt catcttcccc tcctcccacc agatcaccat cttgtcgaca 3060

cagtcgttga agggaaagtt ctcattggtc cagttgacgc agccgtagaa agggcgaatt 3120

c 3121

<210> 14

<211> 3131

<212> DNA

<213> novel AAV serotype, clone 1-3

<400> 14

gcggccgcga attcgccctt ggctgcgtca actggaccaa tgagaacttt cccttcaatg 60

attgcgtcga caagatggtg atctggtggg aggagggcaa gatgacggcc aaggtcgtgg 120

agtccgccaa ggccattctc ggcggcagca aggtgcgcgt ggaccaaaag tgcaagtcgt 180

ccgcccagat cgaccccacc cccgtgatcg tcacctccaa caccaacatg tgcgccgtga 240

ttgacgggaa cagcaccacc ttcgagcacc agcagcctct ccaggaccgg atgtttaagt 300

tcgaactcac ccgccgtctg gagcacgact ttggcaaggt gacaaagcag gaagtcaaag 360

agttcttccg ctgggccagt gatcacgtga ccgaggtggc gcatgagttt tacgtcagaa 420

agggcggagc cagcaaaaga cccgcccccg atgacgcgga taaaagcgag cccaagcggg 480

cctgcccctc agtcgcggat ccatcgacgt cagacgcgga aggagctccg gtggactttg 540

ccgacaggta ccaaaacaaa tgttctcgtc acgcgggcat gcttcagatg ctgtttccct 600

gcaaaacgtg cgagagaatg aatcggaatt tcaacatttg cttcacacac ggggtcagag 660

actgctcaga gtgtttcccc ggcgtgtcag aatctcaacc ggtcgtcaga aagaggacgt 720

atcggaaact ccgtgcgatt catcatctgc tggggcgggc tcccgagatt gcttgctcgg 780

cctgcgatct ggtcaacgtg gacctggatg actgtgtttc tgagcaataa atgacttaaa 840

ccaggtatgg ctgccgatgg ttatcttcca gattggctcg aggacaacct ctctgagggc 900

attcgcgagt ggtgggcgct gaaacctgga gccccgaagc ccaaagccaa ccagcaaaag 960

caggacgacg gccggggtct ggtgcttcct ggctacaagt acctcggacc cttcaacgga 1020

ctcgacaagg gggagcccgt caacgcggcg gacgcagcgg ccctcgagca cgacaaggct 1080

tacgaccagc agctgcaggc gggtgacaat ccgtacctgc ggtataacca cgccgacgcc 1140

gagtttcagg agcgtctgca agaagatacg tcttttgggg gcaacctcgg gcgagcagtc 1200

ttccaggcca agaagcgggt tctcgaacct ctcggtctgg ttgaggaagg cgctaagacg 1260

gctcctggaa agaagagacc ggtagagcca tcaccccagc gttctccaga ctcctctacg 1320

ggcatcggca agaaaggcca acagcccgcc agaaaaagac tcaattttgg tcagactggc 1380

gactcagagt cagttccaga ccctcaacct ctcggagaac ctccagcagc gccctctggt 1440

gtgggaccta atacaatggc tgcaggcggt ggcgcaccaa tggcagacaa taacgaaggc 1500

gccgacggag tgggtagttc ctcgggaaat tggcattgcg attccacatg gctgggcgac 1560

agagtcatca ccaccagcac ccgaacctgg gccctgccca cctacaacaa ccacctctac 1620

aagcaaatct ccaacgggac atcgggagga gccaccaacg acaacaccta cttcggctac 1680

agcaccccct gggggtattt tgactttaac agattccact gccacctttc accacgtgac 1740

tggcagcgac tcatcaacaa caactgggga ttccgaccca agagactcag cttcaagctc 1800

ttcaacatcc aggtcaagga ggtcacgcag aatgaaggca ccaagaccat cgccaataac 1860

ctcaccagca ccatccaggt gtttacggac tcggagtacc agctgccgta cgttctcggc 1920

tctgtccacc agggctgcct gcctccgttc ccggcggacg tgttcatgat tccccagtac 1980

ggctacctaa cactcaacaa cggtagtcag gccgtgggac gctcctcctt ctactgcctg 2040

gaatactttc cttcgcagat gctgagaacc ggcaacaact tccagtttac ttacaccttc 2100

gaggacgtgc ctttccacag cagctacgcc cacagctaga gcttggaccg gctgatgaat 2160

cctctgattg accagtacct gtactacttg tctcggactc aaacaacagg aggcacggca 2220

aatacgcaga ctctgggctt cagccaaggt gggcctaata caatggccaa tcaggcaaag 2280

aactggctgc caggaccctg ttaccgccaa caacgcgtct caacgacaac cgggcaaaac 2340

aacaatagca actttgcctg gactgctggg accaaatacc atctgaatgg aagaaattca 2400

ttggctaatc ctggcatcgc tatggcaaca cacaaagacg acgaggagcg tttttttccc 2460

agtaacggga tcctgatttt tggcaaacaa aatgctgcca gagacaatgc ggattacagc 2520

gatgtcatgc tcaccagcga ggaagaaatc aaaaccacta accctgtggc tacagaggaa 2580

tacggtatcg tggcagataa cttgcagcag caaaacacgg ctcctcaaat tggaactgtc 2640

aacagccagg gggccttacc cggtatggtc tggcagaacc gggacgtgta cctgcagggt 2700

cccatctggg ccaagattcc tcacacggac ggcaacttcc acccgtctcc gctgatgggc 2760

ggctttggcc tgaaacatcc tccgcctcag atcctgatca agaacacgcc tgtacctgcg 2820

gatcctccga ccaccttcaa ccagtcaaag ctgaactctt tcatcacgca atacagcacc 2880

ggacaggtca gcgtggaaat tgaatgggag ctgcagaagg aaaacagcaa gcgctggaac 2940

cccgagatcc agtacacctc caactactac aaatctataa gtgtggactt tgctgttaat 3000

acagaaggcg tgtactctga accccgcccc attggcaccc gttacctcac ccgtaatctg 3060

taattgcctg ttaatcaata aaccggttga ttcgtttcag ttgaactttg gtctctgcga 3120

agggcgaatt c 3131

<210> 15

<211> 3127

<212> DNA

<213> novel AAV serotype, clone 13-3b

<400> 15

gcggccgcga attcgccctt cgcagagacc aaagttcaac tgaaacgaat caaccggttt 60

attgattaac atgcaattac agattacggg tgaggtaacg agtgccaata gggcgaggct 120

cagagtaaac accctggctg tcaacggcaa agtccacacc agtctgcttt tcaaagttgg 180

aggtgtactg aatctccggg tcccagcgct tgctgttttc cttctgcagc tcccactcga 240

tttccacgct gacttgtccg gtgctgtact gtgtgatgaa cgaagcaaac ttggcaggag 300

taaacacctc cggaggatta gcgggaacgg gagtgttctt gatcaggatc tgaggaggcg 360

gatgtttaag tccaaagccg cccatcaaag gagacgggtg aaagttgcca tccgtgtgag 420

gaatcttggc ccagatggga ccctgcaggt acacgtcccg gttctgccag accatgccag 480

gtaaggctcc ctggttgttg acaacttgtg tctgggctgc agtattagcc gcttgtaagt 540

tgctgctgac tatcccgtat tcttccgtgg ctacaggatt agtaggacga atttcttctt 600

catttgtcat taacacattt tccaatgtag ttttgttagt tgctccagtt tttccaaaaa 660

tcaggactcc gctggatggg aaaaagcggt cctcgtcgtc cttgtgagtt gccatggcga 720

cgccgggatt aaccaacgag tttctgccgt tcaggtgata tttggtggca ccagtccaag 780

caaagttgct gttgttgttt tgatccagcg ttttggagac cctttgttgc cggaagcagg 840

gtccaggtaa ccaattcttg gcttgttcgg ccatagttga aggcccgccc tggtaaaact 900

gcagttcccg attgccagct gtgcctcctg ggtcactctg tgttctggcc aggtagtaca 960

agtactggtc gatgagggga ttcatcagcc ggtccaggct ctggctgtgt gcgtagctgc 1020

tgtggaaagg cacgtcctcg aagctgtagc tgaactcaaa gttgttgccc gttctcagca 1080

tctgagaggg gaagtactcc aggcagtaga aggaggaacg tcccacagac tgactgccat 1140

tgttgagagt caggtagccg tactgaggaa tcatgaagac gtccgccggg aacggaggca 1200

ggcagccctg gtgcgcagag ccgaggacgt acggcagctg gtattccgag tccgagaata 1260

cctgaatcgt gctggtaagg ttattagcga tggtcgtaac gccgtcattc gtcgtgacct 1320

ccttgacctg gatgttgaag agcttgaacc gcagcttctt gggccggaat ccccagttgt 1380

tgttgatgag tcgctgccag tcacgtggtg agaagtggca gtggaatctg ttaaagtcaa 1440

aataccccca gggggtgctg tagccgaagt aggtgttgtc gttggtacta cctgcagttt 1500

cactggagat ttgctcgtag aggtggttgt tgtaggtggg cagggcccag gttcgggtgc 1560

tggtggtaat gactctgtcg cccagccatg tggaatcgca atgccaattt cctgaggcat 1620

tacccactcc gtcggcacct tcgttattgt ctgccattgg tgcgccaccg cctgcagcca 1680

ctgtaccaga tcccacacta gagggcgctg ctggaggttc tccgagaggt tgagggtcgg 1740

ggactgactc tgagtcgcca gtctgaccga aattgagtct ctttctggcg ggctgctggc 1800

ccttcttgcc gatgcccgtg gaggagtcgg gggaacgctg aggtgacggc tctaccggtc 1860

tcttctttgc aggagccgtc ttagcgcctt cctcaaccag accgagaggt tcgagaaccc 1920

gcttcttggc ctggaagact gctcgcccga ggttgccccc aaatgacgta tcttcttgca 1980

gacgctcctg aaactcggcg tcggcgtggt tataccgcag gtacgggttg tcacccgcat 2040

tgagctgctg gtcgtaggcc ttgtcgtgct cgagggccgc tgcgtccgcc gcgttgacgg 2100

gctccccctt gtcgagtccg ttgaagggtc cgaggtactt gtagccagga agcaccagac 2160

cccggccgtt gtcctgcttt tgctggttgg ctttgggttt cggggctcca ggtttcaggt 2220

cccaccactc gcgaatgccc tcagagaggt tgtcctcgag ccaatctgga agataaccat 2280

cggcagccat acctgattta aatcatttat tgttcaaaga tgcagtcatc caaatccaca 2340

ttgaccagat cgcaggcagt gcaagcgtct ggcacctttc ccatgatatg atgaatgtag 2400

cacagtttct gatacgcctt tttgacgaca gaaacgggtt tagattctga cacgggaaag 2460

cactctaaac agtctttctg tccgtgagtg aagcagatat ttgaattctg attcattctc 2520

tcgcattgtc tgcagggaaa cagcatcaga ttcatgccca cgtgacgaga acatttgttt 2580

tggtacctgt ctgcgtagtt gatcgaagct tccgcgtctg acgtcgatgg ctgcgcaact 2640

gactcgcgca cccgtttggg ctcacttata tctgcgtcac tgggggcggg tcttttcttg 2700

gctccaccct ttttgacgta gaattcatgc tccacctcaa ccacgtaatc ctttgcccac 2760

cggaaaaagt ctttgacttc ctgcttggtg accttcccaa agtcatgatc cagacggcgg 2820

gtgagttcaa atttgaacat ccggtcttgc aacggctgct ggtgttcgaa ggtcgttgag 2880

ttcccgtcga tcacggcgca catgttggtg ttggagatga cgatcgcggg agtcgggtct 2940

atctgggccg aggacttgca tttctggtcc acgcgcacct tgcttcctcc gagaatggct 3000

ttggccgact ccacgacctt ggcggtcatc ttcccctcct cccaccagat caccatcttg 3060

tcgacacagt cgttgaaggg aaagttctca ttggtccagt tgacgcagcc gtagaaaggg 3120

cgaattc 3127

<210> 16

<211> 3106

<212> DNA

<213> novel AAV serotype, clone 24-1

<400> 16

gcggccgcga attcgccctt cgcagagacc aaagttcaac tgaaacgaat caaccggttt 60

attgattaac aagtaattac aggttacggg tgaggtaacg ggtgccaatg gggcgaggct 120

cagtataaac cccttcgttg ttgacagcaa attccacatt attagacttg gcataatttg 180

aggtgtactg aatctctgga ttccagcgtt tgctgttttc tttctgcagt tcccactcga 240

tctccacgct gacctggccg gtgctgtact gcgtgataaa tgaggcaaac ttggcaggag 300

taaacacctc tggaggatta gcaggtaccg gggtgttttt gatgagaatt tgaggaggcg 360

ggtgtttgag tccaaatccg cccatcaggg gagacgggtg aaagttgccg tccgtgtgag 420

gaattttggc ccagatggga ccctgcaggc acacgtcccg gttctgccag accatgccgg 480

gcagagcccc ctggctgttg acagtctgtg tctggggtcc ggccgtagac gattgcaggt 540

tgctggagac cacaccgtat tcttctgtag ccacgggatt ggtggttttg atctcctcct 600

cgctggtcat tagcacgttt tccagcgttg tcttgttggc agcccccgtt ttgccaaaaa 660

ccagcactcc gttgatggga aagaactggt cctcgtcgtc cttgttggtg gccatggcta 720

cgcccgggtt ggttaatgaa tttctaccat tcagatggta tttagtggcc ccggtccagg 780

caaagttact gttgttgttg ctgtctatgt tttttgacag tctctgctgc cgataacagg 840

gtccgggcag ccagttcttt gattgctcgg ccatggtgtt gggcccagcc tgatggaact 900

gcagctccct tgtggacccc gtagtgctct gggtccgggc caggtagtac aggtactggt 960

cgatgagggg attcatcagc cggtctaggc tctggctgtg cacatagctg ctgtggaaag 1020

gcacttcctc aaaggtgtag ctgaattcaa agttattgcc cgttctcagc atctgagaag 1080

gaaagtactc caggcagtag aaggaggaac gtcccacaga ctgactgccg ttgtttagag 1140

tcagatatcc gtactgagga atcatgaaca cgtccgcagg gaacggaggg aggcagccct 1200

ggtgcgcaga gccgaggacg tacggcagtt ggtactccga gtccgagaag acctgaatcg 1260

tgctggtaag gttattagcg atggtcgtaa cgccgtcgtt cgtcgtgacc tccttgacct 1320

ggatgttgaa caacttgaac cgcagctttc tgggccggaa tccccagttg ttgttgatga 1380

gtcgctgcca gtcacgtggt gagaagtggc agtggaatct gttgaagtca aaatagcccc 1440

agggggtgct gtagctgaag aagtggttgt cgttggtagc cccgctctga cttgatatct 1500

gcttgtagag gtggttgttg taggtgggca gggcccaggt gcgggtgctg gtggtgatga 1560

ctctgtcgcc cagccatgtg gaatcgcaat gccaatttcc ggaggcatta cccactccgt 1620

cggcgccttc gttattgtct gccattggtg cgccaccgcc tgcagccatt gtaccagatc 1680

ccagacctga gggcgcggcg ggaggttctc cgagaggttg ggggtcgggc actgactctg 1740

agtcgccagt ctgcccaaag ttgagcttct ttttagcggg ctgctggcct ttcttgccga 1800

tgcccgtgga ggagtcgggg gattctatgg gtctcttctt tccaggagcc gtcttagcga 1860

cttcctcaac cagaccgaga ggttcgagaa cccgcttctt ggcctggaag actgctcgcc 1920

cgaggttgcc cccaaaagac gtatcttctt gaagacgctc ctgaaactcg gcgtcggcgt 1980

ggttgtactt gaggtacggg ttgtccccct gctcgagctg cttgtcgtag gccttgtcgt 2040

gctcgagggc cgcggcgtct gcctcgttga ccggctctcc cttgtcgagt ccgttgaagg 2100

gtctgaggta cttgtagcca ggaagcacca gaccccggcc gtcgtcctgc ttttgctggt 2160

tggctttggg tttcggggct ccaggtttca agtcccacca ctcgcgaatg ccctcagaga 2220

ggttgtcctc gagccaatct ggaagataac catcggcagc catacctggt ttaagtcatt 2280

tattgctcag aaacacagtc atccaggtcc acgttgacca gatcgcaggc cgagcaagca 2340

atctcgggag cccgccccag cagatgatga atggcacaga gtttccgata cgtcctcttt 2400

ctgacgaccg gttgagattc tgacacgccg gggaaacatt ctgaacagtc tctggtcccg 2460

tgcgtgaagc aaatgttgaa attctgattc actctctcgc atgtcttgca gggaaacagc 2520

atctgaagca tgcccgcgtg acgagaacat ttgttttggt acctgtcggc aaagtccacc 2580

ggagctcctt ccgcgtctga cgtcgatgga ttcgcgactg aggggcaggc ccgcttgggc 2640

tcgcttttat ccgcgtcatc gggggcgggt ctcttgttgg ccccaccctt tctgacgtag 2700

aacccatgcg ccacctcggt cacgtgatcc tgcgcccagc ggaagaacct tttgacttcc 2760

tgctttgtca ccttgccaaa gttatgctcc agacggcggg tgggttcaaa tttgaacatc 2820

cggtcctgca acggctgctg gtgctcgaag gtggcgctgt tcccgtcaat cacggcgcac 2880

atgttggtgt tggaggtgac ggtcacgggg gtggggtcga tctgggcgga cgacttgcac 2940

ttttggtcca cgcgcacctt gctgccgccg agaatggcct tggcggactc cacgaccttg 3000

gccgtcatct tgccctcctc ccaccagatc accatcttgt cggcgcaatc gttgaaggga 3060

aagttctcat tggtccagtt gacgcagccg tagaaagggc gaattc 3106

<210> 17

<211> 3102

<212> DNA

<213> novel AAV serotype, clone 27-3

<400> 17

gcggccgcga attcgccctt cgcagagacc aaagttcaac tgaaacgaat caaccggttt 60

attgattaac aagtaattac aggttacggg tgaggtaacg ggtgccaatg gggcgaggct 120

cagtataaac cccttcgttg ttgacagcaa attccacatt attagacttg gcataatttg 180

aggtgtactg aatctctgga ttccagcgtt tgctgttttc tttctgcagt tcccactcga 240

tctccacgct gacctggccg gtgctgtact gcgtgataaa tgaggcaaac ttggcaggag 300

taaacacctc tggaggatta gcaggtaccg gggtgttttt gatgagaatt tgaggaggcg 360

ggtgtttgag tccaaatccg cccatcaggg gagacgggtg aaagttgccg tccgtgtgag 420

gaatttcggc ccagatggga ccctgcaggt acacgtcccg gttctgccag accatgccgg 480

gcagagcccc ctggctgttg acagtctgtg tccggggtcc ggccgtagac gattgcaggt 540

tgctggagac cacaccgtat tcttctgtag ccacgggatt ggtggttttg atctcctcct 600

cgctggtcat tagcacgttt tccagcgttg tcttgttggc agcccccgtt ttgccaaaaa 660

ccagcactcc gttgatggga aggaactggt cctcgtcgtc cttgttggtg gccatggcta 720

cgcccgggtt ggttaatgaa tttctaccat tcagatggta tttagtggcc ccggtccagg 780

caaagttact gttgttgttg ctgtctatgt tttttgacag tctctgctgc cgataacagg 840

gtccgggcag ccagttcttt gattgctcgg ccacggtgtt gggcccagcc tgatggaact 900

gcagctccct tgtggacccc gtagtgctct gggtccgggc caggtagtac aggtactggt 960

cgatgagggg attcatcagc cggtccaggc tctggctgtg cgcatagctg ctgtggaaag 1020

gcacttcctc aaaggtgtag ctgaattcaa agttattgcc cgttctcagc atctgagaag 1080

gaaagtactc caggcagcag aaggaggaac gtcccacaga ctgactgccg ttgtttagag 1140

tcagatatcc gtactgagga atcatgaaca cgtccgcagg gaacggaggg aggcagccct 1200

ggtgcgcaga gccgaggacg tacggcagtt ggtactccga gtccgagaag acctgaatcg 1260

tgctggtaag gttattagcg atggtcgtaa cgccgtcgtt cgtcgtgacc tccttgacct 1320

ggatgttgaa caacttgaac cgcagctttc tgggccggaa tccccagttg ttgttgatga 1380

gtcgctgcca gtcacgtggt gagaagtggc agtggaatct gttgaagtca aaatagcccc 1440

agggggtgct gtagccgaag aagtggttgt cgttggtagc cccgctctga cttgatatct 1500

gcttgtagag gtggttgttg taggtgggca gggcccaggt gcgggtgctg gtggtgatga 1560

ctctgtcgcc cagccatgtg gaatcgcaat gccaatttcc ggaggcatta cccactccgt 1620

cggcgccttc gttattgtct gccattggtg cgccaccgcc tgcagccatt gtaccagatc 1680

ccagacctga gggcgcggcg ggaggttctc cgagaggttg ggggtcgggc actgactctg 1740

agtcgccagt ctgcccaaag ttgagcttct ttttagcggg ctgctggcct ttcttgccga 1800

tgcccgtgga ggagtcgggg gattctatgg gtctcttctt tccggaagcc gtcttagcgc 1860

cttcctcaac cagaccgaga ggttcgagaa cccgcttctt ggcctggaag actgctcgcc 1920

cgaggttgcc cccaaaagac gtatcttctt gaagacgctc ctgaaactcg gcgtcggcgt 1980

ggttgtactt gaggtacggg ttgtccccct gctcgagctg cttgtcgtag gccttgtcgt 2040

gctcgagggc cgcggcgtct gcctcgttga ccggctctcc cttgtcgagt ccgttgaagg 2100

gtccgaggta cttgtagcca ggaagcacca gaccccggcc gtcgtcctgc ttttgctggt 2160

tggctttggg tttcggggct ccaggtttca agtcccacca ctcgcgaatg ccctcagaga 2220

ggttgtcctc gagccaatct ggaagataac catcggcagc catacctggt ttaagtcatt 2280

tattgctcag aaacacagtc atccaggtcc acgttgacca gatcgcaggc cgagcaagca 2340

atctcgggag cccgccccag cagatgatga atggcacaga gtttccgata cgtcctcttt 2400

ctgacgaccg gttgagattc tgacacgccg gggaaacatt ctgaacagtc tctggtcccg 2460

tgcgtgaagc aaatgttgaa attctgattc attctctcgc atgtcttgca gggaaacagc 2520

atctgaagca tgcccgcgtg acgagaacat ttgttttggt acctgtcggc aaagtccacc 2580

ggagctcctt ccgcgtctga cgtcgatgga tccgcgactg aggggcaagc ccgcttgggc 2640

tcgcttttat ccgcgtcatc gggggcgggt ctcttgttgg ctccaccctt tctgacgtag 2700

aactcatgcg ccacctcggt cacgtgatcc tgcgcccagc ggaagaactc tttgacttcc 2760

tgctttgtca ccttgccaaa gtcatgctcc agacggcggg tgagttcaaa tttgaacatc 2820

cggtcttgta acggctgctg gtgctcgaag gtggtgctgt tcccgtcaat cacggcgcac 2880

atgttggtgt tggaagtgac gatcacgggg gtgggatcga tctgggcgga cgacttgcac 2940

ttttggtcca cgcgcacctt gctgccgccg agaatggcct tggcggactc cacgaccttg 3000

gccgtcatct tgccctcctc ccaccagatc accatcttgt cgacgcaatc gttgaaggga 3060

aagttctcat tggtccagtt gacgcagccg aagggcgaat tc 3102

<210> 18

<211> 3106

<212> DNA

<213> novel AAV serotype, clone 7-2

<400> 18

gcggccgcga attcgccctt cgcagagacc aaagttcaac tgaaacgaat cagccggttt 60

attgattaac aagtaattac aggttacggg tgaggtaacg ggtgccaatg gggcgaggct 120

cagtataaac cccttcgttg ttgacagcaa attccacatt attagacttg gcataatttg 180

aggtgtactg aatctctgga ttccagcgtt tgctgttttc tttctgcagt tcccactcga 240

tctccacgct gacctggccg gtgctgtact gcgtgataaa tgaggcaaac ttggcaggag 300

taaacacctc tggaggatta gcaggtaccg gggtgttttt gatgagaatt tgaggaggcg 360

ggtgtttgag tccaaatccg cccatcaggg gagacgggtg aaagttgccg tccgtgtgag 420

gaattttggc ccagatggga ccctgcaggt acacgtcccg gttctgccag accatgccgg 480

gcagagcccc ctggctgttg acagtctgtg tctggggtcc ggccgtagac gattgcaggt 540

tgctggagac cacaccgtat tcttctgtag ccacgggatt ggtggttttg atctcctcct 600

cgctggtcat tagcacgttt tccagcgttg tcttgttggc agcccccgtt ttgccaaaaa 660

ccagcactcc gttgatggga aagaactggt cctcgtcgtc cttgttggtg gccatggcta 720

cgcccgggtt ggttaatgaa tttctaccat tcagatggta tttagtggcc ccggtccagg 780

caaagttact gttgttgttg ctgtctatgt tttttgacag tctctgctgc cgataacagg 840

gtccgggcag ccagttcttt gattgctcgg ccatggtgtt gggcccagcc tgatggaact 900

gcagctccct tgtggacccc gtagtgctct gggtccgggc caggtagtac aggtactggt 960

cgatgagggg attcatcagc cggtccaggc tctggctgtg cgcatagctg ctgtggaaag 1020

gcacttcctc aaaggtgtag ctgaattcaa agttatcgcc cgttctcagc atctgagaag 1080

gaaagtactc caggcagtag aaggaggaac gtcccacaga ctgactgccg ttgtttagag 1140

tcagatatcc gtactgagga atcatgaaca cgtccgcagg gaacggaggg aggcagccct 1200

ggtgcgcaga gccgaggacg tacggcagtt ggtactccga gtccgagaag acctgaatcg 1260

tgctggtaag gttattagcg atggtcgtaa cgccgtcgtt cgtcgtgacc tccttgacct 1320

ggatgttgaa caacttgaac cgcagctttc tgggccggaa tccccagttg ttgttgatga 1380

gtcgctgcca gtcacgtggt gagaagtggc agtggaatct gttgaagtca aaatagcccc 1440

agggggtgct gtagccgaag aagtggttgt cgttggtagc cccgctctga cttgatatct 1500

gcttgtagag gtggttgttg taggtgggca gggcccaggt gcgggtgctg gtggtgatga 1560

ctctgtcgcc cagccatgtg gaatcgcaat gccaatttcc ggaggcatta cccactccgt 1620

cggcgccttc gttattgtct gccattggtg cgccaccgcc tgcagccatt gtaccagatc 1680

ccagacctga gggcgcggcg ggaggttctc cgagaggttg ggggtcgggc actgactctg 1740

agtcgccagt ctgcccaaag ttgagcttct ttttagcggg cggctggccg ttcttgccga 1800

tgcccgtgga ggagtcgggg gattctatgg gtctcttctt tccaggagcc gtcttagcgc 1860

cttcctcaac cagaccgaga ggttcgagaa cccgcttctt ggcctggaag actgctcgcc 1920

cgaggttgcc cccaaaagac gtatcttctt gaagacgctc ctgaaactcg gcgtcggcgt 1980

ggttgtactt gaggtacggg ttgtccccct gctcgagctg cttgtcgtag gccttgtcgt 2040

gctcgagggc cgcggcgtct gcctcgttga ccggctctcc cttgtcgagt ccgttgaagg 2100

gtccgaggta cctgtagcca ggaagcacca gaccccggcc gtcgtcctgc ttttgctggt 2160

tggctttggg tttcggggct ccaggtttca agtcccacca ctcgcgaatg ccctcagaga 2220

ggttgccctc gagccaatct ggaagataac catcggcagc catacctggt ttaagtcatt 2280

tattgctcag aaacacagtc atccaggtcc acgttggcca gatcgcaggc cgagcaagca 2340

atctcgggag cccgccccag cagatgatga atggcacaga gtttccgata cgtcctcttt 2400

ctgacgaccg gttgagattc tgacacgccg gggaaacatt ctgaacagtc tctggtcccg 2460

tgcgtgaagc aaatgttgaa attctgattc attctctcgc atgtcttgca ggggaacagc 2520

atctgaagca tgcccgcgtg acgagaacat ttgttttggt acctgtcggc aaagtccacc 2580

ggagctcctt ccgcgtctga cgtcgatgga tccgcgactg aggggcaggc ccgcttgggc 2640

tcgcttttat ccgcgtcatc gggggcgggt ctcttgttgg ctccaccctt tctgacgtag 2700

aactcatacg ccacctcggt cacgtgatcc tgcgcccagc ggaagaactc tttgacttcc 2760

tgctttgtca ccttgccaaa gtcatgctcc agacggcggg tgagttcaaa tttgaacatc 2820

cggtcttgta acggctgctg gtgctcgaag gtggtgctgt tcccgtcaat cacggcgcac 2880

atgttggtgt tggaagtgac gatcacgggg gtgggatcga tctgggcgga cgacttgcac 2940

ttttggtcca cgcgcacctt gctgccgccg agaatggcct tggcggactc cacgaccttg 3000

gccgtcatcc tgccctcctc ccaccagatc accatcttgt cgacgcaatc gttgaaggga 3060

aagttctcat tggtccagtt gacgcagccg tagaaagggc gaattc 3106

<210> 19

<211> 3105

<212> DNA

<213> novel AAV serotype, clone C1

<400> 19

gaattcgccc ttgctgcgtc aactggacca atgagaactt tcccttcaac gattgcgtcg 60

acaagatggt gatctggtgg gaggagggca agatgaccgc caaggtcgtg gagtccgcca 120

aggccattct gggcggaagc aaggtgcgcg tggaccaaaa gtgcaagtca tcggcccaga 180

tcgaccccac gcccgtgatc gtcacctcca acaccaacat gtgcgccgtg atcgacggga 240

acagcaccac cttcgagcac cagcagccgc tgcaggaccg catgttcaag ttcgagctca 300

cccgccgtct ggagcacgac tttggcaagg tgaccaagca ggaagtcaaa gagttcttcc 360

gctgggctca ggatcacgtg actgaggtgg cgcatgagtt ctacgtcaga aagggcggag 420

ccaccaaaag acccgccccc agtgacgcgg atataagcga gcccaagcgg gcctgcccct 480

cagttgcgga gccatcgacg tcagacgcgg aagcaccggt ggactttgcg gacaggtacc 540

aaaacaaatg ttctcgtcac gcgggcatgc ttcagatgct gtttccctgc aagacatgcg 600

agagaatgaa tcagaatttc aacgtctgct tcacgcacgg ggtcagagac tgctcagagt 660

gcttccccgg cgcgtcagaa tctcaacccg tcgtcagaaa aaagacgtat cagaaactgt 720

gcgcgattca tcatctgctg gggcgggcac ccgagattgc gtgttcggcc cgcgatctcg 780

tcaacgtgga cttggatgac tgtgtttctg agcaataaat gacttaaacc aggtatggct 840

gctgacggtt atcttccaga ttggctcgag gacaacctct ctgagggcat tcgcgagtgg 900

tgggacctga aacctggagc ccccaagccc aaggccaacc agcagaagca ggacgacggc 960

cggggtctgg tgcttcctgg ctacaagtac ctcggaccct tcaacggact cgacaagggg 1020

gagcccgtca acgcggcgga cgcagcggcc ctcgagcacg acaaggccta cgaccagcag 1080

ctcaaagcgg gtgacaatcc gtacctgcgg tataaccacg ccgacgccga gtttcaggag 1140

cgtctgcaag aagatacgtc ttttgggggc aacctcgggc gagcagtctt ccaggccaag 1200

aagagggtac tcgaacctct gggcctggtt gaagaaggtg ctaagacggc tcctggaaag 1260

aagagaccgt tagagtcacc acaagagccc gactcctcct caggaatcgg caaaaaaggc 1320

aaacaaccag ccaaaaagag actcaacttt gaagaggaca ctggagccgg agacggaccc 1380

cctgaaggat cagataccag cgccatgtct tcagacattg aaatgcgtgc agcaccgggc 1440

ggaaatgctg tcgatgcggg acaaggttcc gatggagtgg gtaatgcctc gggtgattgg 1500

cattgcgatt ccacctggtc tgagggcaag gtcacaacaa cctcgaccag aacctgggtc 1560

ttgcccacct acaacaacca cttgtacctg cggctcggaa caacatcaaa cagcaacacc 1620

tacaacggat tctccacccc ctggggatac tttgacttta acagattcca ctgtcacttc 1680

tcaccacgtg actggcaaag actcatcaac aacaactggg gactacgacc aaaagccatg 1740

cgcgttaaaa tcttcaatat ccaagttaag gaggtcacaa cgtcgaacgg cgagactacg 1800

gtcgctaata accttaccag cacggttcag atatttgcgg actcgtcgta tgagctcccg 1860

tacgtgatgg acgctggaca agagggaagt ctgtctcctt tccccaatga cgtcttcatg 1920

gtgcctcaat atggctactg tggcattgtg actggcgaaa atcagaacca gacggacaga 1980

aatgctttct actgcctgga gtattttcct tcacaaatgc tgagaactgg caataacttt 2040

gaaatggctt acaactttgg gaaggtgccg ttccactcaa tgtatgctta cagccagagc 2100

ccggacagac tgatgaatcc cctcctggac cagtacctgt ggcacttaca gtcgaccacc 2160

tctggagaga ctctgaatca aggcaatgca gcaaccacat ttggaaaaat caggagtgga 2220

gactttgcct tttacagaaa gaactggctg cctgggcctt gtgttaaaca gcagagactc 2280

tcaaaaactg ccagtcaaaa ttacaagatt cctgccagcg ggggcaacgc tctgttaaag 2340

tatgacaccc actatacctt aaacaaccgc tggagcaaca tagcgcctgg acctccaatg 2400

gcaacagctg gaccttcaga tggggacttc agcaacgccc agctcatctt ccctggacca 2460

tcagtcaccg gaaacacaac aacctcagca aacaatctgt tgtttacatc agaagaagaa 2520

attgctgcca ccaacccaag agacacggac atgtttggtc agattgctga caataatcag 2580

aatgctacaa ctgctcccat aaccggcaac gtgactgcta tgggagtgct tcctggcatg 2640

gtgtggcaaa acagagacat ttactaccaa gggccaattt gggccaagat cccacacgcg 2700

gacggacatt ttcatccttc accgctaatt ggcggttttg gactgaaaca tccgcctccc 2760

cagatattta tcaaaaacac ccccgtacct gccaatcctg cgacaacctt cactgcagcc 2820

agagtggact ctttcatcac acaatacagc accggccagg tcgctgttca gattgaatgg 2880

gaaatcgaaa aggaacgctc caaacgctgg aatcctgaag tgcagtttac ttcaaactat 2940

gggaaccagt cttctatgtt gtgggctccc gatacaactg ggaagtatac agagccgcgg 3000

gttattggct ctcgttattt gactaatcat ttgtaactgc ctagttaatc aataaaccgt 3060

gtgattcgtt tcagttgaac tttggtctct gcgaagggcg aattc 3105

<210> 20

<211> 3105

<212> DNA

<213> novel AAV serotype, clone C3

<400> 20

gaattcgccc ttgctgcgtc aactggacca atgagaactt tcccttcaac gattgcgtcg 60

acaagatggt gatctggtgg gaggagggca agatgaccgc caaggtcgtg gagtccgcca 120

aggccattct gggcggaagc aaggtgcgcg tggaccaaaa gtgcaagtca tcggcccaga 180

tcgaccccac gcccgtgatc gtcacctcca acaccaacat gtgcgccgtg atcgacggga 240

acagcaccac cttcgagcac cagcagccgc tgcaggaccg catgttcaag ttcgagctca 300

cccgccgtct ggagcacgac tttggcaagg tgaccaagca ggaagtcaaa gagttcttcc 360

gctgggctca ggatcacgtg actgaggtgg cgcatgagtt ctacgtcaga aagggcggag 420

ccaccaaaag acccgccccc agtgacgcgg atataagcga gcccaagcgg gcctgcccct 480

cagttgcgga gccatcgacg tcagacgcgg aagcaccggt ggactttgcg gacaggtacc 540

aaaacaaatg ttctcgtcac gcgggcatgc ttcagatgct gtttccctgc aagacatgcg 600

agagaatgaa tcagaatttc aacgtctgct tcacgcacgg ggtcagagac tgctcagagt 660

gcttccccgg cgcgtcagaa tctcaacccg tcgtcagaaa aaagacgtat cagaaactgt 720

gcgcgattca tcatctgctg gggcgggcac ccgagattgc gtgttcggcc tgcgatctcg 780

tcaacgtgga cttggatgac tgtgtttctg agcaataaat gacttaaacc aggtatggct 840

gctgacggtt atcttccaga ttggctcgag gacaacctct ctgagggcat tcgcgagtgg 900

tgggacctga aacctggagc ccccaagctc aaggccaacc agcagaagca ggacgacggc 960

cggggtctgg tgcttcctgg ctacaagtac ctcggaccct tccacggact cgacaagggg 1020

gagcccgtca acgcggcgga cgcagcggcc ctcgagcacg acaaggccta cgaccagcag 1080

ctcaaagcgg gtgacaatcc gtacctgcgg tataaccacg ccgacgccga gtttcaggag 1140

cgtctgcaag aagatacgtc ttttgggggc aacctcgggc gagcagtctt ccaggccaag 1200

aagagggtac tcgaaccact gggcctggtt gaagaaggtg ctaagacggc tcctggaaag 1260

aagagaccgt tagagtcacc acaagagccc gactcctcct caggaatcgg caaaaaaggc 1320

aaacaaccag ccaaaaagag actcaacttt gaagaggaca ctggagccgg agacggaccc 1380

cctgaaggat cagataccag cgccatgtct tcagacattg aaatgcgtgc agcaccgggc 1440

ggaaatgctg tcgatgcggg acaaggttcc gatggagtgg gtaatgcctc gggtgattgg 1500

cattgcgatt ccacctggtc tgagggcaag gtcacaacaa cctcgaccag aacctgggtc 1560

ttgcccacct acaacaacca cttgtacctg cggctcggaa caacatcaaa cagcaacacc 1620

tacaacggat tctccacccc ctggggatac tttgacttta acagattcca ctgtcacttc 1680

tcaccacgtg actggcaaag actcatcaac aacaactggg gactacgacc aaaagccatg 1740

cgcgttaaaa tcttcaatat ccaagttaag gaggtcacaa cgtcgaacgg cgagactacg 1800

gtcgctaata accttaccag cacggttcag atatttgcgg actcgtcgta tgagctcccg 1860

tacgtgatgg acgctggaca agagggaagt ctgcctcctt tccccaatga cgtcttcatg 1920

gtgcctcaat atggctactg tggcattgtg actggcgaaa atcagaacca gacggacaga 1980

aatgctttct actgcctgga gtattttcct tcacaaatgc tgagaactgg caataacttt 2040

gaaatggctt acaactttga gaaggtgccg ttccactcaa tgtatgctca cagccagagc 2100

ctggacagac tgatgaatcc cctcctggac cagtacctgt ggcacttaca gtcgaccacc 2160

tctggagaga ctctgaatca aggcaatgca gcaaccacat ttggaaaaat caggagtgga 2220

gactttgcct tttacagaaa gaactggctg cctgggcctt gtgttaaaca gcagagattc 2280

tcaaaaactg ccagtcaaaa ttacaagatt cctgccagcg ggggcaacgc tctgttaaag 2340

tatgacaccc actatacctt aaacaaccgc tggagcaaca tagcgcctgg acctccaatg 2400

gcaacagctg gaccttcaga tggggacttc agcaacgccc agctcatctt ccctggacca 2460

tcagtcaccg gaaacacaac aacctcagca aacaatctgt tgtttacatc agaaggagaa 2520

attgctgcca ccaacccaag agacacggac atgtttggtc agattgctga caataatcag 2580

aatgctacaa ctgctcccat aaccggcaac gtgactgcta tgggagtgct tcctggcatg 2640

gtgtggcaaa acagagacat ttactaccaa gggccaattt gggccaagat cccacacgcg 2700

gacggacatt ttcatccttc accgctaatt ggcggttttg gactgaaaca tccgcctccc 2760

cagatattta tcaaaaacac ccccgtacct gccaatcctg cgacaacctt cactgcagcc 2820

agagtggact ctttcatcac acaatacagc accggccagg tcgctgttca gattgaatgg 2880

gaaatcgaaa aggaacgctc caaacgccgg aatcctgaag tgcagtttac ttcaaactat 2940

gggaaccagt cttctatgtt gtgggctccc gatacaactg ggaagtatac agagccgcgg 3000

gttattggct ctcgttattt gactaatcat ttgtaactgc ctagttaatc aataaaccgt 3060

gtgattcgtt tcagttgaac tttggtctct gcgaagggcg aattc 3105

<210> 21

<211> 3105

<212> DNA

<213> novel AAV serotype, clone C5

<400> 21

gaattcgccc ttcgcagaga ccaaagttca actgaaacga atcacacggt ttattgatta 60

actaggcagt tacaaatgat tagtcaaata acgagagcca ataacccgcg gctctgtata 120

cttcccagtt gtatcgggag cccacaacat agaagactgg ttcccacagt ttgaagtaaa 180

ctgcacttca ggattccagc gtttggagcg ttccttttcg atttcccatt caatctgaac 240

agcgacctgg ccggtgctgt attgtgtgat gaaagagtcc actctggctg cagtgaaggt 300

tgtcgcagga taggcaggta cgggggtgtt tttgataaat atctggggag gcggatgttt 360

cagtccaaaa ccgccaatta gcggtgaagg atgaaaatgt ccgtccgcgt gtgggatctt 420

ggcccaaatt ggcccttggt agtaaatgtc tctgttttgc cacaccatgc caggaagcac 480

tcccatagca gtcacgttgc cggttatggg agcagttgta gcattctgat tattgtcagc 540

aatctgacca aacatgtccg tgtctcttgg gttggtggca gcaatttctt cttctgatgt 600

aaacaacaga ttgtttgctg aggttgttgt gtttccggtg actgatggtc cagggaagat 660

gagctgggcg ttgctgaagt ccccatctga aggtccagct gttgccattg gaggtccagg 720

cgctatgttg ctccagcggt tgtttaaggt atagtgggtg tcatacttta acagagcgtt 780

gcccccgctg gcaggaatct tgtaattttg actggcagtt tttgagaatc tctgctgttt 840

aacacaaggc ccaggcagcc agttctttct gtaaaaggca aagtctccac tcctgatttt 900

tccaaatgtg gttgctgcat tgccttgatt cagagtctct ccagaggtgg tcgactgtaa 960

gtgccacagg tactggtcca ggaggggatt catcagtccg tccaggctct ggctgtgagc 1020

atacattgag tggaacggca ccttctcaaa gttgtaagcc gtttcaaagt tattgccagt 1080

tctcagcatt tgtgaaggaa aatactccag gcagtagaaa gcatttctgt ccgtctggtt 1140

ctgattttcg ccagtcacaa tgccacagta gccatattga ggcaccatga agacgtcatt 1200

ggggaaagga ggcagacttc cctcttgtcc agcgtccatc acgtacggga gctcatacga 1260

cgagtccgca aatatctgaa ccgtgctggt aaggttatta gcgaccgtag tctcgccgtt 1320

cgacgttgtg acctccttaa cttggatatt gaagatttta acgcgcatgg cttttggtcg 1380

tagtccccag ttgttgttga tgagtctttg ccagtcacgt ggtgagaagt gacagtggaa 1440

tctgttaaag tcaaagtatc cccagggggt ggagaatccg ttgtaggtgt tgctgtttga 1500

tgttgttccg agccgcaggt acaagtggtt gttgtaggtg ggcaagaccc aggttctggt 1560

cgaggttgtt gtgaccttgc cctcagacca ggtggaatcg caatgccaat cacccgaggc 1620

attacccact ccatcggaac cttgtcccgc atcgacagca tttccgcccg gtgctgcacg 1680

catttcaatg tctgaagaca tggcgctggt atctgatcct tcagggggtc cgtctccggc 1740

tccagtgtcc tcttcaaagt tgagtctctt tttggctggt tgtttgcctt ttttgccgat 1800

tcctgaggag gagtcgggct cttgtggtga ctctaacggt ctcttctttc caggagccgt 1860

cttagcacct tcttcaacca ggcccagagg ttcgagtacc ctcttcttgg cctggaagac 1920

tgctcgcccg aggttgcccc caaaagacgt atcttcttgc agacgctcct gaaactcggc 1980

gtcggcgtgg ttataccgca ggtacggatt gtcacccgct ttgagctgct ggtcgtaggc 2040

cttgtcgtgc tcgagggccg ctgcgtccgc cgcgttgacg ggctccccct tgtcgagtcc 2100

gttgaagggt ccgaggtact cgtagccagg aagcaccaga ccccggccgt cgtcctgctt 2160

ctgctggttg gccttgggct tgggggctcc aggtttcagg tcccaccact cgcgaatgcc 2220

ctcagagagg ttgtcctcga gccaatctgg aagataaccg tcagcagcca tacctggttt 2280

aagtcattta ttgctcagaa acacagtcat ccaagtccac gttgacgaga tcgcaggccg 2340

aacacgcaat ctcgggtgcc cgccccagca gatgatgaat cgcgcacagt ttctgatacg 2400

tcttttttct gacgacgggt tgagattctg acgcgccggg gaagcactct gagcagtctc 2460

tgaccccgtg cgtgaagcag acgttgaaat tctgattcat tctctcgcat gtcttgcagg 2520

gaaacagcat ctgaagcatg cccgcgtgac gagaacattt gttttggtac ctgtccgcaa 2580

ggtccaccgg tgcttccgcg tctgacgtcg atggctccgc aactgagggg caggcccgct 2640

tgggctcgct tatatccgcg tcactggggg cgggtctttt ggtggctccg ccctttctga 2700

cgtagaactc atgcgccacc tcagtcacgt gatcctgagc ccagcggaag aactctttga 2760

cttcctgctt ggtcaccttg ccaaagtcgt gctccagacg gcgggtgagc tcgaacttga 2820

acatgcggtc ctgcagcggc tgctggtgct cgaaggtggt gctgttcccg tcgatcacgg 2880

cgcacatgtt ggtgttggag gtgacgatca cgggcgtggg gtcgatctgg gccgatgact 2940

tgcacttttg gtccacgcgc accttgcttc cgcccagaat ggccttggcg gactccacga 3000

ccttggcggt catcttgccc tcctcccacc agatcaccat cttgtcgacg caatcgttga 3060

agggaaagtt ctcattggtc cagttgacgc agcaagggcg aattc 3105

<210> 22

<211> 3094

<212> DNA

<213> novel AAV serotype, clone F1

<400> 22

gaattcgccc ttgctgcgtc aactggacca agagaacttt cccttcaacg attgcgtcga 60

caagatggtg atctggtggg aggagggcaa gatgacggcc aaggtcgtgg agtccgccaa 120

agccattctg ggcggaagca aggtgcgcgt cgaccaaaag tgcaagtcct cggcccagat 180

cgatcccacc cccgtgatcg tcacctccaa caccaacatg tgcgccgtga tcgacgggaa 240

cagcaccacc ttcgagcacc agcagccgtt gcaggaccgg atgttcaaat ttgaactcac 300

ccgccgtctg gaacacgact ttggcaaggt gaccaagcag gaagtcaaag agttcttccg 360

ctgggctagt gatcacgtga ctgaggtgac gcatgagttc tacgtcagaa agggcggagc 420

cagcaaaaga cccgcccccg atgacgcgga tataagcgag cccaagcggg cctgtccctc 480

agtcacggac ccatcgacgt cagacgcgga aggagctccg gtggactttg ccgacaggta 540

ccaaaacaaa tgttctcgtc acgcgggcat gcttcagatg ctgtttccct gcaaaacgtg 600

cgagagaatg aatcagaatt tcaacatttg cttcacgcac ggggtcagag actgtttaga 660

atgtttcccc ggcgtgtcag aatctcaacc ggtcgtcaga aaaaagacgt atcggaagct 720

gtgtgcgatt catcatctgc tggggcgggc acccgagatt gcttgctcgg cctgcgacct 780

ggtcaacgtg gacctggacg actgtgtttc tgagcaataa atgacttaaa ccgggtatgg 840

ctgccgatgg ttatcttcca gattggctcg aggacaacct ctctgagggc attcgcgagt 900

ggtgggacct gaaacctgga gccccgaaac ccaaagccaa ccagcaaaag caggacgacg 960

gccggggtct ggtgcttcct ggctacaagt acctcggacc cttcaacgga ctcgacaagg 1020

gggagcccgt caacgcggcg gacgcagcgg ccctcgagca cgacaaggcc tacgaccagc 1080

agctcaaagc gggtgacaat ccgtacctgc ggtataacca cgccgacgcc gagtttcagg 1140

agcgtctgca agaagatacg tcatttgggg gcaacctcgg gcgagcagtc ttccaggcca 1200

agaagcgggt tctcgaacct ctcggtctgg ttgaggaagg cgctaagacg gctcctggaa 1260

agaagagacc catagactct ccagactcct ccacgggcat cggcaaaaaa ggccagcagc 1320

ccgctaaaaa gaagctcaat tttggtcaga ctggcgactc agagtcagtc cccgaccctc 1380

aacctcttgg agaacctcca gcagcgccct ctagtgtggg atctggtaca atggctgcag 1440

gcggtggcgc accaatggca gacaataacg aaggtgccga cggagtgggt aatgcctcag 1500

gaaattggca ttgcgattcc acatggctgg gcgacagagt catcaccacc agcaccagaa 1560

cctgggccct ccccacctac aacaaccacc tctacaagca aatctccagc agcagctcag 1620

gagccaccaa tgacaaccac tacttcggct acagcacccc ctgggggtat tttgacttta 1680

acagattcca ctgccacttc tcaccacgtg actggcagcg actcatcaac aacaactggg 1740

gattccggcc caagaagctg cggttcaagc tcttcaacat ccaggtcaag gaggtcacaa 1800

cgaatgacgg cgtcacgacc atcgctaata accttaccag cacggttcag gtcttctcgg 1860

actcggaata ccagctgccg tacgtcctcg gctctgcgca ccagggctgc ctgcctccgt 1920

tcccggcgga cgtcttcatg attcctcagt acggctacct gactctgaac aacggcagcc 1980

aatcggtggg ccgttcctcc ttctactgcc tggaatattt cccctctcaa atgctgagaa 2040

cgggcaacaa ctttgagttc agttacagct tcgaggacgt gcctttccac agcagctacg 2100

cgcacagcca gagcctagac cggctgatga accctctcat cgaccagtac ctgtactacc 2160

tggcccggac ccagagcacc acgggttcca ccagggaact gcaatttcat caagctgggc 2220

ccaatactat ggccgagcag tcaaagaact ggctgcctgg accctgctat aggcaacagg 2280

gactgtcaaa gaacttggac tttaacaaca acagcaattt tgcctggact gctgccacta 2340

aatatcatct gaatggcaga aactctttga ccaatcctgg cattcccatg gcaaccaaca 2400

aggatgatga ggaccagttc tttcccatca acggggtact ggtttttggc aagacgggag 2460

ctgccaacaa aactacgctg gaaaacgttc tgatgaccag cgaggaggag atcaagacca 2520

ctaaccctgt ggctacagaa gaatacggtg tggtctccag caacctgcag ccgtctacag 2580

ccgggcctca atcacagact atcaacagcc agggagcact gcctggcatg gtctggcaga 2640

accgggacgt gtatctgcag ggtcccatct gggccaaaat tcctcacacg gatggcaact 2700

ttcacccgtc tcctctgatg ggcggttttg gactcaaaca cccgcctcca cagatcctga 2760

tcaaaaacac acctgtacct gctaatcctc cggaggtgtt tactcctgcc aagtttgcct 2820

ccttcatcac gcagtacagc accggacaag tcagcgtgga aatcgagtgg gagctgcaga 2880

aagaaaacag caagcgctgg aacccagaaa ttcagtatac ttccaattat gccaagtcta 2940

ataatgttga atttgctgtg aaccctgatg gtgtttatac tgagcctcgc cccattggca 3000

ctcgttacct cccccgtaat ctgtaattgc ttgttaatca ataaaccggt tgattcgttt 3060

cagttgaact ttggtctctg cgaagggcga attc 3094

<210> 23

<211> 3095

<212> DNA

<213> novel AAV serotype, clone F3

<400> 23

gaattcgccc ttcgcagaga ccaaagttca actgaaacga atcaaccggt ttattgatta 60

acaagcaatt acagattacg ggtgaggtaa cgagtgccaa tggggcgagg ctcagtataa 120

acaccatcag ggttcacagc aaattcaaca ttattagact tggcataatt ggaagtatac 180

tgaatttctg ggttccagcg cttgctgttt tctttctgca gctcccactc gatttccacg 240

ctgacttgtc cggtgctgta ctgcgtgatg aaggaggcaa acttggcagg agtaaacacc 300

tccggaggat tagcaggtac aggtgtgttt ttgatcagga tctgtggagg cgggtgtttg 360

agtccaaaac cgcccatcag aggagacggg tgaaagttgc catccgtgtg aggaattttg 420

gcccagatgg gaccctgcag atacacgtcc cggttctgcc agaccatgcc aggcagtgct 480

ccctggctgt tgatagtctg tgattgaggc ccggctgtag acgactgcag gttgctggag 540

accacaccgt attcttctgt agccacaggg ttagtggtct tgatctcctc ctcgctggtc 600

atcagaacgt tttccagcgt agttttgttg gcagctcccg tcttgccaaa aaccagtacc 660

ccgttgatgg gaaagaactg gtcctcatca tccttgttgg ttgccatggg aatgccagga 720

ttggtcaaag agtttctgcc attcagatga tatttagtgg cagcagtcca ggcaaaattg 780

ctgttgttgt taaagtccaa gttctttgac agtctctgtt gcctatagca gggtccaggc 840

agccagttct ttgactgctc ggccatagta ttgggcccag cttgatgaaa ttgcagttcc 900

ctggtggaac ccgtggtgct ctgggtccgg gccaggtagt acaggtactg gtcgatgaga 960

gggttcatca gccggtctag gctctggctg tgcgcgtagc tgctgtggaa aggcacgtcc 1020

tcgaagctgt aactgaactc aaagttgttg cccgttctca gcatttgaga ggggaaatat 1080

tccaggcagt agaaggagga acggcccacc gattggctgc cgttgtccag agtcaggtag 1140

ccgtactgag gaatcatgaa gacgtccgcc gggaacggag gcaggcagcc ctggtgcgca 1200

gagccgagga cgtacggcag ctggtattcc gagtccgaga agacctgaac cgtgctggta 1260

aggttattag cgatggtcgt gacgccgtca ttcgttgtga cctccttgac ctggatgttg 1320

aggagcttga accgcagctt cttgggccgg aatccccagt tgttgttgat gagtcgctgc 1380

cagtcacgtg gtgagaagtg gcagtggaat ctgttaaagt caaaataccc ccagggggtg 1440

ctgtagccga agtagtggtt gtcattggtg gctcctgagc tgctgctgga gatttgcttg 1500

tagaggtggt tgttgtaggt ggggagggcc caggttctgg tgctggtggt gatgactctg 1560

tcgcccagcc atgtggaatc gcaatgccaa tttcctgagg cattacccac tccgtcggca 1620

ccttcgttat tgtctgccat tggtgcgcca ccgcctgcag ccattgtacc agatcccaca 1680

ctagagggcg ctgctggagg ttctccaaga ggttgagggt cggggactga ctctgagtcg 1740

ccagtctgac caaaattgag cttcttttta gcgggctgct ggcctttttt gccgatgccc 1800

gtggaggagt ctggagagcc tatgggtctc ttctttccag gagccgtctt agcgccttcc 1860

tcaaccagac cgagaggttc gagaacccgc ttcttggcct ggaagactgc tcgcccgagg 1920

ttgcccccaa atgacgtatc ttcttgcaga cgctcctgaa actcggcgtc ggcgtggtta 1980

taccgcaggt acggattgtc acccgctttg agctgctggt cgtaggcctt gtcgtgctcg 2040

agggccgctg cgtccgccgc gttgacgggc tcccccttgt cgagtccgtt gaagggtccg 2100

aggtacttgt agccaggaag caccagaccc cggccgtcgt cctgcttttg ctggttggct 2160

ttgggtttcg gggctccagg tttcaggtcc caccactcgc gaatgccctc agagaggttg 2220

tcctcgagcc aatctggaag ataaccatcg gcagccatac ctggtttaag tcatttattg 2280

ctcagaaaca cagtcgtcca ggtccacgtt gaccaggtcg caggccgagc aagcaatctc 2340

gggtgcccgc cccagcagat gatgaatcgc acacagcttc cgatacgtct tttttctgac 2400

gaccggttga gattctgaca cgccggggaa acattctaaa cagtctctga ccccgtgcgt 2460

gaagcaaatg ttgaaattct gattcattct ctcgcacgtt ttgcagggaa acagcacctg 2520

aagcatgccc gcgtgacgag aacatttgtt ttggtacctg tcggcaaagt ccaccggagc 2580

tccttccgcg tctgacgtcg atgggtccgt gactgaggga cgggcccgct tgggctcgct 2640

tatatccgcg tcatcggggg cgggtctttt gctggctccg ccctttctga cgtagaactc 2700

atgcgtcacc tcagtcacgt gatcactagc ccagcggaag aactctttga cttcctgctt 2760

tgtcaccttg ccaaagtcgt gttccagacg gcgggtgagt tcaaatttga acatccggtc 2820

ctgcaacggt tgctggtgct cgaaggtggt gctgttcccg tcgatcacgg cgcacatgtt 2880

ggtgttggag gtgacgatca cgggggtggg atcgatctgg gcggacgact tgcacttttg 2940

gtccacgcgc accttgctgc cgccgagaat ggccttggcg gactccacga ccttggccgt 3000

catcttgccc tcctcccacc agatcaccat cttgtcgacg caatcgttga agggaaagtt 3060

ctcattggtc cagttgacgc agcaagggcg aattc 3095

<210> 24

<211> 3095

<212> DNA

<213> novel AAV serotype, clone F5

<400> 24

gaattcgccc ttcgcagaga ccaaagttca actgaaacga atcaaccggt ttattgatta 60

acaagcaatt acagattacg ggtgaggtaa cgagtgccaa tggggcgagg ctcagtataa 120

acaccatcag ggttcacagc aaattcaaca ttattagact tggcataatt ggaagtatac 180

tgaatttctg ggttccagcg cttgctgttt tctttctgca gctcccactc gatttccacg 240

ctgacttgtc cggtgctgta ctgcgtgatg aaggaggcaa acttggcagg agtaaacacc 300

tccggaggat tagcaggtac aggtgtgttt ttgatcagga tctgtggagg cgggtgttcg 360

agtccaaaac cgcccatcag aggagacggg tgaaagttgc catccgtgtg aggaattttg 420

gcccagatgg gaccctgcag atacacgtcc cggttctgcc agaccatgcc aggcagtgct 480

ccctggctgt tgatagtctg tgattgaggc ccggctgtag acgactgcag gttgctggag 540

accacaccgt attcttctgt agccacaggg ttagtggtct tgatctcctc ctcgctggtc 600

atcagaacgt tttccagcgt agttttgttg gcagctcccg tcttgccaaa aaccagtacc 660

ccgttgatgg gaaagaactg gtcctcatca tccttgttgg ttgccatggg aatgccagga 720

ttggtcaaag agtttctgcc attcagatga tatttagtgg cagcagtcca ggcaaaattg 780

ctgttgttgt taaagtccaa gttctttgac agtctctgtt gcctatagca gggtccaggc 840

agccagttct ttgactgctc ggccatagta ttgggcccag cttgatgaaa ttgcagttcc 900

ctggtggaac ccgtggtgct ctgggtccgg gccaggtagt acaggtactg gtcgatgaga 960

gggttcatca gccggtctag gctctggctg tgcgcgtagc tgctgtggaa aggcacgtcc 1020

tcgaagctgt aactgaactc aaagttgttg cccgttctca gcatttgaga ggggaaatat 1080

tccaggcagt agaaggagga acggcccacc gattggctgc cgttgttcag agtcaggtag 1140

ccgtactgag gaatcatgaa gacgtccgcc gggaacggag gcaggcagcc ctggtgcgca 1200

gagccgagga cgtacggcag ctggtattcc gagtccgaga agacctgaac cgtgctggta 1260

aggttattag cgatggtcgt gacgccgtca ttcgttgtga cctccttgac ctggatgttg 1320

aagagcttga accgcagctt cttgggccgg aatccccagt tgttgttgat gagtcgctgc 1380

cagtcacgtg gtgagaagtg gcagtggaat ctgttaaagt caaaataccc ccagggggtg 1440

ctgtagccga agtagtggtt gtcattggtg gctcctgagc tgctgctgga gatttgcttg 1500

tagaggtggt tgttgtaggt ggggagggcc caggttctgg tgctggtggt gatgactctg 1560

tcgcccagcc atgtggaatc gcaatgccaa tttcctgagg cattacccac tccgtcggca 1620

ccttcgttat tgtctgccgt tggtgcgcca ccgcctgcag ccattgtacc agatcccaca 1680

ctagagggcg ctgctggagg ttctccaaga ggttgagggt cggggactga ctctgagtcg 1740

ccagtctgac caaaattgag cttcttttta gcgggctgct ggcctttttt gccgatgccc 1800

gtggaggagt ctggagagtc tatgggtctc ttctttccag gagccgtctt agcgccttcc 1860

tcaaccagac cgagaggttc gagaacccgc ttcttggcct ggaagactgc tcgcccgagg 1920

ttgcccccaa atgacgtatc ttcttgcagg cgctcctgaa actcggcgtc ggcgtggtta 1980

taccgcaggt acggattgtc acccgctttg agctgctggt cgtaggcctt gtcgtgctcg 2040

agggccgctg cgtccgccgc gttgacgggc tcccccttgt cgagtccgtt gaagggtccg 2100

aggtacttgt agccaggaag caccagaccc cggccgtcgt cctgcttttg ctggttggct 2160

ttgggtttcg gggctccagg tttcaggtcc caccactcgc gaatgccctc agagaggttg 2220

tcctcgagcc aatctggaag ataaccatcg gcagccatac ctggtttaag ccatttattg 2280

ctcagaaaca cagtcgtcca ggtccacgtt gaccaggtcg caggccgagc aggcaatctc 2340

gggtgcccgc cccagcagat gatgaatcgc acacagcttc cgatacgtct tttttctgac 2400

gaccggttga gattctgaca cgccggggaa acattctaaa cagtctctga ccccgtgcgt 2460

gaagcaaatg ttgaaattct gattcattct ctcgcacgtt ttgcagggaa acagcatctg 2520

aagcatgccc gcgtggcgag aacatttgtt ttggtacctg tcggcaaagt ccaccggagc 2580

tccttccgcg tctgacgtcg atgggtccgt gactgaggga caggcccgct tgggctcgct 2640

tatatccgcg tcatcggggg cgggtctttt gctggctccg ccctttctga cgtagaactc 2700

atgcgtcacc tcagtcacgt gatcactagc ccagcggaag aactctttga cttcctgctt 2760

tgtcaccttg ccaaagtcgt gttccagacg gcgggtgagt tcaaatttga acatccggtc 2820

ctgcaacggc tgctggtgct cgaaggtggt gctgttcccg tcgatcacgg cgcgcatgtt 2880

ggtgttggag gtgacgatca cgggggtggg atcgatctgg gcggacgact tgcacttttg 2940

gtccacgcgc accttgctgc cgccgagaat ggccttggcg gactccacga ccttggccgt 3000

catcttgccc tcctcccacc agatcaccat cttgtcgacg caatcgttga agggaaagtt 3060

ctcattggtc cagttgacgc agcaagggcg aattc 3095

<210> 25

<211> 3142

<212> DNA

<213> novel AAV serotype, clone H6

<400> 25

aaaacgacgg gccagtgatt gtaatacgac tcactatagg gcgaaattga aattagcggc 60

cgcgaattcg cctttcgcag agaccaaagt tcaactgaaa cgaattaaac ggtttattga 120

ttaacaagca attacagatt acgagtcagg tatctggtgc caatggggcg aggctctgaa 180

tacacaccat tagtgtccac agtaaagtcc acattaacag acttgttgta gttggaagtg 240

tactgaattt cgggattcca gcgtttgctg ttctccttct gcagctccca ctcgatctcc 300

acgctgacct gtcccgtgga atactgtgtg atgaaagaag caaacttggc agaactgaag 360

tttgtgggag gattggctgg aacgggagtg tttttgatca tgatctgagg aggcgggtgt 420

ttgagtccaa aacctcccat cagtggagaa ggatgaaagt gtccatcggt gtgaggaatc 480

ttggcccaaa tgggtccctg caggtacacg tctcgatcct gccacaccat accaggtaac 540

gctccttggt gattgacagt tccagtagtt ggaccagtgt ttgagttttg caaattattt 600

gacacagtcc cgtactgctc cgtagccacg ggattggtgg ccctgatttc ttcttcatct 660

gtaatcatga cattttccaa atccgcgtcg ttggcatttg ttccttgttt accaaatatc 720

agggttccat gcatggggaa aaacttttct tcgtcatcct tgtgactggc catagctggt 780

cctggattaa ccaacgagtc ccggccattt agatgatact ttgtagctgc agtccaggga 840

aagttgctgt tgttgttgtc gtttgcctgt tttgacagac gctgctgtct gtagcaaggt 900

ccaggcagcc agtttttagc ttgaagagac atgttggttg gtccagcttg gctaaacagt 960

agccgagact gctgaagagt tccactattt gtttgtgtct tgttcagata atacaggtac 1020

tggtcgatca gaggattcat cagccgatcc agactctggc tgtgagcgta gctgctgtgg 1080

aaaggcacgt cttcaaaagt gtagctgaac tgaaagttgt ttccagtacg cagcatctga 1140

gaaggaaagt actccaggca gtaaaaggaa gagcgtccta ccgcctgact cccgttgttc 1200

agggtgaggt atccatactg tgggaccatg aagacgtccg ctggaaacgg cgggaggcat 1260

ccttgatgcg ccgagcccag gacgtacggg agctggtact ccgagtcagt aaacacctga 1320

accgtgctgg taaggttatt ggcaatcgtc gtcgtaccgt cattctgcgt gacctctttg 1380

acttgaatat taaagagctt gaagttgagt cttttgggcc ggaatccccg gttgttgttg 1440

acgagtcttt gccagtcacg tggtgaaaag tggcagtgga atctgttgaa gtcaaaatac 1500

ccccaggggg tgctgtagcc aaagtagtgg ttgtcgttgc tggctcctga ttggctggag 1560

atttgcttgt agaggtggtt gttgtatgtg ggcagggccc aggttcgggt gctggtggtg 1620

atgactctgt cgcccagcca ttgggaatcg caatgccaat ttcctgagga attacccact 1680

ccatcggcac cctcgttatt gtctgccatt ggtgcgccac tgcctgtagc cattgtagta 1740

gatcccagac cagagggggc tgctggtggc tgtccgagag gctgggggtc aggtacggag 1800

tctgcgtctc cagtctgacc aaaatttaat ctttttcttg caggctgctg gcccgctttt 1860

ccggttcccg aggaggagtc tggctccaca ggagagtgct ctaccggcct cttttttccc 1920

ggagccgtct taacaggctc ctcaaccagg cccagaggtt caagaaccct ctttttcgcc 1980

tggaagactg ctcgtccgag gttgccccca aaagacgtat cttctttaag gcgctcctga 2040

aactctgcgt cggcgtggtt gtacttgagg tacgggttgt ctccgctgtc gagctgccgg 2100

tcgtaggcct tgtcgtgctc gagggccgcg gcgtctgcct cgttgaccgg ctcccccttg 2160

tcgagtccgt tgaagggtcc gaggtacttg tacccaggaa gcacaagacc cctgctgtcg 2220

tccttatgcc gctctgcggg ctttggtggt ggtgggccag gtttgagctt ccaccactgt 2280

cttattcctt cagagagagt gtcctcgagc caatctggaa gataaccatc ggcagccata 2340

cctgatttaa atcatttatt gttcagagat gcagtcatcc aaatccacat tgaccagatc 2400

gcaggcagtg caagcgtctg gcacctttcc catgatatga tgaatgtagc acagtttctg 2460

atacgccttt ttgacgacag aaacgggttg agattctgac acgggaaagc actctaaaca 2520

gtctttctgt ccgtgagtga agcagatatt tgaattctga ttcattctct cgcattgtct 2580

gcagggaaac agcatcagat tcatgcccac gtgacgagaa catttgtttt ggtacctgtc 2640

cgcgtagttg atcgaagctt ccgcgtctga cgtcgatggc tgcgcaactg actcgcgcgc 2700

ccgtttgggc tcacttatat ctgcgtcact gggggcgggt cttttcttag ctccaccctt 2760

tttgacgtag aattcatgct ccacctcaac cacgtgatcc tttgcccacc ggaaaaagtc 2820

tttcacttcc tgcttggtga cctttccaaa gtcatgatcc agacggcggg taagttcaaa 2880

tttgaacatc cggtcttgca acggctgctg gtgctcgaag gtcgttgagt tcccgtcaat 2940

cacggcgcac atgttggtgt tggaggtgac gatcacggga gtcgggtcta tctgggccga 3000

ggacttgcat ttctggtcca cacgcacctt gcttcctcca agaatggctt tggccgactc 3060

cacgaccttg gcggtcatct tcccctcctc ccaccagatc accatcttgt cgacgcaatg 3120

gtaaaaggaa agttctcatt gg 3142

<210> 26

<211> 3075

<212> DNA

<213> novel AAV serotype, clone H2

<400> 26

tgagaacttt cctttcaacg attgcgtcgg acaagatggt gatctggtgg gaggagggga 60

agatgaccgc caaggtcgtg gagtcggcca aagccattct tggaggaagc aaggtgcgtg 120

tggaccagaa atgcaagtcc tcggcccaga tagacccgac tcccgtgatc gtcacctcca 180

acaccaacat gtgcgccgtg attgacggga actcaacgac cttcgagcac cagcagccgt 240

tgcaagaccg gatgttcaaa tttgaactta cccgccgtct ggatcatgac tttggaaagg 300

tcaccaagca ggaagtgaaa gactttttcc ggtgggcaaa ggatcacgtg gttgaggtgg 360

agcatgaatt ctacgtcaaa aagggtggag ctaagaaaag acccgccccc agtgacgcag 420

atataagtga gcccaaacgg gcgcgcgagt cagttgcgca gccatcaacg tcagacgcgg 480

aagcttcgat caactacgcg gacaggtacc aaaaacaaat gttctcgtca cgtgggcatg 540

aatctgatgc tgtttccctg cagacaatgc gagagaatga atcagaattc aaatatctgc 600

ttcactcacg gacagaaaga ctgtttagag tgctttcccg tgtcagaatc tcaacccgtt 660

tctgtcgtca aaaaggcgta tcagaaactg tgctacattc atcatatcat gggaaaggtg 720

ccagacgctt gcactgcctg cgatctggtc aatgtggatt tggatgactg catctctgaa 780

caataaatga tttaaatcag gtatggctgc cgatggttat cctccagatt ggctcgagga 840

cactctctct gaagggataa gacagtggtg gaagctcaaa cctggcccac caccaccaaa 900

gcccgcagag cggcataagg acgacagcag gggtcttgtg cttcctgggt acaagtacct 960

cggacccttc aacggactcg acaaggggga gccggtcaac gaggcagacg ccgcggccct 1020

cgagcacgac aaggcctacg accggcagct cgacagcgga gacaacccgt acctcaagta 1080

caaccacgcc gacgcagagt ttcaggagcg ccttaaagaa gatacgtctt ttgggggcaa 1140

cctcggacga gcagtcttcc aggcgaaaaa gagggttctt gaacctctgg gcctggttga 1200

ggaacctgtt aagacggctc cgggaaaaaa gaggccggta gagcactctc ctgtggagcc 1260

agactcctcc tcgggaaccg gaaaagcggg ccagcggcct gcaagaaaaa gattaaattt 1320

tggtcagact ggagacgcag actccgtacc tgacccccag cctctcggac agccaccagc 1380

agccccctct ggtctgggat ctactacaat ggctacaggc agtggcgcac caatggcaga 1440

caataacgag ggtgccgatg gagtgggtaa ttcctcagga aattggcatt gcgattccca 1500

atggctgggc gacagagtca tcaccaccag cacccgaacc tgggccctgc ccacatacaa 1560

caaccacctc tacaagcaaa tctccagcca atcaggagcc agcaacgaca accactactt 1620

tggctacagc accccctggg ggtattttga cttcaacaga ttccactgcc acttttcacc 1680

acgtgactgg caaagactca tcaacaacaa ctggggattc cggcccaaaa gactcaactt 1740

caagctcttt aatattcaag tcaaagaggt cacgcagaat gacggtacga cgacgattgc 1800

caataacctt accagcacgg ttcaggtgtt tactgactcg gagtaccagc tcccgtacgt 1860

cctgggctcg gcgcatcaag gatgcctccc gccgtttcca gcggacgtct tcatggtccc 1920

acagtatgga tacctcaccc tgaacaacgg gagtcaggcg gtaggacgct cttcctttta 1980

ctgcctggag tactttcctt ctcagatgct gcgtactgga aacaactttc agttcagcta 2040

cacttttgaa gacgtgcctt tccacagcag ctacgctcac agccagagtc tggatcggct 2100

gatgaatcct ctgatcgacc agtacctgta ttatctgaac aagacacaaa caaatagtgg 2160

aactcttcag cagtctcggc tactgtttag ccaagctgga ccaaccaaca tgtctcttca 2220

agctaaaaac tggctgcctg gaccttgcta cagacagcag cgtctgtcaa aacaggcaaa 2280

cgacaacaac aacagcaact ttccctggac tgcagctaca aagtatcatc taaatggccg 2340

ggactcgttg gttaatccag gaccagctat ggccagtcac aaggatgacg aagaaaagtt 2400

tttccccatg catggaaccc tgatatttgg taaacaagga acaaatgcca acgacgcgga 2460

tttggaaaat gtcatgatta cagatgaaga agaaatcagg gccaccaatc ccgtggctac 2520

ggagcagtac gggactgtgt caaataattt gcaaaactca aacactggtc caactactgg 2580

aactgtcaat cgccaaggag cgttacctgg tatggtgtgg caggatcgag acgtgtacct 2640

gcagggaccc atttgggcca agattcctca caccgatgga cactttcatc cttctccact 2700

gatgggaggt tttggactca aacacccgcc tcctcagatc atgatcaaaa acactcccgt 2760

tccagccaat cctcccacaa acttcagttc tgccaagttt gcttctttca tcacacagta 2820

ttccacggga caggtcagcg tggagatcga gtgggagctg cagaaggaga acagcaaacg 2880

ctggaatccc gaaattcagt acacttccaa ctacaacaag tctgttaatg tggactttac 2940

tgtggacact aatggtgtgt attcagagcc tcgccccatt ggcaccagat acctgactcg 3000

taatctgtaa ttgcttgtta atcaataaac cgtttaattc gtttcagttg aactttggtc 3060

tctgcgaagg gcgaa 3075

<210> 27

<211> 3128

<212> DNA

<213> 42.8

<400> 27

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgcgtgga ccaaaagtgc aagtcttccg 180

cccagatcga tcccaccccc gtgatcgtca cttccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttaca agaccggatg ttcaaatttg 300

aactcacccg ccgtctggag cacgactttg gcaaggtgac aaagcaggaa gtcaaagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttctac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggataa aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

agacatgcga gagaatgaat cagaatttca acatttgctt cacgcacggg accagagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt cgtcagaaag aggacgtatc 720

ggaaactctg tgccattcat catctgctag ggcgggctcc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggatgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggctcgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaaggggg agcccgtcaa cgcggcggac gcagcggccc tcgagcacga caaggcctac 1080

gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc cgacgccgag 1140

tttcaggagc gtctgcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagaccggt agagccatca ccccagcgtt ctccagactc ctctacgggc 1320

atcggcaaga caggccagca gcccgcgaaa aagagactca actttgggca gactggcgac 1380

tcagagtcag tgcccgaccc tcaaccaatc ggagaacccc ccgcaggccc ctctggtctg 1440

ggatctggta caatggctgc aggcggtggc gctccaatgg cagacaataa cgaaggcgcc 1500

gacggagtgg gtagttcctc aggaaattgg cattgcgatt ccacatggct gggcgacaga 1560

gtcatcacca ccagcacccg aacctgggcc ctccccacct acaacaacca cctctacaag 1620

caaatctcca acgggacatc gggaggaagc accaacgaca acacctactt cggctacagc 1680

accccctggg ggtattttga ctttaacaga ttccactgcc acttctcacc acgtgactgg 1740

cagcgactca tcaacaacaa ctggggattc cggcccaaga gactcaactt caagctcttc 1800

aacatccagg tcaaggaggt cacgcagaat gaaggcacca agaccatcgc caataacctt 1860

accagcacga ttcaggtctt tacggactcg gaataccagc tcccgtacgt cctcggctct 1920

gcgcaccagg gctgcctgcc tccgttcccg gcggacgtct tcatgattcc tcagtacggg 1980

tacctgactc tgaacaacgg cagtcaggcc gtgggccgtt cctccttcta ctgcctggag 2040

tactttcctt ctcaaatgct gagaacgggc aacaactttg agttcagcta ccagtttgag 2100

gacgtgcctt ttcacagcag ctacgcgcac agccaaagcc tggaccggct gatgaacccc 2160

ctcatcgacc agtacctgta ctacctgtct cggactcagt ccacgggagg taccgcagga 2220

actcagcagt tgctattttc tcaggccggg cctaataaca tgtcggctca ggccaaaaac 2280

tggctacccg ggccctgcta ccggcagcaa cgcgtctcca cgacactgtc gcaaaataac 2340

aacagcaact ttgcttggac cggtgccacc aagtatcatc tgaatggcag agactctctg 2400

gtaaatcccg gtgtcgctat ggcaacgcac aaggacgacg aagagcgatt ttttccatcc 2460

agcggagtct tgatgtttgg gaaacaggga gctggaaaag acaacgtgga ctatagcagc 2520

gttatgctaa ccagtgagga agaaatcaaa accaccaacc cagtggccac agaacagtac 2580

ggcgtggtgg ccgataacct gcaacagcaa aacgccgctc ctattgtagg ggccgtcaac 2640

agtcaaggag ccttacctgg catggtctgg cagaaccggg acgtgtacct gcagggtcct 2700

atctgggcca agattcctca cacggacggc aactttcatc cttcgccgct gatgggaggc 2760

tttggactga aacacccgcc tcctcagatc ctgattaaga atacacctgt tcccgcggat 2820

cctccaacta ccttcagtca agccaagctg gcgtcgttca tcacgcagta cagcaccgga 2880

caggtcagcg tggaaattga atgggagctg cagaaagaga acagcaagcg ctggaaccca 2940

gagattcagt atacttccaa ctactacaaa tctacaaatg tggactttgc tgtcaatact 3000

gagggtactt attcagagcc tcgccccatt ggcacccgtt acctcacccg taacctgtaa 3060

ttgcctgtta atcaataaac cggctaattc gtttcagttg aactttggtc tctgcgaagg 3120

gcgaattc 3128

<210> 28

<211> 3128

<212> DNA

<213> novel AAV serotype, clone 42.15

<400> 28

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgcgtgga ccaaaagtgc aagtcgtccg 180

cccagatcga ccccaccccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttgca ggaccggatg ttcaaatttg 300

aactcacccg ccgtctggag catgactttg gcaaggtgac aaagcaggaa gtcaaagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttctac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggataa aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

agacatgcga gagaatgaat cagaatttca acatttgctt cacgcgcggg accagagact 660

gttcagaatg tttcccgggc gtgtcagaat ctcaaccggt cgtcagaaag aggacgtatc 720

ggaaactctg tgccattcat catctgctgg ggcgggctcc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggatgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggctcgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaaggggg agcccgtcaa cgcggcggac gcagcggccc tcgagcacga caaggcctac 1080

gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc cgacgccgag 1140

tttcaggagc gtctgcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagaccggt agagccatca ccccagcgtt ctccagactc ctctacgggc 1320

atcggcaaga caggccagca gcccgcgaaa aagagactca actttgggca gactggcgac 1380

tcagagtcag tgcccgaccc tcaaccaatc ggagaacccc ccgcaggccc ctctggtctg 1440

ggatctggta caatggctgc aggcggtggc gctccaatgg cagacaataa cgaaggcgcc 1500

gacggagtgg gtagttcctc aggaaattgg cattgcgatt ccacatggct gggcgacaga 1560

gtcatcacca ccagcacccg aacctgggcc ctccccacct acaacaacca cctctacaag 1620

caaatctcca acgggacatc gggaggaagc accaacgaca acacctactt cggctacagc 1680

accccctggg ggtattttga ctttaacaga ttccactgcc acttctcacc acgtgactgg 1740

cagcgactca tcaacaacaa ctggggattc cggcccaaga gactcaactt caagctcttc 1800

aacatccagg tcaaggaggt cacgcagaat gaaggcacca agaccatcgc caataacctt 1860

accagcacga ttcaggtctt tacggactcg gaataccagc tcccgtacgt cctcggctct 1920

gcgcaccagg gctgcccgcc tccgttcccg gcggacgtct tcatgattcc tcagtacggg 1980

tacctgactc tgaacaacgg cagtcaggcc gtgggccgtt cctccttcta ctgcctggag 2040

tactttcctt ctcaaatgcg gagaacgggc aacaactttg agttcagcta ccagtttgag 2100

gacgtgcctt ttcacagcag ctacgcgcat agccaaagcc tggaccggct gatgaacccc 2160

ctcatcgacc agtacctgta ctacctgtct cggactcagt ccacgggagg taccgcagga 2220

actcagcagt tgctattttc tcaggccggg cctaataaca tgtcggctca ggccaaaaac 2280

tggctacccg ggccctgcta ccggcagcaa cgcgtctcca cgacactgtc gcaaaataac 2340

aacagcaact ttgcttggac cggtgccacc aagtatcatc tgaatggcag agactctctg 2400

gtaaatcccg gtgtcgctat ggcaacgcac aaggacgacg aagagcgatt ttttccatcc 2460

agcggagtct tgatgtttgg gaaacaggga gctggaaaag acaacgtgga ctatagcagc 2520

gttatgctaa ccagtgagga agaaatcaaa accaccaacc cagtggccac agaacagtac 2580

ggcgtggtgg ccgataacct gcaacagcaa aacgccgctc ctattgtagg ggccgtcaac 2640

agtcaaggag ccttacctgg catggtctgg cagaaccggg acgtgtacct gcagggtcct 2700

atctgggcca agattcctca cacggacggc aactttcatc cttcgccgct gatgggaggc 2760

tttggactga aacacccgcc tcctcagatc ctgattaaga atacacctgt tcccgcggat 2820

cctccaacta ccttcagtca agccaagctg gcgtcgttca tcacgcagta cagcaccgga 2880

caggtcagcg tggaaattga atgggagctg cagaaagaga acagcaagcg ctggaaccca 2940

gagattcagt atacttccaa ctactacaaa tctacaaatg tggactttgc tgtcaatact 3000

gagggtactt attcagagcc tcgccccatt ggcacccgtt acctcacccg taacctgtaa 3060

ttgcctgtta atcaataaac cggttaattc gtttcagttg aactttggtc tctgcgaagg 3120

gcgaattc 3128

<210> 29

<211> 3197

<212> DNA

<213> novel AAV serotype clone 42.5b

<400> 29

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgcgtgga ccaaaagtgc aagtcgtccg 180

cccagatcga ccccaccccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttaca agaccggatg ttcaaatttg 300

aactcacccg ccgtctggag cacgactttg gcaaggtgac aaagcaggaa gtcaaagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttctac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggataa aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

agacatgcga gagaatgaat cagaatttca acatttgctt cacgcacggg accagagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt cgtcagaaag aggacgtatc 720

ggaaactctg tgccattcat catctgctgg ggcgggctcc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggatgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggctcgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaagggag agccggtcaa cgaggcagac gccgcggccc tcgagcacga caaggcctac 1080

gacaagcagc tcgagcaggg ggacaacccg tacctcaagt acaaccacgc cgacgccgag 1140

tttcaggagc gtcttcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagaccggt agagccatca ccccagcgtt ctccagactc ctctacgggc 1320

atcggcaaga caggccagca gcccgcgaaa aagagactca actttgggca gactggcgac 1380

tcagagtcag tgcccgaccc tcaaccaatc ggagaacccc ccgcaggccc ctctggtctg 1440

ggatctggta caatggctgc aggcggtggc gctccaatgg cagacaataa cgaaggcgcc 1500

gacggagtgg gtagttcctc aggaaattgg cattgcgatt ccacatggct gggcgacaga 1560

gtcatcacca ccagcacccg aacctgggcc ctccccacct acaacaacca cctctacaag 1620

caaatctcca acgggacatc gggaggaagc accaacgaca acacctactt cggctacagc 1680

accccctggg ggtattttga ctttaacaga ttccactgcc acttctcacc acgtgactgg 1740

cagcgactca tcaacaacaa ctggggattc cggcccaaga gactcaactt caagctcttc 1800

aacatccagg tcaaggaggt cacgcagaat gaaggcacca agaccatcgc caataacctt 1860

accagcacga ttcaggtctt tacggactcg gaataccagc tcccgtacgt cctcggctct 1920

gcgcaccagg gctgcctgcc tccgttcccg gcggacgtct tcatgattcc tcagtacggg 1980

tacctgactc tgaacaacgg cagtcaggcc gtgggccgtt cctccttcta ctgcctggag 2040

tactttcctt ctcaaatgct gagaacgggc aacaactttg agttcagcta ccagtttgag 2100

gacgtgcctt ttcacagcag ctacgcgcac agccaaagcc tggaccggct gatgaacccc 2160

ctcatcgacc agtacctgta ctacctgtct cggactcagt ccacgggagg taccgcagga 2220

actcagcagt tgctattttc tcaggccggg cctaataaca tgtcggctca ggccaaaaac 2280

tggctacccg ggccctgcta ccggcagcaa cgcgtctcca cgacactgtc gcaaaataac 2340

aacagcaact ttgcttggac cggtgccacc aagtatcatc tgaatggcag agactctctg 2400

gtaaatcccg gtgtcgctat ggcaacgcac aaggacgacg aagagcgatt ttttccatcc 2460

agcggagtct tgatgtttgg gaaacaggga gctggaaaag acaacgtgga ctatagcagc 2520

gttatgctaa ccagtgagga agaaatcaaa accaccaacc cagtggccac agaacagtac 2580

ggcgtggtgg ccgataacct gcaacagcaa aacgccgctc ctattgtagg ggccgtcaac 2640

agtcaaggag ccttacctgg catggtctgg cagaaccggg acgtgtacct gcagggtcct 2700

atctgggcca agattcctca cacggacggc aactttcatc cttcgccgct gatgggaggc 2760

tttggactga aacacccgcc tcctcagatc ctgattaaga atacacctgt tcccgcggat 2820

cctccaacta ccttcagtca agccaagctg gcgtcgttca tcacgcagta cagcaccgga 2880

caggtcagcg tggaaattga atgggagctg cagaaagaga acagcaagcg ctggaaccca 2940

gagattcagt atacttccaa ctactacaaa tctacaaatg tggactttgc tgtcaatact 3000

gagggtactt attcagagcc tcgccccatt ggcacccgtt acctcacccg taacctgtaa 3060

ttgcctgtta atcaataaac cggttaattc gtttcagttg aactttggtc tctgcgaagg 3120

gcgaattcgt ttaaacctgc aggactagtc cctttagtga gggttaattc tgagcttggc 3180

gtaatcatgg gtcatag 3197

<210> 30

<211> 2501

<212> DNA

<213> novel AAV serotype, clone 42.1b

<400> 30

gaattcgccc ttggctgcgt caactggacc aatgagaact ttcccttcaa cgattgcgtc 60

gacaagatgg tgatctggtg ggaggagggc aagatgacgg ccaaggtcgt ggagtccgcc 120

aaggccattc atcatctgct ggggcgggct cccgagattg cttgctcggc ctgcgatctg 180

gtcaacgtgg acctggatga ctgtgtttct gagcaataaa tgacttaaac caggtatggc 240

tgccgatggt tatcttccag attggctcga ggacaacctc tctgagggca ttcgcgagtg 300

gtgggacttg agacctggag ccccgaaacc caaagccaac cagcaaaagc aggacgacgg 360

ccggggtctg gtgcttcctg gctacaagta cctcggaccc ttcaacggac tcgacaaggg 420

agagccggtc aacgaggcag acgccgcggc cctcgagcac gacaaggcct acgacaagca 480

gctcgagcag ggggacaacc cgtacctcaa gtacaaccac gccgacgccg agtttcagga 540

gcgtcttcaa gaagatacgt cttttggggg caacctcggg cgagcagtct tccaggccaa 600

gaagcgggtt ctcgaacctc tcggtctggt tgaggaaggc gctaagacgg ctcctggaaa 660

gaagagaccc atagaatccc ccgactcctc cacgggcatc ggcaagaaag gccagcagcc 720

cgctaaaaag agactcaact ttgggcagac tggcgactca gagtcagtgc ccgaccctca 780

accaatcgga gaaccccccg caggcccctc tggtctggga tctggcacaa tggctgcagg 840

cggtggcgct ccaatggcag acaataacga aggcgccgac ggagtgggta gttcctcagg 900

aaattggcat tgcgattcca catggctggg cgacagagtc atcaccacca gcacccgaac 960

ctgggccctc cccacctaca acaaccacct ctacaagcaa atctccaacg ggacatcggg 1020

aggaagcacc aacgacaaca cctacttcgg ctacagcacc ccctgggggt attttgactt 1080

taacagattc cactgccact tctcaccacg tgactggcag cgactcatca acaacaactg 1140

gggattccgg cccaagagac tcaacttcaa gctcttcaac atccaggtca aggaggtcac 1200

gcagaatgaa ggcaccaaga ccatcgccaa taaccttacc agcacgattc aggtctttac 1260

ggactcggaa taccagctcc cgtacgtcct cggctctgcg caccagggct gcctgcctcc 1320

gttcccggcg gacgtcttca tgattcctca gtacgggtac ctgactctga acaacggcag 1380

tcaggccgtg ggccgttcct ccttctactg cctggagtac tttccttctc aaatgctgag 1440

aacgggcaac aactttgagt tcagctacca gtttgaggac gtgccttttc acagcagcta 1500

tgcgcacagc caaagcctgg accggctgat gaaccccctc atcgaccagt acctgtacta 1560

cctgtctcgg actcagtcca cgggaggtac cgcaggaact cagcagttgc tattttctca 1620

ggccgggcct aataacatgt cggctcaggc caaaaactgg ctacccgggc cctgctaccg 1680

gcagcaacgc gtctccacga cagtgtcgca aaataacaac agcaactttg cttggaccgg 1740

tgccaccaag tatcatctga atggcagaga ctctctggta aatcccggtg tcgctatggc 1800

aacgcacaag ggcgacgaag agcgattttt tccatccagc ggagtcttga tgtttgggaa 1860

acagggagct ggaaaagaca acgtagacta tagcagcgtt atgctaacca gtgaggaaga 1920

aatcaaaacc accaacccag tggccacaga acagtacggc gtggtggccg ataacctgca 1980

acagcaaaac gccgctccta ttgtaggggc cgtcaacagt caaggagcct tacctggcat 2040

ggtctggcag aaccgggacg tgtacctgca gggtcctatc tgggccaaga ttcctcacac 2100

ggacggcaac tttcatcctt cgccgctgat gggaggcttt ggactgaaac acccgcctcc 2160

tcagatcctg attaagaata cacctgttcc cgcggatcct ccaactacct tcagtcaagc 2220

caagctggcg tcgttcatca cgcagtacag caccggacag gtcagcgtgg aaattgaatg 2280

ggagctgcag aaagagaaca gcaagcgctg gaacccagag attcagtata cttccaacta 2340

ctacaaatct acaaatgtgg actttgctgt caatactgag ggtacttatt cagagcctcg 2400

ccccattggc acccgttacc tcacccgtaa cctgtaattg cctgttaatc aataaaccgg 2460

ttgattcgtt tcagttgaac tttggtctca agggcgaatt c 2501

<210> 31

<211> 3113

<212> DNA

<213> novel AAV serotype, clone 42.13

<400> 31

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgcgtgga ccaaaagtgc aagtcgtccg 180

cccagatcga tcccaccccc gtgatcgtca cttccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttaca agaccggatg ttcaaatttg 300

aactcacccg ccgtctggag catgactttg gcaaggtgac aaagcaggaa gtcaaagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttctac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggataa aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

agacatgcga gagaatgaat cagaatttca acatttgctt cacgcacggg accagagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt cgtcagaaag aggacgtatc 720

ggaaactctg tgccattcat catctgctgg ggcgggctcc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggatgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggctcgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaaggggg agcccgtcaa cgcggcggac gcagcggccc tcgagcacga caaggcctac 1080

gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc cgacgccgag 1140

tttcaggagc gtcttcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagacccat agaatccccc gactcctcca cgggcatcgg caagaaaggc 1320

cagcagcccg ctaaaaagaa gctcaacttt gggcagactg gcgactcaga gtcagtgccc 1380

gaccctcaac caatcggaga accccccgca ggcccctctg gtctgggatc tggtacaatg 1440

gctgcaggcg gtggcgctcc aatggcagac aataacgaag gcgccgacgg agtgggtagt 1500

tcctcaggaa attggcattg cgattccaca tggctgggcg acagagtcat caccaccagc 1560

acccgaacct gggccctccc cacctacaac aaccacctct acaagcaaat ctccaacggg 1620

acatcgggag gaagcaccaa cgacaacacc tacttcggct acagcacccc ctgggggtat 1680

tttgacttta acagattcca ctgccacttc tcaccacgtg actggcagcg actcatcaac 1740

aacaactggg gattccggcc caagagactc aacttcaagc tcttcaacat ccaggtcaag 1800

gaggtcacgc agaatgaagg caccaagacc atcgccaata accttaccag cacgattcag 1860

gtctttacgg actcggaata ccagctcccg tacgtcctcg gctctgcgca ccagggctgc 1920

ctgcctccgt tcccggcgga cgtcttcatg attcctcagt acgggtacct gactctgaac 1980

aacggcagtc aggccgtggg ccgttcctcc ttctactgcc tggagtactt tccttctcaa 2040

atgctgagaa cgggcaacaa ctttgagttc agctaccagt ttgaggacgt gccttttcac 2100

agcagctatg cgcacagcca aagcctggac cggctgatga accccctcat cgaccagtac 2160

ctgtactacc tgtctcggac tcagtccacg ggaggtaccg caggaactca gcagttgcta 2220

ttttctcagg ccgggcctaa taacatgtcg gctcaggcca aaaactggct acccgggccc 2280

tgctaccggc agcaacgcgt ctccacgaca gtgtcgcaaa ataacaacag caactttgct 2340

tggaccggtg ccaccaagta tcatctgaat ggcagagact ctctggtaaa tcccggtgtc 2400

gctatggcaa cgcacaaggg cgacgaagag cgattttttc catccagcgg agtcttgatg 2460

tttgggaaac agggagctgg aaaagacaac gtggactata gcagcgttat gctaaccagt 2520

gaggaagaaa tcaaaaccac caacccagtg gccacagaac agtacggcgt ggtggccgat 2580

aacctgcaac agcaaaacgc cgctcctatt gtaggggccg tcaacagtca aggagcctta 2640

cctggcatgg tctggcagaa ccgggacgtg tacctgcagg gtcctatctg ggccaagatt 2700

cctcacacgg acggcaactt tcatccttcg ccgctgatgg gaggctttgg actgaaacac 2760

ccgcctcctc agatcctgat taagaataca cctgttcccg cggatcctcc aactaccttc 2820

agtcaagcca agctggcgtc gttcatcacg cagtacagca ccggacaggt cagcgtggaa 2880

attgaatggg agctgcagaa agagaacagc aagcgctgga acccagagat tcagtatact 2940

tccaactact acaaatctac aaatgtggac tttgctgtca atactgaggg tacttattca 3000

gagcctcgcc ccattggcac ccgttacctc acccgtagcc tgtaattgcc tgttaatcaa 3060

taaaccggtt gattcgtttc agttgaactt tggtctctgc gaagggcgaa ttc 3113

<210> 32

<211> 3113

<212> DNA

<213> novel AAV serotype, clone 42.3a

<400> 32

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgcgtgga ccaaaagtgc aagtcgtccg 180

cccagatcga tcccaccccc gtgatcgtca cttccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttaca agaccggatg ttcaaatttg 300

aactcacccg ccgtctggag catgactttg gcaaggtgac aaagcaggaa gtcaaagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttctac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggataa aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg cttccctgca 600

agacatgcga gagaatgaat cagaatttca gcatttgctt cacgcacggg accagagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt cgtcagaaag aggacgtatc 720

ggaaactctg tgccattcat catctgctgg ggcgggctcc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggatgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtca tcttccagat tggctcgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaaggggg agcccgtcaa cgcggcggac gcagcggccc tcgagcacga caaggcctac 1080

gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc cgacgccgag 1140

tttcaggagc gtcttcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagacccat agaatccccc gactcctcca cgggcatcgg caagaaaggc 1320

cagcagcccg ctaaaaagaa gctcaacttt gggcagactg gcgactcaga gtcagtgccc 1380

gaccctcaac caatcggaga accccccgca ggcccctctg gtctgggatc tggtacaatg 1440

gctgcaggcg gtggcgctcc aatggcagac aataacgaag gcgccgacgg agtgggtagt 1500

tcctcaggaa attggcattg cgattccaca tagctgggcg acagagtcat caccaccagc 1560

acccgaacct gggccctccc cacctacaac aaccacctct acaagcaaat ctccaacggg 1620

acatcgggag gaagcaccaa cgacaacacc tacttcggct acagcacccc ctgggggtat 1680

tttgacttta acagattcca ctgccacttc tcaccacgtg actggcagcg actcatcaac 1740

aacagctggg gattccggcc caagagactc aacttcaagc tcttcaacat ccaggtcaag 1800

gaggtcacgc agaatgaagg caccaagacc atcgccaata accttaccag cacgattcag 1860

gtctttacgg actcggaata ccagctcccg tacgtcctcg gctctgcgca ccagggctgc 1920

ctgcctccgt tcccggcgga cgtcttcatg attcctcagt acgggtacct gactctgaac 1980

aacggcagtc aggccgtggg ccgttcctcc ttctactgcc tggagtactt tccttctcaa 2040

atgctgagaa cgggcaacaa ctttgagttc agctaccagt ttgaggacgt gccttttcac 2100

agcagctacg cgcacagcca aagcctggac cggctgatga accccctcat cgaccagtac 2160

ctgtactacc tgtctcggac tcagtccacg ggaggtaccg caggaactca gcagttgcta 2220

ttttctcagg ccgggcctaa taacatgtcg gctcaggcca aaaactggct acccgggccc 2280

tgctaccggc agcaacgcgt ctccacgaca ctgtcgcaaa ataacaacag caactttgct 2340

tggaccggtg ccaccaagta tcatctgaat ggcagagact ctctggtaaa tcccggtgtc 2400

gctatggcaa cgcacaagga cgacgaagag cgattttttc catccagcgg agtcttgatg 2460

tttgggaaac agggagctgg aaaagacaac gtggactata gcagcgttat gctaaccagt 2520

gaggaagaaa tcaaaaccac caacccagtg gccacagaac agtacggcgt ggtggccgat 2580

aacctgcaac agcaaaacgc cgctcctatt gtaggggccg tcaacagtca aggagcctta 2640

cctggcatgg tctggcagaa ccgggacgtg tacctgcagg gtcctatctg ggccaagatt 2700

cctcacacgg acggcaactt tcatccttcg ccgctgatgg gaggctttgg actgaaacac 2760

ccgcctcctc agatcctgat taagaataca cctgttcccg cggatcctcc aactaccttc 2820

agtcaagcca agctggcgtc gttcatcacg cagtacagca ccggacaggt cagcgtggaa 2880

attgaatggg agctgcagaa agagaacagc aagcgctgga acccagagat tcagtatact 2940

tccaactact acaaatctac aaatgtggac tttgctgtca atactgaggg tacttattca 3000

gagcctcgcc ccattggcac ccgttacctc acccgtaacc tgtaattgcc tgttaatcaa 3060

taaaccggtt aattcgtttc agttgaactt tggtctctgc gaagggcgaa ttc 3113

<210> 33

<211> 2504

<212> DNA

<213> novel AAV serotype, clone 42.4

<400> 33

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattcatcat ctgctggggc gggctcccga gattgcttgc tcggcctgcg 180

atctggtcaa cgtggacctg gatgactgtg tttctgagca ataaatgact taaaccaggt 240

atggctgccg atggttatct tccagattgg ctcgaggaca acctctctga gggcattcgc 300

gagtggtggg acttgaaacc tggagccccg aaacccaaag ccaaccagca aaagcaggac 360

gacggccggg gtctggtgct tcctggctac aagtacctcg gacccttcaa cggactcgac 420

aagggagagc cggtcaacga ggcagacgcc gcggccctcg agcacgacaa ggcctacgac 480

aagcagctcg agcaggggga caacccgtac ctcaagtaca accacgccga cgccgagttt 540

caggagcgtc ttcaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 600

gccaagaagc gggttctcga acctctcggt ctggttgagg aaggcgctaa gacggctcct 660

ggaaagaaga gacccataga atcccccgac tcctccacgg gcatcggcaa gaaaggccag 720

cagcccgcta aaaagaagct caactttggg cagactggcg actcagagtc agtgcccgac 780

cctcaaccaa tcggagaacc ccccgcaggc ccctctggtc tgggatctgg tacaatggct 840

gcaggcggtg gcgctccaat ggcagacaat aacgaaggcg ccgacggagt gggtaatgcc 900

tccggaaatt ggcattgcga ttccacatgg ctgggcgaca gagtcatcac caccagcacc 960

cgcacctggg ccctgcccac ctacaacaac cacctctaca agcagatatc aagtcagagc 1020

ggggctacca acgacaacca cttcttcggc tacagcaccc cctggggcta ttttgacttc 1080

aacagattcc actgccactt ctcatcacgt gactggcagc gactcatcaa caacaactgg 1140

ggattccggc ccaagagact caacttcaag ctcttcaaca tccaggtcaa ggaggtcacg 1200

cagaatgaag gcaccaagac catcgccaat aaccttacca gcacgattca ggtctttacg 1260

gactcggaat accggctccc gtacgtcctc ggctctgcgc accagggctg cctgcctccg 1320

ttcccggcgg acgtcttcat gattcctcag tacgggtacc tgactctgaa caacggcagt 1380

caggccgtgg gccgttcctc cttctactgc ctggagtact ttccttctca aatgctgaga 1440

acgggcaaca actttgagtt cagctaccag tttgaggacg tgccttttca cagcagctac 1500

gcgcacagcc aaagcctgga ccggctgatg aaccccctca tcgaccagta cctgtactac 1560

ctgtctcgga ctcagtccac gggaggtacc gcaggaactc agcagttgct attttctcag 1620

gccgggccta ataacatgtc ggctcaggcc aaaaactggc tacccgggcc ctgctaccgg 1680

cagcaacgcg tctccacgac actgtcgcaa aataacaaca gcaactttgc ttggaccggt 1740

gccaccaagt atcatctgaa tggcagagac tctctggtaa atcccggtgt cgctatggca 1800

acgcacaagg acgacgaaga gcgatttttt ccatccagcg gagtcttgat gtttgggaaa 1860

cagggagctg gaaaagacaa cgtggactat agcagcgtta tgctaaccag tgaggaagaa 1920

atcaaaacca ccaacccagt ggccacagaa cagtacggcg tggtggccga taacctgcaa 1980

cagcaaaacg ccgctcctat tgtaggggcc gtcaacagtc aaggagcctt acctggcatg 2040

gtctggcaga accgggacgt gtacctgcag ggtcctatct gggccaagat tcctcacacg 2100

gacggcaact ttcatccttc gccgctgatg ggaggctttg gactgaaaca cccgcctcct 2160

cagatcctga ttaagaatac acctgttccc gcggatcctc caactacctt cagtcaagcc 2220

aagccggcgt cgttcatcac gcagtacagc accggacagg tcagcgtgga aattgaatgg 2280

gagctgcaga aagagaacag caagcgctgg aacccagaga ttcagtatac ttccaactac 2340

tacaaatcta caaatgtgga ctttgctgtc aatactgagg gtacttattc agagcctcgc 2400

cccattggca cccgttacct cacccgtaac ctgtaattgc ctgttaatca ataaaccggt 2460

taattcgttt cagttgaact ttggtctctg cgaagggcga attc 2504

<210> 34

<211> 3106

<212> DNA

<213> novel AAV serotype, clone 42.5a

<400> 34

gaattcgccc ttctacggct gcgtcaactg gaccaatgag aactttccct tcaacgattg 60

cgtcgacaag atggtgatct ggtgggagga gggcaagatg acggccaagg tcgtggagtc 120

cgccaaggcc attctcggcg gcagcaaggt gcgcgtggac caaaagtgca agtcgtccgc 180

ccagatcgac cccacccccg tgatcgtcac ctccaacacc aacatgtgcg ccgtgattga 240

cgggaacagc accaccttcg agcaccagca gccgttgcag gaccggatgt tcaaatttga 300

actcacccgc cgtctggagc atgactttgg caaggcgaca aagcaggaag tcaaagagtt 360

cttccgctgg gcgcaggatc acgtgaccga ggtggcgcat gagttctacg tcagaaaggg 420

tggagccaac aagagacccg cccccgatga cgcggataaa agcgagccca agcgggcccg 480

cccctcagtc gcggatccat cgacgtcaga cgcggaagga gctccggtgg actttgccga 540

caggtaccaa aacaaatgtt ctcgtcacgc gggcatgctt cagatgctgt ttccctgcaa 600

aacatgcgag agaatgaatc agaatttcaa catttgcttc acgcacggga ccagagactg 660

ttcagaatgt ttccccggcg tgtcagaatc tcaaccggtc gtcagaaaga ggacgtatcg 720

gaaactctgt gccattcatc atctgctggg gcgggctccc gagattgctt gctcggcctg 780

cgatctggtc aacgtggacc tggatgactg tgtttctgag caataaatga cttaaaccag 840

gtatggctgc cgatggttat cttccagatt ggctcgagga caacctctct gagggcattc 900

gcgagtggtg ggacttgaaa cctggagccc cgaaacccaa agccaaccag caaaagcagg 960

acgacggccg gggtctggtg cttcctggct acaagtacct cggacccttc aacggactcg 1020

acaagggaga gccggtcaac gaggcagacg ccgcggccct cgagcacgac aaggcctacg 1080

acaagcagct cgagcagggg gacaacccgt acctcaagta caaccacgcc gacgccgagt 1140

ttcaggagcg tcttcaagaa gatacgtctt ttgggggcaa cctcgggcga gcagtcttcc 1200

gggccaagaa gcgggttctc gaacctctcg gtctggttga ggaaggcgct aagacggctc 1260

ctggaaagaa gagacccata gaatcccccg actcctccac gggcatcggc aagaaaggcc 1320

agcagcccgc taaaaagaag ctcaactttg ggcagactgg cgactcagag tcagtgcccg 1380

acccccaacc tctcggagaa cctcccgccg cgccctcagg tctgggatct ggtacaatgg 1440

ctgcaggcgg tggcgcacca atggcagaca ataacgaagg cgccgacgga gtgggtaatg 1500

cctccggaaa ttggcattgc gattccacat ggctgggcga cagagtcatc accaccagca 1560

cccgcacctg ggccctgccc acctacaaca accacctcta caagcagata tcaagtcaga 1620

gcggggctac caacgacaac cacttcttcg gctacagcac cccctggggc tattttgact 1680

tcaacagatt ccactgccac ttctcaccac gtgactggca gcgactcatc aacaacaacc 1740

ggggattccg gcccagaaag ctgcggttca agttgttcaa catccaggtc aaggaggtca 1800

cgacgaacga cggcgttacg accatcgcta ataaccttac cagcacgatt caggtcttct 1860

cggactcgga gtaccaactg ccgtacgtcc tcggctctgc gcaccagggc tgcctccctc 1920

cgttccctgc ggacgtgttc atgattcctc agtacggata tctgactcta aacaacggca 1980

gtcagtctgt gggacgttcc tccttctact gcctggagta ctttccttct cagatgctga 2040

gaacgggcaa taactttgaa ttcagctacc agtttgagga cgtgcccttt cacagcagct 2100

acgcgcacag ccaaagcctg gaccggctga tgaaccccct catcgaccag tacctgtact 2160

acctgtctcg gactcagtcc acgggaggta ccgcaggaac tcagcagttg ctattttctc 2220

aggccgggcc taataacatg tcggctcagg ccaaaaactg gctacccggg ccctgctacc 2280

ggcagcaacg cgtctccacg acactgtcgc aaaataacaa cagcaacttt gcttggaccg 2340

gtgccaccaa gtatcatctg aatggcagag actctctggt aaatcccggt gtcgctatgg 2400

caacgcacaa ggacgacgaa gagcgatttt ttccatccag cggagtcttg atgtttggga 2460

aacagggagc tggaaaagac aacgtggact atagcagcgt tatgctaacc agtgaggaag 2520

aaatcaaaac caccaaccca gtggccacag aacagtacgg cgtggtggcc gataacctgc 2580

aacagcaaaa cgccgctcct attgtagggg ccgtcaacag tcaaggagcc ttacctggca 2640

tggcctggca gaaccgggac gtgtacctgc agggtcctat ctgggccaag attcctcaca 2700

cggacggcaa ctttcatcct tcgccgctga tgggaggctt tggactgaaa cacccgcctc 2760

ctcagatcct gattaagaat acacctgttc ccgcggatcc tccaactacc ttcagtcaag 2820

ccaagctggc gtcgttcatc acgcagtaca gcaccggaca ggtcagcgtg gaaattgaat 2880

gggagctgca gaaagagaac agcaagcgct ggaacccaga gattcagtat acttccaact 2940

actacaaatc tacaaatgtg gactttgctg tcaatactga gggtacttat tcagagcctc 3000

gccccattgg cacccgttac ctcacccgta acctgtaatt gcctgttaat caataaaccg 3060

gttaattcgt ttcagttgaa ctttggtctc tgcgaagggc gaattc 3106

<210> 35

<211> 2489

<212> DNA

<213> novel AAV serotype, clone 42.10

<400> 35

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtgaagt 120

ccgccaaggc cattcatcat ctgctggggc gggctcccga gattgcttgc tcggcctgcg 180

atctggtcaa cgtggacctg gatgactgtg tttctgagca ataaatgact taaaccaggt 240

atggctgccg atggttatct tccagattgg ctcgaggaca acctctctga gggcattcgc 300

gagtggtggg acttgaaacc tggagccccg aaacccaaag ccaaccagca aaagcaggac 360

gacggccggg gtctggtgct tcctggctac aagtacctcg gacccttcaa cggactcgac 420

aagggagagc cggtcaacga ggcagacgcc gcggccctcg agcacgacaa ggcctacgac 480

aagcagctcg agcaggggga caacccgtac ctcaagtaca accacgccga cgccgagttt 540

caggagcgtc ttcaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 600

gccaagaagc gggttctcga acctctcggt ctggttgagg aaggcgctaa gacggctcct 660

ggaaagaaga gacccataga atcccccgac tcctccacgg gcatcggcag gaaaggccag 720

cagcccgcta aaaagaagct caactttggg cagactggcg actcagagtc agtgcccgac 780

cctcaaccaa tcggagaacc ccccgcaggc ccctctggtc tgggatctgg tacaatggct 840

gcaggcggtg gcgctccaat ggcagacaat aacgaaggcg ccgacggagt gggtaatgcc 900

tccggaaatt ggcattgcga ttccacatgg ctgggcgaca gagtcatcac caccagcacc 960

cgcacctggg ccctgcccac ctacaacaac cacctctaca agcagatatc aagtcagagc 1020

ggggctacca acgacaacca cttcttcggc tacagcaccc cctggggcta ttttgacttc 1080

aacagattcc actgccactt ctcaccacgt gactggcagc gactcatcaa caacaactgg 1140

ggattccggc ccagaaagct gcggttcaag ttgttcaaca tccaggtcaa ggaggtcacg 1200

acgaacgacg gcgttacgac catcgccaat aaccttacca gcacgattca ggtcttctcg 1260

gactcggagt accaactgcc gtacgtcctc ggctctgcgc accagggctg cctccctccg 1320

ttccctgcgg acgtgttcat gattcctcag tacggatatc tgactctaaa caacggcagt 1380

cagtctgtgg gacgttcctc cttctactgc ctggagtact ttccttctca gatgctgaga 1440

acgggcaata actttgaatt cagctacacc tttgaggaag tgcctttcca cagcagctat 1500

gcgcacagcc agagcctgga ccggctgatg aatcccctca tcgaccagta cctgtactac 1560

ctggcccgga cccagagcac tacggggtcc acaagggagc tgcagttcca tcaggctggg 1620

cccaacacca tggccgagca atcaaagaac tggctgcccg gaccctgtta tcggcagcag 1680

agactgtcaa aaaacataga cagcaacaac aacagtaact ttgcctggac cggggccact 1740

aaataccatc tgaatggtag aaattcatta accaacccgg gcgtagccat ggccaccaac 1800

aaggacgacg aggaccagtt ctttcccatc aacggagtgc tggtttttgg caaaacgggg 1860

gctgccaaca agacaacgct ggaaaacgtg ctaatgacca gcgaggagga gatcaaaacc 1920

accaatcccg tggctacaga agaatacggt gtggtctcca gcaacctgca atcgtctacg 1980

gccggacccc agacacagac tgtcaacagc cagggggctc tgcccggcat ggtctggcag 2040

aaccgggacg tgtacctgca gggtcccatc tgggccaaaa ttcctcacac ggacggcaac 2100

tttcacccgt ctcccctgat gggcggattt ggactcaaac acccgcctcc tcaaattctc 2160

atcaaaaaca ccccggtacc tgctaatcct ccagaggtgt ttactcctgc caagtttgcc 2220

tcatttatca cgcagtacag caccggccag gtcagcgtgg agatcgagtg ggaactgcag 2280

aaagaaaaca gcaaacgctg gaatccagag attcagtaca cctcaaatta tgccaagtct 2340

aataatgtgg aatttgctgt caacaacgaa ggggtttata ctgagcctcg ccccattggc 2400

acccgttacc tcacccgtaa cctgtaattg cctgttaatc aataaaccgg ttaattcgtt 2460

tcagttgaac tttggtcaag ggcgaattc 2489

<210> 36

<211> 2495

<212> DNA

<213> novel AAV serotype, clone 42.3b

<400> 36

gaattcgccc tttctacggc tgcgtcaact agaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattcatcat ctgctggggc gggctcccga gattgcttgc tcggcctgcg 180

atctggtcaa cgtggacctg gatgactgtg tttctgagca ataaatgact taaaccaggt 240

atggctgccg atggttatct tccagattgg ctcgaggaca acctctctga gggcattcgc 300

gagtggtggg acttgaaacc tggagccccg aaacccaaag ccaaccagca aaagcaggac 360

gacggccggg gtctggtgct tcctggctac aagtacctcg gacccttcaa cggactcgac 420

aagggagagc cggtcaacga ggcagacgcc gcggccctcg agcacgacaa ggcctacgac 480

aagcagctcg agcaggggga caacccgtac ctcaagtaca accacgccga cgccgagttt 540

caggagcgtc ttcaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 600

gccaagaagc gggttctcga acctctcggt ctggttgagg aaggcgctaa gacggctcct 660

ggaaagaaga gacccataga atcccccgac tcctccacgg gcatcggcaa gaaaggccag 720

cagcccgcta aaaagaagct caactttggg cagactggcg actcagagtc agtgcccgac 780

cctcaaccaa tcggagaacc ccccgcaggc ccctctggtc tgggatctgg tacaatggct 840

gcaggcggtg gcgctccaat ggcagacaat aacgaaggcg ccgacggagt gggtaatgcc 900

tccggaaatt ggcattgcga ttccacatgg ctgggcgaca gagtcatcac caccagcacc 960

cgcacctggg ccctgcccac ctacaacaac cacctctaca agcagatatc aagtcagagc 1020

ggggctacca acgacaacca cttcttcggc tacagcaccc cctggggcta ttttgacttc 1080

aacagattcc actgccactt ctcaccacgt gactggcagc gactcatcaa caacaactgg 1140

ggattccggc ccagaaagct gcggttcaag ttgttcaaca tccaggtcaa ggaggtcacg 1200

acgaacgacg gcgttacgac catcgctaat aaccttacca gcacgattca ggtcttctcg 1260

gactcggagt accaactgcc gtacgtcctc ggctctgcgc accagggctg cctccctccg 1320

ttccctgcgg acgtgttcat gattcctcag tacggatatc tgactctaaa caacggcagt 1380

cagtctgtgg gacgttcctc cttctactgc ctggagtact ttccttctca gatgctgaga 1440

acgggcaata actttgaatt cagctacacc tttgaggaag tgcctttcca cagcagctat 1500

gcgcacagcc agagcctgga ccggctgatg aatcccctca tcgaccagta cctgtactac 1560

ctggcccgga cccagagcac tacggggtcc acaagggagc tgcagttcca tcaggctggg 1620

cccaacacca tggccgagca atcaaagaac tggctgcccg gaccctgtta tcggcagcag 1680

agactgtcaa aaaacataga cagcaacaac accagtaact ttgcctggac cggggccact 1740

aaataccatc tgaatggtag aaattcatta accaacccgg gcgtagccat ggccaccaac 1800

aaggacgacg aggaccagtt ctttcccatc aacggagtgc tggtttttgg caaaacgggg 1860

gctgccaaca agacaacgct ggaaaacgtg ctaatgacca gcgaggagga gatcaaaacc 1920

accaatcccg tggctacaga acagtacggt gtggtctcca gcaacctgca atcgtctacg 1980

gccggacccc agacacagac tgtcaacagc cagggggctc tgcccggcat ggtctggcag 2040

aaccgggacg tgtacctgca gggtcccatc tgggccaaaa ttcctcacac ggacggcaac 2100

tttcacccgt ctcccctgat gggcggattt ggactcaaac acccgcctcc tcaaattctc 2160

atcaaaaaca ccccggtacc tgctaatcct ccagaggtgt ttactcctgc caagtttgcc 2220

tcatttatca cgcagtacag caccggccag gtcagcgtgg agatcgagtg ggaactgcag 2280

aaagaaaaca gcaaacgctg gaatccagag attcagtaca cctcaaatta tgccaagtct 2340

aataatgtgg aatttgctgt caacaacgaa ggggtttata ctgagcctcg ccccattggc 2400

acccgttacc tcacccgtaa cctgtaattg cctgttaatc aataaaccgg ttaattcgtt 2460

tcagttgaac tttggtctct gcgaagggcg aattc 2495

<210> 37

<211> 3098

<212> DNA

<213> novel AAV serotype, clone 42.11

<400> 37

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgcgtgga ccaaaagtgc aagtcttccg 180

cccagatcga tcccaccccc gtgatcgtca cttccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttaca agaccggatg ttcaaatttg 300

aactcacccg ccgtctggag cacgactttg gcaaggtgac aaagcaggaa gtcaaagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttctac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggataa aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

agacatgcga gagaatgaat cagaatttca acatttgctt cacgcacggg accggagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt cgtcagaaag aggacgtatc 720

ggaaactctg tgccattcat catctgctgg ggcgggctcc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggatgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggctcgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaagggag agccggtcaa cgcggcggac gcagcggccc tcgagcacga caaggcctac 1080

gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc cgacgccgag 1140

tttcaggagc gtcttcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagacccat agaatccccc gactcctcca cgggcatcgg caagaaaggc 1320

cagcagcccg ctaaaaagaa gctcaacttt gggcagactg gcgactcaga gtcagtgccc 1380

gaccctcaac caatcggaga accccccgca ggcccctctg gtctgggatc tggtacaatg 1440

gctgcaggcg gtggcgctcc aatggcagac aataacgaag gcgccgacgg agtgggtaat 1500

gcctccggaa attggcattg cgattccaca tggctgggcg acagagtcat caccaccagc 1560

acccgcacct gggccctgcc cacctacaac aaccacctct acaagcagat atcaagtcag 1620

agcggggcta ccaacgacaa ccacttcttc ggctacagca ccccctgggg ctattttgac 1680

ttcaacagat tccactgcca cttctcacca cgtgactggc agcgactcat caacaacaac 1740

tggggattcc ggcccagaaa gctgcggttc aagttgttca acatccaggt caaggaggtc 1800

acgacgaacg acggcgttac gaccatcgct aataacctta ccagcacgat tcaggtcttc 1860

tcggactcgg agtaccaact gccgtacgtc ctcggctctg cgcaccaggg ctgcctccct 1920

ccgttccctg cggacgtgtt catgattcct cagtacggat atctgactct aaacaacggc 1980

agtcagtctg tgggacgttc ctccttctac tgcctggagt actttccttc tcagatgctg 2040

agaacgggca ataactttga attcagctac acctttgagg aagtgccttt ccacagcagc 2100

tatgcgcaca gccagagcct ggaccggctg atgaatcccc tcatcgacca gtacctgtac 2160

tacctggccc ggacccagag cactacgggg tccacaaggg agctgcagtt ccatcaggct 2220

gggcccaaca ccatggccga gcaatcaaag aactggctgc ccggaccctg ttatcggcgg 2280

cagagactgt caaaagacat agacagcaac aacaacagta actttgcctg gaccggggcc 2340

actaaatacc atctgaatgg tagaaattca ttaaccaacc cgggcgtagc catggccacc 2400

aacaaggacg acgaggacca gttctttccc atcaacggag tgctggtttt tggcaaaacg 2460

ggggctgcca acaagacaac gctggaaaac gtgctaatga ccagcgagga ggagatcaaa 2520

accaccaatc ccgtggctac agaagaatac ggtgtggtct ccagcaacct gcaatcgtct 2580

acggccggac cccagacaca gactgtcaac agccaggggg ctctgcccgg catggtctgg 2640

cagaaccggg acgtgtacct gcagggtccc atctgggcca aaattcctca cacggacggc 2700

aactttcacc cgtctcccct gatgggcgga tttggactca aacacccgcc tcctcaaatt 2760

ctcatcaaaa acaccccggt acctgctaat cctccagagg tgtttactcc tgccaagttt 2820

gcctcattta tcacgcagta cagcaccggc caggtcagcg tggagatcga gtgggaactg 2880

cagaaagaga acagcaaacg ctggaatcca gagattcagt acacctcaaa ttatgccaag 2940

tctaataatg tggaatttgc tgtcaacaac gaaggggttt atactgagcc tcgccccatt 3000

ggcacccgtt acctcacccg taacctgtaa ttacttgtta atcaataaac cggttgattc 3060

gtttcagttg aactttggtc tctgcgaagg gcgaattc 3098

<210> 38

<211> 3276

<212> DNA

<213> novel AAV serotype, clone 42.6a

<400> 38

gaattcgccc ttcgcagaga ccaaagttca actgaaacga attaaccggt ttattgatta 60

acaggcaatt acaggttacg ggtgaggtaa cgggtgccaa tggggcgagg ctcagtataa 120

accccttcgt tgttgacagc aaattccaca ttattagact tggcataatt tgaggtgtac 180

tgaatctctg gattccagcg tttgctgttt tctttctgca gttcccactc gatctccacg 240

ctgacctggc cggtgctgta ctgcgtgata aatgaggcaa acttggcagg agtaaacacc 300

tctggaggat tagcaggtac cggggtgttt ttgatgagaa tttgaggagg cgggtgtttg 360

agtccaaatc cgtccatcag gggagacggg tgaaagttgc cgtccgtgtg aggaattttg 420

gcccagatgg gaccctgcag gtacacgtcc cggttctgcc agaccatgcc gggcagagcc 480

ccctggctgt tgacagtctg tgtctggggt ccggccgtag acgattgcag gttgctggag 540

accacaccgt attcttctgt agccacggga ttggtggttt tgatctcctc ctcgctggtc 600

attagcacgt tttccagcgt tgtcttgttg gcagcccccg ttttgccaaa aaccagcact 660

ccgttgatgg gaaagaactg gtcctcgtcg tccttgttgg tggccatggc tacgcccggg 720

ttggttaatg aatttctacc attcagatgg tatttagtgg ccccggtcca ggcaaagtta 780

ctgttgttgt tgctgtctat gttttttgac agtctctgct gccgataaca gggtccgggc 840

agccagttct ttgattgctc ggccatggtg ttgggcccag cctgatggaa ctgcagctcc 900

cttgtggacc ccgtagtgct ctgggtccgg gccaggtagt acaggtactg gtcgatgagg 960

ggattcatca gccggtccag gctctggcta tgcgcatagc tgctgtggaa aggcacttcc 1020

tcaaaggtgt agctgaattc aaagttattg cccgttctca gcatctgaga aggaaagtac 1080

tccaggcagt agaaggagga acgtcccaca gactgactgc cgttgtttag agtcagatat 1140

ccgtactgag gaatcatgaa cacgtccgca gggaacggag ggaggcagcc ctggtgcgca 1200

gagccgagga cgtacggcag ttggtactcc gagtccgaga agacctgaat cgtgctggta 1260

aggttattag cgatggtcgt aacgccgtcg tccgtcgtga cctccttgac ctggatgttg 1320

aacaacttga accgcagctt tctgggccgg aatccccagt tgttgttgat gagtcgctgc 1380

cagtcacgtg gtgagaagtg gcagtggaat ctgttaaagt caaaataccc ccagggggtg 1440

ctgtagccga agtaggtgtt gtcgttggtg cttcctcccg atgtcccgtt ggagatttgc 1500

ttgtagaggt ggttgttgta ggtggggagg gcccaggttc gggtgctggt ggtgatgact 1560

ctgtcgccca gccatgtgga atcgcaatgc caatttcctg aggaactacc cactccgtcg 1620

gcgccttcgt tattgtctgc cattggagcg ccaccgcctg cagccattgt accagatccc 1680

agaccagagg ggcctgcggg gggttctccg attggttgag ggtcgggcac tgactctgag 1740

tcgccagtct gcccaaagtt gagtctcttt ttcgcgggct gctggcctgt cttgccgatg 1800

cccgtagagg agtctggaga acgctggggt gatggctcta ccggtctctt ctttccagga 1860

gccgtcttag cgccttcctc aaccagaccg agaggttcga gaacccgctt cttggcctgg 1920

aagactgctc gcccgaggtt gcccccaaaa gacgtatctt cttgaagacg ctcctgaaac 1980

tcggcgtcgg cgtggttgta cttgaggtac gggttgtccc cctgctcgag ctgcttgtcg 2040

taggccttgt cgtgctcgag ggccgcggcg tctgcctcgt tgaccggctc tcccttgtcg 2100

agtccgttga agggtccgag gtacttgtag ccaggaagca ccagaccccg gccgtcgtcc 2160

tgcttttgct ggttggcttt gggtttcggg gctccaggtt tcaagtccca ccactcgcga 2220

atgccctcag agaggttgtc ctcgagccaa tctggaagat aaccatcggc agccatacct 2280

ggtttaagtc atttattgct cagaaacaca gtcatccagg tccacgttga ccagatcgca 2340

ggccgagcaa gcaatctcgg gagcccgccc cagcagatga tgaatggcac agagtttccg 2400

atacgtcctc tttctgacga ccggttgaga ttctgacacg ccggggaaac attctgaaca 2460

gtctctggtc ccgtgcgtga agcaaatgtt gaaattctga ttcattctct cgcatgtctt 2520

gcagggaaac agcatctgaa gcatgcccgc gtgacgagaa cacttgtttt ggtacctgtc 2580

ggcaaagtcc accggagctc cttccgcgtc tgacgtcgat ggatgcaaaa tgtcgcaaaa 2640

gcactcacgt gacagctaat acaggaccac tcccctatga cgtgatttac gtcagcgcta 2700

tgcccgcgtg acgagaacat ttgttttggt acctgtcggc aaagtccacc ggagctcctt 2760

ccgcgtctga cgtcgatgga tccgcgactg aggggcaggc ccgcttgggc tcgcttttat 2820

ccgcgtcatc gggggcgggt ctcttgttgg ctccaccctt tctgacgtag aactcatgcg 2880

ccacctcggt cacgtgatcc tgcgcccagc ggaagaactc tttgacttcc tgctttgtca 2940

ccttgccaaa gtcatgctcc agacggcggg tgagttcaaa tttgaacatc cggtcctgca 3000

acggctgctg gtgctcgaag gtggtgctgt tcccgtcaat cacggcgcac atgttggtgt 3060

tggaagtgac gatcacgggg gtgggatcga tctgggcgga agacttgcac ttttggtcca 3120

cgcgcacctt gctgccgccg agaatggcct tggcggactc cacgaccttg gccgtcatct 3180

tgccctcctc ccaccagatc accatcttgt cgacgcaatc gttgaaggga aagttctcat 3240

tggtccagtt gacgcagccg tagaaagggc gaattc 3276

<210> 39

<211> 3084

<212> DNA

<213> 43.1

<400> 39

gaattcgccc tttctacggc tgcatcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgcgtgga ccaaaagtgc aagtcgtccg 180

cccagatcga ccccaccccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttgca ggaccggatg ttcaagttcg 300

aactcacccg ccgtctggag cacgactttg gcaaggtgac caagcaggaa gtcaaagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttctac gtcagaaagg 420

gcggagccag caaaagaccc gcccccgatg acgcggatat aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

aaacgtgcga gaaaatgaat cagaatttca acatttgctt cacgcacggg gtcagagact 660

gctcagaatg tttccccggt gcatcagaat ctcaaccggt cgtcagaaaa aaaacgtatc 720

agaaactgtg tgccattcat catctgctgg ggcgggcacc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggacgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggcttgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacctgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaaggggg agcccgtcaa cgcggcggac gcagcggccc tcgagcacga caaggcctac 1080

gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc cgacgccgag 1140

tttcaggagc gtctgcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagaccggt agagccatca cctcagcgtt cccccgactc ctccacgggc 1320

atcggcaaga aaggccacca gcccgcgaga aagagactga actttgggca gactggcgac 1380

tcggagtcag tccccgaccc tcaaccaatc ggagaaccac cagcaggccc ctctggtctg 1440

ggatctggta caatggctgc aggcggtggc gctccaatgg cagacaataa cgaaggcgcc 1500

gacggagtgg gtagttcctc aggaaattgg cattgcgatt ccacatggct gggcgacaga 1560

gtcatcacca ccagcacccg aacctgggcc ctgcccacct acaacaacca tctctacaag 1620

caaatctcca acgggacatc gggaggaagc actaacgaca acacctactt tggctacagc 1680

accccctggg ggtattttga cttcaacaga ttccactgcc acttctcacc acgtgactgg 1740

cagcgactca tcaacaataa ctggggattc cggcccaaga gactcaactt caagctcttc 1800

aacatccagg tcaaggaggt cacgcagaat gaaggcacca agaccatcgc caataacctt 1860

accagcacga ttcaggtgtt tacggactcg gaataccagc tcccgtacgt ccccggctct 1920

gcgcaccagg gctgcctccc tccgttcccg gcggacgtct tcatgattcc tcagtacggg 1980

tatctgaccc taaacaatgg cagtcaggct gtgggccgtt cctccttcta ctgcctggaa 2040

tacttccctt ctcaaatgct gaggacgggc aacaactttg aattcagcta caccttcgag 2100

gacgtgcctt tccacagcag ctacgcgcac agccagagcc tggaccggct gatgaaccct 2160

ctcatcgacc agtacctgta ttacttatcc agaactcagt ccacaggagg aactcaaggt 2220

actcagcaat tgttattttc tcaagccggg cccgcaaaca tgtcggctca ggccaagaac 2280

tggctacctg gaccgtgtta ccgtcagcaa cgagtttcca cgacactgtc gcaaaacaac 2340

aacagcaatt ttgcttggac cggtgccacc aagtatcacc tgaatggcag agactccctg 2400

gttaatcccg gcgttgccat ggctacccac aaggacgacg aggagcgctt cttcccgtca 2460

agcggagttc taatgtttgg caagcagggg gctggaaaag acaatgtgga ctacagcagc 2520

gtgatgctca ccagcgaaga agaaattaaa actactaacc cagtggctac agagcagtat 2580

ggtgtggtgg cagacaacct gcagcagacc aacggagctc ccattgtggg aactgtcaac 2640

agccaggggg ccttacctgg tatggtctgg caaaaccggg acgtgtacct gcagggcccc 2700

atctgggcca aaattcctca cacggacggc aactttcatc cttcgccgct gatgggaggc 2760

tttggactga aacacccgcc tcctcagatc ctggtgaaaa acactcctgt tcctgcggat 2820

cctccgacca ccttcagcca ggccaagctg gcttctttta tcacgcagta cagcaccgga 2880

caggtcagcg tggaaatcga atgggagctg cagaaagaaa acagcaagcg ctggaaccca 2940

gagattcagt atacttccaa ctactacaaa tctacaaatg tggactttgc tgtcaatact 3000

gagggtactt attcagagcc tcgccccatt ggcactcgtt atctcacccg taatctgtaa 3060

ttgcttgtta atcaataaac cggt 3084

<210> 40

<211> 2370

<212> DNA

<213> novel AAV serotype, clone 43.5

<400> 40

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgcgtgga ccaaaagtgc aagtcgtccg 180

cccagatcga ccccaccccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttgca ggaccggatg ttcaagttcg 300

aactcacccg ccgtctggag cacgactttg gcaaggtgac caagcaggaa gtcaaagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttctac gtcagaaagg 420

gcggagccag caaaagaccc gcccccgatg acgcggatat aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagacgctg tttccctgca 600

aaacgtgcga gagaatgaat cagaatttca acatttgctt cacgcacggg gtcagagact 660

gctcagaatg tttccccggt gcatcagaat ctcaaccggt cgtcagaaaa aaaacgtatc 720

agaaactgtg tgccattcat catctgctgg ggcgggcacc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggacgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggcttgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacctgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaaggggg agcccgtcaa cgcggcggac gcagcggccc tcgagcacga caaggcctac 1080

gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc cgacgccgag 1140

tttcaggagc gtctgcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagaccggt agagccatca cctcagcgtt cccccgactc ctccacgggc 1320

atcggcaaga aaggccacca gcccgcgaga aagagactga actttgggca gactggcgac 1380

tcggagtcag tccccgaccc tcaaccaatc ggagaaccac cagcaggccc ctctggtctg 1440

ggatctggta caatggctgc aggcggtggc gctccaatgg cagacaataa cgaaggcgcc 1500

gacggagtgg gtagttcctc aggaaattgg cattgcgatt ccacatggct gggcgacaga 1560

gtcatcacca ccagcacccg aacctgggcc ctgcccacct acaacaacca tctctacaag 1620

caaatctcca acgggacatc gggaggaagc actaacgaca acacctactt tggctacagc 1680

accccctggg ggtattttga cttcaacaga ttccactgcc acttctcacc acgtgactgg 1740

cagcgactca tcaacaataa ctggggattc cggcccaaga gactcaactt caagctcttc 1800

aacatccagg tcaaggaggt cacgcagaat gaaggcacca agaccatcgc caataacctt 1860

accagcacga ttcaggtgtt tacggactcg gaataccagc tcccgtacgt cctcggctct 1920

gcgcaccagg gctgcctccc tccgttcccg gcggacgtct tcatgattcc tcagtacggg 1980

tatctgaccc taaacaatgg cagtcaggct gtgggccgtt cctccttcta ctgcctggaa 2040

tacttccctt ctcaaatgct gaggacgggc aacaactttg aattcagcta caccttcgag 2100

gacgtgcctt tccacagcag ctacgcgcac agccagagcc tggaccggct gatgaaccct 2160

ctcatcgacc agtacctgta ttacttatcc agaactcagt ccacaggagg aactcaaggt 2220

actcagcaat tgttattttc tcaagccggg cccgcaaaca tgtyggctca ggccaagaac 2280

tggctacctg gaccgtgtta ccgtcagcaa cgagtttcca cgacactgtc gcaaaacaac 2340

aacagcaatt ttgctggacc ggtgccacca 2370

<210> 41

<211> 3123

<212> DNA

<213> 43.12

<400> 41

gaattcgccc ttggctgcgt caactggacc aatgagaact ttcccttcaa cgattgcgtc 60

gacaagatgg tgatctggtg ggaggagggc aagatgacgg ccaaggtcgt ggagtccgcc 120

aaggccattc tcggcggcag caaggtgcgc gtggaccaaa agtgcaagtc gtccgcccag 180

atcgacccca cccccgtgat cgtcacctcc aacaccaaca tgtgcgccgt gattgacggg 240

aacagcacca ccttcgagca ccagcagccg ttgcaggacc ggatgttcaa gttcgaactc 300

acccgccgtc tggagcacga ctttggcaag gtgaccaagc aggaagtcaa agagttcttc 360

cgctgggcgc aggatcacgt gaccgaggtg gcgcatgagt tctacgtcag aaagggcgga 420

gccagcaaaa gacccgcccc cgatgacgcg gatataagcg agcccaagcg ggcctgcccc 480

tcagtcgcgg atccatcgac gtcagacgcg gaaggagctc cggtggactt tgccgacagg 540

taccaaaaca aatgttctcg tcacgcgggc atgctccaga tgctgtttcc ctgcaaaacg 600

tgcgagagaa tgaatcagaa tttcaacatt tgcttcacgc acggggtcag agactgctca 660

gaatgtttcc ccggtgcatc agaatctcaa ccggtcgtca gaaaaaaaac gtatcagaaa 720

ctgtgtgcca ttcatcatct gctggggcgg gcacccgaga ttgcttgctc ggcctgcgat 780

ctggtcaacg tggacctgga cgactgtgtt tctgagcaat aaatgactta aaccaggtat 840

ggctgccgat ggttatcttc cagattggct tgaggacaac ctctctgagg gcattcgcga 900

gtggtgggac ctgaaacctg gagccccgaa acccaaagcc aaccagcaaa agcaggacga 960

cggccggggt ctggtgcttc ctggctacaa gtacctcgga cccttcaacg gactcgacaa 1020

gggggagccc gtcaacgcgg cggacgcagc ggccctcgag cacgacaagg cctacgacca 1080

gcagctcaaa gcgggtgaca atccgtacct gcggtataac cacgccgacg ccgagtttca 1140

ggagcgtctg caagaagata cgtcttttgg gggcaacctc gggcgagcag tcttccaggc 1200

caagaagcgg gttctcgaac ctctcggtct ggttgaggaa ggcgctaaga cggctcctgg 1260

aaagaagaga ccggtagagc catcacctca gcgttccccc gactcctcca cgggcatcgg 1320

caagaaaggc caccagcccg cgagaaagag actgaacttt gggcagactg gcgactcgga 1380

gtcagtcccc gaccctcaac caatcggaga accaccagca ggcccctctg gtctgggatc 1440

tggtacaatg gctgcaggcg gtggcgctcc aatggcagac aataacgaag gcgccgacgg 1500

agtgggtagt tcctcaggaa attggcattg cgattccaca tggctgggcg acagagtcat 1560

caccaccagc acccgaacct gggccctgcc cacctacaac aaccatctct acaagcaaat 1620

ctccaacggg acatcgggag gaagcactaa cgacaacacc tactttggct acagcacccc 1680

ctgggggtat tttgacttca acagattcca ctgccacttc tcaccacgtg actggcagcg 1740

actcatcaac aataactggg gattccggcc caagagactc aacttcaagc tcttcaacat 1800

ccaggtcaag gaggtcacgc agaatgaagg caccaagacc atcgccaata accttaccag 1860

cacgattcag gtgtttacgg actcggaata ccagctcccg tacgtcctcg gctctgcgca 1920

ccagggctgc ctccctccgt tcccggcgga cgtcttcatg attcctcagt acgggtatct 1980

gaccctaaac aatggcagtc aggctgtggg ccgttcctcc ttctactgcc tggaatactt 2040

cccttctcaa atgctgagga cgggcaacaa ctttgaattc agctacacct tcgaggacgt 2100

gcctttccac agcagctacg cgcacagcca gagcctggac cggctgatga accctctcat 2160

cgaccagtac ctgtattact tatccagaac tcagtccaca ggaggaactc aaggtactca 2220

gcaattgtta ttttctcaag ccgggcccgc aaacatgtcg gctcaggcca agaactggct 2280

acctggaccg tgttaccgtc agcaacgagt ttccacgaca ctgtcgcaaa acaacaacag 2340

caattttgct tggaccggtg ccaccaagta tcacctgaat ggcagagact ccctggttaa 2400

tcccggcgtt gccatggcta cccacaagga cgacgaggag cgcttcttcc cgtcaagcgg 2460

agttctaatg tttggcaagc agggggctgg aaaagacaat gtggactaca gcagcgtgat 2520

gctcaccagc gaagaagaaa ttaaaactac taacccagtg gctacagagc agtatggtgt 2580

ggtggcagac aacctgcagc agaccaacgg agctcccatt gtgggaactg tcaacagcca 2640

gggggcctta cctggtatgg tctggcaaaa ccgggacgtg tacctgcagg gccccatctg 2700

ggccaaaatt cctcacacgg acggcaactt tcatccttcg ccgctgatgg gaggctttgg 2760

actgaaacac ccgcctcctc agatcctggt gaaaaacact cctgttcctg cggatcctcc 2820

gaccaccttc agccaggcca agctggcttc ttttatcacg cagtacagca ccggacaggt 2880

cagcgtggaa atcgaatggg agctgcagaa agaaaacagc aagcgctgga acccagagat 2940

tcagtatact tccaactact acaaatctac aaatgtggac tttgctgtca atactgaggg 3000

tacttattca gagcctcgcc ccattggcac tcgttatctc acccgtaatc tgtaattgct 3060

tgttaatcaa taaaccggtt aattcgtttc agttgaactt tggtctctgc gaagggcgaa 3120

ttc 3123

<210> 42

<211> 3122

<212> DNA

<213> 43.20

<400> 42

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgtgtgga ccaaaagtgc aagtcttccg 180

cccagatcga tcccaccccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg 240

acgggaacag cgccaccttc gagcaccagc agccgttgca ggaccggatg ttcaaatttg 300

aactcacccg ccgtctggag catgactttg gcaaggtgac gaagcaggaa gtcaaagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttccac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggatat aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

agacatgcga gagaatgaat cagaatttca acatttgctt cacgcacggg accagagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt cgtcagaaag aggacgtatc 720

ggaaactctg tgcgattcat catctgctgg ggcgggctcc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggatgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggctcgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaaggggg agcccgtcaa cgcggcggac gcagcggccc tcgagcacga caaagcctac 1080

gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataatcacgc cgacgccgag 1140

tttcaggagc gtctgcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagactggt agagcagtcg ccacaagagc cagactcctc ctcgggcatc 1320

ggcaagacag gccagcagcc cgctaaaaag agactcaatt ttggtcagac tggcgactca 1380

gagtcagtcc ccgacccaca acctctcgga gaacctccag cagccccctc aggtctggga 1440

cctaatacaa tggcttcagg cggtggcgct ccaatggcag acaataacga aggcgccgac 1500

ggagtgggta attcctcggg aaattggcat tgcgattcca catggctggg ggacagagtc 1560

atcaccacca gcacccgaac ctgggccctg cccacctaca acaaccacct ctacaagcaa 1620

atctccaacg gcacctcggg aggaagcacc aacgacaaca cctattttgg ctacagcacc 1680

ccctgggggt attttgactt caacagattc cactgtcact tttcaccacg tgactggcaa 1740

cgactcatca acaacaattg gggattccgg cccaaaagac tcaacttcaa gctgttcaac 1800

atccaggtca aggaagtcac gacgaacgaa ggcaccaaga ccatcgccaa taatctcacc 1860

agcaccgtgc aggtctttac ggactcggag taccagttac cgtacgtgct aggatccgct 1920

caccagggat gtctgcctcc gttcccggcg gacgtcttca cggttcctca gtacggctat 1980

ttaactttaa acaatggaag ccaagccctg ggacgttcct ccttctactg tctggagtat 2040

ttcccatcgc agatgctgag aaccggcaac aactttcagt tcagctacac cttcgaggac 2100

gtgcctttcc acagcagcta cgcgcacagc cagagcctgg acaggctgat gaatcccctc 2160

atcgaccagt acctgtacta cctggtcaga acgcaaacga ctggaactgg agggacgcag 2220

actctggcat tcagccaagc gggtcctagc tcaatggcca accaggctag aaattgggtg 2280

cccggacctt gctaccggca gcagcgcgtc tccacgacaa ccaaccagaa caacaacagc 2340

aactttgcct ggacgggagc tgccaagttt aagctgaacg gccgagactc tctaatgaat 2400

ccgggcgtgg caatggcttc ccacaaggat gacgacgacc gcttcttccc ttcgagcggg 2460

gtcctgattt ttggcaagca aggagccggg aacgatggag tggattacag ccaagtgctg 2520

attacagatg aggaagaaat caaggctacc aaccccgtgg ccacagaaga atatggagca 2580

gtggccatca acaaccaggc cgccaatacg caggcgcaga ccggactcgt gcacaaccag 2640

ggggtgattc ccggcatggt gtggcagaat agagacgtgt acctgcaggg tcccatctgg 2700

gccaaaattc ctcacacgga cggcaacttt cacccgtctc ccctgatggg cggctttgga 2760

ctgaagcacc cgcctcctca aattctcatc aagaacacac cggttccagc ggacccgccg 2820

cttaccttca accaggccaa gctgaactct ttcatcacgc agtacagcac cggacaggtc 2880

agcgtggaaa tcgagtggga gctgcagaaa gaaaacagca aacgctggaa tccagagatt 2940

caatacactt ccaactacta caaatctaca aatgtggact ttgctgtcaa cacggaagga 3000

gtttatagcg agcctcgccc cattggcacc cgttacctca cccgcaacct gtaattacat 3060

gttaatcaat aaaccggtta attcgtttca gttgaacttt ggtctctgcg aagggcgaat 3120

tc 3122

<210> 43

<211> 3117

<212> DNA

<213> 43.21

<400> 43

gaattcgccc ttggctgcgt caactggacc aatgagaact ttcccttcaa cgattgcgtc 60

gacaagatgg tgatctggtg ggaggagggc aagatgacgg ccaaggtcgt ggagtccgcc 120

aaggccattc tcggcggcag caaggtgcgt gtggaccaaa agtgcaagtc ttccgcccag 180

atcgatccca cccccgtgat cgtcacctcc aacaccaaca tgtgcgccgt gattgacggg 240

aacagcacca ccttcgagca ccagcagccg ttgcaggacc ggatgttcaa atttgaactc 300

acccgccgtc tggagcatga ctttggcaag gtgacgaagc aggaagtcaa agagttcttc 360

cgctgggcgc aggatcacgt gaccgaggtg gcgcatgagt tccacgtcag aaagggtgga 420

gccaacaaga gacccgcccc cgatgacgcg gatataagcg agcccaagcg ggcctgcccc 480

tcagtcgcgg atccatcgac gtcagacgcg gaaggagctc cggtggactt tgccgacagg 540

taccaaaaca aatgttctcg tcacgcgggc atgcttcaga tgctgtttcc ctgcaagaca 600

tgcgagagaa tgaatcagaa tttcaacatt tgcttcacgc acgggaccag agactgttca 660

gaatgtttcc ccggcgtgtc agaatctcaa ccggtcgtca gaaagaggac gtatcggaaa 720

ctctgtgcga ttcatcatct gctggggcgg gctcccgaga ttgcttgctc ggcctgcgat 780

ctggtcaacg tggacctgga tgactgtgtt tctgagcaat aaatgactta aaccaggtat 840

ggctgccgat ggttatcttc cagattggct cgaggacaac ctctctgagg gcattcgcga 900

gtggtgggac ttgaaacctg gagccccgaa acccaaagcc aaccagcaaa agcaggacga 960

cggccggggt ctggtgcttc ctggctacaa gtacctcgga cccttcaacg gactcgacaa 1020

gggggagccc gtcaacgcgg cggacgcagc ggccctcgag cacgacaaag cctacgacca 1080

gcagctcaaa gcgggtgaca atccgtacct gcggtataat cacgccgacg ccgagtttca 1140

ggagcgtctg caagaagata cgtcttttgg gggcaacctc gggcgagcag tcttccaggc 1200

caagaagcgg gttctcgaac ctctcggtct ggttgaggaa ggcgctaaga cggctcctgg 1260

aaagaagaga ccggtagagc agtcgccaca agagccagac tcctcctcgg gcatcggcaa 1320

gacaggccag cagcccgcta aaaagagact caattttggt cagactggcg actcagagtc 1380

agtccccgac ccacaacctc tcggagaacc tccagcagcc ccctcaggtc tgggacctaa 1440

tacaatggct tcaggcggtg gcgctccaat ggcagacaat aacgaaggcg ccgacggagt 1500

gggtaattcc tcgggaaatt ggcattgcga ttccacatgg ctgggggaca gagtcatcac 1560

caccagcacc cgaacctggg ccctgcccac ctacaacaac cacctctaca agcaaatctc 1620

caacggcacc tcgggaggaa gcaccaacga caacacctat tttggctaca gcaccccctg 1680

ggggtatttt gacttcaaca gattccactg tcacttttca ccacgtgact ggcaacgact 1740

catcaacaac aattggggat tccggcccaa aagactcaac ttcaagctgt tcaacatcca 1800

ggtcaaggaa gtcacgacga acgaaggcac caagaccatc gccaataatc tcaccagcac 1860

cgtgcgggtc tttacggact cggagtacca gttaccgtac gtgctaggat ccgctcacca 1920

gggatgtctg cctccgttcc cggcggacgt cttcatggtt cctcagtacg gctatttaac 1980

tttaaacaat ggaagccaag ccctgggacg ttcctccttc tactgtctgg agtatttccc 2040

atcgcagatg ctgagaaccg gcaacaactt tcagttcagc tacaccttcg aggacgtgcc 2100

tttccacagc agctacgcgc acagccagag cctggacagg ctgatgaatc ccctcatcga 2160

ccagtacctg tactacctgg tcagaacgca aacgactgga actggaggga cgcagactct 2220

ggcattcagc caagcgggtc ctagctcaat ggccaaccag gctagaaatt gggtgcccgg 2280

accttgctac cggcagcagc gcgtctccac gacaaccaac cagagcaaca acagcaactt 2340

tgcctggacg ggagctgcca agtttaagct gaacggccga gactctctaa tgaatccggg 2400

cgtggcaatg gcttcccaca aggatgacga cgaccgcttc ttcccttcga gcggggtcct 2460

gatttttggc aagcaaggag ccgggaacga tggagtggat tacagccaag tgctgattac 2520

agatgaggaa gaaatcaagg ctaccaaccc cgtggccaca gaagaatatg gagcagtggc 2580

catcaacaac caggccgcca atacgcaggc gcagaccgga ctcgtgcaca accagggggt 2640

gattcccggc atggtgtggc agaatagaga cgtgtacctg cagggtccca tctgggccaa 2700

aattcctcac acggacggca actttcaccc gtctcccctg atgggcggct ttggactgaa 2760

gcacccgcct cctcaaattc tcatcaagaa cacaccggtt ccagcggacc cgccgcttac 2820

cttcaaccag gccaagctga actctttcat cacgcagtac agcaccggac aggtcagcgt 2880

ggaaatcgag tgggagctgc agaaagaaaa cagcaaacgc tggaatccag agattcaata 2940

cacttccaac tactacaaat ctacaaatgt ggactttgct gtcaacacgg aaggagttta 3000

tagcgagcct cgccccattg gcacccgtta cctcacccgc aacctgtaat tacatgttaa 3060

tcaataaacc ggttaattcg tttcagttga actttggtct ctgcgaaggg cgaattc 3117

<210> 44

<211> 3121

<212> DNA

<213> 43.23

<400> 44

gaattcgccc ttctacggct gcgtcaactg gaccaatgag aactttccct tcaacgattg 60

cgtcgacaag atggtgatct ggtgggagga gggcaagatg acggccaagg tcgtggagtc 120

cgccaaggcc attctcggcg gcagcaaggt gcgtgtggac caaaagtgca agtcttccgc 180

ccagatcgat cccacccccg tgatcgtcac ctccaacacc aacatgtgcg ccgtgattga 240

cgggaacagc accaccttcg agcaccagca gccgttgcag gaccggatgt tcaaatttga 300

actcacccgc cgtctggagc atgactttgg caaggtgacg aagcaggaag tcaaagagtt 360

cttccgctgg gcgcaggatc acgtgaccga ggtggcgcat gagttccacg tcagaaaggg 420

tggcgccaac aagagacccg cccccgatga cgcggatata agcgagccca agcgggcctg 480

cccctcagtc gcggatccat cgacgtcaga cgcggaagga gctccggtgg actttgccga 540

caggtaccaa aacaaatgtt ctcgtcacgc gggcatgctt cagatgctgt ttccctgcaa 600

gacatgcgag agaatgaatc agaatttcaa catttgcttc acgcacggga ccagagactg 660

ttcagaatgt ttccccggcg tgtcagaatc tcaaccggtc gtcagaaaga ggacgtatcg 720

gaaactctgt gcgattcatc atctgctggg gcgggctccc gagattgctt gctcggcctg 780

cgatctggtc aacgtggacc tggatgactg tgtttctgag caataaatga cttaaaccag 840

gtatggctgc cgatggttat cttccagatt ggctcgagga caacctctct gagggcattc 900

gcgagtggtg ggacttgaaa cctggagccc cgaaacccaa agccaaccag caaaagcagg 960

acgacggccg gggtctggtg cttcctggct acaagtacct cggacccttc aacggactcg 1020

acaaggggga gcccgtcaac gcggcggacg cagcggccct cgagcacgac aaagcctacg 1080

accagcagct caaagcgggt gacaatccgt acctgcggta taatcacgcc gacgccgagt 1140

ttcaggagcg tctgcaagaa gatacgtcct ttgggggcaa cctcgggcga gcagtcttcc 1200

aggccaagaa gcgggttctc gaacctctcg gtctggttga ggaaggcgct aagacggctc 1260

ctggaaagaa gagaccggta gagcagtcgc cacaagagcc agactcctcc tcgggcatcg 1320

gcaagacagg ccagcagccc gctaaaaaga gactcaattt tggtcagact ggcgactcag 1380

agtcagtccc cgacccacaa cctctcggag aacctccagc agccccctca ggtctgggac 1440

ctaatacaat ggcttcaggc ggtggcgctc caatggcaga caataacgaa ggcgccgacg 1500

gagtgggtaa ttcctcggga aattggcatt gcgattccac atggctgggg gacagagtca 1560

tcaccaccag cacccgaacc tgggccctgc ccacctacaa caaccacctc tacaagcaaa 1620

tctccaacgg cacctcggga ggaagcacca acgacaacac ctattttggc tacagcaccc 1680

cctgggggta ttttgacttc aacagattcc actgtcactt ttcaccacgt gactggcaac 1740

gactcatcaa caacaattgg ggattccggc ccaaaagact caacttcaag ctgttcaaca 1800

tccaggtcaa ggaagtcacg acgaacgaag gcaccaagac catcgccaat aatctcacca 1860

gcaccgtgca ggtctttacg gacttggagt accagttacc gtacgtgcta ggatccgctc 1920

accagggatg tctgcctccg ttcccggcgg acgtcttcat ggttcctcag tacggctatt 1980

taactttaaa caatggaagc caagccctgg gacgttcctc cttctactgt ctggagtatt 2040

tcccatcgca gatgccgaga accggcaaca actttcagtt cagctacacc ttcgaggacg 2100

tgcctttcca cagcagctac gcgcacagcc agagcctgga caggctgatg aatcccctca 2160

tcgaccagta cctgtactac ctggtcagaa cgcaaacgac tggaactgga gggacgcaga 2220

ctctggcatt cagccaagcg ggtcctagct caatggccaa ccaggctaga aattgggtgc 2280

ccggaccttg ctaccggcag cagcgcgtct ccacgacaac caaccagaac aacaacagca 2340

actttgcctg gacgggagct gccaagttta agctgaacgg ccgagactct ctaatgaatc 2400

cgggcgtggc aatggcttcc cacaaggatg acgacgaccg cttcttccct tcgagcgggg 2460

tcctgatttt tggcaagcaa ggagccggga acgatggagt ggattacagc caagtgctga 2520

ttacagatga ggaagaaatc aaggctacca accccgtggc cacagaagaa tatggagcag 2580

tggccatcaa caaccaggcc gccaatacgc aggcgcagac cggactcgtg cacaaccagg 2640

gggtgattcc cggcatggtg tggcagaata gagacgtgta cctgcagggt cccatctggg 2700

ccaaaattcc tcacacggac ggcaactttc acccgtctcc cctgatgggc ggctttggac 2760

tgaagcaccc gcctcctcaa attctcatca agaacacacc ggttccagcg gacccgccgc 2820

ttaccttcaa ccaggccaag ctgaactctt tcatcacgca gtacagcacc ggacaggtca 2880

gcgtggaaat cgagtgggag ctgcagaaag aaaacagcaa acgctggaat ccagagattc 2940

aatacacttc caactactac aaatctacaa atgtggactt tgctgtcaac acggaaggag 3000

tttatagcga gcctcgcccc attggcaccc gttacctcac ccgcaacctg taattacatg 3060

ttaatcaata aaccggttaa ttcgtttcag ttgaactttg gtctctgcga agggcgaatt 3120

c 3121

<210> 45

<211> 3122

<212> DNA

<213> 43.25

<400> 45

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgtgtgga ccaaaagtgc aagtcttccg 180

cccagatcga tcccaccccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttgca ggaccggatg ttcaaatttg 300

aactcacccg ccgtctggag catgactttg gcaaggtgac gaagcaggaa gtcaaagggt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttccac gtgcgagccc 420

aagcgggcct gcccctcagt cgcggatcca tcgacgtcag accagaaagg gtggagccaa 480

caagagaccc gcccccgatg acgcggatat aagcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

agacatgcga gagaatgaat cagaatttca acatttgctt cacgcacggg accagagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt cgtcagaaag aggacgtatc 720

ggaaactctg tgcgattcat catctgctgg ggcgggctcc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggatgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggctcgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaaggggg agcccgtcaa cgcggcggac gcagcggccc tcgagcacga caaagcctac 1080

gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataatcacgc cgacgccgag 1140

tttcaggagc gtctgcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagaccggt agagcagtcg ccacaagagc cagactcctc ctcgggcatc 1320

ggcaagacag gccagcagcc cgctaaaaag agactcaatt ttggtcagac tggcgactca 1380

gagtcagtcc ccgacccaca acctctcgga gaacctccag cagccccctc aggtctggga 1440

cctaatacaa tggcttcagg cggtggcgct ccaatggcag acaataacga aggcgccgac 1500

ggagtgggta attcctcggg aaattggcat tgcgattcca catggctggg ggacagagtc 1560

atcaccacca gcacccgaac ctgggccctg cccacctaca acaaccacct ctacaagcaa 1620

atctccaacg gcacctcggg aggaagcacc aacgacaaca cctattttgg ctacagcacc 1680

ccctgggggt attttgactt caacagattc cactgtcact tttcaccacg tgactggcaa 1740

cgactcatca acaacaattg gggattccgg cccaaaagac tcaacttcaa gctgttcaac 1800

atccaggtca aggaagtcac gacgaacgaa ggcaccaaga ccatcgccaa taatctcacc 1860

agcaccgtgc aggtctttac ggactcggag taccagttac cgtacgtgct aggatccgct 1920

caccagggat gtctgcctcc gttcccggcg gacgtcttca tggttcctca gtacggctat 1980

ttaactttaa acaatggaag ccaagccctg ggacgttcct ccttctactg tctggagtat 2040

ttcccatcgc agatgctgag aaccggcaac aactttcagt tcagctacac cttcgaggac 2100

gtgcctttcc acagcagcta cgcgcacagc cagagcctgg acaggctgat gaatcccctc 2160

atcgaccagt acctgtacta cctggtcaga acgcaaacga ctggaactgg agggacgcag 2220

actctggcat tcagccaagc gggtcctagc tcaatggcca accaggctag aaattgggtg 2280

cccggacctt gctaccggca gcagcgcgtc tccacgacaa ccaaccagaa caacaacagc 2340

aactttgcct ggacgggagc tgccaagttt aagctgaacg gccgagactc tctaatgaat 2400

ccgggcgtgg caatggcttc ccacaaggat gacgacgacc gcttcttccc ttcgagcggg 2460

gtcctgattt ttggcaagca aggagccggg aacgatggag tggattacag ccaagtgctg 2520

attacagatg aggaagaaat caaggctacc aaccccgtgg ccacagaaga atatggagca 2580

gtggccatca acaaccaggc cgccaatacg caggcgcaga ccggactcgt gcacaaccag 2640

ggggtgattc ccggcatggt gtggcagaat agagacgtgt acctgcaggg tcccatctgg 2700

gccaaaattc ctcacacgga cggcaacttt cacccgtctc ccctgatggg cggctttgga 2760

ctgaagcacc cgcctcctca aattctcatc aagaacacac cggttccagc ggacccgccg 2820

cttaccttca accaggccaa gctgaactct ttcatcacgc agtacagcac cggacaggtc 2880

agcgtggaaa tcgagtggga gctgcagaaa gaaaacagca aacgctggaa tccagagatt 2940

caatacactt ccaactacta caaatctaca aatgtggact ttgctgtcaa cacggagggg 3000

gtttatagcg agcctcgccc cattggcacc cgttacctca cccgcaacct gtaattacat 3060

gttaatcaat aaaccggtta attcgtttca gttgaacttt ggtctctgcg aagggcgaat 3120

tc 3122

<210> 46

<211> 3128

<212> DNA

<213> 44.1

<400> 46

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatgttgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaaag tgcgcgtgga ccaaaagtgc aagccgtccg 180

cccagatcga ccccaccccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttgcg ggaccggatg ttcaagtttg 300

aactcacccg ccgtctggag cacgactttg gcaaggtgac aaagcaggaa gtcagagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca cgagttctac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggataa aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

aaacatgcga gagaatgaat cagaatttca acatttgctt cacgcacggg accagagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt cgtcagaaaa aagacgtatc 720

ggaaactctg tgcgattcat catctgctgg ggcgggcacc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctagatgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggctcgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaaggggg agcccgtcaa cgcggcggac gcagcggccc tcgagcacga caaggcctac 1080

gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc cgacgccgag 1140

tttcaggagc gtctgcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagaccggt agagccatca ccccagcgtt ctccagactc ctctacgggc 1320

atcggcaaga aaggccagca gcccgcgaaa aagagactca actttgggca gactggcgac 1380

tcagagtcag tgcccgaccc tcaaccaatc ggagaacccc ccgcaggccc ctctggtctg 1440

ggatctggta caatggctgc aggcggtggc gctccaatgg cagacaataa cgaaggcgcc 1500

gacggagtgg gtagttcctc aggaaattgg cattgcgatt ccacatggct gggcgacaga 1560

gtcatcacca ccagcacccg aacctgggcc ctccccacct acaacaacca cctctacaag 1620

caaatctcca acgggacttc gggaggaagc accaacgaca acacctactt cggctacagc 1680

accccctggg ggtattttga ctttaacaga ttccactgcc acttctcacc acgtgactgg 1740

cagcgactca tcaacaacaa ctggggattc cggcccaaga gactcaactt caagctcttc 1800

aacatccagg tcaaggaggt cacgcagaat gaaggcacca agaccatcgc caataacctt 1860

accagcacga ttcaggtctt tacggactcg gaataccagc tcccgtacgt cctcggctct 1920

gcgcaccagg gctgcctgcc tccgttcccg gcggacgtct tcatgattcc tcagtacggg 1980

tacctgactc tgaacaatgg cagtcaggcc gtgggccgtt cctccttcta ctgcctggag 2040

tactttcctt ctcaaatgct gagaacgggc aacaactttg agttcagcta ccagtttgag 2100

gacgtgcctt ttcacagcag ctacgcgcac agccaaagcc tggaccggct gatgaacccc 2160

ctcatcgacc agtacctgta ctacctgtct cggactcagt ccacgggagg taccgcagga 2220

actcagcagt tgctattttc tcaggccggg cctaataaca tgtcggctca ggccaaaaac 2280

tggctacccg ggccctgcta ccggcagcaa cgcgtctcca cgacactgtc gcaaaataac 2340

aacagcaact gtaaatcccg gtgtcgctat ggcaacccac aaggacgacg aagagcgatt 2400

ttgcctggac cggtgccacc aagtatcatc tgaatggcag agactctctg ttttccgtcc 2460

agcggagtct taatgtttgg gaaacaggga gctggaaaag acaacgtgga ctatagcagc 2520

gttatgctaa ccagtgagga agaaattaaa accaccaacc cagtggccac ggaacagtac 2580

ggcgtggtgg ccgataacct gcaacagcaa aacgccgctc ctattgtagg ggccgtcaac 2640

agtcaaggag ccttacctgg catggtctgg cagaaccggg acgtgtacct gcagggtcct 2700

atctgggcca agattcctca cacggacgga aactttcatc cctcgccgct gatgggaggc 2760

tttggactga aacacccgcc tcctcagatc ctgattaaga atacacctgt tcccgcggat 2820

cctccaacta ccttcagtca agctaagctg gcgtcgttca tcacgcagta cagcaccgga 2880

caggtcagcg tggaaattga atgggagctg cagaaagaaa acagcaaacg ctggaaccca 2940

gagattcaat acacttccaa ctactacaaa tctacaaatg tggacttcgc tgttaacaca 3000

gatggcactt attctgagcc tcgccccatt ggcacccgtt acctcacccg taatctgtaa 3060

ttgctcgtta atcaataaac cggttgattc gtttcagttg aactttggtc tctgcgaagg 3120

gcgaattc 3128

<210> 47

<211> 3128

<212> DNA

<213> 44.5

<400> 47

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaaag tgcgcgtgga ccaaaagtgc aagtcgtccg 180

cccagatcga ccccaccccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttgca ggaccggatg ttcaagtttg 300

aactcacccg ccgtctggag cacgactttg gcaaggtgac aaagcaggaa gtcagagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca cgagttctac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggataa aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

aaacatgcga gagaatgaat cagaatttca acatttgctt cacgcacggg accagagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt tgtcagaaaa aagacgtatc 720

ggaaactctg tgcgattcat catctgctgg ggcgggcacc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctagatgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggctcgagg acaacctctc tgagggcatt 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaaggggg agcccgtcaa cgcggcggac gcagcggccc tcgagcacga caaggcctac 1080

gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc cgacgccgag 1140

tttcaggagc gtctgcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagaccggt agagccatca ccccagcgtt ctccagactc ctctacgggc 1320

atcggcaaga aaggccagca gcccgcgaaa aagagactca actttgggca gactggcgac 1380

tcagagtcag tgcccgaccc tcaaccaatc ggagaacccc ccgcaggccc ctctggtctg 1440

ggatctggta caatggctgc aggcggtggc gctccaatgg cagacaataa cgaaggcgcc 1500

gacggagtgg gtagttcctc aggaaattgg cattgcgatt ccacatggct gggcgacaga 1560

gtcatcacca ccagcacccg aacctgggcc ctccccacct acaacaacca cctctacaag 1620

caaatctcca acgggacttc gggaggaagc accaacgaca acacctactt cggctacagc 1680

accccctggg ggtattttga ctttaacaga ttccactgcc acttctcacc acgtgactgg 1740

cagcgactca tcaacaacaa ctggggattc cggcccaaga gacccaactt caagctcttc 1800

aacatccagg tcaaggaggt cacgcagaat gaaggcacca agaccatcgc caataacctt 1860

accagcacga ttcaggtctt tacggactcg gaataccagc tcccgtacgt cctcggctct 1920

gcgcaccagg gctgcctgcc tccgttcccg gcggacgtct tcatgattcc tcagtacggg 1980

tacctgactc tgaacaatgg cagtcaggcc gtgggccgtt cctccttcta ctgcctggag 2040

tactttcctt ctcaaatgct gagaacgggc aacaactttg agttcagcta ccagtttgag 2100

gacgtgcctt ttcacagcag ctacgcgcac agccaaagcc tggaccggct gatgaacccc 2160

ctcatcgacc agtacctgta ctacctgtct cggactcagt ccacgggagg taccgcagga 2220

actcagcagt tgctattttc tcaggccggg cctaataaca tgtcggctca ggccaaaaac 2280

tggctacccg ggccctgcta ccggcagcaa cgcgtctcca cgacactgtc gcaaaataac 2340

aacagcaact ttgcctggac cggtgccacc aagtatcatc tgaatggcag agactctctg 2400

gtaaatcccg gtgtcgctat ggcaacccac aaggacgacg aagagcgatt ttttccgtcc 2460

agcggagtct taatgtttgg gaaacaggga gctggaaaag acaacgtgga ctatagcagc 2520

gttatgctaa ccagtgagga agaaattaaa accaccaacc cagtggccac agaacagtac 2580

ggcgtggtgg ccgataacct gcaacagcaa aacgccgctc ctattgtagg ggccgtcaac 2640

agtcaaggag ccttacctgg catggtctgg cagaaccggg acgtgtacct gcagggtcct 2700

atctgggcca agattcctca cacggacgga aactttcatc cctcgccgct gatgggaggc 2760

tttggactga aacacccgcc tcctcagatc ctgattaaga atacacctgt tcccgcggat 2820

cctccaacta ccttcagtca agctaagctg gcgtcgttca tcacgcagta cagcaccgga 2880

caggtcagcg tggaaattga atgggagctg cagaaagaaa acagcaaacg ctggaaccca 2940

gagattcaat acacttccaa ctactacaaa tctacaaatg tggactttgc tgttaacaca 3000

gatggcactt attctgagcc tcgccccatt ggcacccgtt acctcacccg taatctgtaa 3060

ttgcttgtta atcaataaac cggttgattc gtttcagttg aactttggtc tctgcgaagg 3120

gcgaattc 3128

<210> 48

<211> 1933

<212> DNA

<213> novel AAV serotype, clone 223.10

<220>

<221> misc_feature

<222> (1302)..(1302)

<223> can be a, c, g or t

<400> 48

caaggcctac gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc 60

cgacgccgag tttcaggagc gtcttcaaga agatacgtct tttgggggca acctcgggcg 120

agcagtcttc caggccaaaa agcgggttct cgaacctctt ggtctggttg agacgccagc 180

taagacggca cctggaaaga agcgaccggt agactcgcca gactccacct cgggcatcgg 240

caagaaaggc cagcagcccg cgaaaaagag actcaacttt gggcagactg gcgactcaga 300

gtcagtcccc gaccctcaac caatcggaga accaccagca ggcccctctg gtctgggatc 360

tggtacaatg gctgcaggcg gtggcgcacc aatggctgac aataacgagg gcgccgacgg 420

agtgggtaat gcctcaggaa attggcattg cgattccaca tggctgggcg acagagtcat 480

caccaccagc acccgaacct gggccctgcc cacctacaac aaccacctct acaagcaaat 540

ctccagtcag tcagcaggga gcaccaacga taacgtctat ttcggctaca gcaccccctg 600

ggggtatttt gacttcaaca gattccattg ccacttctca ccacgtgact ggcagcgact 660

tatcaacaac aactggggat tccggcccaa gaagctcaac ttcaagctct tcaacatcca 720

ggtcaaggag gtcacgacga atgacggtgt cacaaccatc gctaataacc ttaccagcac 780

ggttcaggtc ttttcggact cggaatatca actgccgtac gtcctcggct ccgcgcacca 840

gggctgcctg cctccgttcc cggcagacgt gttcatgatt ccgcagtacg gatacctgac 900

tctgaacaat ggcagccaat cggtaggccg ttcctccttc tactgcctgg agtactttcc 960

ttctcagatg ctgagaacgg gcaacaactt cacctttagc tacaccttcg aggacgtgcc 1020

tttccacagc agctacgcgc acagccagag tctggaccgg ctgatgaatc ccctcatcga 1080

ccagtacctg tactacttgg ccagaacaca gagcaacgca ggaggtactg ctggcaatcg 1140

ggaactgcag ttttatcagg gcggacctac caccatggcc gaacaagcaa agaactggct 1200

gcccggacct tgcttccggc aacagagagt atccaagacg ctggatcaaa ataacaacag 1260

caactttgcc tggactggtg ccacaaaata ccatttaaat gnaagaaatt cattggttaa 1320

tcccggtgtc gccatggcaa cccacaagga cgacgaggaa cgcttcttcc cttcgagcgg 1380

agttctaatt tttggcaaaa ctggagcagc taataaaact acattagaaa acgtgctcat 1440

gacaaatgaa gaagaaattc gtcctaccaa cccggtagct accgaggaat acgggattgt 1500

aagcagcaac ttgcaggcgg ctagcaccgc agcccagaca caagttgtta acaaccaggg 1560

agccttacct ggcatggtct ggcagaaccg ggacgtgtac ctgcaaggtc ccatttgggc 1620

caagattcct cacacggacg gcaactttca cccgtctcct ctaatgggtg gctttggact 1680

gaaacacccg cctccccaga tcctgatcaa aaacacaccg gtacctgcta atcctccaga 1740

agtgtttact cctgccaagt ttgcttcctt catcacgcag tacagcaccg ggcaagtcag 1800

cgttgagatc gagtgggagc tgcagaaaga gaacagcaag cgctggaacc cagagattca 1860

gtacacctcc aactttgaca aacagactgg agtggacttt gctgttgaca gccagggtgt 1920

ttactctgag cct 1933

<210> 49

<211> 1933

<212> DNA

<213> novel AAV serotype, clone 223.2

<400> 49

caaggcctac gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc 60

cgacgccgag tttcaggagt gtcttcaaga agatacgtct tttgggggca acctcgggcg 120

agcagtcttc caggccaaaa agcgggttct cgaacctctt ggtctggttg agacgccagc 180

taagacggca cctggaaaga agcgaccggt agactcgcca gactccacct cgggcatcgg 240

caagaaaggc cagcagcccg cgaaaaagag actcaacttt gggcagactg gcgactcaga 300

gtcagtcccc gaccctcaac caatcggaga accaccagca ggcccctctg gtctgggatc 360

tggtacaatg gttgcaggcg gtggcgcacc aatggctgac aataacgagg gcgccgacgg 420

agtgggtaat gcctcaggaa attggcattg cgattccaca tggctgggcg acagagtcat 480

caccaccagc acccgaacct gggccctgcc cacctacaac aaccacctct acaagcaaat 540

ctccagtcag tcagcaggga gcaccaacga taacgtctat ttcggctaca gcaccccctg 600

ggggtatttt gacttcaaca gattccattg ccacttctca ccacgtgact ggcagcgact 660

tatcaacaac aactggggat tccggcccaa gaagctcaac ttcaagctct tcaacatcca 720

ggtcaaggag gtcacgacga atgacggtgt cacaaccatc gctaataacc ttaccagcac 780

ggttcaggtc ttttcggact cggaatatca actgccgtac gtcctcggct ccgcgcacca 840

gggctgcctg cctccgttcc cggcagacgt gttcatgatt ccgcagtacg gatacctgac 900

tctgaacaat ggcagccaat cggtaggccg ttcctccttc tactgcctgg agtactttcc 960

ttctcagatg ctgagaacgg gcaacaactt cacctttagc tacaccttcg aggacgtgcc 1020

tttccacagc agctacgcgc acagccagag tctggaccgg ctgatgaatc ccctcatcga 1080

ccagtacctg tactacttgg ccagaacaca gagcaacgca ggaggtactg ctggcaatcg 1140

ggaactgcag ttttatcagg gcggacctac caccatggcc gaacaagcaa agaactggct 1200

gcccggacct tgcttccggc aacagagagt atccaagacg ctggatcaaa ataacaacag 1260

caactttgcc tggactggtg ccacaaaata ccatttaaat ggaagaaatt cattggttaa 1320

tcccggtgtc gccatggcaa cccacaagga cgacgaggaa cgcttctccc cttcgagcgg 1380

agttctaatt tttggcaaaa ctggagcagc taataaaact acattagaaa acgtgctcat 1440

gacaaatgaa gaagaaattc gtcctaccaa cccggtagct accgaggaat acgggattgt 1500

aagcagcaac ttgcaggcgg ctagcaccgc agcccagaca caagttgtta acaaccaggg 1560

agccttacct ggcatggtct ggcagaaccg ggacgtgtac ctgcaaggtc ccatttgggc 1620

caagattcct cacacggacg gcaactttca cccgtctcct ctaatgggtg gctttggact 1680

gaaacacccg cctccccaga tcctgatcaa aaacacgccg gtacctgcta atcctccaga 1740

agtgtttact cctgccaagt ttgcttcctt catcacgcag tacagcaccg ggcaagtcag 1800

cgttgagatc gagtgggagc tgcagaaaga gaacagcaag cgctggaacc cagagattca 1860

gtacacctcc aactttgaca aacagactgg agtggacttt gctgttgaca gccagggtgt 1920

ttactctgag cct 1933

<210> 50

<211> 1933

<212> DNA

<213> novel AAV serotype, clone 223.4

<400> 50

caaggcctac gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc 60

cgacgccgag tttcaggagc gtcttcaaga agatacgtct tttgggggca acctcgggcg 120

agcagtcttc caggccaaaa agcgggttct cgaacctctt ggtctggttg agacgccagc 180

taagacggca cctggaaaga agcgaccggt agactcgcca gactccacct cgggcatcgg 240

caagaaaggc cagcagcccg cgaaaaagag actcaacttt gggcagactg gcgactcaga 300

gccagtcccc gaccctcaac caatcggaga accaccagca ggcccctctg gtctgggatc 360

tggtacaatg gctgcaggcg gtggcgcacc aatggctgac aataacgagg gcgccgacgg 420

agtgggtaat gcctcaggaa attggcattg cgattccaca cggctgggcg acagagtcat 480

caccaccagc acccgaacct gggccctgcc cacctacaac aaccacctct acaagcaaat 540

ctccagtcag tcagcaggga gcaccaacga taacgtctat ttcggctaca gcaccccctg 600

ggggtatttt gacttcaaca gattccattg ccacttctca ccacgtgact ggcagcgact 660

tatcaacaac aactggggat tccggcccaa gaagctcaac ttcaagctct tcaacatcca 720

ggtcaaggag gtcacgacga atgacggcgt cacaaccatc gctaataacc ttaccagcac 780

ggttcaggtc ttttcggact cggaatatca actgccgtac gtcctcggct ccgcgcacca 840

gggctgcctg cctccgttcc cggcagacgt gttcatgatt ccgcagtacg gatacctgac 900

tctgaacaat ggcagccaat cggtaggccg ttcctccttc tactgcctgg agtactttcc 960

ttctcagatg ctgagaacgg gcaacaactt cacctttagc tacaccttcg aggacgtgcc 1020

tttccacagc agctacgcgc acagccagag tctgggccgg ctgatgaatc ccctcatcga 1080

ccagtacctg tactacttgg ccagaacaca gagcaacgca ggaggtactg ctggcaatcg 1140

ggaactgcag ttttatcagg gcggacctac caccatggcc gaacaagcaa agaactggct 1200

gcccggacct tgcttccggc aacagagagt atccaagacg ctggatcaaa ataacaacag 1260

caactttgcc tggactggtg ccacaaaata ccatttaaat ggaagaaatt cattggttaa 1320

tcccggtgtc gccatggcaa cccacaagga cgacgaggaa cgcttcttcc cttcgagcgg 1380

agttctaatt tttggcaaaa ctggagcagc taataaaact acattagaaa acgtgctcat 1440

gacaaatgaa gaagaaattc gtcctaccaa cccggtagct accgaggaat acgggattgt 1500

aagcagcaac ttgcaggcgg ctagcaccgc agcccagaca caagttgtta acaaccaggg 1560

agccttacct ggcatggtct ggcagaaccg ggacgtgtac ctgcaaggtc ccatttgggc 1620

caagattcct cacacggacg gcaactttca cccgtctcct ctaatgggtg gctttggact 1680

gaaacacccg cctccccaga tcctgatcaa aaacacaccg gtacctgcta atcctccaga 1740

agtgtttact cctgccaagt ttgcttcctt catcacgcag tacagcaccg ggcaagtcag 1800

cgttgagatc gaatgggagc tgcagaaaga gaacagcaag cgctggaacc cagagattca 1860

gtacacctcc aactttgaca aacagactgg agtggacttt gctgttgaca gccagggtgt 1920

ttactctgag cct 1933

<210> 51

<211> 1933

<212> DNA

<213> novel AAV serotype, clone 223.5

<400> 51

caaggcctac gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc 60

cgacgccgag tttcaggagc gtcttcaaga agatacgtct tttgggggca acctcgggcg 120

agcagtcttc caggccaaaa agcgggttct cgaacctctt ggtctggttg agacgccagc 180

taagacggca cctggaaaga agcgaccggt agactcgcca gactccacct cgggcatcgg 240

caagaaaggc cagcagcccg cgaaaaagag actcaacttt gggcagactg gcgactcaga 300

gccagtcccc gaccctcaac caatcggaga accaccagca ggcccctctg gtctgggatc 360

tggtacaatg gctgcaggcg gtggcgcacc aatggctgac aataacgagg gcgccgacgg 420

agtgggtaat gcctcaggaa attggcattg cgattccaca cggctgggcg acagagtcat 480

caccaccagc acccgaacct gggccctgcc cacctacaac aaccacctct acaagcaaat 540

ctccagtcag tcagcaggga gcaccaacga taacgtctat ttcggctaca gcaccccctg 600

ggggtatttt gacttcaaca gattccattg ccacttctca ccacgtgact ggcagcgact 660

tatcaacaac aactggggat tccggcccaa gaagctcaac ttcaagctct tcaacatcca 720

ggtcaaggag gtcacgacga atgacggcgt cacaaccatc gctaataacc ttaccagcac 780

ggttcaggtc ttttcggact cggaatatca actgccgtac gtcctcggct ccgcgcacca 840

gggctgcctg cctccgttcc cggcagacgt gttcatgatt ccgcagtacg gatacctgac 900

tctgaacaat ggcagccaat cggtaggccg ttcctccttc tactgcctgg agtactttcc 960

ttctcagatg ctgagaacgg gcaacaactt cacctttagc tacaccttcg aggacgtgcc 1020

tttccacagc agctacgcgc acagccagag tctgggccgg ctgatgaatc ccctcatcga 1080

ccagtacctg tactacttgg ccagaacaca gagcaacgca ggaggtactg ctggcaatcg 1140

ggaactgcag ttttatcagg gcggacctac caccatggcc gaacaagcaa agaactggct 1200

gcccggacct tgcttccggc aacagagagt atccaagacg ctggatcaaa ataacaacag 1260

caactttgcc tggactggtg ccacaaaata ccatttaaat ggaagaaatt cattggttaa 1320

tcccggtgtc gccatggcaa cccacaagga cgacgaggaa cgcttcttcc cttcgagcgg 1380

agttctaatt tttggcaaaa ctggagcagc taataaaact acattagaaa acgtgctcat 1440

gacaaatgaa gaagaaattc gtcctaccaa cccggtagct accgaggaat acgggattgt 1500

aagcagcaac ttgcaggcgg ctagcaccgc agcccagaca caagttgtta acaaccaggg 1560

agccttacct ggcatggtct ggcagaaccg ggacgtgtac ctgcaaggtc ccatttgggc 1620

caagattcct cacacggacg gcaactttca cccgtctcct ctaatgggtg gctttggact 1680

gaaacacccg cctccccaga tcctgatcaa aaacacaccg gtacctgcta atcctccaga 1740

agtgtttact cctgccaagt ttgcttcctt catcacgcag tacagcaccg ggcaagtcag 1800

cgttgagatc gaatgggagc tgcagaaaga gaacagcaag cgctggaacc cagagattca 1860

gtacacctcc aactttgaca aacagactgg agtggacttt gctgttgaca gccagggtgt 1920

ttactctgag cct 1933

<210> 52

<211> 1933

<212> DNA

<213> novel AAV serotype, clone 223.6

<400> 52

caaggcctac gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc 60

cgacgccgag tttcaggagc gtcttcaaga agatacgtct tttgggggca acctcgggcg 120

agcagtcttc caggccaaaa agcgggttct cgaacctctt ggtctggttg agacgccagc 180

taagacggca cctggaaaga agcgaccggt agactcgcca gactccacct cgggcatcgg 240

caagaaaggc cagcagcccg cgaaaaagag actcaacttt gggcagactg gcgactcaga 300

gtcagtcccc gaccctcaac caatcggaga accaccagca ggcccctctg gtctgggatc 360

tggtacaatg gctgcaggcg gtggcgcacc aatggctgac aatagcgagg gcgccgacgg 420

agtgggtaat gcctcaggaa attggcattg cgattccaca tggctgggcg acagagtcat 480

caccaccagc acccgaacct gggccctgcc cacctacaac aaccacctct acaagcaaat 540

ctccagtcag tcagcaggga gcaccaacga taacgtctat ttcggctaca gcaccccctg 600

ggggtatttt gacttcaaca gattccattg ccacttctca ccacgtgact ggcagcgact 660

tatcaacaac aactggggat tccggcccaa gaagctcaac ttcaagctct tcaacatcca 720

ggtcaaggag gtcacgacga atgacggtgt cacaaccatc gctaataacc ttaccagcac 780

ggttcaggtc ttttcggact cggaatatca actgccgtac gtcctcggct ccgcgcacca 840

gggctgcctg cctccgttcc cggcagacgt gttcatgatt ccgcagtacg gatacctgac 900

tctgaacaat ggcagccaat cggtaggccg ttcctccttc tactgcctgg agtactttcc 960

ttctcagatg ctgagaacgg gcaacaactt cacctttagc tacaccttcg aggacgtgcc 1020

tttccacagc agctacgcgc acagccagag tctggaccgg ctgatgaatc ccctcatcga 1080

ccagtacctg tactacttgg ccagaacaca gagcaacgca ggaggtactg ctggcaatcg 1140

ggaactgcag ttttatcagg gcggacctac caccatggcc gaacaagcaa agaactggct 1200

gcccggacct tgcttccggc aacagagagt atccaagacg ctggatcaaa ataacaacag 1260

caactttgcc tggactggtg ccacaaaata ccatttaaat ggaagaaatt cattggttaa 1320

tcccggtgtc gccatggcaa cccacaagga cgacgaggaa cgcttcttcc cttcgagcgg 1380

agttctaatt tttggcaaaa ctggagcagc taataaaact acattagaaa acgtgctcat 1440

gacaaatgaa gaagaaattc gtcctaccaa cccggtagct accgaggaat acgggattgt 1500

aagcagcaac ttgcaggcgg ctagcaccgc agcccagaca caagttgtta acaaccaggg 1560

agccttacct ggcatggtct ggcagaaccg ggacgtgtac ctgcaaggtc ccatttgggc 1620

caagattcct cacacggacg gcaactttca cccgtctcct ctaatgggtg gctttggact 1680

gaaacacccg cctccccaga tcctgatcaa aaacacaccg gtacctgcta atcctccaga 1740

agtgtttact cctgccaagc ttgcttcctt catcacgcag tacagcaccg ggcaagtcag 1800

cgttgagatc gagtgggagc tgcagaaaga gaacagcaag cgctggaacc cagagattca 1860

gtacacctcc aactttgaca aacagactgg agtggacttt gctgttgaca gccagggtgt 1920

ttactctgag cct 1933

<210> 53

<211> 1933

<212> DNA

<213> novel AAV serotype, clone 223.7

<400> 53

caaggcctac gaccagcagc tcaaagcggg tgacaatccg tacctgcggt ataaccacgc 60

cgacgccgag tttcaggagc gtcttcaaga agatacgtct tttgggggca acctcgggcg 120

agcagtcttc caggccaaaa agcgggttct cgaacctctt ggtctggttg agacgccagc 180

taagacggca cctggaaaga agcgaccggt agactcgcca gactccacct cgggcatcgg 240

caagaaaggc cagcagcccg cgaaaaagag actcaacttt gggcagactg gcgactcaga 300

gtcagtcccc gaccctcaac caatcggaga accaccagca ggcccctctg gtctgggatc 360

tggtacaatg gctgcaggcg gtggcgcacc aatggctgac aataacgagg gcgccgacgg 420

agtgggtaat gcctcaggaa attggcattg cgattccaca tggctgggcg acagagtcat 480

caccaccagc acccgaacct gggccctgcc cacctacaac aaccacctct acaagcaaat 540

ctccagtcag tcagcaggga gcaccaacga taacgtctat ttcggctaca gcaccccctg 600

ggggtatttt gacttcaaca gattccattg ccacttctca ccacgtgact ggcagcgact 660

tatcaacaac aactggggat tccggcccaa gaagctcaac ttcaagctct tcaacatcca 720

ggtcaaggag gtcacgacga atgacggcgt cacaaccatc gctaataacc ttaccagcac 780

ggttcaggtc ttttcggacc cggaatatca actgccgtac gtcctcggct ccgcgcacca 840

gggctgcctg cctccgttcc cggcagacgt gttcatgatt ccgcagtacg gatacctgac 900

tctgaacaat ggcagccaat cggtaggccg ttcctccttc tactgcctgg agtactttcc 960

ttctcagatg ctgagaacgg gcaacaactt cacctttagc tacaccttcg aggacgtgcc 1020

tttccacagc agctacgcgc acagccagag tctggaccgg ctgatgaatc ccctcatcga 1080

ccagtacctg tactacttgg ccagaacaca gagcaacgca ggaggtactg ctggcaatcg 1140

ggaactgcag ttttatcagg gcggacctac caccatggcc gaacaagcaa agaactggct 1200

gcccggacct tgcttccggc aacagagagt atccaagacg ctggatcaaa ataacaacag 1260

caactttgcc tggactggtg ccacaaaata ccatttaaat ggaagaaatt cattggttaa 1320

tcccggtgtc gccatggcaa cccacaagga cgacgaggaa cgcttcttcc cttcgagcgg 1380

agttctaatt tttggcaaaa ctggagcagc taataaaact acattagaaa acgtgctcat 1440

gacaaatgaa gaagaaattc gtcctaccaa cccggtagct accgaggaat acgggattgt 1500

aagcagcaac ttgcaggcgg ctagcaccgc agcccagaca caagttgtta acaaccaggg 1560

agccttacct ggcatggtct ggcagaaccg ggacgtgtac ctgcaaggtc ccatttgggc 1620

caagattcct cacacggacg gcaactttca cccgtctcct ctaatgggtg gctttggact 1680

gaaacacccg cctccccaga tcctgatcaa aaacacaccg gtacctgcta atcctccaga 1740

agtgtttact cctgccaaga ttgcttcctt catcacgcag tacagcaccg ggcaagtcag 1800

cgttgagatc gagtgggagc tgcagaaaga gaacagcaag cgctggaacc cagagattca 1860

gtacacctcc aactttgaca aacagactgg agtggacttt gctgttgaca gccagggtgt 1920

ttactctgag cct 1933

<210> 54

<211> 3123

<212> DNA

<213> novel AAV serotype, clone A3.4

<400> 54

gaattcgccc tttctacggc tgcgtcaact ggaccaatga aaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggaaagat gaccgccaag gtcgtggaat 120

ctgccaaagc cattctgggt ggaagcaagg ttcgtgtgga ccagaaatgc aagtcttcgg 180

cccagatcga cccgactccg gtgattgtca cctctaacac caacatgtgc gccgtgattg 240

acggaaactc gaccaccttc gagcaccagc agccgttgca agaccggatg ttcaaatttg 300

aacttacccg ccgtttggat catgactttg ggaaggtcac caagcaggaa gtcaaagact 360

ttttccggtg ggctcaagat cacgtgactg aggtggagca tgagttctac gtcaaaaagg 420

gtggagccaa gaaaaggccc gcccccgatg atgtatatat aaatgagccc aagcgggcgc 480

gcgagtcagt tgcgcagcca tcgacgtcag acgcggaagc ttcgataaac tacgcgggca 540

ggtaccaaaa caaatgttct cgtcacgtgg gcatgaatct gatgctgttt ccctgtcgac 600

aatgcgaaag aatgaatcag aattcaaata tctgcttcac acacgggcaa aaagactgtt 660

tggaatgctt tcccgtgtca gaatctcaac ccgtttctgt cgtcagaaaa acgtatcaga 720

aactttgtta cattcatcat atcatgggaa aagaaccaga cgcctgcact gcctgcgacc 780

tggtaaatgt ggacttggat gactgtattt ctgagcaata aatgacttaa atcaggtatg 840

gctgctgacg gttatcttcc agattggctc gaggacactc tctctgaagg aatcagacag 900

tggtggaagc tcaaacctgg cccaccaccg ccgaaaccta accaacaaca ccgggacgac 960

agtaggggtc ttgtgcttcc tgggtacaag tacctcggac ccttcaacgg actcgacaaa 1020

ggagagccgg tcaacgaggc agacgccgcg gccctcgagc acgacaaagc ctacgaccac 1080

cagctcaagc aaggggacaa cccgtacctc aaatacaacc acgcggacgc tgaatttcag 1140

gagcgtcttc aagaagatac gtctttcggg ggcaacctcg ggcgagcagt cttccaggcc 1200

aaaaagaggg tactcgagcc tcttggtctg gttgaggaag ctgttaagac ggctcctgga 1260

aaaaagagac ctatagagca gtctcctgca gaaccggact cttcctcggg catcggcgaa 1320

tcaggccagc agcccgctaa gaaaagactc aattttggtc agactggcga cacagagtca 1380

gtcccagacc ctcaaccaat cggagaaccc cccgcagccc cctctggtgt gggatctaat 1440

acaatggctt caggcggtgg ggcaccaatg gcagacgata acgaaggcgc cgacggagtg 1500

ggtaattcct cgggaaattg gcattgcgat tccacatgga tgggcgacag agttatcacc 1560

accagcacaa gaacctgggc cctccccacc tacaataatc acctctacaa gcaaatctcc 1620

agcgaatcgg gagccaccaa cgacaaccac tacttcggct acagcacccc ctgggggtat 1680

tttgacttta acagattcca ctgtcacttc tcaccacgtg actggcagcg actcatcaac 1740

aacaactggg gatttagacc caagaaactc aatttcaagc tcttcaacat ccaagtcaag 1800

gaggtcacgc agaatgatgg aaccacgacc atcgccaata accttaccag cacggtgcag 1860

gtcttcacag actctgagta ccagctgccc tacgtcctcg gttcggctca ccagggctgc 1920

cttccgccgt tcccagcaga cgtcttcatg attcctcagt acggctactt gactctgaac 1980

aatggcagcc aagcggtagg acgttcttca ttctactgtc tagagtattt tccctctcag 2040

atgctgagga cgggaaacaa cttcaccttc agctacactt ttgaagacgt gcctttccac 2100

agcagctacg cgcacagcca gagtctggat cggctgatga atcctctcat tgaccagtac 2160

ctgtattacc tgagcaaaac tcagggtaca agtggaacaa cgcagcaatc gagactgcag 2220

ttcagccaag ctgggcctag ctccatggct cagcaggcca aaaactggct accgggaccc 2280

agctaccgac agcagcgaat gtctaagacg gctaatgaca acaacaacag tgaatttgct 2340

tggactgcag ccaccaaata ttacctgaat ggaagaaatt ctctggtcaa tcccgggccc 2400

ccaatggcca gtcacaagga cgatgaggaa aagtatttcc ccatgcacgg aaatctcatc 2460

tttggaaaac aaggcacagg aactaccaat gtggacattg aatcagtgct tattacagac 2520

gaagaagaaa tcagaacaac taatcctgtg gctacagaac aatacggaca ggttgccacc 2580

aaccatcaga gtcaggacac cacagcttcc tatggaagtg tggacagcca gggaatctta 2640

cctggaatgg tgtggcagga ccgcgatgtc tatcttcaag gtcccatttg ggccaaaact 2700

cctcacacgg acggacactt tcatccttct ccgctcatgg gaggctttgg actgaaacac 2760

cctcctcccc agatcctgat caaaaacaca cctgtgccag cgaatcccgc gaccactttc 2820

actcctggaa agtttgcttc gttcattacc cagtattcca ccggacaggt cagcgtggaa 2880

atagagtggg agctgcagaa agaaaacagc aaacgctgga acccagaaat tcagtacacc 2940

tccaactaca acaagtcggt gaatgtggag tttaccgtgg acgcaaacgg tgtttattct 3000

gaaccccgcc ctattggcac tcgttacctt acccggaact tgtaatttcc tgttaatgaa 3060

taaaccgatt tatgcgtttc agttgaactt tggtctctgc gaagggcgaa ttcgcggccg 3120

cta 3123

<210> 55

<211> 3113

<212> DNA

<213> novel AAV serotype, clone A3.5

<400> 55

gaattcgccc tttctacggc tgcgtcaact ggaccaatga aaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggaaagat gaccgccaag gtcgtggaat 120

ctgccaaagc cattctgggt ggaagcaagg ttcgtgtgga ccagaaatgc aagtcttcgg 180

cccagatcga cccgactccg gtgattgtca cctctaacac caacatgtgc gccgtgattg 240

acggaaactc gaccaccttc gagcaccagc agccgttgca agaccggatg ttcaaatttg 300

aacttacccg ccgtttggat catgactttg ggaaggtcac caagcaggaa gtcaaagact 360

ttttccggtg ggctcaagat cacgtgactg aggtggagca tgagttctac gtcaaaaagg 420

gtggagccaa gaaaaggccc gcccccgatg atgtatatat aaatgagccc aagcgggcgc 480

gcgagtcagt tgcgcagcca tcgacgtcag acgcggaagc ttcgataaac tacgcggaca 540

ggtaccaaaa caaatgttct cgtcacgtgg gcatgaatct gatgctgttt ccctgtcgac 600

aatgcgaaag aatgaatcag aattcaaata tctgcttcac acacgggcaa aaagactgtt 660

tggaatgctt tcccgtgtca gaatctcaac ccgttcctgt cgtcagaaaa acgtatcaga 720

aactttgtta cattcatcat atcatgggaa aagtaccaga cgcctgcact gcctgcgacc 780

tggtaaatgt ggacttggat gactgtattt ctgagcaata aatgacttaa atcaggtatg 840

gctgctgacg gttatcttcc agattggctc gaggacactc tctctgaagg aatcagacag 900

tggtggaagc tcaaacctgg cccaccaccg ccgaaaccta accaacaaca ccgggacgac 960

agtaggggtc ttgtgcttcc tgggtacaag tacctcggac ccttcaacgg actcgacaaa 1020

ggagagccgg tcaacgaggc agacgccgcg gccctcgagc acgacaaagc ctacgaccac 1080

cagctcaagc aaggggacaa cccgtacctc aaatacaacc acgcggacgc tgaatttcag 1140

gagcgtcttc aagaagatac gtctttcggg ggcaacctcg ggcgagcagt cttccaggcc 1200

aaaaagaggg tactcgagcc tcttggtctg gttgaggaag ctgttaagac ggctcctgga 1260

aaaaagagac ctatagagca gtctcctgca gaaccggact cttcctcggg catcggcaaa 1320

tcaggccagc agcccgctaa gaaaagactc aattttggtc agactggcga cacagagtca 1380

gtcccagacc ctcaaccaat cggagaaccc cccgcagccc cctctggtgt gggatctaat 1440

acaatggctt caggcggtgg ggcaccaatg gcagacaata acgaaggcgc cgacggagtg 1500

ggtaattcct cgggaaattg gcattgcgat tccacatgga tgggcgacag agttatcacc 1560

accagcacaa gaacctgggc cctccccacc tacaataatc acctctacaa gcaaatctcc 1620

agcgaatcgg gagccaccaa cgacaaccac tacttcggct acagcacccc ctgggggtat 1680

tttgacttta acagattcca ctgtcacttc tcaccacgtg actggcagcg actcatcaat 1740

aacaactggg gatttagacc caagaaactc aatttcaagc tcttcaacat ccaagtcaag 1800

gaggtcacgc agaatgatgg aaccacgacc atcgccaata accttaccag cacggtgcag 1860

gtcttcacag actctgagta ccagctgccc tacgtcctcg gttcggctca ccagggctgc 1920

cttccgccgt tcccagcaga cgtcttcatg attcctcagt acggctactt gactctgaac 1980

aatggcagcc aagcggtagg acgttcttca ttctactgtc tagagtattt tccctctcag 2040

atgctgagga cgggaaacaa cttcaccttc agctacactt ttgaagacgt gcctttccac 2100

agcagctacg cgcacagcca gagtctggat cggctgatga atcctctcat tgaccagtac 2160

ctgtattacc tgagcaaaac tcagggtaca agtggaacaa cgcagcaatc gagactgcag 2220

ttcaaccaag ctgggcctag ctccatggct cagcaggcca aaaactggct accgggaccc 2280

agctaccgac agcagcgaat gtctaagacg gctaatgaca acaacaacag tgaatttgct 2340

tggactgcag ccaccaaata ttacccgaat ggaagaaatt ctctggtcaa tcccgggccc 2400

ccaatggcca gtcacaagga cgatgaggaa aagtatttcc ccatgcacgg aaatctcatc 2460

tttggaaaac aaggcacagg aactaccaat gtggacattg aatcagtgct tattacagac 2520

gaagaagaaa tcagaacgac taatcctgtg gctacagaac aatacggaca ggttgccacc 2580

aaccgtcaga gtcagaacac cacagcttcc tatggaagtg tggacagcca gggaatctta 2640

cctggaatgg tgtggcagga ccgcgatgtc tatcttcaag gtcccatttg ggccaaaact 2700

cctcacacgg acggacactt tcatccttct ccgctcatgg gaggctttgg actgaaacac 2760

cctcctcccc agatcctgat caaaaacaca cctgtgccag cgaatcccgc gaccactttc 2820

actcctggaa agtttgcttc gttcattacc cagtattcca ccggacaggt cagcgtggaa 2880

atagagtggg agctgcagaa agaaaacagc aaacgctgga acccggaaat tcagtacacc 2940

tccaactaca acaagtcggt gaatgtggag tttaccgtgg acgcaaacgg tgtttattct 3000

gaaccccgcc ctattggcac tcgttacctt acccggaact tgtaatttcc tgttaatgaa 3060

taaaccgatt tatgcgtttc agttgaactt tggtctctgc gaagggcgaa ttc 3113

<210> 56

<211> 3122

<212> DNA

<213> novel AAV serotype, clone A3.7

<400> 56

agcggccgcg aattcgccct ttctacggct gcgtcaactg gaccaatgaa aactttccct 60

tcaacgattg cgtcgacaag atggtgatct ggtgggagga gggaaagatg accgccaagg 120

tcgtggaatc tgccaaagcc attctgggtg gaagcaaggt tcgtgtggac cagaaatgca 180

ggtcttcggc ccagatcgac ccgactccgg tgattgtcac ctctaacacc aacatgtgcg 240

ccgtgattga cggaaactcg accaccttcg agcaccagca gccgttgcaa gaccggatgt 300

tcaaatttga acttacccgc cgtttggatc atgactttgg gaaggtcacc aagcaggaag 360

tcaaagactt tttccggtgg gctcaagatc acgtgactga ggtggagcat gagttctacg 420

tcaaaaaggg tggagccaag aaaaggcccg cccccgatga tgtatatata aatgagccca 480

agcgggcgcg cgagtcagtt gcgcagccat cgacgtcaga cgcggaagct tcgataaact 540

acgcggacag gtaccaaaac aaatgttctc gtcacgtggg catgaatctg atgctgtttc 600

cctgtcgaca atgcgaaaga atgaatcaga attcaaatat ctgcttcaca cacgggcaaa 660

aagactgttt ggaatgcttt cccgtgtcag aatctcaacc cgtttctgtc gtcagaaaaa 720

cgtatcagaa actttgttac attcatcata tcatgggaaa agtaccagac gcctgcactg 780

cctgcgacct ggtaaatgtg gacttggatg actgtatttc tgagcaataa atgacttaaa 840

tcaggtatgg ctgctgacgg ttatcttcca gattggctcg aggacactct ctctgaagga 900

atcagacagt ggtggaagct caaacctggc ccaccaccgc cgaaacctaa ccaacaacac 960

cgggacgaca gtaggggtct tgtgcttcct gggtacaagt acctcggacc cttcaacgga 1020

ctcgacaaag gagagccggt caacgaggca gacgccgcgg ccctcgagca cgacaaagcc 1080

tacgaccacc agctcaagca aggggacaac ccgtacctca aatacaacca cgcggacgct 1140

gaatttcagg agcgtcttca agaagatacg tctttcgggg gcaacctcgg gcgagcagtc 1200

ttccaggcca aaaagagggt actcgagcct cttggtctgg ttgaggaagc tgttaagacg 1260

gctcctggaa aaaagagacc tatagagcag tctcctgcag aaccggactc ttcctcgggc 1320

atcggcaaat caggccagca gcccgctaag aaaagactca attttggtca gactggcgac 1380

acagagtcag tcccagaccc tcaaccaatc ggagaacccc ccgcagcccc ctctggtgtg 1440

ggatctaata caatggcttc aggcggtggg gcaccaatgg cagacaataa cgaaggcgcc 1500

gacggagtgg gtaattcctc gggaaattgg cattgcgatt ccacatggat gggcgacaga 1560

gttatcacca ccagcacaag aacctgggcc ctccccacct acaataatcg cctctacaag 1620

caaatctcca gcgaatcggg agccaccaac gacaaccact acttcggcta cagcaccccc 1680

tgggggtatt ttgactttaa cagattccac tgtcacttct caccacgtga ctggcagcga 1740

ctcatcaaca acaactgggg atttagaccc aagaaactca atttcaagct cttcaacatc 1800

caagtcaagg aggtcacgca gaatgatgga accacgacca tcgccaataa ccttaccagc 1860

acggtgcagg tcttcacaga ctctgagtac cagctgccct acgtcctcgg ttcggctcac 1920

cagggctgcc ttccgccgtt cccagcagac gtcttcatga ttcctcagta cggctacttg 1980

actctgaaca atggcagcca agcggtagga cgttcttcat tctactgtct agagtatttt 2040

ccctctcaga tgctgaggac gggaaacaac ttcaccttca gctacacttt tgaagacgtg 2100

cctttccaca gcagctacgc gcacagccag agtctggatc ggctgatgaa tcctctcatt 2160

gaccagtacc tgtattacct gagcaaaact cagggtacaa gtggaacaac gcagcaatcg 2220

agactgcagt tcagccaagc tgggcctagc tccatggctc agcaggccaa aaactggcta 2280

ccgggaccca gctaccgaca gcagcgaatg tctaagacgg ctaatgacaa caacaacagt 2340

gaatttgctt ggactgcagc caccaaatat tacctgaatg gaagaaattc tctggtcaat 2400

cccgggcccc caatggccag tcacaaggac gatgaggaaa agtatttccc catgcacgga 2460

aatctcatct ttggaaaaca aggcacagga actaccaatg tggacattga atcagtgctt 2520

attacagacg aagaagaaat cagaacaact aatcctgtgg ctacagaaca atacggacag 2580

gttgccacca accatcagag tcagaacacc acagcttcct atggaagtgt ggacagccag 2640

ggaatcttac ctggaatggt gtggcaggac cgcgatgtct atcttcaagg tcccatttgg 2700

gccaaaactc ctcacacgga cggacacttt catccttctc cgctcatggg aggctttgga 2760

ctgaaacacc ctcctcccca gatcctgatc aaaaacacac ctgtgccagc gaatcccgcg 2820

accactttca ctcctggaaa gtttgcttcg ttcattaccc agtattccac cggacaggtc 2880

agcgtggaaa tagagtggga gctgcagaaa gaaaacagca aacgctggaa cccagaaatt 2940

cagtacacct ccaactacaa caagtcggtg aatgtggagt ttaccgtgga cgcaaacggt 3000

gtttattctg aaccccgccc tattggcact cgttacctta cccggaactt gtaatttcct 3060

gttaatgaat aaaccgattt atgcgtttca gttgaacttt ggtctctgcg aagggcgaat 3120

tc 3122

<210> 57

<211> 3123

<212> DNA

<213> novel AAV serotype, clone A3.3

<400> 57

gaattcgccc tttctacggc tgcgtcaact ggaccaatga aaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggaaagat gaccgccaag gtcgtggaat 120

ctgccaaagc cattctgggt ggaggcaagg ttcgtgtgga ccagaaatgc aagtcttcgg 180

cccagatcga cccgactccg gtgattgtca cctctaacac caacatgtgc gccgtgattg 240

acggaaactc gaccaccttc gagcaccagc agccgttgca agaccggatg ttcaaatttg 300

aacttacccg ccgtttggat catgactttg ggaaggtcac caagcaggaa gtcaaagact 360

ttttccggtg ggctcaagat cacgtgactg aggtggagca tgagttctac gtcaaaaagg 420

gtggagccaa gaaaaggccc gcccccgatg atgtatatat aaatgagccc aagcgggcgc 480

gcgagtcagt tgcgcagcca tcgacgtcag acgcggaagc ttcgataaac tacgcggaca 540

ggtaccaaaa caaatgttct cgtcacgtgg gcatgaatct gatgctgttt ccctgtcgac 600

aatgcgaaag aatgaatcag aattcaaata tctgcttcac acacgggcaa aaagactgtt 660

tggaatgctt tcccgtgtca gaatctcaac ccgtttctgt cgtcagaaaa acgtatcaga 720

aactttgtta cattcatcat atcatgggaa aagtaccaga cgcctgcact gcctgcgacc 780

tggtaaatgt ggacttggat gactgtattt ctgagcaata aatgacttaa atcaggtatg 840

gctgctgacg gttatcttcc agattggctc gaggacactc tctctgaagg aatcagacag 900

tggtggaagc tcaaacctgg cccaccaccg ccgaaaccta accaacaaca ccgggacgac 960

agtaggggtc ttgtgcttcc tgggtacaag tacctcggac ccttcaacgg actcgacaaa 1020

ggagagccgg tcaacgaggc agacgccgcg gccctcgagc acgacaaagc ctacgaccac 1080

cagctcaagc aaggggacaa cccgtacctc aaatacaacc acgcggacgc tgaatttcag 1140

gagcgtcttc aagaagatac gtctttcggg ggcaacctcg ggcgagcagt cttccaggcc 1200

aaaaagaggg tactcgagcc tcttggtctg gttgaggaag ctgttaagac ggctcctgga 1260

aaaaagagac ctatagagca gtctcctgca gaaccggact cttcctcggg catcggcaaa 1320

tcaggccagc agcccgctaa gaaaagactc aattttggtc agactggcga cacagagtca 1380

gtcccaggcc ctcaaccaat cggagaaccc cccgcagccc cctctggtgt gggatctaat 1440

acaatggctt caggcggtgg ggcaccaatg gcagacaata acgaaggcgc cgacggagtg 1500

ggtaattcct cgggaaattg gcattgcgat tccacatgga tgggcgacag agttatcacc 1560

accagcacaa gaacctgggc cctccccacc tacaataatc acctctacaa gcaaatctcc 1620

agcgaatcgg gagccaccaa cgacaaccac tacttcggct acagcacccc ctgggggtat 1680

tttgacttta acagattcca ctgtcacttc tcaccacgtg actggcagcg actcatcaac 1740

aacaactggg gatttagacc caagaaactc aatttcaagc tcttcaacat ccaagtcaag 1800

gaggtcacgc agaatgatgg aaccacgacc atcgccaata accttaccag cgcggtgcag 1860

gtcttcacag actctgagta ccagctgccc tacgtcctcg gttcggctca ccagggctgc 1920

cttccgccgt tcccagcaga cgtcttcatg attcctcagt acggctactt gactctgaac 1980

aatggcagcc aagcggtagg acgttcttca ttctactgtc tagagtattt tccctctcag 2040

atgctgagga cgggaaacaa cttcaccttc agctacactt ttgaagacgt gcctttccac 2100

agcagctacg cgcacagcca gagtctggat cggctgatga atcctctcat tgaccagtac 2160

ctgtattacc tgagcaaaac tcagggtaca agtggaacaa cgcagcaatc gagactgcag 2220

ttcagccaag ctgggcctag ctccatggct cagcaggcca aaaactggct accgggaccc 2280

agctaccgac agcagcgaat gtctaagacg gctaatgaca acaacaacag tgaatttgct 2340

tggactgcag ccaccaaata ttacctgaat ggaagaaatt ctctggtcaa tcccgggccc 2400

ccagtggcca gtcacaagga cgatgaggaa aagtatttcc ccatgcacgg aaatctcatc 2460

tttggaaaac aaggcacagg aactaccaat gtggacattg aatcagtgct tattacagac 2520

gaagaagaaa tcagaacaac taatcctgtg gctacagaac aatacggaca ggttgccacc 2580

aaccatcaga gtcagaacac cacagcttcc tatggaagtg tggacagcca gggaatctta 2640

cctggaatgg tgtggcagga ccgcgatgtc tatcttcaag gtcccatttg ggccaaaact 2700

cctcacacgg acggacactt tcatccttct ccgctcatgg gaggctttgg actgaaacac 2760

cctcctcccc agatcctgat caaaaacaca cctgtgccag cgaatcccgc gaccactttc 2820

actcctggaa agtttgcttc gttcattacc cagtattcca cctgacaggt cagcgtggaa 2880

atagagtggg agctgcagaa agaaaacagc aaacgctgga acccagaaat tcagtacacc 2940

tccaactaca acaagtcggt gaatgtggag tttaccgtgg acgcaaacgg tgtttattct 3000

gaaccccgcc ctattggcac tcgttacctt acccggaact tgtaatttcc tgttaatgaa 3060

taagccgatt tatgcgtttc agttgaactt tggtctctgc gaagggcgaa ttcgtttaaa 3120

cct 3123

<210> 58

<211> 2969

<212> DNA

<213> 42.12

<400> 58

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaagg tgcgcgtgga ccaaaagtgc aagtcgtccg 180

cccagatcga ccccaccccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttaca agaccggatg ttcaaatttg 300

aactcacccg ccgtctggag cacgactttg gcaaggtgac aaagcaggaa gtcaaagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca tgagttctac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggataa aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

agacatgcga gagaatgaat cagaatttca acatttgctt cacgcacggg accagagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt cgtcagaaag aggacgtatc 720

ggaaactctg tgccattcat catctgctgg ggcgggctcc cgagattgct tgctcggcct 780

gcgatctggt caacgtggac ctggatgact gtgtttctga gcaataaatg acttaaacca 840

ggtatggctg ccgatggtta tcttccagat tggctcgagg acaacctctc tgagggcatc 900

cgcgagtggt gggacttgaa acctggagcc ccgaaaccca aagccaacca gcaaaagcag 960

gacgacggcc ggggtctggt gcttcctggc tacaagtacc tcggaccctt caacggactc 1020

gacaagggag agccggtcaa cgaggcagac gccgcggccc tcgagcacga caaggcctac 1080

gacaagcagc tcgagcaggg ggacaacccg tacctcaagt acaaccacgc cgacgccgag 1140

tttcaggagc gtcttcaaga agatacgtct tttgggggca acctcgggcg agcagtcttc 1200

caggccaaga agcgggttct cgaacctctc ggtctggttg aggaaggcgc taagacggct 1260

cctggaaaga agagaccggt agagccatca ccccagcgtt ctccagactc ctctacgggc 1320

atcggcaaga caggccagca gcccgcgaaa aagagactca actttgggca gactggcgac 1380

tcagagtcag tgcccgaccc tcaaccaatc ggagaacccc ccgcaggccc ctctggtctg 1440

ggatctggta caatggctgc aggcggtggc gctccaatgg cagacaataa cgaaggcgcc 1500

gacggagtgg gtagttcctc aggaaattgg cattgcgatt ccacatggct gggcgacaga 1560

gtcatcacca ccagcacccg aacctgggcc ctccccacct acaacaacca cctctacaag 1620

caaatctcca acgggacatc gggaggaagc accaacgaca acacctactt cggctacagc 1680

accccctggg ggtattttga ctttaacaga ttccactgcc acttctcacc acgtgactgg 1740

cagcgactca tcaacaacaa ctggggattc cggcccaaga gactcaactt caagctcttc 1800

aacatccagg tcaaggaggt cacgcagaat gaaggcacca agaccatcgc caataacctt 1860

accagcacga ttcaggtctt tacggactcg gaataccagc tcccgtacgt cctcggctct 1920

gcgcaccagg gctgcctgcc tccgttcccg gcggacgtct tcatgattcc tcagtacggg 1980

tacctgactc tgaacaacgg cagtcaggcc gtgggccgtt cctccttcta ctgcctggag 2040

tactttcctt ctcaaatgct gagaacgggc aacaactttg agttcagcta ccagtttgag 2100

gacgtgcctt ttcacagcag ctacgcgcac agccaaagcc tggaccggct gacgaacccc 2160

ctcatcgacc agtacctgta ctacctggcc cggacccaga gcactacggg gtccacaagg 2220

gggctgcagt tccatcaggc tgggcccaac accatggccg agcaatcaaa gaactggctg 2280

cccggaccct gttatcggca gcagagactg tcaaaaaaca tagacagcaa caacaacagt 2340

aactttgcct ggaccggggc cactaaatac catctgaatg gtagaaattc attaaccaac 2400

ccgggcgtag ccatggccac caacaaggac gacgaggacc agttctttcc catcaacgga 2460

gtgctggttt ttggcaaaac gggggctgcc aacaagacaa cgctggaaaa cgtgctaatg 2520

accagcgagg aggagatcaa aaccaccaat cccgtggcta cagaagaata cggtgtggtc 2580

tccagcaacc tgcaatcgtc tacggccgga ccccagacac agactgtcaa cagccagggg 2640

gctctgcccg gcatggtctg gcagaaccgg gacgtgtacc tgcagggtcc catctgggcc 2700

aaaattcctc acacggacgg caactttcac ccgtctcccc tgatgggcgg atttggactc 2760

aaacacccgc ctcctcaaat tctcatcaag tatacttcca actactacaa atctacaaat 2820

gtggactttg ctgtcaatac tgagggtact tattcagagc ctcgccccat tggcacccgt 2880

tacctcaccc gtaacctgta attgcctgtt aatcaataaa ccggttaatt cgtttcagtt 2940

gaactttggt ctctgcgaag ggcgaattc 2969

<210> 59

<211> 3129

<212> DNA

<213> 44.2

<400> 59

gaattcgccc tttctacggc tgcgtcaact ggaccaatga gaactttccc ttcaacgatt 60

gcgtcgacaa gatggtgatc tggtgggagg agggcaagat gacggccaag gtcgtggagt 120

ccgccaaggc cattctcggc ggcagcaaag tgcgcgtgga ccaaaagtgc aagtcgtccg 180

cccagatcga ccccaccccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg 240

acgggaacag caccaccttc gagcaccagc agccgttgca ggaccggatg ttcaagtttg 300

aactcacccg ccgtctggag cacgactttg gcaaggtgac aaagcaggaa gtcagagagt 360

tcttccgctg ggcgcaggat cacgtgaccg aggtggcgca cgagttctac gtcagaaagg 420

gtggagccaa caagagaccc gcccccgatg acgcggataa aagcgagccc aagcgggcct 480

gcccctcagt cgcggatcca tcgacgtcag acgcggaagg agctccggtg gactttgccg 540

acaggtacca aaacaaatgt tctcgtcacg cgggcatgct tcagatgctg tttccctgca 600

aaacatgcga gagaatgaat cagaatttca acatttgctt cacgcacggg accagagact 660

gttcagaatg tttccccggc gtgtcagaat ctcaaccggt cgtcagaaaa aagacgtatc 720

ggaaactctg tgcgattcat catctgctgg gggcgggcac ccgagattgc ttgctcggcc 780

tgcgatctgg tcaacgtgga cctagatgac tgtgtttctg agcaataaat gacttaaacc 840

aggtatggct gccgatggtt atcttccaga ttggctcgag gacaacctct ctgagggcat 900

tcgcgagtgg tgggacttga aacctggagc cccgaaaccc aaagccaacc agcaaaagca 960

ggacgacggc cggggtctgg tgcttcctgg ctacaagtac ctcggaccct tcaacggact 1020

cgacaagggg gagcccgtca acgcggcgga cgcagcggcc ctcgagcacg acaaggccta 1080

cgaccagcag ctcaaagcgg gtgacaatcc gtacctgcgg tataaccacg ccgacgccga 1140

gtttcaggag cgtctgcaag aagatacgtc ttttgggggc aacctcgggc gagcagtctt 1200

ccaggccaag aagcgggttc tcgaacctct cggtctggtt gaggaaggcg ctaagacggc 1260

tcctggaaag aagagaccgg tagagccatc accccagcgt tctccagact cctctacggg 1320

catcggcaag aaaggccagc agcccgcgaa aaagagactc aactttgggc agactggcga 1380

ctcagagtca gtgcccgacc ctcaaccaat cggagaaccc cccgcaggcc cctctggtct 1440

gggatctggt acaatggctg caggcggtgg cgctccaatg gcagacaata acgaaggcgc 1500

cgacggagtg ggtagttcct caggaaattg gcattgcgat tccacatggc tgggcgacag 1560

agtcatcacc accagcaccc gaacctgggc cctccccacc tacaacaacc acctctacaa 1620

gcaaatctcc aacgggactt cgggaggaag caccaacgac aacacctact tcggctacag 1680

caccccctgg gggtattttg actttaacag attccactgc cacttctcac cacgtgactg 1740

gcagcgactc atcaacaaca actggggatt ccggcccaag agactcaact tcaagctctt 1800

caacatccag gtcaaggagg tcacgcagaa tgaaggcacc aagaccatcg ccaataacct 1860

taccagcacg attcaggtct ttacggactc ggaataccag ctcccgtacg tcctcggctc 1920

tgcgcaccag ggctgcctgc ctccgttccc ggcggacgtc ttcatgattc ctcagtacgg 1980

gtacctgact ctgaacaatg gcagtcaggc cgtgggccgt tcctccttct actgcctgga 2040

gtactttcct tctcaaatgc tgagaacggg caacaacttt gagttcagct accagtttga 2100

ggacgtgcct tttcacagca gctacgcgca cagccaaagc ctggaccggc tgatgaaccc 2160

cctcatcgac cagtacctgt actacctgtc tcggactcag tccacgggag gtaccgcagg 2220

aactcagcag ttgctatttt ctcaggccgg gcctaataac atgtcggctc aggccaaaaa 2280

ctggctaccc gggccctgct accggcagca acgcgtctcc acgacactgt cgcaaaataa 2340

caacagcaac tttgcctgga ccggtgccac caagtatcat ctgaatggca gagactctct 2400

ggtaaatccc ggtgtcgcta tggcaaccca caaggacgac gaagagcgat tttttccgtc 2460

cagcggagtc ttaatgtttg ggaaacaggg agctggaaaa gacaacgtgg actatagcag 2520

cgttatgcta accagtgagg aagaaattaa aaccaccaac ccagtggcca cagaacagta 2580

cggcgtggtg gccgataacc tgcaacagca aaacgccgct cctattgtag gggccgtcaa 2640

cagtcaagga gccttacctg gcatggtctg gcagaaccgg gacgtgtacc tgcagggtcc 2700

tatctgggcc aagattcctc acacggacgg aaactttcat ccctcgccgc tgatgggagg 2760

ctttggactg aaacacccgc ctcctcagat cctgattaag aatacacctg ttcccgcgga 2820

tcctccaact accttcagtc aagctaagct ggcgtcgttc atcacgcagt acagcaccgg 2880

acaggtcagc gtggaaattg aatgggagct gcagaaagaa aacagcaaac gctggaaccc 2940

agagattcaa tacacttcca actactacaa atctacaaat gtggactttg ctgttaacac 3000

agatggcact tattctgagc ctcgccccat cggcacccgt tacctcaccc gtaatctgta 3060

attgcttgtt aatcaataaa ccggttgatt cgtttcagtt gaactttggt ctctgcgaag 3120

ggcgaattc 3129

<210> 60

<211> 733

<212> PRT

<213> capsid protein of AAV serotype, clone C1VP1

<400> 60

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Leu Glu Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly Lys

145 150 155 160

Lys Gly Lys Gln Pro Ala Lys Lys Arg Leu Asn Phe Glu Glu Asp Thr

165 170 175

Gly Ala Gly Asp Gly Pro Pro Glu Gly Ser Asp Thr Ser Ala Met Ser

180 185 190

Ser Asp Ile Glu Met Arg Ala Ala Pro Gly Gly Asn Ala Val Asp Ala

195 200 205

Gly Gln Gly Ser Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys

210 215 220

Asp Ser Thr Trp Ser Glu Gly Lys Val Thr Thr Thr Ser Thr Arg Thr

225 230 235 240

Trp Val Leu Pro Thr Tyr Asn Asn His Leu Tyr Leu Arg Leu Gly Thr

245 250 255

Thr Ser Asn Ser Asn Thr Tyr Asn Gly Phe Ser Thr Pro Trp Gly Tyr

260 265 270

Phe Asp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln

275 280 285

Arg Leu Ile Asn Asn Asn Trp Gly Leu Arg Pro Lys Ala Met Arg Val

290 295 300

Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Thr Ser Asn Gly Glu

305 310 315 320

Thr Thr Val Ala Asn Asn Leu Thr Ser Thr Val Gln Ile Phe Ala Asp

325 330 335

Ser Ser Tyr Glu Leu Pro Tyr Val Met Asp Ala Gly Gln Glu Gly Ser

340 345 350

Leu Ser Pro Phe Pro Asn Asp Val Phe Met Val Pro Gln Tyr Gly Tyr

355 360 365

Cys Gly Ile Val Thr Gly Glu Asn Gln Asn Gln Thr Asp Arg Asn Ala

370 375 380

Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg Thr Gly Asn

385 390 395 400

Asn Phe Glu Met Ala Tyr Asn Phe Gly Lys Val Pro Phe His Ser Met

405 410 415

Tyr Ala Tyr Ser Gln Ser Pro Asp Arg Leu Met Asn Pro Leu Leu Asp

420 425 430

Gln Tyr Leu Trp His Leu Gln Ser Thr Thr Ser Gly Glu Thr Leu Asn

435 440 445

Gln Gly Asn Ala Ala Thr Thr Phe Gly Lys Ile Arg Ser Gly Asp Phe

450 455 460

Ala Phe Tyr Arg Lys Asn Trp Leu Pro Gly Pro Cys Val Lys Gln Gln

465 470 475 480

Arg Leu Ser Lys Thr Ala Ser Gln Asn Tyr Lys Ile Pro Ala Ser Gly

485 490 495

Gly Asn Ala Leu Leu Lys Tyr Asp Thr His Tyr Thr Leu Asn Asn Arg

500 505 510

Trp Ser Asn Ile Ala Pro Gly Pro Pro Met Ala Thr Ala Gly Pro Ser

515 520 525

Asp Gly Asp Phe Ser Asn Ala Gln Leu Ile Phe Pro Gly Pro Ser Val

530 535 540

Thr Gly Asn Thr Thr Thr Ser Ala Asn Asn Leu Leu Phe Thr Ser Glu

545 550 555 560

Glu Glu Ile Ala Ala Thr Asn Pro Arg Asp Thr Asp Met Phe Gly Gln

565 570 575

Ile Ala Asp Asn Asn Gln Asn Ala Thr Thr Ala Pro Ile Thr Gly Asn

580 585 590

Val Thr Ala Met Gly Val Leu Pro Gly Met Val Trp Gln Asn Arg Asp

595 600 605

Ile Tyr Tyr Gln Gly Pro Ile Trp Ala Lys Ile Pro His Ala Asp Gly

610 615 620

His Phe His Pro Ser Pro Leu Ile Gly Gly Phe Gly Leu Lys His Pro

625 630 635 640

Pro Pro Gln Ile Phe Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Ala

645 650 655

Thr Thr Phe Thr Ala Ala Arg Val Asp Ser Phe Ile Thr Gln Tyr Ser

660 665 670

Thr Gly Gln Val Ala Val Gln Ile Glu Trp Glu Ile Glu Lys Glu Arg

675 680 685

Ser Lys Arg Trp Asn Pro Glu Val Gln Phe Thr Ser Asn Tyr Gly Asn

690 695 700

Gln Ser Ser Met Leu Trp Ala Pro Asp Thr Thr Gly Lys Tyr Thr Glu

705 710 715 720

Pro Arg Val Ile Gly Ser Arg Tyr Leu Thr Asn His Leu

725 730

<210> 61

<211> 733

<212> PRT

<213> capsid protein of AAV serotype, clone C2VP1

<400> 61

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Leu

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe His Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Leu Glu Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly Lys

145 150 155 160

Lys Gly Lys Gln Pro Ala Lys Lys Arg Leu Asn Phe Glu Glu Asp Thr

165 170 175

Gly Ala Gly Asp Gly Pro Pro Glu Gly Ser Asp Thr Ser Ala Met Ser

180 185 190

Ser Asp Ile Glu Met Arg Ala Ala Pro Gly Gly Asn Ala Val Asp Ala

195 200 205

Gly Gln Gly Ser Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys

210 215 220

Asp Ser Thr Trp Ser Glu Gly Lys Val Thr Thr Thr Ser Thr Arg Thr

225 230 235 240

Trp Val Leu Pro Thr Tyr Asn Asn His Leu Tyr Leu Arg Leu Gly Thr

245 250 255

Thr Ser Asn Ser Asn Thr Tyr Asn Gly Phe Ser Thr Pro Trp Gly Tyr

260 265 270

Phe Asp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln

275 280 285

Arg Leu Ile Asn Asn Asn Trp Gly Leu Arg Pro Lys Ala Met Arg Val

290 295 300

Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Thr Ser Asn Gly Glu

305 310 315 320

Thr Thr Val Ala Asn Asn Leu Thr Ser Thr Val Gln Ile Phe Ala Asp

325 330 335

Ser Ser Tyr Glu Leu Pro Tyr Val Met Asp Ala Gly Gln Glu Gly Ser

340 345 350

Leu Pro Pro Phe Pro Asn Asp Val Phe Met Val Pro Gln Tyr Gly Tyr

355 360 365

Cys Gly Ile Val Thr Gly Glu Asn Gln Asn Gln Thr Asp Arg Asn Ala

370 375 380

Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg Thr Gly Asn

385 390 395 400

Asn Phe Glu Met Ala Tyr Asn Phe Glu Lys Val Pro Phe His Ser Met

405 410 415

Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro Leu Leu Asp

420 425 430

Gln Tyr Leu Trp His Leu Gln Ser Thr Thr Ser Gly Glu Thr Leu Asn

435 440 445

Gln Gly Asn Ala Ala Thr Thr Phe Gly Lys Ile Arg Ser Gly Asp Phe

450 455 460

Ala Phe Tyr Arg Lys Asn Trp Leu Pro Gly Pro Cys Val Lys Gln Gln

465 470 475 480

Arg Phe Ser Lys Thr Ala Ser Gln Asn Tyr Lys Ile Pro Ala Ser Gly

485 490 495

Gly Asn Ala Leu Leu Lys Tyr Asp Thr His Tyr Thr Leu Asn Asn Arg

500 505 510

Trp Ser Asn Ile Ala Pro Gly Pro Pro Met Ala Thr Ala Gly Pro Ser

515 520 525

Asp Gly Asp Phe Ser Asn Ala Gln Leu Ile Phe Pro Gly Pro Ser Val

530 535 540

Thr Gly Asn Thr Thr Thr Ser Ala Asn Asn Leu Leu Phe Thr Ser Glu

545 550 555 560

Gly Glu Ile Ala Ala Thr Asn Pro Arg Asp Thr Asp Met Phe Gly Gln

565 570 575

Ile Ala Asp Asn Asn Gln Asn Ala Thr Thr Ala Pro Ile Thr Gly Asn

580 585 590

Val Thr Ala Met Gly Val Leu Pro Gly Met Val Trp Gln Asn Arg Asp

595 600 605

Ile Tyr Tyr Gln Gly Pro Ile Trp Ala Lys Ile Pro His Ala Asp Gly

610 615 620

His Phe His Pro Ser Pro Leu Ile Gly Gly Phe Gly Leu Lys His Pro

625 630 635 640

Pro Pro Gln Ile Phe Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Ala

645 650 655

Thr Thr Phe Thr Ala Ala Arg Val Asp Ser Phe Ile Thr Gln Tyr Ser

660 665 670

Thr Gly Gln Val Ala Val Gln Ile Glu Trp Glu Ile Glu Lys Glu Arg

675 680 685

Ser Lys Arg Arg Asn Pro Glu Val Gln Phe Thr Ser Asn Tyr Gly Asn

690 695 700

Gln Ser Ser Met Leu Trp Ala Pro Asp Thr Thr Gly Lys Tyr Thr Glu

705 710 715 720

Pro Arg Val Ile Gly Ser Arg Tyr Leu Thr Asn His Leu

725 730

<210> 62

<211> 733

<212> PRT

<213> capsid protein of AAV serotype, clone C5VP1@2

<400> 62

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Glu Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Leu Glu Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly Lys

145 150 155 160

Lys Gly Lys Gln Pro Ala Lys Lys Arg Leu Asn Phe Glu Glu Asp Thr

165 170 175

Gly Ala Gly Asp Gly Pro Pro Glu Gly Ser Asp Thr Ser Ala Met Ser

180 185 190

Ser Asp Ile Glu Met Arg Ala Ala Pro Gly Gly Asn Ala Val Asp Ala

195 200 205

Gly Gln Gly Ser Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys

210 215 220

Asp Ser Thr Trp Ser Glu Gly Lys Val Thr Thr Thr Ser Thr Arg Thr

225 230 235 240

Trp Val Leu Pro Thr Tyr Asn Asn His Leu Tyr Leu Arg Leu Gly Thr

245 250 255

Thr Ser Asn Ser Asn Thr Tyr Asn Gly Phe Ser Thr Pro Trp Gly Tyr

260 265 270

Phe Asp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln

275 280 285

Arg Leu Ile Asn Asn Asn Trp Gly Leu Arg Pro Lys Ala Met Arg Val

290 295 300

Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Thr Ser Asn Gly Glu

305 310 315 320

Thr Thr Val Ala Asn Asn Leu Thr Ser Thr Val Gln Ile Phe Ala Asp

325 330 335

Ser Ser Tyr Glu Leu Pro Tyr Val Met Asp Ala Gly Gln Glu Gly Ser

340 345 350

Leu Pro Pro Phe Pro Asn Asp Val Phe Met Val Pro Gln Tyr Gly Tyr

355 360 365

Cys Gly Ile Val Thr Gly Glu Asn Gln Asn Gln Thr Asp Arg Asn Ala

370 375 380

Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg Thr Gly Asn

385 390 395 400

Asn Phe Glu Thr Ala Tyr Asn Phe Glu Lys Val Pro Phe His Ser Met

405 410 415

Tyr Ala His Ser Gln Ser Leu Asp Gly Leu Met Asn Pro Leu Leu Asp

420 425 430

Gln Tyr Leu Trp His Leu Gln Ser Thr Thr Ser Gly Glu Thr Leu Asn

435 440 445

Gln Gly Asn Ala Ala Thr Thr Phe Gly Lys Ile Arg Ser Gly Asp Phe

450 455 460

Ala Phe Tyr Arg Lys Asn Trp Leu Pro Gly Pro Cys Val Lys Gln Gln

465 470 475 480

Arg Phe Ser Lys Thr Ala Ser Gln Asn Tyr Lys Ile Pro Ala Ser Gly

485 490 495

Gly Asn Ala Leu Leu Lys Tyr Asp Thr His Tyr Thr Leu Asn Asn Arg

500 505 510

Trp Ser Asn Ile Ala Pro Gly Pro Pro Met Ala Thr Ala Gly Pro Ser

515 520 525

Asp Gly Asp Phe Ser Asn Ala Gln Leu Ile Phe Pro Gly Pro Ser Val

530 535 540

Thr Gly Asn Thr Thr Thr Ser Ala Asn Asn Leu Leu Phe Thr Ser Glu

545 550 555 560

Glu Glu Ile Ala Ala Thr Asn Pro Arg Asp Thr Asp Met Phe Gly Gln

565 570 575

Ile Ala Asp Asn Asn Gln Asn Ala Thr Thr Ala Pro Ile Thr Gly Asn

580 585 590

Val Thr Ala Met Gly Val Leu Pro Gly Met Val Trp Gln Asn Arg Asp

595 600 605

Ile Tyr Tyr Gln Gly Pro Ile Trp Ala Lys Ile Pro His Ala Asp Gly

610 615 620

His Phe His Pro Ser Pro Leu Ile Gly Gly Phe Gly Leu Lys His Pro

625 630 635 640

Pro Pro Gln Ile Phe Ile Lys Asn Thr Pro Val Pro Ala Tyr Pro Ala

645 650 655

Thr Thr Phe Thr Ala Ala Arg Val Asp Ser Phe Ile Thr Gln Tyr Ser

660 665 670

Thr Gly Gln Val Ala Val Gln Ile Glu Trp Glu Ile Glu Lys Glu Arg

675 680 685

Ser Lys Arg Trp Asn Pro Glu Val Gln Phe Thr Ser Asn Cys Gly Asn

690 695 700

Gln Ser Ser Met Leu Trp Ala Pro Asp Thr Thr Gly Lys Tyr Thr Glu

705 710 715 720

Pro Arg Val Ile Gly Ser Arg Tyr Leu Thr Asn His Leu

725 730

<210> 63

<211> 734

<212> PRT

<213> capsid protein of AAV serotype cloning of AAV4VP1

<400> 63

Met Thr Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser Glu

1 5 10 15

Gly Val Arg Glu Trp Trp Ala Leu Gln Pro Gly Ala Pro Lys Pro Lys

20 25 30

Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro Gly

35 40 45

Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro Val

50 55 60

Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp Gln

65 70 75 80

Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala Asp

85 90 95

Ala Glu Phe Gln Gln Arg Leu Gln Gly Asp Thr Ser Phe Gly Gly Asn

100 105 110

Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Leu

115 120 125

Gly Leu Val Glu Gln Ala Gly Glu Thr Ala Pro Gly Lys Lys Arg Pro

130 135 140

Leu Ile Glu Ser Pro Gln Gln Pro Asp Ser Ser Thr Gly Ile Gly Lys

145 150 155 160

Lys Gly Lys Gln Pro Ala Lys Lys Lys Leu Val Phe Glu Asp Glu Thr

165 170 175

Gly Ala Gly Asp Gly Pro Pro Glu Gly Ser Thr Ser Gly Ala Met Ser

180 185 190

Asp Asp Ser Glu Met Arg Ala Ala Ala Gly Gly Ala Ala Val Glu Gly

195 200 205

Gly Gln Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys

210 215 220

Asp Ser Thr Trp Ser Glu Gly His Val Thr Thr Thr Ser Thr Arg Thr

225 230 235 240

Trp Val Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Arg Leu Gly Glu

245 250 255

Ser Leu Gln Ser Asn Thr Tyr Asn Gly Phe Ser Thr Pro Trp Gly Tyr

260 265 270

Phe Asp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln

275 280 285

Arg Leu Ile Asn Asn Asn Trp Gly Met Arg Pro Lys Ala Met Arg Val

290 295 300

Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Thr Ser Asn Gly Glu

305 310 315 320

Thr Thr Val Ala Asn Asn Leu Thr Ser Thr Val Gln Ile Phe Ala Asp

325 330 335

Ser Ser Tyr Glu Leu Pro Tyr Val Met Asp Ala Gly Gln Glu Gly Ser

340 345 350

Leu Pro Pro Phe Pro Asn Asp Val Phe Met Val Pro Gln Tyr Gly Tyr

355 360 365

Cys Gly Leu Val Thr Gly Asn Thr Ser Gln Gln Gln Thr Asp Arg Asn

370 375 380

Ala Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg Thr Gly

385 390 395 400

Asn Asn Phe Glu Ile Thr Tyr Ser Phe Glu Lys Val Pro Phe His Ser

405 410 415

Met Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro Leu Ile

420 425 430

Asp Gln Tyr Leu Trp Gly Leu Gln Ser Thr Thr Thr Gly Thr Thr Leu

435 440 445

Asn Ala Gly Thr Ala Thr Thr Asn Phe Thr Lys Leu Arg Pro Thr Asn

450 455 460

Phe Ser Asn Phe Lys Lys Asn Trp Leu Pro Gly Pro Ser Ile Lys Gln

465 470 475 480

Gln Gly Phe Ser Lys Thr Ala Asn Gln Asn Tyr Lys Ile Pro Ala Thr

485 490 495

Gly Ser Asp Ser Leu Ile Lys Tyr Glu Thr His Ser Thr Leu Asp Gly

500 505 510

Arg Trp Ser Ala Leu Thr Pro Gly Pro Pro Met Ala Thr Ala Gly Pro

515 520 525

Ala Asp Ser Lys Phe Ser Asn Ser Gln Leu Ile Phe Ala Gly Pro Lys

530 535 540

Gln Asn Gly Asn Thr Ala Thr Val Pro Gly Thr Leu Ile Phe Thr Ser

545 550 555 560

Glu Glu Glu Leu Ala Ala Thr Asn Ala Thr Asp Thr Asp Met Trp Gly

565 570 575

Asn Leu Pro Gly Gly Asp Gln Ser Asn Ser Asn Leu Pro Thr Val Asp

580 585 590

Arg Leu Thr Ala Leu Gly Ala Val Pro Gly Met Val Trp Gln Asn Arg

595 600 605

Asp Ile Tyr Tyr Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp

610 615 620

Gly His Phe His Pro Ser Pro Leu Ile Gly Gly Phe Gly Leu Lys His

625 630 635 640

Pro Pro Pro Gln Ile Phe Ile Lys Asn Thr Pro Val Pro Ala Asn Pro

645 650 655

Ala Thr Thr Phe Ser Ser Thr Pro Val Asn Ser Phe Ile Thr Gln Tyr

660 665 670

Ser Thr Gly Gln Val Ser Val Gln Ile Asp Trp Glu Ile Gln Lys Glu

675 680 685

Arg Ser Lys Arg Trp Asn Pro Glu Val Gln Phe Thr Ser Asn Tyr Gly

690 695 700

Gln Gln Asn Ser Leu Leu Trp Ala Pro Asp Ala Ala Gly Lys Tyr Thr

705 710 715 720

Glu Pro Arg Ala Ile Gly Thr Arg Tyr Leu Thr His His Leu

725 730

<210> 64

<211> 736

<212> PRT

<213> capsid protein of AAV serotype, clone AAV1

<400> 64

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly

145 150 155 160

Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro

180 185 190

Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Ser Ala Ser Thr Gly Ala Ser Asn Asp Asn His

260 265 270

Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe

275 280 285

His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn

290 295 300

Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln

305 310 315 320

Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn

325 330 335

Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro

340 345 350

Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala

355 360 365

Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly

370 375 380

Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro

385 390 395 400

Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe

405 410 415

Glu Glu Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp

420 425 430

Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg

435 440 445

Thr Gln Asn Gln Ser Gly Ser Ala Gln Asn Lys Asp Leu Leu Phe Ser

450 455 460

Arg Gly Ser Pro Ala Gly Met Ser Val Gln Pro Lys Asn Trp Leu Pro

465 470 475 480

Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys Thr Lys Thr Asp Asn

485 490 495

Asn Asn Ser Asn Phe Thr Trp Thr Gly Ala Ser Lys Tyr Asn Leu Asn

500 505 510

Gly Arg Glu Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys

515 520 525

Asp Asp Glu Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly

530 535 540

Lys Glu Ser Ala Gly Ala Ser Asn Thr Ala Leu Asp Asn Val Met Ile

545 550 555 560

Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Arg

565 570 575

Phe Gly Thr Val Ala Val Asn Phe Gln Ser Ser Ser Thr Asp Pro Ala

580 585 590

Thr Gly Asp Val His Ala Met Gly Ala Leu Pro Gly Met Val Trp Gln

595 600 605

Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

610 615 620

Thr Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

625 630 635 640

Lys Asn Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

645 650 655

Asn Pro Pro Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile Thr

660 665 670

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

675 680 685

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gln Tyr Thr Ser Asn

690 695 700

Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr Val Asp Asn Asn Gly Leu

705 710 715 720

Tyr Thr Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Pro Leu

725 730 735

<210> 65

<211> 736

<212> PRT

<213> capsid protein of AAV serotype, cloning of AAV6VP1

<400> 65

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Phe Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly

145 150 155 160

Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro

180 185 190

Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Ser Ala Ser Thr Gly Ala Ser Asn Asp Asn His

260 265 270

Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe

275 280 285

His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn

290 295 300

Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln

305 310 315 320

Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn

325 330 335

Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro

340 345 350

Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala

355 360 365

Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly

370 375 380

Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro

385 390 395 400

Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe

405 410 415

Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp

420 425 430

Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg

435 440 445

Thr Gln Asn Gln Ser Gly Ser Ala Gln Asn Lys Asp Leu Leu Phe Ser

450 455 460

Arg Gly Ser Pro Ala Gly Met Ser Val Gln Pro Lys Asn Trp Leu Pro

465 470 475 480

Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys Thr Lys Thr Asp Asn

485 490 495

Asn Asn Ser Asn Phe Thr Trp Thr Gly Ala Ser Lys Tyr Asn Leu Asn

500 505 510

Gly Arg Glu Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys

515 520 525

Asp Asp Lys Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly

530 535 540

Lys Glu Ser Ala Gly Ala Ser Asn Thr Ala Leu Asp Asn Val Met Ile

545 550 555 560

Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Arg

565 570 575

Phe Gly Thr Val Ala Val Asn Leu Gln Ser Ser Ser Thr Asp Pro Ala

580 585 590

Thr Gly Asp Val His Val Met Gly Ala Leu Pro Gly Met Val Trp Gln

595 600 605

Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

610 615 620

Thr Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

625 630 635 640

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

645 650 655

Asn Pro Pro Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile Thr

660 665 670

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

675 680 685

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gln Tyr Thr Ser Asn

690 695 700

Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr Val Asp Asn Asn Gly Leu

705 710 715 720

Tyr Thr Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Pro Leu

725 730 735

<210> 66

<211> 735

<212> PRT

<213> capsid protein of AAV serotype, clone A3.3

<400> 66

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser

1 5 10 15

Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro

20 25 30

Lys Pro Asn Gln Gln His Arg Asp Asp Ser Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

His Gln Leu Lys Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Ala Val Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Gln Ser Pro Ala Glu Pro Asp Ser Ser Ser Gly Ile Gly

145 150 155 160

Lys Ser Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Thr Glu Ser Val Pro Gly Pro Gln Pro Ile Gly Glu Pro Pro

180 185 190

Ala Ala Pro Ser Gly Val Gly Ser Asn Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Met Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Ser Glu Ser Gly Ala Thr Asn Asp Asn His Tyr

260 265 270

Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His

275 280 285

Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp

290 295 300

Gly Phe Arg Pro Lys Lys Leu Asn Phe Lys Leu Phe Asn Ile Gln Val

305 310 315 320

Lys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu

325 330 335

Thr Ser Ala Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr

340 345 350

Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp

355 360 365

Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser

370 375 380

Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser

385 390 395 400

Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu

405 410 415

Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg

420 425 430

Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Lys Thr

435 440 445

Gln Gly Thr Ser Gly Thr Thr Gln Gln Ser Arg Leu Gln Phe Ser Gln

450 455 460

Ala Gly Pro Ser Ser Met Ala Gln Gln Ala Lys Asn Trp Leu Pro Gly

465 470 475 480

Pro Ser Tyr Arg Gln Gln Arg Met Ser Lys Thr Ala Asn Asp Asn Asn

485 490 495

Asn Ser Glu Phe Ala Trp Thr Ala Ala Thr Lys Tyr Tyr Leu Asn Gly

500 505 510

Arg Asn Ser Leu Val Asn Pro Gly Pro Pro Val Ala Ser His Lys Asp

515 520 525

Asp Glu Glu Lys Tyr Phe Pro Met His Gly Asn Leu Ile Phe Gly Lys

530 535 540

Gln Gly Thr Gly Thr Thr Asn Val Asp Ile Glu Ser Val Leu Ile Thr

545 550 555 560

Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr

565 570 575

Gly Gln Val Ala Thr Asn His Gln Ser Gln Asn Thr Thr Ala Ser Tyr

580 585 590

Gly Ser Val Asp Ser Gln Gly Ile Leu Pro Gly Met Val Trp Gln Asp

595 600 605

Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Thr Pro His Thr

610 615 620

Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys

625 630 635 640

His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn

645 650 655

Pro Ala Thr Thr Phe Thr Pro Gly Lys Phe Ala Ser Phe Ile Thr Gln

660 665 670

Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys

675 680 685

Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr

690 695 700

Asn Lys Ser Val Asn Val Glu Phe Thr Val Asp Ala Asn Gly Val Tyr

705 710 715 720

Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 67

<211> 735

<212> PRT

<213> capsid protein of AAV serotype, clone A3.7

<400> 67

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser

1 5 10 15

Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro

20 25 30

Lys Pro Asn Gln Gln His Arg Asp Asp Ser Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

His Gln Leu Lys Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Ala Val Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Gln Ser Pro Ala Glu Pro Asp Ser Ser Ser Gly Ile Gly

145 150 155 160

Lys Ser Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

180 185 190

Ala Ala Pro Ser Gly Val Gly Ser Asn Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Met Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn Arg Leu

245 250 255

Tyr Lys Gln Ile Ser Ser Glu Ser Gly Ala Thr Asn Asp Asn His Tyr

260 265 270

Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His

275 280 285

Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp

290 295 300

Gly Phe Arg Pro Lys Lys Leu Asn Phe Lys Leu Phe Asn Ile Gln Val

305 310 315 320

Lys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu

325 330 335

Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr

340 345 350

Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp

355 360 365

Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser

370 375 380

Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser

385 390 395 400

Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu

405 410 415

Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg

420 425 430

Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Lys Thr

435 440 445

Gln Gly Thr Ser Gly Thr Thr Gln Gln Ser Arg Leu Gln Phe Ser Gln

450 455 460

Ala Gly Pro Ser Ser Met Ala Gln Gln Ala Lys Asn Trp Leu Pro Gly

465 470 475 480

Pro Ser Tyr Arg Gln Gln Arg Met Ser Lys Thr Ala Asn Asp Asn Asn

485 490 495

Asn Ser Glu Phe Ala Trp Thr Ala Ala Thr Lys Tyr Tyr Leu Asn Gly

500 505 510

Arg Asn Ser Leu Val Asn Pro Gly Pro Pro Met Ala Ser His Lys Asp

515 520 525

Asp Glu Glu Lys Tyr Phe Pro Met His Gly Asn Leu Ile Phe Gly Lys

530 535 540

Gln Gly Thr Gly Thr Thr Asn Val Asp Ile Glu Ser Val Leu Ile Thr

545 550 555 560

Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr

565 570 575

Gly Gln Val Ala Thr Asn His Gln Ser Gln Asn Thr Thr Ala Ser Tyr

580 585 590

Gly Ser Val Asp Ser Gln Gly Ile Leu Pro Gly Met Val Trp Gln Asp

595 600 605

Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Thr Pro His Thr

610 615 620

Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys

625 630 635 640

His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn

645 650 655

Pro Ala Thr Thr Phe Thr Pro Gly Lys Phe Ala Ser Phe Ile Thr Gln

660 665 670

Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys

675 680 685

Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr

690 695 700

Asn Lys Ser Val Asn Val Glu Phe Thr Val Asp Ala Asn Gly Val Tyr

705 710 715 720

Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 68

<211> 735

<212> PRT

<213> capsid protein of AAV serotype, clone A3.4

<400> 68

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser

1 5 10 15

Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro

20 25 30

Lys Pro Asn Gln Gln His Arg Asp Asp Ser Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

His Gln Leu Lys Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Ala Val Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Gln Ser Pro Ala Glu Pro Asp Ser Ser Ser Gly Ile Gly

145 150 155 160

Glu Ser Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

180 185 190

Ala Ala Pro Ser Gly Val Gly Ser Asn Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asp Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Met Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Ser Glu Ser Gly Ala Thr Asn Asp Asn His Tyr

260 265 270

Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His

275 280 285

Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp

290 295 300

Gly Phe Arg Pro Lys Lys Leu Asn Phe Lys Leu Phe Asn Ile Gln Val

305 310 315 320

Lys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu

325 330 335

Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr

340 345 350

Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp

355 360 365

Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser

370 375 380

Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser

385 390 395 400

Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu

405 410 415

Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg

420 425 430

Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Lys Thr

435 440 445

Gln Gly Thr Ser Gly Thr Thr Gln Gln Ser Arg Leu Gln Phe Ser Gln

450 455 460

Ala Gly Pro Ser Ser Met Ala Gln Gln Ala Lys Asn Trp Leu Pro Gly

465 470 475 480

Pro Ser Tyr Arg Gln Gln Arg Met Ser Lys Thr Ala Asn Asp Asn Asn

485 490 495

Asn Ser Glu Phe Ala Trp Thr Ala Ala Thr Lys Tyr Tyr Leu Asn Gly

500 505 510

Arg Asn Ser Leu Val Asn Pro Gly Pro Pro Met Ala Ser His Lys Asp

515 520 525

Asp Glu Glu Lys Tyr Phe Pro Met His Gly Asn Leu Ile Phe Gly Lys

530 535 540

Gln Gly Thr Gly Thr Thr Asn Val Asp Ile Glu Ser Val Leu Ile Thr

545 550 555 560

Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr

565 570 575

Gly Gln Val Ala Thr Asn His Gln Ser Gln Asp Thr Thr Ala Ser Tyr

580 585 590

Gly Ser Val Asp Ser Gln Gly Ile Leu Pro Gly Met Val Trp Gln Asp

595 600 605

Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Thr Pro His Thr

610 615 620

Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys

625 630 635 640

His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn

645 650 655

Pro Ala Thr Thr Phe Thr Pro Gly Lys Phe Ala Ser Phe Ile Thr Gln

660 665 670

Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys

675 680 685

Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr

690 695 700

Asn Lys Ser Val Asn Val Glu Phe Thr Val Asp Ala Asn Gly Val Tyr

705 710 715 720

Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 69

<211> 735

<212> PRT

<213> capsid protein of AAV serotype, clone A3.5

<400> 69

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser

1 5 10 15

Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro

20 25 30

Lys Pro Asn Gln Gln His Arg Asp Asp Ser Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

His Gln Leu Lys Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Ala Val Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Gln Ser Pro Ala Glu Pro Asp Ser Ser Ser Gly Ile Gly

145 150 155 160

Lys Ser Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

180 185 190

Ala Ala Pro Ser Gly Val Gly Ser Asn Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Met Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Ser Glu Ser Gly Ala Thr Asn Asp Asn His Tyr

260 265 270

Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His

275 280 285

Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp

290 295 300

Gly Phe Arg Pro Lys Lys Leu Asn Phe Lys Leu Phe Asn Ile Gln Val

305 310 315 320

Lys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu

325 330 335

Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr

340 345 350

Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp

355 360 365

Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser

370 375 380

Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser

385 390 395 400

Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu

405 410 415

Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg

420 425 430

Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Lys Thr

435 440 445

Gln Gly Thr Ser Gly Thr Thr Gln Gln Ser Arg Leu Gln Phe Asn Gln

450 455 460

Ala Gly Pro Ser Ser Met Ala Gln Gln Ala Lys Asn Trp Leu Pro Gly

465 470 475 480

Pro Ser Tyr Arg Gln Gln Arg Met Ser Lys Thr Ala Asn Asp Asn Asn

485 490 495

Asn Ser Glu Phe Ala Trp Thr Ala Ala Thr Lys Tyr Tyr Pro Asn Gly

500 505 510

Arg Asn Ser Leu Val Asn Pro Gly Pro Pro Met Ala Ser His Lys Asp

515 520 525

Asp Glu Glu Lys Tyr Phe Pro Met His Gly Asn Leu Ile Phe Gly Lys

530 535 540

Gln Gly Thr Gly Thr Thr Asn Val Asp Ile Glu Ser Val Leu Ile Thr

545 550 555 560

Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr

565 570 575

Gly Gln Val Ala Thr Asn Arg Gln Ser Gln Asn Thr Thr Ala Ser Tyr

580 585 590

Gly Ser Val Asp Ser Gln Gly Ile Leu Pro Gly Met Val Trp Gln Asp

595 600 605

Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Thr Pro His Thr

610 615 620

Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys

625 630 635 640

His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn

645 650 655

Pro Ala Thr Thr Phe Thr Pro Gly Lys Phe Ala Ser Phe Ile Thr Gln

660 665 670

Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys

675 680 685

Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr

690 695 700

Asn Lys Ser Val Asn Val Glu Phe Thr Val Asp Ala Asn Gly Val Tyr

705 710 715 720

Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 70

<211> 735

<212> PRT

<213> capsid protein of AAV serotype, clone AAV2

<400> 70

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser

1 5 10 15

Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro

20 25 30

Lys Pro Ala Glu Arg His Lys Asp Asp Ser Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Arg Gln Leu Asp Ser Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Pro Val Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu His Ser Pro Val Glu Pro Asp Ser Ser Ser Gly Thr Gly

145 150 155 160

Lys Ala Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Ala Asp Ser Val Pro Asp Pro Gln Pro Leu Gly Gln Pro Pro

180 185 190

Ala Ala Pro Ser Gly Leu Gly Thr Asn Thr Met Ala Thr Gly Ser Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Met Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Ser Gln Ser Gly Ala Ser Asn Asp Asn His Tyr

260 265 270

Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His

275 280 285

Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp

290 295 300

Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln Val

305 310 315 320

Lys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu

325 330 335

Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr

340 345 350

Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp

355 360 365

Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser

370 375 380

Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser

385 390 395 400

Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu

405 410 415

Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg

420 425 430

Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Arg Thr

435 440 445

Asn Thr Pro Ser Gly Thr Thr Thr Gln Ser Arg Leu Gln Phe Ser Gln

450 455 460

Ala Gly Ala Ser Asp Ile Arg Asp Gln Ser Arg Asn Trp Leu Pro Gly

465 470 475 480

Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys Thr Ser Ala Asp Asn Asn

485 490 495

Asn Ser Glu Tyr Ser Trp Thr Gly Ala Thr Lys Tyr His Leu Asn Gly

500 505 510

Arg Asp Ser Leu Val Asn Pro Gly Pro Ala Met Ala Ser His Lys Asp

515 520 525

Asp Glu Glu Lys Phe Phe Pro Gln Ser Gly Val Leu Ile Phe Gly Lys

530 535 540

Gln Gly Ser Glu Lys Thr Asn Val Asp Ile Glu Lys Val Met Ile Thr

545 550 555 560

Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr

565 570 575

Gly Ser Val Ser Thr Asn Leu Gln Arg Gly Asn Arg Gln Ala Ala Thr

580 585 590

Ala Asp Val Asn Thr Gln Gly Val Leu Pro Gly Met Val Trp Gln Asp

595 600 605

Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr

610 615 620

Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys

625 630 635 640

His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn

645 650 655

Pro Ser Thr Thr Phe Ser Ala Ala Lys Phe Ala Ser Phe Ile Thr Gln

660 665 670

Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys

675 680 685

Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr

690 695 700

Asn Lys Ser Val Asn Val Asp Phe Thr Val Asp Thr Asn Gly Val Tyr

705 710 715 720

Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 71

<211> 736

<212> PRT

<213> capsid protein of AAV serotype, clone AAV3

<400> 71

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Val Pro Gln Pro

20 25 30

Lys Ala Asn Gln Gln His Gln Asp Asn Arg Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Ile Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Gly

130 135 140

Ala Val Asp Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Val Gly

145 150 155 160

Lys Ser Gly Lys Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro

180 185 190

Ala Ala Pro Thr Ser Leu Gly Ser Asn Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Ser Gln Ser Gly Ala Ser Asn Asp Asn His Tyr

260 265 270

Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His

275 280 285

Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp

290 295 300

Gly Phe Arg Pro Lys Lys Leu Ser Phe Lys Leu Phe Asn Ile Gln Val

305 310 315 320

Arg Gly Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu

325 330 335

Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr

340 345 350

Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp

355 360 365

Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser

370 375 380

Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser

385 390 395 400

Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Thr Phe Glu

405 410 415

Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg

420 425 430

Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg Thr

435 440 445

Gln Gly Thr Thr Ser Gly Thr Thr Asn Gln Ser Arg Leu Leu Phe Ser

450 455 460

Gln Ala Gly Pro Gln Ser Met Ser Leu Gln Ala Arg Asn Trp Leu Pro

465 470 475 480

Gly Pro Cys Tyr Arg Gln Gln Arg Leu Ser Lys Thr Ala Asn Asp Asn

485 490 495

Asn Asn Ser Asn Phe Pro Trp Thr Ala Ala Ser Lys Tyr His Leu Asn

500 505 510

Gly Arg Asp Ser Leu Val Asn Pro Gly Pro Ala Met Ala Ser His Lys

515 520 525

Asp Asp Glu Glu Lys Phe Phe Pro Met His Gly Asn Leu Ile Phe Gly

530 535 540

Lys Glu Gly Thr Thr Ala Ser Asn Ala Glu Leu Asp Asn Val Met Ile

545 550 555 560

Thr Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu Gln

565 570 575

Tyr Gly Thr Val Ala Asn Asn Leu Gln Ser Ser Asn Thr Ala Pro Thr

580 585 590

Thr Gly Thr Val Asn His Gln Gly Ala Leu Pro Gly Met Val Trp Gln

595 600 605

Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

610 615 620

Thr Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

625 630 635 640

Lys His Pro Pro Pro Gln Ile Met Ile Lys Asn Thr Pro Val Pro Ala

645 650 655

Asn Pro Pro Thr Thr Phe Ser Pro Ala Lys Phe Ala Ser Phe Ile Thr

660 665 670

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

675 680 685

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

690 695 700

Tyr Asn Lys Ser Val Asn Val Asp Phe Thr Val Asp Thr Asn Gly Val

705 710 715 720

Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 72

<211> 737

<212> PRT

<213> capsid protein of AAV serotype, clone 3.3bVP1

<400> 72

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asn Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Asn Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Ala Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro

180 185 190

Pro Ala Ala Pro Ser Ser Val Gly Ser Gly Thr Val Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn

210 215 220

Ala Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Glu Gln Ile Ser Ser Glu Thr Ala Gly Ser Thr Asn Asp Asn

260 265 270

Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg

275 280 285

Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn

290 295 300

Asn Trp Gly Phe Arg Pro Lys Lys Leu Arg Phe Lys Leu Phe Asn Ile

305 310 315 320

Gln Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn

325 330 335

Asn Leu Thr Ser Thr Ile Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu

340 345 350

Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro

355 360 365

Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn

370 375 380

Gly Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe

385 390 395 400

Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Ser

405 410 415

Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu

420 425 430

Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala

435 440 445

Arg Thr Gln Ser Asp Pro Gly Gly Thr Ala Gly Asn Arg Glu Leu Gln

450 455 460

Phe Tyr Gln Gly Gly Pro Ser Thr Met Ala Glu Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Phe Arg Gln Gln Arg Val Ser Lys Thr Leu Asp

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asn Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile

530 535 540

Phe Gly Lys Thr Gly Ala Thr Asn Lys Thr Thr Leu Glu Asn Val Leu

545 550 555 560

Met Thr Asn Glu Glu Glu Ile Arg Pro Thr Asn Pro Val Ala Thr Glu

565 570 575

Glu Tyr Gly Ile Val Ser Ser Asn Leu Gln Ala Ala Asn Thr Ala Ala

580 585 590

Gln Thr Gln Val Val Asn Asn Gln Gly Ala Leu Pro Gly Met Val Trp

595 600 605

Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro

610 615 620

His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly

625 630 635 640

Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro

645 650 655

Ala Asn Pro Pro Glu Val Phe Thr Pro Ala Lys Phe Ala Ser Phe Ile

660 665 670

Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu

675 680 685

Gln Lys Glu Asn Ser Lys Arg Trp Asp Pro Glu Ile Gln Tyr Thr Ser

690 695 700

Asn Phe Glu Lys Gln Thr Gly Val Asp Phe Ala Val Asp Ser Gln Gly

705 710 715 720

Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn

725 730 735

Leu

<210> 73

<211> 644

<212> PRT

<213> capsid protein of AAV serotype, clone 223-4

<400> 73

Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg

1 5 10 15

Tyr Asn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr

20 25 30

Ser Phe Gly Gly Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg

35 40 45

Val Leu Glu Pro Leu Gly Leu Val Glu Thr Pro Ala Lys Thr Ala Pro

50 55 60

Gly Lys Lys Arg Pro Val Asp Ser Pro Asp Ser Thr Ser Gly Ile Gly

65 70 75 80

Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

85 90 95

Gly Asp Ser Glu Pro Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

100 105 110

Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly

115 120 125

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala

130 135 140

Ser Gly Asn Trp His Cys Asp Ser Thr Arg Leu Gly Asp Arg Val Ile

145 150 155 160

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

165 170 175

Tyr Lys Gln Ile Ser Ser Gln Ser Ala Gly Ser Thr Asn Asp Asn Val

180 185 190

Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe

195 200 205

His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn

210 215 220

Trp Gly Phe Arg Pro Lys Lys Leu Asn Phe Lys Leu Phe Asn Ile Gln

225 230 235 240

Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn

245 250 255

Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro

260 265 270

Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala

275 280 285

Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly

290 295 300

Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro

305 310 315 320

Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe

325 330 335

Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Gly

340 345 350

Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg

355 360 365

Thr Gln Ser Asn Ala Gly Gly Thr Ala Gly Asn Arg Glu Leu Gln Phe

370 375 380

Tyr Gln Gly Gly Pro Thr Thr Met Ala Glu Gln Ala Lys Asn Trp Leu

385 390 395 400

Pro Gly Pro Cys Phe Arg Gln Gln Arg Val Ser Lys Thr Leu Asp Gln

405 410 415

Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His Leu

420 425 430

Asn Gly Arg Asn Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr His

435 440 445

Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe

450 455 460

Gly Lys Thr Gly Ala Ala Asn Lys Thr Thr Leu Glu Asn Val Leu Met

465 470 475 480

Thr Asn Glu Glu Glu Ile Arg Pro Thr Asn Pro Val Ala Thr Glu Glu

485 490 495

Tyr Gly Ile Val Ser Ser Asn Leu Gln Ala Ala Ser Thr Ala Ala Gln

500 505 510

Thr Gln Val Val Asn Asn Gln Gly Ala Leu Pro Gly Met Val Trp Gln

515 520 525

Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

530 535 540

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

545 550 555 560

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

565 570 575

Asn Pro Pro Glu Val Phe Thr Pro Ala Lys Phe Ala Ser Phe Ile Thr

580 585 590

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

595 600 605

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

610 615 620

Phe Asp Lys Gln Thr Gly Val Asp Phe Ala Val Asp Ser Gln Gly Val

625 630 635 640

Tyr Ser Glu Pro

<210> 74

<211> 644

<212> PRT

<213> capsid protein of AAV serotype, clone 223.5

<400> 74

Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg

1 5 10 15

Tyr Asn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr

20 25 30

Ser Phe Gly Gly Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg

35 40 45

Val Leu Glu Pro Leu Gly Leu Val Glu Thr Pro Ala Lys Thr Ala Pro

50 55 60

Gly Lys Lys Arg Pro Val Asp Ser Pro Asp Ser Thr Ser Gly Ile Gly

65 70 75 80

Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

85 90 95

Gly Asp Ser Glu Pro Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

100 105 110

Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly

115 120 125

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala

130 135 140

Ser Gly Asn Trp His Cys Asp Ser Thr Arg Leu Gly Asp Arg Val Ile

145 150 155 160

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

165 170 175

Tyr Lys Gln Ile Ser Ser Gln Ser Ala Gly Ser Thr Asn Asp Asn Val

180 185 190

Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe

195 200 205

His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn

210 215 220

Trp Gly Phe Arg Pro Lys Lys Leu Asn Phe Lys Leu Phe Asn Ile Gln

225 230 235 240

Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn

245 250 255

Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro

260 265 270

Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala

275 280 285

Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly

290 295 300

Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro

305 310 315 320

Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe

325 330 335

Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Gly

340 345 350

Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg

355 360 365

Thr Gln Ser Asn Ala Gly Gly Thr Ala Gly Asn Arg Glu Leu Gln Phe

370 375 380

Tyr Gln Gly Gly Pro Thr Thr Met Ala Glu Gln Ala Lys Asn Trp Leu

385 390 395 400

Pro Gly Pro Cys Phe Arg Gln Gln Arg Val Ser Lys Thr Leu Asp Gln

405 410 415

Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His Leu

420 425 430

Asn Gly Arg Asn Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr His

435 440 445

Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe

450 455 460

Gly Lys Thr Gly Ala Ala Asn Lys Thr Thr Leu Glu Asn Val Leu Met

465 470 475 480

Thr Asn Glu Glu Glu Ile Arg Pro Thr Asn Pro Val Ala Thr Glu Glu

485 490 495

Tyr Gly Ile Val Ser Ser Asn Leu Gln Ala Ala Ser Thr Ala Ala Gln

500 505 510

Thr Gln Val Val Asn Asn Gln Gly Ala Leu Pro Gly Met Val Trp Gln

515 520 525

Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

530 535 540

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

545 550 555 560

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

565 570 575

Asn Pro Pro Glu Val Phe Thr Pro Ala Lys Phe Ala Ser Phe Ile Thr

580 585 590

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

595 600 605

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

610 615 620

Phe Asp Lys Gln Thr Gly Val Asp Phe Ala Val Asp Ser Gln Gly Val

625 630 635 640

Tyr Ser Glu Pro

<210> 75

<211> 644

<212> PRT

<213> capsid protein of AAV serotype, clone 223.10

<220>

<221> MISC_FEATURE

<222> (434)..(434)

<223> can be any amino acid

<400> 75

Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg

1 5 10 15

Tyr Asn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr

20 25 30

Ser Phe Gly Gly Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg

35 40 45

Val Leu Glu Pro Leu Gly Leu Val Glu Thr Pro Ala Lys Thr Ala Pro

50 55 60

Gly Lys Lys Arg Pro Val Asp Ser Pro Asp Ser Thr Ser Gly Ile Gly

65 70 75 80

Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

85 90 95

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

100 105 110

Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly

115 120 125

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala

130 135 140

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile

145 150 155 160

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

165 170 175

Tyr Lys Gln Ile Ser Ser Gln Ser Ala Gly Ser Thr Asn Asp Asn Val

180 185 190

Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe

195 200 205

His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn

210 215 220

Trp Gly Phe Arg Pro Lys Lys Leu Asn Phe Lys Leu Phe Asn Ile Gln

225 230 235 240

Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn

245 250 255

Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro

260 265 270

Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala

275 280 285

Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly

290 295 300

Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro

305 310 315 320

Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe

325 330 335

Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp

340 345 350

Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg

355 360 365

Thr Gln Ser Asn Ala Gly Gly Thr Ala Gly Asn Arg Glu Leu Gln Phe

370 375 380

Tyr Gln Gly Gly Pro Thr Thr Met Ala Glu Gln Ala Lys Asn Trp Leu

385 390 395 400

Pro Gly Pro Cys Phe Arg Gln Gln Arg Val Ser Lys Thr Leu Asp Gln

405 410 415

Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His Leu

420 425 430

Asn Xaa Arg Asn Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr His

435 440 445

Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe

450 455 460

Gly Lys Thr Gly Ala Ala Asn Lys Thr Thr Leu Glu Asn Val Leu Met

465 470 475 480

Thr Asn Glu Glu Glu Ile Arg Pro Thr Asn Pro Val Ala Thr Glu Glu

485 490 495

Tyr Gly Ile Val Ser Ser Asn Leu Gln Ala Ala Ser Thr Ala Ala Gln

500 505 510

Thr Gln Val Val Asn Asn Gln Gly Ala Leu Pro Gly Met Val Trp Gln

515 520 525

Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

530 535 540

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

545 550 555 560

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

565 570 575

Asn Pro Pro Glu Val Phe Thr Pro Ala Lys Phe Ala Ser Phe Ile Thr

580 585 590

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

595 600 605

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

610 615 620

Phe Asp Lys Gln Thr Gly Val Asp Phe Ala Val Asp Ser Gln Gly Val

625 630 635 640

Tyr Ser Glu Pro

<210> 76

<211> 644

<212> PRT

<213> capsid protein of AAV serotype, clone 223.2

<400> 76

Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg

1 5 10 15

Tyr Asn His Ala Asp Ala Glu Phe Gln Glu Cys Leu Gln Glu Asp Thr

20 25 30

Ser Phe Gly Gly Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg

35 40 45

Val Leu Glu Pro Leu Gly Leu Val Glu Thr Pro Ala Lys Thr Ala Pro

50 55 60

Gly Lys Lys Arg Pro Val Asp Ser Pro Asp Ser Thr Ser Gly Ile Gly

65 70 75 80

Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

85 90 95

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

100 105 110

Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Val Ala Gly Gly Gly

115 120 125

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala

130 135 140

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile

145 150 155 160

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

165 170 175

Tyr Lys Gln Ile Ser Ser Gln Ser Ala Gly Ser Thr Asn Asp Asn Val

180 185 190

Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe

195 200 205

His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn

210 215 220

Trp Gly Phe Arg Pro Lys Lys Leu Asn Phe Lys Leu Phe Asn Ile Gln

225 230 235 240

Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn

245 250 255

Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro

260 265 270

Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala

275 280 285

Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly

290 295 300

Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro

305 310 315 320

Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe

325 330 335

Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp

340 345 350

Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg

355 360 365

Thr Gln Ser Asn Ala Gly Gly Thr Ala Gly Asn Arg Glu Leu Gln Phe

370 375 380

Tyr Gln Gly Gly Pro Thr Thr Met Ala Glu Gln Ala Lys Asn Trp Leu

385 390 395 400

Pro Gly Pro Cys Phe Arg Gln Gln Arg Val Ser Lys Thr Leu Asp Gln

405 410 415

Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His Leu

420 425 430

Asn Gly Arg Asn Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr His

435 440 445

Lys Asp Asp Glu Glu Arg Phe Ser Pro Ser Ser Gly Val Leu Ile Phe

450 455 460

Gly Lys Thr Gly Ala Ala Asn Lys Thr Thr Leu Glu Asn Val Leu Met

465 470 475 480

Thr Asn Glu Glu Glu Ile Arg Pro Thr Asn Pro Val Ala Thr Glu Glu

485 490 495

Tyr Gly Ile Val Ser Ser Asn Leu Gln Ala Ala Ser Thr Ala Ala Gln

500 505 510

Thr Gln Val Val Asn Asn Gln Gly Ala Leu Pro Gly Met Val Trp Gln

515 520 525

Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

530 535 540

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

545 550 555 560

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

565 570 575

Asn Pro Pro Glu Val Phe Thr Pro Ala Lys Phe Ala Ser Phe Ile Thr

580 585 590

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

595 600 605

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

610 615 620

Phe Asp Lys Gln Thr Gly Val Asp Phe Ala Val Asp Ser Gln Gly Val

625 630 635 640

Tyr Ser Glu Pro

<210> 77

<211> 644

<212> PRT

<213> capsid protein of AAV serotype, clone 223.7

<400> 77

Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg

1 5 10 15

Tyr Asn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr

20 25 30

Ser Phe Gly Gly Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg

35 40 45

Val Leu Glu Pro Leu Gly Leu Val Glu Thr Pro Ala Lys Thr Ala Pro

50 55 60

Gly Lys Lys Arg Pro Val Asp Ser Pro Asp Ser Thr Ser Gly Ile Gly

65 70 75 80

Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

85 90 95

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

100 105 110

Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly

115 120 125

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala

130 135 140

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile

145 150 155 160

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

165 170 175

Tyr Lys Gln Ile Ser Ser Gln Ser Ala Gly Ser Thr Asn Asp Asn Val

180 185 190

Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe

195 200 205

His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn

210 215 220

Trp Gly Phe Arg Pro Lys Lys Leu Asn Phe Lys Leu Phe Asn Ile Gln

225 230 235 240

Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn

245 250 255

Leu Thr Ser Thr Val Gln Val Phe Ser Asp Pro Glu Tyr Gln Leu Pro

260 265 270

Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala

275 280 285

Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly

290 295 300

Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro

305 310 315 320

Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe

325 330 335

Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp

340 345 350

Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg

355 360 365

Thr Gln Ser Asn Ala Gly Gly Thr Ala Gly Asn Arg Glu Leu Gln Phe

370 375 380

Tyr Gln Gly Gly Pro Thr Thr Met Ala Glu Gln Ala Lys Asn Trp Leu

385 390 395 400

Pro Gly Pro Cys Phe Arg Gln Gln Arg Val Ser Lys Thr Leu Asp Gln

405 410 415

Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His Leu

420 425 430

Asn Gly Arg Asn Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr His

435 440 445

Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe

450 455 460

Gly Lys Thr Gly Ala Ala Asn Lys Thr Thr Leu Glu Asn Val Leu Met

465 470 475 480

Thr Asn Glu Glu Glu Ile Arg Pro Thr Asn Pro Val Ala Thr Glu Glu

485 490 495

Tyr Gly Ile Val Ser Ser Asn Leu Gln Ala Ala Ser Thr Ala Ala Gln

500 505 510

Thr Gln Val Val Asn Asn Gln Gly Ala Leu Pro Gly Met Val Trp Gln

515 520 525

Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

530 535 540

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

545 550 555 560

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

565 570 575

Asn Pro Pro Glu Val Phe Thr Pro Ala Lys Ile Ala Ser Phe Ile Thr

580 585 590

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

595 600 605

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

610 615 620

Phe Asp Lys Gln Thr Gly Val Asp Phe Ala Val Asp Ser Gln Gly Val

625 630 635 640

Tyr Ser Glu Pro

<210> 78

<211> 644

<212> PRT

<213> capsid protein of AAV serotype, clone 223.6

<400> 78

Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg

1 5 10 15

Tyr Asn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr

20 25 30

Ser Phe Gly Gly Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg

35 40 45

Val Leu Glu Pro Leu Gly Leu Val Glu Thr Pro Ala Lys Thr Ala Pro

50 55 60

Gly Lys Lys Arg Pro Val Asp Ser Pro Asp Ser Thr Ser Gly Ile Gly

65 70 75 80

Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

85 90 95

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro

100 105 110

Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly

115 120 125

Ala Pro Met Ala Asp Asn Ser Glu Gly Ala Asp Gly Val Gly Asn Ala

130 135 140

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile

145 150 155 160

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

165 170 175

Tyr Lys Gln Ile Ser Ser Gln Ser Ala Gly Ser Thr Asn Asp Asn Val

180 185 190

Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe

195 200 205

His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn

210 215 220

Trp Gly Phe Arg Pro Lys Lys Leu Asn Phe Lys Leu Phe Asn Ile Gln

225 230 235 240

Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn

245 250 255

Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro

260 265 270

Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala

275 280 285

Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly

290 295 300

Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro

305 310 315 320

Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe

325 330 335

Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp

340 345 350

Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg

355 360 365

Thr Gln Ser Asn Ala Gly Gly Thr Ala Gly Asn Arg Glu Leu Gln Phe

370 375 380

Tyr Gln Gly Gly Pro Thr Thr Met Ala Glu Gln Ala Lys Asn Trp Leu

385 390 395 400

Pro Gly Pro Cys Phe Arg Gln Gln Arg Val Ser Lys Thr Leu Asp Gln

405 410 415

Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His Leu

420 425 430

Asn Gly Arg Asn Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr His

435 440 445

Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe

450 455 460

Gly Lys Thr Gly Ala Ala Asn Lys Thr Thr Leu Glu Asn Val Leu Met

465 470 475 480

Thr Asn Glu Glu Glu Ile Arg Pro Thr Asn Pro Val Ala Thr Glu Glu

485 490 495

Tyr Gly Ile Val Ser Ser Asn Leu Gln Ala Ala Ser Thr Ala Ala Gln

500 505 510

Thr Gln Val Val Asn Asn Gln Gly Ala Leu Pro Gly Met Val Trp Gln

515 520 525

Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

530 535 540

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

545 550 555 560

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

565 570 575

Asn Pro Pro Glu Val Phe Thr Pro Ala Lys Leu Ala Ser Phe Ile Thr

580 585 590

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

595 600 605

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

610 615 620

Phe Asp Lys Gln Thr Gly Val Asp Phe Ala Val Asp Ser Gln Gly Val

625 630 635 640

Tyr Ser Glu Pro

<210> 79

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone 44.1

<400> 79

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Gln Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Ser Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu

450 455 460

Phe Ser Gln Ala Gly Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met

530 535 540

Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala

580 585 590

Pro Ile Val Gly Ala Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Asp

705 710 715 720

Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 80

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone 44.5

<400> 80

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Pro Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Gln Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Ser Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu

450 455 460

Phe Ser Gln Ala Gly Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met

530 535 540

Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala

580 585 590

Pro Ile Val Gly Ala Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Asp

705 710 715 720

Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 81

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone 44.2

<400> 81

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Gln Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Ser Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu

450 455 460

Phe Ser Gln Ala Gly Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met

530 535 540

Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala

580 585 590

Pro Ile Val Gly Ala Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Asp

705 710 715 720

Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 82

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone 29.3VP1

<400> 82

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Thr Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala Arg Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Gln Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Ser Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu

450 455 460

Phe Ser Gln Ala Gly Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met

530 535 540

Phe Gly Lys Gln Gly Ala Gly Lys Gly Asn Val Asp Tyr Ser Ser Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala

580 585 590

Pro Ile Val Gly Ala Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Asp

705 710 715 720

Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 83

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone 29.5VP1

<400> 83

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Gly Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Ser Leu Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Gln Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Ser Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu

450 455 460

Phe Ser Gln Ala Gly Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser

485 490 495

Gln Asn Asp Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met

530 535 540

Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala

580 585 590

Pro Ile Val Gly Ala Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Asp

705 710 715 720

Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 84

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone 42.15

<400> 84

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Pro Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Arg Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Gln Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Ser Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu

450 455 460

Phe Ser Gln Ala Gly Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met

530 535 540

Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala

580 585 590

Pro Ile Val Gly Ala Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu

705 710 715 720

Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 85

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone 42.8

<400> 85

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Gln Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Ser Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu

450 455 460

Phe Ser Gln Ala Gly Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met

530 535 540

Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala

580 585 590

Pro Ile Val Gly Ala Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu

705 710 715 720

Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 86

<211> 733

<212> PRT

<213> amino acids of AAV serotype, clone 42.13

<400> 86

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro Ala Gly Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp Asn Thr Tyr Phe Gly

260 265 270

Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His

275 280 285

Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe

290 295 300

Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln Val Lys Glu

305 310 315 320

Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala Asn Asn Leu Thr Ser

325 330 335

Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu

340 345 350

Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe

355 360 365

Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ala

370 375 380

Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met

385 390 395 400

Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Gln Phe Glu Asp Val

405 410 415

Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met

420 425 430

Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Arg Thr Gln Ser

435 440 445

Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu Phe Ser Gln Ala Gly

450 455 460

Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp Leu Pro Gly Pro Cys

465 470 475 480

Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Ser Gln Asn Asn Asn Ser

485 490 495

Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asp

500 505 510

Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr His Lys Gly Asp Glu

515 520 525

Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met Phe Gly Lys Gln Gly

530 535 540

Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val Met Leu Thr Ser Glu

545 550 555 560

Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr Gly Val

565 570 575

Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala Pro Ile Val Gly Ala

580 585 590

Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp

595 600 605

Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly

610 615 620

Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro

625 630 635 640

Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asp Pro Pro

645 650 655

Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe Ile Thr Gln Tyr Ser

660 665 670

Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn

675 680 685

Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys

690 695 700

Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu Gly Thr Tyr Ser Glu

705 710 715 720

Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Ser Leu

725 730

<210> 87

<211> 733

<212> PRT

<213> capsid protein of AAV serotype, clone 42.3A

<400> 87

Met Ala Ala Asp Gly His Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro Ala Gly Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp Asn Thr Tyr Phe Gly

260 265 270

Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His

275 280 285

Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Ser Trp Gly Phe

290 295 300

Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln Val Lys Glu

305 310 315 320

Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala Asn Asn Leu Thr Ser

325 330 335

Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu

340 345 350

Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe

355 360 365

Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ala

370 375 380

Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met

385 390 395 400

Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Gln Phe Glu Asp Val

405 410 415

Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met

420 425 430

Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Arg Thr Gln Ser

435 440 445

Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu Phe Ser Gln Ala Gly

450 455 460

Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp Leu Pro Gly Pro Cys

465 470 475 480

Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser Gln Asn Asn Asn Ser

485 490 495

Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asp

500 505 510

Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr His Lys Asp Asp Glu

515 520 525

Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met Phe Gly Lys Gln Gly

530 535 540

Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val Met Leu Thr Ser Glu

545 550 555 560

Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr Gly Val

565 570 575

Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala Pro Ile Val Gly Ala

580 585 590

Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp

595 600 605

Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly

610 615 620

Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro

625 630 635 640

Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asp Pro Pro

645 650 655

Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe Ile Thr Gln Tyr Ser

660 665 670

Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn

675 680 685

Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys

690 695 700

Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu Gly Thr Tyr Ser Glu

705 710 715 720

Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730

<210> 88

<211> 731

<212> PRT

<213> capsid protein of AAV serotype, clone 42.4

<400> 88

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro Ala Gly Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Gln Ser Gly Ala Thr Asn Asp Asn His Phe Phe Gly Tyr Ser

260 265 270

Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser

275 280 285

Ser Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro

290 295 300

Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr

305 310 315 320

Gln Asn Glu Gly Thr Lys Thr Ile Ala Asn Asn Leu Thr Ser Thr Ile

325 330 335

Gln Val Phe Thr Asp Ser Glu Tyr Arg Leu Pro Tyr Val Leu Gly Ser

340 345 350

Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Ile

355 360 365

Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ala Val Gly

370 375 380

Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg

385 390 395 400

Thr Gly Asn Asn Phe Glu Phe Ser Tyr Gln Phe Glu Asp Val Pro Phe

405 410 415

His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro

420 425 430

Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Arg Thr Gln Ser Thr Gly

435 440 445

Gly Thr Ala Gly Thr Gln Gln Leu Leu Phe Ser Gln Ala Gly Pro Asn

450 455 460

Asn Met Ser Ala Gln Ala Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg

465 470 475 480

Gln Gln Arg Val Ser Thr Thr Leu Ser Gln Asn Asn Asn Ser Asn Phe

485 490 495

Ala Trp Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asp Ser Leu

500 505 510

Val Asn Pro Gly Val Ala Met Ala Thr His Lys Asp Asp Glu Glu Arg

515 520 525

Phe Phe Pro Ser Ser Gly Val Leu Met Phe Gly Lys Gln Gly Ala Gly

530 535 540

Lys Asp Asn Val Asp Tyr Ser Ser Val Met Leu Thr Ser Glu Glu Glu

545 550 555 560

Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr Gly Val Val Ala

565 570 575

Asp Asn Leu Gln Gln Gln Asn Ala Ala Pro Ile Val Gly Ala Val Asn

580 585 590

Ser Gln Gly Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr

595 600 605

Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe

610 615 620

His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro

625 630 635 640

Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asp Pro Pro Thr Thr

645 650 655

Phe Ser Gln Ala Lys Pro Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly

660 665 670

Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys

675 680 685

Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys Ser Thr

690 695 700

Asn Val Asp Phe Ala Val Asn Thr Glu Gly Thr Tyr Ser Glu Pro Arg

705 710 715 720

Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730

<210> 89

<211> 731

<212> PRT

<213> capsid protein of AAV serotype, clone 42.5A

<400> 89

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Arg Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro Ala Ala Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Gln Ser Gly Ala Thr Asn Asp Asn His Phe Phe Gly Tyr Ser

260 265 270

Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser

275 280 285

Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Arg Gly Phe Arg Pro

290 295 300

Arg Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr

305 310 315 320

Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Ile

325 330 335

Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser

340 345 350

Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Ile

355 360 365

Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser Val Gly

370 375 380

Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg

385 390 395 400

Thr Gly Asn Asn Phe Glu Phe Ser Tyr Gln Phe Glu Asp Val Pro Phe

405 410 415

His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro

420 425 430

Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Arg Thr Gln Ser Thr Gly

435 440 445

Gly Thr Ala Gly Thr Gln Gln Leu Leu Phe Ser Gln Ala Gly Pro Asn

450 455 460

Asn Met Ser Ala Gln Ala Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg

465 470 475 480

Gln Gln Arg Val Ser Thr Thr Leu Ser Gln Asn Asn Asn Ser Asn Phe

485 490 495

Ala Trp Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asp Ser Leu

500 505 510

Val Asn Pro Gly Val Ala Met Ala Thr His Lys Asp Asp Glu Glu Arg

515 520 525

Phe Phe Pro Ser Ser Gly Val Leu Met Phe Gly Lys Gln Gly Ala Gly

530 535 540

Lys Asp Asn Val Asp Tyr Ser Ser Val Met Leu Thr Ser Glu Glu Glu

545 550 555 560

Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr Gly Val Val Ala

565 570 575

Asp Asn Leu Gln Gln Gln Asn Ala Ala Pro Ile Val Gly Ala Val Asn

580 585 590

Ser Gln Gly Ala Leu Pro Gly Met Ala Trp Gln Asn Arg Asp Val Tyr

595 600 605

Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe

610 615 620

His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro

625 630 635 640

Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asp Pro Pro Thr Thr

645 650 655

Phe Ser Gln Ala Lys Leu Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly

660 665 670

Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys

675 680 685

Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys Ser Thr

690 695 700

Asn Val Asp Phe Ala Val Asn Thr Glu Gly Thr Tyr Ser Glu Pro Arg

705 710 715 720

Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730

<210> 90

<211> 733

<212> PRT

<213> capsid protein of AAV serotype, clone 42.1B

<400> 90

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Arg Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro Ala Gly Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp Asn Thr Tyr Phe Gly

260 265 270

Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His

275 280 285

Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe

290 295 300

Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln Val Lys Glu

305 310 315 320

Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala Asn Asn Leu Thr Ser

325 330 335

Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu

340 345 350

Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe

355 360 365

Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ala

370 375 380

Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met

385 390 395 400

Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Gln Phe Glu Asp Val

405 410 415

Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met

420 425 430

Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser Arg Thr Gln Ser

435 440 445

Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu Phe Ser Gln Ala Gly

450 455 460

Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp Leu Pro Gly Pro Cys

465 470 475 480

Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Ser Gln Asn Asn Asn Ser

485 490 495

Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asp

500 505 510

Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr His Lys Gly Asp Glu

515 520 525

Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met Phe Gly Lys Gln Gly

530 535 540

Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val Met Leu Thr Ser Glu

545 550 555 560

Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr Gly Val

565 570 575

Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala Pro Ile Val Gly Ala

580 585 590

Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp

595 600 605

Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly

610 615 620

Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro

625 630 635 640

Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asp Pro Pro

645 650 655

Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe Ile Thr Gln Tyr Ser

660 665 670

Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn

675 680 685

Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys

690 695 700

Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu Gly Thr Tyr Ser Glu

705 710 715 720

Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730

<210> 91

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone 42.5B

<400> 91

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Gln Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Ser Thr Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu

450 455 460

Phe Ser Gln Ala Gly Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met

530 535 540

Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala

580 585 590

Pro Ile Val Gly Ala Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu

705 710 715 720

Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 92

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone 43.1

<400> 92

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly His Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Pro Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Thr Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Ser Thr Gly Gly Thr Gln Gly Thr Gln Gln Leu Leu

450 455 460

Phe Ser Gln Ala Gly Pro Ala Asn Met Ser Ala Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met

530 535 540

Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Thr Asn Gly Ala

580 585 590

Pro Ile Val Gly Thr Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Val Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu

705 710 715 720

Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 93

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone 43.12

<400> 93

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly His Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Thr Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Ser Thr Gly Gly Thr Gln Gly Thr Gln Gln Leu Leu

450 455 460

Phe Ser Gln Ala Gly Pro Ala Asn Met Ser Ala Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met

530 535 540

Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Thr Asn Gly Ala

580 585 590

Pro Ile Val Gly Thr Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Val Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu

705 710 715 720

Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 94

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone 43.5

<400> 94

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly His Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Thr Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Ser Thr Gly Gly Thr Gln Gly Thr Gln Gln Leu Leu

450 455 460

Phe Ser Gln Ala Gly Pro Ala Asn Met Ser Ala Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser Gly Val Leu Met

530 535 540

Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn Val Asp Tyr Ser Ser Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Gln Tyr Gly Val Val Ala Asp Asn Leu Gln Gln Thr Asn Gly Ala

580 585 590

Pro Ile Val Gly Thr Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Val Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala Lys Leu Ala Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu

705 710 715 720

Gly Thr Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 95

<211> 738

<212> PRT

<213> capsid protein of AAV serotype, clone AAV8

<400> 95

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Gln Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Lys Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro

180 185 190

Pro Ala Ala Pro Ser Gly Val Gly Pro Asn Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ala Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Ser Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Thr Tyr

405 410 415

Thr Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ser Arg Thr Gln Thr Thr Gly Gly Thr Ala Asn Thr Gln Thr Leu Gly

450 455 460

Phe Ser Gln Gly Gly Pro Asn Thr Met Ala Asn Gln Ala Lys Asn Trp

465 470 475 480

Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Gly

485 490 495

Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Ala Gly Thr Lys Tyr His

500 505 510

Leu Asn Gly Arg Asn Ser Leu Ala Asn Pro Gly Ile Ala Met Ala Thr

515 520 525

His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Asn Gly Ile Leu Ile

530 535 540

Phe Gly Lys Gln Asn Ala Ala Arg Asp Asn Ala Asp Tyr Ser Asp Val

545 550 555 560

Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr

565 570 575

Glu Glu Tyr Gly Ile Val Ala Asp Asn Leu Gln Gln Gln Asn Thr Ala

580 585 590

Pro Gln Ile Gly Thr Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val

595 600 605

Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile

610 615 620

Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe

625 630 635 640

Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val

645 650 655

Pro Ala Asp Pro Pro Thr Thr Phe Asn Gln Ser Lys Leu Asn Ser Phe

660 665 670

Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu

675 680 685

Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr

690 695 700

Ser Asn Tyr Tyr Lys Ser Thr Ser Val Asp Phe Ala Val Asn Thr Glu

705 710 715 720

Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg

725 730 735

Asn Leu

<210> 96

<211> 736

<212> PRT

<213> capsid protein of AAV serotype, clone 43.21

<400> 96

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly

145 150 155 160

Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro

180 185 190

Ala Ala Pro Ser Gly Leu Gly Pro Asn Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp Asn

260 265 270

Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg

275 280 285

Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn

290 295 300

Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile

305 310 315 320

Gln Val Lys Glu Val Thr Thr Asn Glu Gly Thr Lys Thr Ile Ala Asn

325 330 335

Asn Leu Thr Ser Thr Val Arg Val Phe Thr Asp Ser Glu Tyr Gln Leu

340 345 350

Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro

355 360 365

Ala Asp Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn

370 375 380

Gly Ser Gln Ala Leu Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe

385 390 395 400

Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Thr

405 410 415

Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu

420 425 430

Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Val

435 440 445

Arg Thr Gln Thr Thr Gly Thr Gly Gly Thr Gln Thr Leu Ala Phe Ser

450 455 460

Gln Ala Gly Pro Ser Ser Met Ala Asn Gln Ala Arg Asn Trp Val Pro

465 470 475 480

Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Asn Gln Ser

485 490 495

Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Ala Lys Phe Lys Leu Asn

500 505 510

Gly Arg Asp Ser Leu Met Asn Pro Gly Val Ala Met Ala Ser His Lys

515 520 525

Asp Asp Asp Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe Gly

530 535 540

Lys Gln Gly Ala Gly Asn Asp Gly Val Asp Tyr Ser Gln Val Leu Ile

545 550 555 560

Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Glu

565 570 575

Tyr Gly Ala Val Ala Ile Asn Asn Gln Ala Ala Asn Thr Gln Ala Gln

580 585 590

Thr Gly Leu Val His Asn Gln Gly Val Ile Pro Gly Met Val Trp Gln

595 600 605

Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

610 615 620

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

625 630 635 640

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

645 650 655

Asp Pro Pro Leu Thr Phe Asn Gln Ala Lys Leu Asn Ser Phe Ile Thr

660 665 670

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

675 680 685

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

690 695 700

Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu Gly Val

705 710 715 720

Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 97

<211> 736

<212> PRT

<213> capsid protein of AAV serotype, clone 43.25

<400> 97

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly

145 150 155 160

Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro

180 185 190

Ala Ala Pro Ser Gly Leu Gly Pro Asn Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp Asn

260 265 270

Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg

275 280 285

Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn

290 295 300

Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile

305 310 315 320

Gln Val Lys Glu Val Thr Thr Asn Glu Gly Thr Lys Thr Ile Ala Asn

325 330 335

Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu

340 345 350

Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro

355 360 365

Ala Asp Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn

370 375 380

Gly Ser Gln Ala Leu Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe

385 390 395 400

Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Thr

405 410 415

Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu

420 425 430

Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Val

435 440 445

Arg Thr Gln Thr Thr Gly Thr Gly Gly Thr Gln Thr Leu Ala Phe Ser

450 455 460

Gln Ala Gly Pro Ser Ser Met Ala Asn Gln Ala Arg Asn Trp Val Pro

465 470 475 480

Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Asn Gln Asn

485 490 495

Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Ala Lys Phe Lys Leu Asn

500 505 510

Gly Arg Asp Ser Leu Met Asn Pro Gly Val Ala Met Ala Ser His Lys

515 520 525

Asp Asp Asp Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe Gly

530 535 540

Lys Gln Gly Ala Gly Asn Asp Gly Val Asp Tyr Ser Gln Val Leu Ile

545 550 555 560

Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Glu

565 570 575

Tyr Gly Ala Val Ala Ile Asn Asn Gln Ala Ala Asn Thr Gln Ala Gln

580 585 590

Thr Gly Leu Val His Asn Gln Gly Val Ile Pro Gly Met Val Trp Gln

595 600 605

Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

610 615 620

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

625 630 635 640

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

645 650 655

Asp Pro Pro Leu Thr Phe Asn Gln Ala Lys Leu Asn Ser Phe Ile Thr

660 665 670

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

675 680 685

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

690 695 700

Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu Gly Val

705 710 715 720

Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 98

<211> 736

<212> PRT

<213> capsid protein of AAV serotype, clone 43.23

<400> 98

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly

145 150 155 160

Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro

180 185 190

Ala Ala Pro Ser Gly Leu Gly Pro Asn Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp Asn

260 265 270

Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg

275 280 285

Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn

290 295 300

Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile

305 310 315 320

Gln Val Lys Glu Val Thr Thr Asn Glu Gly Thr Lys Thr Ile Ala Asn

325 330 335

Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Leu Glu Tyr Gln Leu

340 345 350

Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro

355 360 365

Ala Asp Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn

370 375 380

Gly Ser Gln Ala Leu Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe

385 390 395 400

Pro Ser Gln Met Pro Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Thr

405 410 415

Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu

420 425 430

Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Val

435 440 445

Arg Thr Gln Thr Thr Gly Thr Gly Gly Thr Gln Thr Leu Ala Phe Ser

450 455 460

Gln Ala Gly Pro Ser Ser Met Ala Asn Gln Ala Arg Asn Trp Val Pro

465 470 475 480

Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Asn Gln Asn

485 490 495

Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Ala Lys Phe Lys Leu Asn

500 505 510

Gly Arg Asp Ser Leu Met Asn Pro Gly Val Ala Met Ala Ser His Lys

515 520 525

Asp Asp Asp Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe Gly

530 535 540

Lys Gln Gly Ala Gly Asn Asp Gly Val Asp Tyr Ser Gln Val Leu Ile

545 550 555 560

Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Glu

565 570 575

Tyr Gly Ala Val Ala Ile Asn Asn Gln Ala Ala Asn Thr Gln Ala Gln

580 585 590

Thr Gly Leu Val His Asn Gln Gly Val Ile Pro Gly Met Val Trp Gln

595 600 605

Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

610 615 620

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

625 630 635 640

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

645 650 655

Asp Pro Pro Leu Thr Phe Asn Gln Ala Lys Leu Asn Ser Phe Ile Thr

660 665 670

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

675 680 685

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

690 695 700

Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu Gly Val

705 710 715 720

Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 99

<211> 736

<212> PRT

<213> capsid protein of AAV serotype, clone 43.20

<400> 99

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Leu Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly

145 150 155 160

Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro

180 185 190

Ala Ala Pro Ser Gly Leu Gly Pro Asn Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp Asn

260 265 270

Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg

275 280 285

Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn

290 295 300

Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile

305 310 315 320

Gln Val Lys Glu Val Thr Thr Asn Glu Gly Thr Lys Thr Ile Ala Asn

325 330 335

Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu

340 345 350

Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro

355 360 365

Ala Asp Val Phe Thr Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn

370 375 380

Gly Ser Gln Ala Leu Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe

385 390 395 400

Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Thr

405 410 415

Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu

420 425 430

Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Val

435 440 445

Arg Thr Gln Thr Thr Gly Thr Gly Gly Thr Gln Thr Leu Ala Phe Ser

450 455 460

Gln Ala Gly Pro Ser Ser Met Ala Asn Gln Ala Arg Asn Trp Val Pro

465 470 475 480

Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Asn Gln Asn

485 490 495

Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Ala Lys Phe Lys Leu Asn

500 505 510

Gly Arg Asp Ser Leu Met Asn Pro Gly Val Ala Met Ala Ser His Lys

515 520 525

Asp Asp Asp Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe Gly

530 535 540

Lys Gln Gly Ala Gly Asn Asp Gly Val Asp Tyr Ser Gln Val Leu Ile

545 550 555 560

Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Glu

565 570 575

Tyr Gly Ala Val Ala Ile Asn Asn Gln Ala Ala Asn Thr Gln Ala Gln

580 585 590

Thr Gly Leu Val His Asn Gln Gly Val Ile Pro Gly Met Val Trp Gln

595 600 605

Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

610 615 620

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

625 630 635 640

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

645 650 655

Asp Pro Pro Leu Thr Phe Asn Gln Ala Lys Leu Asn Ser Phe Ile Thr

660 665 670

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

675 680 685

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

690 695 700

Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu Gly Val

705 710 715 720

Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 100

<211> 736

<212> PRT

<213> capsid protein of AAV serotype, clone AAV9

<400> 100

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly

145 150 155 160

Lys Ser Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr

165 170 175

Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro

180 185 190

Glu Ala Pro Ser Gly Leu Gly Pro Asn Thr Met Ala Ser Gly Gly Gly

195 200 205

Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser

210 215 220

Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile

225 230 235 240

Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu

245 250 255

Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp Asn

260 265 270

Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg

275 280 285

Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn

290 295 300

Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile

305 310 315 320

Gln Val Lys Glu Val Thr Thr Asn Glu Gly Thr Lys Thr Ile Ala Asn

325 330 335

Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu

340 345 350

Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro

355 360 365

Ala Asp Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn

370 375 380

Gly Ser Gln Ala Leu Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe

385 390 395 400

Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Thr

405 410 415

Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu

420 425 430

Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Val

435 440 445

Arg Thr Gln Thr Thr Gly Thr Gly Gly Thr Gln Thr Leu Ala Phe Ser

450 455 460

Gln Ala Gly Pro Ser Ser Met Ala Asn Gln Ala Arg Asn Trp Val Pro

465 470 475 480

Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Asn Gln Asn

485 490 495

Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Ala Lys Phe Lys Leu Asn

500 505 510

Gly Arg Asp Ser Leu Met Asn Pro Gly Val Ala Met Ala Ser His Lys

515 520 525

Asp Asp Glu Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile Phe Gly

530 535 540

Lys Gln Gly Ala Gly Asn Asp Gly Val Asp Tyr Ser Gln Val Leu Ile

545 550 555 560

Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Glu

565 570 575

Tyr Gly Ala Val Ala Ile Asn Asn Gln Ala Ala Asn Thr Gln Ala Gln

580 585 590

Thr Gly Leu Val His Asn Gln Gly Val Ile Pro Gly Met Val Trp Gln

595 600 605

Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His

610 615 620

Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu

625 630 635 640

Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala

645 650 655

Asp Pro Pro Leu Thr Phe Asn Gln Ala Lys Leu Asn Ser Phe Ile Thr

660 665 670

Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln

675 680 685

Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn

690 695 700

Tyr Tyr Lys Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu Gly Val

705 710 715 720

Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 101

<211> 728

<212> PRT

<213> capsid protein of AAV serotype, clone 24.1

<400> 101

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Arg Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Val Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro Ala Ala Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Gln Ser Gly Ala Thr Asn Asp Asn His Phe Phe Ser Tyr Ser

260 265 270

Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser

275 280 285

Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro

290 295 300

Arg Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr

305 310 315 320

Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Ile

325 330 335

Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser

340 345 350

Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Ile

355 360 365

Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser Val Gly

370 375 380

Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg

385 390 395 400

Thr Gly Asn Asn Phe Glu Phe Ser Tyr Thr Phe Glu Glu Val Pro Phe

405 410 415

His Ser Ser Tyr Val His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro

420 425 430

Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr Thr

435 440 445

Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly Pro Asn Thr Met

450 455 460

Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln

465 470 475 480

Arg Leu Ser Lys Asn Ile Asp Ser Asn Asn Asn Ser Asn Phe Ala Trp

485 490 495

Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asn Ser Leu Thr Asn

500 505 510

Pro Gly Val Ala Met Ala Thr Asn Lys Asp Asp Glu Asp Gln Phe Phe

515 520 525

Pro Ile Asn Gly Val Leu Val Phe Gly Lys Thr Gly Ala Ala Asn Lys

530 535 540

Thr Thr Leu Glu Asn Val Leu Met Thr Ser Glu Glu Glu Ile Lys Thr

545 550 555 560

Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn Leu

565 570 575

Gln Ser Ser Thr Ala Gly Pro Gln Thr Gln Thr Val Asn Ser Gln Gly

580 585 590

Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Cys Leu Gln Gly

595 600 605

Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser

610 615 620

Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile Leu

625 630 635 640

Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr Pro

645 650 655

Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser

660 665 670

Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn

675 680 685

Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Asn Asn Val Glu

690 695 700

Phe Ala Val Asn Asn Glu Gly Val Tyr Thr Glu Pro Arg Pro Ile Gly

705 710 715 720

Thr Arg Tyr Leu Thr Arg Asn Leu

725

<210> 102

<211> 728

<212> PRT

<213> capsid protein of AAV serotype, clone 42.2REAL

<400> 102

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro Ala Ala Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Gln Ser Gly Ala Thr Asn Asp Asn His Phe Phe Gly Tyr Ser

260 265 270

Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser

275 280 285

Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro

290 295 300

Arg Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr

305 310 315 320

Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Ile

325 330 335

Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser

340 345 350

Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Ile

355 360 365

Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser Val Gly

370 375 380

Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg

385 390 395 400

Thr Gly Asn Asn Phe Glu Phe Ser Tyr Thr Phe Glu Glu Val Pro Phe

405 410 415

His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro

420 425 430

Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr Thr

435 440 445

Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly Pro Asn Thr Met

450 455 460

Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln

465 470 475 480

Arg Leu Ser Lys Asn Ile Asp Ser Asn Asn Asn Ser Asn Phe Ala Trp

485 490 495

Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asn Ser Leu Thr Asn

500 505 510

Pro Gly Val Ala Met Ala Thr Asn Lys Asp Asp Glu Asp Gln Phe Phe

515 520 525

Pro Ile Asn Gly Val Leu Val Phe Gly Glu Thr Gly Ala Ala Asn Lys

530 535 540

Thr Thr Leu Glu Asn Val Leu Met Thr Ser Glu Glu Glu Ile Lys Thr

545 550 555 560

Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn Leu

565 570 575

Gln Ser Ser Thr Ala Gly Pro Gln Thr Gln Thr Val Asn Ser Gln Gly

580 585 590

Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly

595 600 605

Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser

610 615 620

Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile Leu

625 630 635 640

Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr Pro

645 650 655

Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser

660 665 670

Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn

675 680 685

Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Asn Asn Val Glu

690 695 700

Phe Ala Val Asn Asn Glu Gly Val Tyr Thr Glu Pro Arg Pro Ile Gly

705 710 715 720

Thr Arg Tyr Leu Thr Arg Asn Leu

725

<210> 103

<211> 728

<212> PRT

<213> capsid protein of AAV serotype, clone 7.2VP1

<400> 103

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Gly Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Arg Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Asn Gly Gln

145 150 155 160

Pro Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro Ala Ala Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Gln Ser Gly Ala Thr Asn Asp Asn His Phe Phe Gly Tyr Ser

260 265 270

Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser

275 280 285

Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro

290 295 300

Arg Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr

305 310 315 320

Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Ile

325 330 335

Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser

340 345 350

Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Ile

355 360 365

Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser Val Gly

370 375 380

Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg

385 390 395 400

Thr Gly Asp Asn Phe Glu Phe Ser Tyr Thr Phe Glu Glu Val Pro Phe

405 410 415

His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro

420 425 430

Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr Thr

435 440 445

Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly Pro Asn Thr Met

450 455 460

Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln

465 470 475 480

Arg Leu Ser Lys Asn Ile Asp Ser Asn Asn Asn Ser Asn Phe Ala Trp

485 490 495

Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asn Ser Leu Thr Asn

500 505 510

Pro Gly Val Ala Met Ala Thr Asn Lys Asp Asp Glu Asp Gln Phe Phe

515 520 525

Pro Ile Asn Gly Val Leu Val Phe Gly Lys Thr Gly Ala Ala Asn Lys

530 535 540

Thr Thr Leu Glu Asn Val Leu Met Thr Ser Glu Glu Glu Ile Lys Thr

545 550 555 560

Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn Leu

565 570 575

Gln Ser Ser Thr Ala Gly Pro Gln Thr Gln Thr Val Asn Ser Gln Gly

580 585 590

Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly

595 600 605

Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser

610 615 620

Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile Leu

625 630 635 640

Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr Pro

645 650 655

Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser

660 665 670

Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn

675 680 685

Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Asn Asn Val Glu

690 695 700

Phe Ala Val Asn Asn Glu Gly Val Tyr Thr Glu Pro Arg Pro Ile Gly

705 710 715 720

Thr Arg Tyr Leu Thr Arg Asn Leu

725

<210> 104

<211> 728

<212> PRT

<213> capsid protein of AAV serotype, clone 27.3VP1

<400> 104

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Ser Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro Ala Ala Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Gln Ser Gly Ala Thr Asn Asp Asn His Phe Phe Gly Tyr Ser

260 265 270

Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser

275 280 285

Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro

290 295 300

Arg Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr

305 310 315 320

Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Ile

325 330 335

Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser

340 345 350

Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Ile

355 360 365

Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser Val Gly

370 375 380

Arg Ser Ser Phe Cys Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg

385 390 395 400

Thr Gly Asn Asn Phe Glu Phe Ser Tyr Thr Phe Glu Glu Val Pro Phe

405 410 415

His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro

420 425 430

Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr Thr

435 440 445

Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly Pro Asn Thr Val

450 455 460

Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln

465 470 475 480

Arg Leu Ser Lys Asn Ile Asp Ser Asn Asn Asn Ser Asn Phe Ala Trp

485 490 495

Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asn Ser Leu Thr Asn

500 505 510

Pro Gly Val Ala Met Ala Thr Asn Lys Asp Asp Glu Asp Gln Phe Leu

515 520 525

Pro Ile Asn Gly Val Leu Val Phe Gly Lys Thr Gly Ala Ala Asn Lys

530 535 540

Thr Thr Leu Glu Asn Val Leu Met Thr Ser Glu Glu Glu Ile Lys Thr

545 550 555 560

Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn Leu

565 570 575

Gln Ser Ser Thr Ala Gly Pro Arg Thr Gln Thr Val Asn Ser Gln Gly

580 585 590

Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly

595 600 605

Pro Ile Trp Ala Glu Ile Pro His Thr Asp Gly Asn Phe His Pro Ser

610 615 620

Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile Leu

625 630 635 640

Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr Pro

645 650 655

Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser

660 665 670

Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn

675 680 685

Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Asn Asn Val Glu

690 695 700

Phe Ala Val Asn Asn Glu Gly Val Tyr Thr Glu Pro Arg Pro Ile Gly

705 710 715 720

Thr Arg Tyr Leu Thr Arg Asn Leu

725

<210> 105

<211> 728

<212> PRT

<213> capsid protein of AAV serotype, clone 16.3VP1

<400> 105

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro Ala Ala Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Gln Ser Gly Ala Thr Asn Asp Asn His Phe Phe Gly Tyr Ser

260 265 270

Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser

275 280 285

Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro

290 295 300

Arg Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr

305 310 315 320

Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Ile

325 330 335

Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser

340 345 350

Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Ile

355 360 365

Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser Met Gly

370 375 380

Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg

385 390 395 400

Thr Gly Asn Asn Phe Glu Phe Ser Tyr Thr Phe Glu Glu Val Pro Phe

405 410 415

His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro

420 425 430

Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr Thr

435 440 445

Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly Pro Asn Thr Met

450 455 460

Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln

465 470 475 480

Arg Leu Ser Lys Asn Ile Asp Ser Asn Asn Asn Ser Asn Phe Ala Trp

485 490 495

Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asn Ser Leu Thr Asn

500 505 510

Pro Gly Val Ala Met Ala Thr Asn Lys Asp Asp Glu Gly Gln Phe Phe

515 520 525

Pro Ile Asn Gly Val Leu Val Phe Gly Lys Thr Gly Ala Ala Asn Lys

530 535 540

Thr Thr Leu Glu Asn Val Leu Met Thr Ser Glu Glu Glu Ile Lys Thr

545 550 555 560

Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn Leu

565 570 575

Gln Ser Ser Thr Ala Gly Pro Gln Thr Gln Thr Val Asn Ser Gln Gly

580 585 590

Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly

595 600 605

Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser

610 615 620

Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile Leu

625 630 635 640

Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Gly Val Phe Thr Pro

645 650 655

Ala Leu Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser

660 665 670

Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn

675 680 685

Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Asn Asn Val Glu

690 695 700

Phe Ala Val Asn Asn Glu Gly Val Tyr Thr Glu Pro Arg Pro Ile Gly

705 710 715 720

Thr Arg Tyr Leu Thr Arg Asn Leu

725

<210> 106

<211> 728

<212> PRT

<213> capsid protein of AAV serotype, clone 42.10

<400> 106

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Arg Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro Ala Gly Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Gln Ser Gly Ala Thr Asn Asp Asn His Phe Phe Gly Tyr Ser

260 265 270

Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser

275 280 285

Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro

290 295 300

Arg Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr

305 310 315 320

Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Ile

325 330 335

Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser

340 345 350

Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Ile

355 360 365

Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser Val Gly

370 375 380

Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg

385 390 395 400

Thr Gly Asn Asn Phe Glu Phe Ser Tyr Thr Phe Glu Glu Val Pro Phe

405 410 415

His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro

420 425 430

Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr Thr

435 440 445

Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly Pro Asn Thr Met

450 455 460

Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln

465 470 475 480

Arg Leu Ser Lys Asn Ile Asp Ser Asn Asn Asn Ser Asn Phe Ala Trp

485 490 495

Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asn Ser Leu Thr Asn

500 505 510

Pro Gly Val Ala Met Ala Thr Asn Lys Asp Asp Glu Asp Gln Phe Phe

515 520 525

Pro Ile Asn Gly Val Leu Val Phe Gly Lys Thr Gly Ala Ala Asn Lys

530 535 540

Thr Thr Leu Glu Asn Val Leu Met Thr Ser Glu Glu Glu Ile Lys Thr

545 550 555 560

Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn Leu

565 570 575

Gln Ser Ser Thr Ala Gly Pro Gln Thr Gln Thr Val Asn Ser Gln Gly

580 585 590

Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly

595 600 605

Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser

610 615 620

Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile Leu

625 630 635 640

Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr Pro

645 650 655

Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser

660 665 670

Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn

675 680 685

Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Asn Asn Val Glu

690 695 700

Phe Ala Val Asn Asn Glu Gly Val Tyr Thr Glu Pro Arg Pro Ile Gly

705 710 715 720

Thr Arg Tyr Leu Thr Arg Asn Leu

725

<210> 107

<211> 728

<212> PRT

<213> capsid protein of AAV serotype, clone 42.3B

<400> 107

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro Ala Gly Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Gln Ser Gly Ala Thr Asn Asp Asn His Phe Phe Gly Tyr Ser

260 265 270

Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser

275 280 285

Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro

290 295 300

Arg Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr

305 310 315 320

Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Ile

325 330 335

Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser

340 345 350

Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Ile

355 360 365

Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser Val Gly

370 375 380

Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg

385 390 395 400

Thr Gly Asn Asn Phe Glu Phe Ser Tyr Thr Phe Glu Glu Val Pro Phe

405 410 415

His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro

420 425 430

Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr Thr

435 440 445

Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly Pro Asn Thr Met

450 455 460

Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln

465 470 475 480

Arg Leu Ser Lys Asn Ile Asp Ser Asn Asn Thr Ser Asn Phe Ala Trp

485 490 495

Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asn Ser Leu Thr Asn

500 505 510

Pro Gly Val Ala Met Ala Thr Asn Lys Asp Asp Glu Asp Gln Phe Phe

515 520 525

Pro Ile Asn Gly Val Leu Val Phe Gly Lys Thr Gly Ala Ala Asn Lys

530 535 540

Thr Thr Leu Glu Asn Val Leu Met Thr Ser Glu Glu Glu Ile Lys Thr

545 550 555 560

Thr Asn Pro Val Ala Thr Glu Gln Tyr Gly Val Val Ser Ser Asn Leu

565 570 575

Gln Ser Ser Thr Ala Gly Pro Gln Thr Gln Thr Val Asn Ser Gln Gly

580 585 590

Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly

595 600 605

Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser

610 615 620

Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile Leu

625 630 635 640

Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr Pro

645 650 655

Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser

660 665 670

Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn

675 680 685

Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Asn Asn Val Glu

690 695 700

Phe Ala Val Asn Asn Glu Gly Val Tyr Thr Glu Pro Arg Pro Ile Gly

705 710 715 720

Thr Arg Tyr Leu Thr Arg Asn Leu

725

<210> 108

<211> 728

<212> PRT

<213> capsid protein of AAV serotype, clone 42.11

<400> 108

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Glu Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro Ala Gly Pro Ser

180 185 190

Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Gln Ser Gly Ala Thr Asn Asp Asn His Phe Phe Gly Tyr Ser

260 265 270

Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser

275 280 285

Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro

290 295 300

Arg Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val Thr

305 310 315 320

Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Ile

325 330 335

Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser

340 345 350

Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Ile

355 360 365

Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser Val Gly

370 375 380

Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg

385 390 395 400

Thr Gly Asn Asn Phe Glu Phe Ser Tyr Thr Phe Glu Glu Val Pro Phe

405 410 415

His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro

420 425 430

Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr Thr

435 440 445

Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly Pro Asn Thr Met

450 455 460

Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Arg Gln

465 470 475 480

Arg Leu Ser Lys Asp Ile Asp Ser Asn Asn Asn Ser Asn Phe Ala Trp

485 490 495

Thr Gly Ala Thr Lys Tyr His Leu Asn Gly Arg Asn Ser Leu Thr Asn

500 505 510

Pro Gly Val Ala Met Ala Thr Asn Lys Asp Asp Glu Asp Gln Phe Phe

515 520 525

Pro Ile Asn Gly Val Leu Val Phe Gly Lys Thr Gly Ala Ala Asn Lys

530 535 540

Thr Thr Leu Glu Asn Val Leu Met Thr Ser Glu Glu Glu Ile Lys Thr

545 550 555 560

Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn Leu

565 570 575

Gln Ser Ser Thr Ala Gly Pro Gln Thr Gln Thr Val Asn Ser Gln Gly

580 585 590

Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln Gly

595 600 605

Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser

610 615 620

Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile Leu

625 630 635 640

Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr Pro

645 650 655

Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser

660 665 670

Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn

675 680 685

Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Asn Asn Val Glu

690 695 700

Phe Ala Val Asn Asn Glu Gly Val Tyr Thr Glu Pro Arg Pro Ile Gly

705 710 715 720

Thr Arg Tyr Leu Thr Arg Asn Leu

725

<210> 109

<211> 729

<212> PRT

<213> capsid protein of AAV serotype, clone F1VP1

<400> 109

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Asp Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro Ala Ala Pro Ser

180 185 190

Ser Val Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Ser Ser Ser Gly Ala Thr Asn Asp Asn His Tyr Phe Gly Tyr

260 265 270

Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe

275 280 285

Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg

290 295 300

Pro Lys Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val

305 310 315 320

Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr

325 330 335

Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly

340 345 350

Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met

355 360 365

Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser Val

370 375 380

Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu

385 390 395 400

Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Ser Phe Glu Asp Val Pro

405 410 415

Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn

420 425 430

Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr

435 440 445

Thr Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly Pro Asn Thr

450 455 460

Met Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln

465 470 475 480

Gln Gly Leu Ser Lys Asn Leu Asp Phe Asn Asn Asn Ser Asn Phe Ala

485 490 495

Trp Thr Ala Ala Thr Lys Tyr His Leu Asn Gly Arg Asn Ser Leu Thr

500 505 510

Asn Pro Gly Ile Pro Met Ala Thr Asn Lys Asp Asp Glu Asp Gln Phe

515 520 525

Phe Pro Ile Asn Gly Val Leu Val Phe Gly Lys Thr Gly Ala Ala Asn

530 535 540

Lys Thr Thr Leu Glu Asn Val Leu Met Thr Ser Glu Glu Glu Ile Lys

545 550 555 560

Thr Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn

565 570 575

Leu Gln Pro Ser Thr Ala Gly Pro Gln Ser Gln Thr Ile Asn Ser Gln

580 585 590

Gly Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln

595 600 605

Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro

610 615 620

Ser Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile

625 630 635 640

Leu Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr

645 650 655

Pro Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val

660 665 670

Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp

675 680 685

Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Asn Asn Val

690 695 700

Glu Phe Ala Val Asn Pro Asp Gly Val Tyr Thr Glu Pro Arg Pro Ile

705 710 715 720

Gly Thr Arg Tyr Leu Pro Arg Asn Leu

725

<210> 110

<211> 729

<212> PRT

<213> capsid protein of AAV serotype, clone F5VP1@3

<400> 110

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Asp Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro Ala Ala Pro Ser

180 185 190

Ser Val Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Thr Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Ser Ser Ser Gly Ala Thr Asn Asp Asn His Tyr Phe Gly Tyr

260 265 270

Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe

275 280 285

Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg

290 295 300

Pro Lys Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln Val Lys Glu Val

305 310 315 320

Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr

325 330 335

Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly

340 345 350

Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met

355 360 365

Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser Gln Ser Val

370 375 380

Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu

385 390 395 400

Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Ser Phe Glu Asp Val Pro

405 410 415

Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn

420 425 430

Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr

435 440 445

Thr Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly Pro Asn Thr

450 455 460

Met Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln

465 470 475 480

Gln Arg Leu Ser Lys Asn Leu Asp Phe Asn Asn Asn Ser Asn Phe Ala

485 490 495

Trp Thr Ala Ala Thr Lys Tyr His Leu Asn Gly Arg Asn Ser Leu Thr

500 505 510

Asn Pro Gly Ile Pro Met Ala Thr Asn Lys Asp Asp Glu Asp Gln Phe

515 520 525

Phe Pro Ile Asn Gly Val Leu Val Phe Gly Lys Thr Gly Ala Ala Asn

530 535 540

Lys Thr Thr Leu Glu Asn Val Leu Met Thr Ser Glu Glu Glu Ile Lys

545 550 555 560

Thr Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn

565 570 575

Leu Gln Ser Ser Thr Ala Gly Pro Gln Ser Gln Thr Ile Asn Ser Gln

580 585 590

Gly Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln

595 600 605

Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro

610 615 620

Ser Pro Leu Met Gly Gly Phe Gly Leu Glu His Pro Pro Pro Gln Ile

625 630 635 640

Leu Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr

645 650 655

Pro Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val

660 665 670

Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp

675 680 685

Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Asn Asn Val

690 695 700

Glu Phe Ala Val Asn Pro Asp Gly Val Tyr Thr Glu Pro Arg Pro Ile

705 710 715 720

Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725

<210> 111

<211> 729

<212> PRT

<213> capsid protein of AAV serotype, clone F3VP1

<400> 111

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Ile Gly Ser Pro Asp Ser Ser Thr Gly Ile Gly Lys Lys Gly Gln

145 150 155 160

Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu

165 170 175

Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro Ala Ala Pro Ser

180 185 190

Ser Val Gly Ser Gly Thr Met Ala Ala Gly Gly Gly Ala Pro Met Ala

195 200 205

Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asn Trp

210 215 220

His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr

225 230 235 240

Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile

245 250 255

Ser Ser Ser Ser Ser Gly Ala Thr Asn Asp Asn His Tyr Phe Gly Tyr

260 265 270

Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe

275 280 285

Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg

290 295 300

Pro Lys Lys Leu Arg Phe Lys Leu Leu Asn Ile Gln Val Lys Glu Val

305 310 315 320

Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr

325 330 335

Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly

340 345 350

Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met

355 360 365

Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asp Asn Gly Ser Gln Ser Val

370 375 380

Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu

385 390 395 400

Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Ser Phe Glu Asp Val Pro

405 410 415

Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn

420 425 430

Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ala Arg Thr Gln Ser Thr

435 440 445

Thr Gly Ser Thr Arg Glu Leu Gln Phe His Gln Ala Gly Pro Asn Thr

450 455 460

Met Ala Glu Gln Ser Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln

465 470 475 480

Gln Arg Leu Ser Lys Asn Leu Asp Phe Asn Asn Asn Ser Asn Phe Ala

485 490 495

Trp Thr Ala Ala Thr Lys Tyr His Leu Asn Gly Arg Asn Ser Leu Thr

500 505 510

Asn Pro Gly Ile Pro Met Ala Thr Asn Lys Asp Asp Glu Asp Gln Phe

515 520 525

Phe Pro Ile Asn Gly Val Leu Val Phe Gly Lys Thr Gly Ala Ala Asn

530 535 540

Lys Thr Thr Leu Glu Asn Val Leu Met Thr Ser Glu Glu Glu Ile Lys

545 550 555 560

Thr Thr Asn Pro Val Ala Thr Glu Glu Tyr Gly Val Val Ser Ser Asn

565 570 575

Leu Gln Ser Ser Thr Ala Gly Pro Gln Ser Gln Thr Ile Asn Ser Gln

580 585 590

Gly Ala Leu Pro Gly Met Val Trp Gln Asn Arg Asp Val Tyr Leu Gln

595 600 605

Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro

610 615 620

Ser Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile

625 630 635 640

Leu Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Glu Val Phe Thr

645 650 655

Pro Ala Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val

660 665 670

Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp

675 680 685

Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Asn Asn Val

690 695 700

Glu Phe Ala Val Asn Pro Asp Gly Val Tyr Thr Glu Pro Arg Pro Ile

705 710 715 720

Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725

<210> 112

<211> 735

<212> PRT

<213> capsid protein of AAV serotype, clone 42.6B

<400> 112

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Arg Lys Leu Arg Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Thr Asp Asp Gly Val Thr Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Ser Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ser Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Thr Phe Glu Glu Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ala Arg Thr Gln Ser Thr Thr Gly Ser Thr Arg Glu Leu Gln Phe His

450 455 460

Gln Ala Gly Pro Asn Thr Met Ala Glu Gln Ser Lys Asn Trp Leu Pro

465 470 475 480

Gly Pro Cys Tyr Arg Gln Gln Arg Leu Ser Lys Asn Ile Asp Ser Asn

485 490 495

Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His Leu Asn

500 505 510

Gly Arg Asn Ser Leu Thr Asn Pro Gly Val Ala Met Ala Thr Asn Lys

515 520 525

Asp Asp Glu Asp Gln Phe Phe Pro Ile Asn Gly Val Leu Val Phe Gly

530 535 540

Lys Thr Gly Ala Ala Asn Lys Thr Thr Leu Glu Asn Val Leu Met Thr

545 550 555 560

Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Glu Tyr

565 570 575

Gly Val Val Ser Ser Asn Leu Gln Ser Ser Thr Ala Gly Pro Gln Thr

580 585 590

Gln Thr Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val Trp Gln Asn

595 600 605

Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr

610 615 620

Asp Gly Asn Phe His Pro Ser Pro Leu Met Asp Gly Phe Gly Leu Lys

625 630 635 640

His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn

645 650 655

Pro Pro Glu Val Phe Thr Pro Ala Lys Phe Ala Ser Phe Ile Thr Gln

660 665 670

Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys

675 680 685

Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr

690 695 700

Ala Lys Ser Asn Asn Val Glu Phe Ala Val Asn Asn Glu Gly Val Tyr

705 710 715 720

Thr Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

725 730 735

<210> 113

<211> 685

<212> PRT

<213> capsid protein of AAV serotype, clone 42.12

<400> 113

Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser

1 5 10 15

Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro

20 25 30

Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro

35 40 45

Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro

50 55 60

Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp

65 70 75 80

Lys Gln Leu Glu Gln Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala

85 90 95

Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly

100 105 110

Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro

115 120 125

Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg

130 135 140

Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile

145 150 155 160

Gly Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln

165 170 175

Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro

180 185 190

Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr Met Ala Ala Gly Gly

195 200 205

Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser

210 215 220

Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val

225 230 235 240

Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His

245 250 255

Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn Asp

260 265 270

Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn

275 280 285

Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn

290 295 300

Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn

305 310 315 320

Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala

325 330 335

Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln

340 345 350

Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe

355 360 365

Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn

370 375 380

Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr

385 390 395 400

Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr

405 410 415

Gln Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser

420 425 430

Leu Asp Arg Leu Thr Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu

435 440 445

Ala Arg Thr Gln Ser Thr Thr Gly Ser Thr Arg Gly Leu Gln Phe His

450 455 460

Gln Ala Gly Pro Asn Thr Met Ala Glu Gln Ser Lys Asn Trp Leu Pro

465 470 475 480

Gly Pro Cys Tyr Arg Gln Gln Arg Leu Ser Lys Asn Ile Asp Ser Asn

485 490 495

Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His Leu Asn

500 505 510

Gly Arg Asn Ser Leu Thr Asn Pro Gly Val Ala Met Ala Thr Asn Lys

515 520 525

Asp Asp Glu Asp Gln Phe Phe Pro Ile Asn Gly Val Leu Val Phe Gly

530 535 540

Lys Thr Gly Ala Ala Asn Lys Thr Thr Leu Glu Asn Val Leu Met Thr

545 550 555 560

Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Glu Tyr

565 570 575

Gly Val Val Ser Ser Asn Leu Gln Ser Ser Thr Ala Gly Pro Gln Thr

580 585 590

Gln Thr Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val Trp Gln Asn

595 600 605

Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr

610 615 620

Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys

625 630 635 640

His Pro Pro Pro Gln Ile Leu Ile Lys Tyr Thr Ser Asn Tyr Tyr Lys

645 650 655

Ser Thr Asn Val Asp Phe Ala Val Asn Thr Glu Gly Thr Tyr Ser Glu

660 665 670

Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu

675 680 685

<210> 114

<211> 724

<212> PRT

<213> capsid protein of AAV serotype cloning of AAV5CAP

<400> 114

Met Ser Phe Val Asp His Pro Pro Asp Trp Leu Glu Glu Val Gly Glu

1 5 10 15

Gly Leu Arg Glu Phe Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys

20 25 30

Pro Asn Gln Gln His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro Gly

35 40 45

Tyr Asn Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly Glu Pro Val

50 55 60

Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp Ile Ser Tyr Asn Glu

65 70 75 80

Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala Asp

85 90 95

Ala Glu Phe Gln Glu Lys Leu Ala Asp Asp Thr Ser Phe Gly Gly Asn

100 105 110

Leu Gly Lys Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Phe

115 120 125

Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg Ile

130 135 140

Asp Asp His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser

145 150 155 160

Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser Gln

165 170 175

Gln Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly Ala Asp Thr

180 185 190

Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp Asn Asn Gln Gly Ala

195 200 205

Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys Asp Ser Thr Trp

210 215 220

Met Gly Asp Arg Val Val Thr Lys Ser Thr Arg Thr Trp Val Leu Pro

225 230 235 240

Ser Tyr Asn Asn His Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp

245 250 255

Gly Ser Asn Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr

260 265 270

Phe Asp Phe Asn Arg Phe His Ser His Trp Ser Pro Arg Asp Trp Gln

275 280 285

Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg Pro Arg Ser Leu Arg Val

290 295 300

Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln Asp Ser Thr

305 310 315 320

Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp

325 330 335

Asp Asp Tyr Gln Leu Pro Tyr Val Val Gly Asn Gly Thr Glu Gly Cys

340 345 350

Leu Pro Ala Phe Pro Pro Gln Val Phe Thr Leu Pro Gln Tyr Gly Tyr

355 360 365

Ala Thr Leu Asn Arg Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser

370 375 380

Phe Phe Cys Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn

385 390 395 400

Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser

405 410 415

Phe Ala Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu Val Asp

420 425 430

Gln Tyr Leu Tyr Arg Phe Val Ser Thr Asn Asn Thr Gly Gly Val Gln

435 440 445

Phe Asn Lys Asn Leu Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn Trp

450 455 460

Phe Pro Gly Pro Met Gly Arg Thr Gln Gly Trp Asn Leu Gly Ser Gly

465 470 475 480

Val Asn Arg Ala Ser Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu

485 490 495

Leu Glu Gly Ala Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr

500 505 510

Asn Asn Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile

515 520 525

Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu

530 535 540

Gly Asn Met Leu Ile Thr Ser Glu Ser Glu Thr Gln Pro Val Asn Arg

545 550 555 560

Val Ala Tyr Asn Val Gly Gly Gln Met Ala Thr Asn Asn Gln Ser Ser

565 570 575

Thr Thr Ala Pro Ala Thr Gly Thr Tyr Asn Leu Gln Glu Ile Val Pro

580 585 590

Gly Ser Val Trp Met Glu Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp

595 600 605

Ala Lys Ile Pro Glu Thr Gly Ala His Phe His Pro Ser Pro Ala Met

610 615 620

Gly Gly Phe Gly Leu Lys His Pro Pro Pro Met Met Leu Ile Lys Asn

625 630 635 640

Thr Pro Val Pro Gly Asn Ile Thr Ser Phe Ser Asp Val Pro Val Ser

645 650 655

Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Thr Val Glu Met Glu

660 665 670

Trp Glu Leu Lys Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln

675 680 685

Tyr Thr Asn Asn Tyr Asn Asp Pro Gln Phe Val Asp Phe Ala Pro Asp

690 695 700

Ser Thr Gly Glu Tyr Arg Thr Thr Arg Pro Ile Gly Thr Arg Tyr Leu

705 710 715 720

Thr Arg Pro Leu

<210> 115

<211> 9

<212> DNA

<213> DraIII restriction sites

<400> 115

caccacgtc 9

<210> 116

<211> 28

<212> DNA

<213> AV2cas

<400> 116

cgcagagacc aaagttcaac tgaaacga 28

<210> 117

<211> 255

<212> DNA

<213> adeno-associated virus serotype 10

<400> 117

ggtaattcct ccggaaattg gcattgcgat tccacatggc tgggcgacag agtcatcacc 60

accagcaccc gaacctgggt cctgcccacc tacaacaacc acatctacaa gcaaatctcc 120

agcgagacag gagccaccaa cgacaaccac tacttcggct acagcacccc ctgggggtat 180

tttgacttta acagattcca ctgccacttt tcaccacgtg actggcagcg actcatcaac 240

aacaactggg gattc 255

<210> 118

<211> 258

<212> DNA

<213> adeno-associated Virus serotype 11

<400> 118

ggtaattcct ccggaaattg gcattgcgat tccacatggc tgggcgacag agtcatcacc 60

accagcaccc gaacctgggc cctgccaacc tacaacaacc acctctacaa acaaatctcc 120

agcgcttcaa cgggggccag caacgacaac cactactttg gctacagcac cccctggggg 180

tattttgact ttaacagatt ccactgccac ttctcaccac gtgactggca gcgactcatc 240

aacaacaact ggggattc 258

<210> 119

<211> 255

<212> DNA

<213> adeno-associated Virus serotype 12

<400> 119

ggtaattcct ccggaaattg gcattgcgat tccacatggc tgggcgaccg agtcattacc 60

accagcaccc ggacttgggc cctgcccacc tacaacaacc acctctacaa gcaaatctcc 120

agccaatcgg gtgccaccaa cgacaaccac tacttcggct acagcacccc ttgggggtat 180

tttgatttca acagattcca ctgccatttc tcaccacgtg actggcagcg actcatcaac 240

aacaactggg gattc 255

<210> 120

<211> 2205

<212> DNA

<213> adeno-associated Virus serotype, clone A3.1vp1

<400> 120

atggctgccg atggttatct tccagattgg ctcgaggaca ctctctctga aggaatcaga 60

cagtggtgga agctcaaacc tggcccacca ccgccgaaac ctaaccaaca acaccgggac 120

gacagtaggg gtcttgtgct tcctgggtac aagtacctcg gacccttcaa cggactcgac 180

aaaggagagc cggtcaacga ggcagacgcc gcggccctcg agcacgacaa agcctacgac 240

caccagctca agcaagggga caacccgtac ctcaaataca accacgcgga cgctgaattt 300

caggagcgtc ttcaagaaga tacgtctttc gggggcaacc tcgggcgagc agtcttccag 360

gccaaaaaga gggtactcga gcctcttggt ctggttgagg aagctgttaa gacggctcct 420

ggaaaaaaga gacctataga gcagtctcct gcagaaccgg actcttcctc gggcatcggc 480

aaatcaggcc agcagcccgc taagaaaaga ctcaattttg gtcagactgg cgacacagag 540

tcagtcccag accctcaacc aatcggagaa ccccccgcag ccccctctgg tgtgggatct 600

aatacaatgg cttcaggcgg tggggcacca atggcagaca ataacgaagg cgccgacgga 660

gtgggtaatt cctcgggaaa ttggcattgc gattccacat ggatgggcga cagagttatc 720

accaccagca caagaacctg ggccctcccc acctacaata atcacctcta caagcaaatc 780

tccagcgaat cgggagccac caacgacaac cactacttcg gctacagcac cccctggggg 840

tattttgact ttaacagatt ccactgtcac ttctcaccac gtgactggca gcgactcatc 900

aacaacaact ggggatttag acccaagaaa ctcaatttca agctcttcaa catccaagtc 960

aaggaggtca cgcagaatga tggaaccacg accatcgcca ataaccttac cagcacggtg 1020

caggtcttca cagactctga gtaccagctg ccctacgtcc tcggttcggc tcaccagggc 1080

tgccttccgc cgttcccagc agacgtcttc atgattcctc agtacggcta cttgactctg 1140

aacaatggca gccaagcggt aggacgttct tcattctact gtctagagta ttttccctct 1200

cagatgctga ggacgggaaa caacttcacc ttcagctaca cttttgaaga cgtgcctttc 1260

cacagcagct acgcgcacag ccagagtctg gatcggctga tgaatcctct cattgaccag 1320

tacctgtatt acctgagcaa aactcagggt acaagtggaa caacgcagca atcgagactg 1380

cagttcagcc aagctgggcc tagctccatg gctcagcagg ccaaaaactg gctaccggga 1440

cccagctacc gacagcagcg aatgtctaag acggctaatg acaacaacaa cagtgaattt 1500

gcttggactg cagccaccaa atattacctg aatggaagaa attctctggt caatcccggg 1560

cccccaatgg ccagtcacaa ggacgatgag gaaaagtatt tccccatgca cggaaatctc 1620

atctttggaa aacaaggcac aggaactacc aatgtggaca ttgaatcagt gcttattaca 1680

gacgaagaag aaatcagaac aactaatcct gtggctacag aacaatacgg acaggttgcc 1740

accaaccatc agagtcagaa caccacagct tcctatggaa gtgtggacag ccagggaatc 1800

ttacctggaa tggtgtggca ggaccgcgat gtctatcttc aaggtcccat ttgggccaaa 1860

actcctcaca cggacggaca ctttcatcct tctccgctca tgggaggctt tggactgaaa 1920

caccctcctc cccagatcct gatcaaaaac acacctgtgc cagcgaatcc cgcgaccact 1980

ttcactcctg gaaagtttgc ttcgttcatt acccagtatt ccaccggaca ggtcagcgtg 2040

gaaatagagt gggagctgca gaaagaaaac agcaaacgct ggaacccaga aattcagtac 2100

acctccaact acaacaagtc ggtgaatgtg gagtttaccg tggacgcaaa cggtgtttat 2160

tctgaacccc gccctattgg cactcgttac cttacccgga acttg 2205

Claims (22)

1. A recombinant adeno-associated virus (AAV) comprising an AAV capsid comprising a vp1 protein, an AAV vp2 protein, and an AAV vp3 protein, the vp1 protein having the sequence consisting of amino acids 1 through 738 of SEQ ID No. 85 or a sequence that is at least 95% identical over the full length of amino acids 1 through 738 of SEQ ID No. 85, wherein the recombinant AAV further comprises a nucleic acid molecule packaged within the capsid, the nucleic acid molecule comprising at least one AAV Inverted Terminal Repeat (ITR) and a non-AAV nucleic acid sequence encoding a gene product that is a dystrophin operably linked to sequences that direct expression of the gene product in a host cell.

2. The recombinant AAV according to claim 1, wherein the sequence of vp1 protein is at least 97% identical to the full length of amino acids 1 to 738 of SEQ ID No. 85.

3. The recombinant AAV according to claim 1, wherein the sequence of vp1 protein is at least 99% identical to the full length of amino acids 1 to 738 of SEQ ID No. 85.

4. The recombinant AAV according to claim 1, wherein the vp1 protein has the sequence of amino acids 1 to 738 full length of SEQ ID No. 85.

5. A recombinant adeno-associated virus (AAV) having an AAV capsid comprising an AAV vp1 protein, an AAV vp2 protein, and an AAV vp3 protein, the AAV vp2 protein having the sequence consisting of amino acids 138 to 738 of SEQ ID NO 85 or a sequence at least 95% identical to the full length of amino acids 138 to 738 of SEQ ID NO 85, wherein the recombinant AAV further comprises a nucleic acid molecule packaged within the capsid comprising at least one AAV Inverted Terminal Repeat (ITR) and a non-AAV nucleic acid sequence encoding a gene product operably linked to sequences that direct expression of the gene product in a host cell, wherein the gene product is a dystrophin protein.

6. The recombinant AAV according to claim 5, wherein the sequence of vp2 protein is at least 97% identical to the full length of amino acids 138 to 738 of SEQ ID NO 85.

7. The recombinant AAV according to claim 5, wherein the sequence of vp2 protein is at least 99% identical to the full length of amino acids 138 to 738 of SEQ ID NO 85.

8. The recombinant AAV of claim 5, wherein the vp2 protein has the sequence of amino acids 138 to 738 full length of SEQ ID NO 85.

9. A recombinant adeno-associated virus (AAV) having an AAV capsid comprising an AAV vp1 protein, an AAV vp2 protein, and an AAV vp3 protein, the AAV vp3 protein having the sequence consisting of amino acids 204 to 738 of SEQ ID NO 85 or a sequence that is at least 95% identical over the full length of amino acids 204 to 738 of SEQ ID NO 85, wherein the recombinant AAV further comprises a nucleic acid molecule packaged within the capsid comprising at least one AAV Inverted Terminal Repeat (ITR) and a non-AAV nucleic acid sequence encoding a gene product operably linked to sequences that direct expression of the gene product in a host cell, wherein the gene product is a dystrophin protein.

10. The recombinant AAV according to claim 9, wherein the sequence of vp3 protein is at least 97% identical to the full length of amino acids 204 to 738 of SEQ ID No. 85.

11. The recombinant AAV according to claim 9, wherein the vp3 protein has a sequence of SEQ ID NO 85 in which amino acids 204 to 738 are at least 99% identical over the full length.

12. The recombinant AAV according to claim 9, wherein the vp3 protein has the sequence of amino acids 204 to 738 full length of SEQ ID No. 85.

13. The recombinant AAV according to claim 1, wherein the AAV ITRs are from AAV2.

14. The recombinant AAV of claim 5, wherein the AAV ITRs are from AAV2.

15. The recombinant AAV according to claim 9, wherein the AAV ITRs are from AAV2.

16. A composition comprising a pharmaceutically compatible carrier and at least the recombinant AAV of claim 1.

17. A composition comprising a pharmaceutically compatible carrier and at least the recombinant AAV of claim 5.

18. A composition comprising a pharmaceutically compatible carrier and at least the recombinant AAV of claim 9.

19. A method of delivering a transgene product to a subject, the method comprising administering a recombinant AAV according to claim 1.

20. A method of delivering a transgene product to a subject, the method comprising administering a recombinant AAV according to claim 5.

21. A method of delivering a transgene product to a subject, the method comprising administering a recombinant AAV according to claim 9.

22. An isolated adeno-associated virus (i.e., AAV) comprising an AAV capsid having an amino acid sequence selected from the group consisting of: AAV7, amino acids 1 to 737 of SEQ ID NO 2; c1, SEQ ID NO: 60; c2, SEQ ID NO: 61; c5, SEQ ID NO: 62; a3-3, SEQ ID NO: 66; a3-7, SEQ ID NO 67; a3-4, SEQ ID NO: 68; a3-5, SEQ ID NO: 69; 3.3b, SEQ ID NO: 62; 223.4, SEQ ID NO: 73; 223-5, SEQ ID NO: 74; 223-10, SEQ ID NO: 75; 223-2, SEQ ID NO: 76; 223-7, SEQ ID NO: 77; 223-6, SEQ ID NO: 78; 44-1, SEQ ID NO: 79; 44-5, SEQ ID NO: 80; 44-2, SEQ ID NO: 81; 42-15, SEQ ID NO: 84; 42-8, SEQ ID NO: 85; 42-13, SEQ ID NO: 86; 42-3A, SEQ ID NO: 87; 42-4, SEQ ID NO: 88; 42-5A, SEQ ID NO: 89; 42-1B, SEQ ID NO: 90; 42-5B, SEQ ID NO: 91; 43-1, SEQ ID NO: 92; 43-12, SEQ ID NO: 93; 43-5, SEQ ID NO 94; 43-21, SEQ ID NO: 96; 43-25, SEQ ID NO: 97; 43-20, SEQ ID NO: 99; 24.1, SEQ ID NO 101; 42.2, SEQ ID NO 102; 7.2, SEQ ID NO: 103; 27.3, SEQ ID NO 104; 16.3, SEQ ID NO: 105; 42.10, SEQ ID NO: 106; 42-3B, SEQ ID NO: 107; 42-11, SEQ ID NO: 108; f1, SEQ ID NO: 109; f5, SEQ ID NO: 110; f3, SEQ ID NO: 111; 42-6B, SEQ ID NO: 112; and 42-12, SEQ ID NO: 113.

Images