CN111956668B - Skin regeneration and repair cell composition and preparation method thereof - Google Patents

Skin regeneration and repair cell composition and preparation method thereof Download PDF

Info

Publication number
CN111956668B
CN111956668B CN202010881284.5A CN202010881284A CN111956668B CN 111956668 B CN111956668 B CN 111956668B CN 202010881284 A CN202010881284 A CN 202010881284A CN 111956668 B CN111956668 B CN 111956668B
Authority
CN
China
Prior art keywords
adipose
stem cells
derived stem
cells
skin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010881284.5A
Other languages
Chinese (zh)
Other versions
CN111956668A (en
Inventor
王阳
杨洋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Li Xiyuan
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN202010881284.5A priority Critical patent/CN111956668B/en
Publication of CN111956668A publication Critical patent/CN111956668A/en
Application granted granted Critical
Publication of CN111956668B publication Critical patent/CN111956668B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1808—Epidermal growth factor [EGF] urogastrone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1825—Fibroblast growth factor [FGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/36—Polysaccharides; Derivatives thereof, e.g. gums, starch, alginate, dextrin, hyaluronic acid, chitosan, inulin, agar or pectin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/99—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0667—Adipose-derived stem cells [ADSC]; Adipose stromal stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/10—General cosmetic use
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
    • A61K2800/86—Products or compounds obtained by genetic engineering
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Abstract

The invention relates to a cell composition for skin regeneration and repair and a preparation method thereof. The high expression of the miR of the transgenic miR-126 adipose-derived stem cell prepared by the invention can promote the differentiation of the adipose-derived stem cell to a skin cell. After the transgenic miR-126 adipose-derived stem cells are prepared into a skin injury repairing agent, verification proves that the transgenic miR-126 adipose-derived stem cells have a remarkable effect of promoting wound healing, and therefore, the transgenic miR-126 adipose-derived stem cells can be used for diminishing inflammation, regenerating skin or healing wounds.

Description

Skin regeneration and repair cell composition and preparation method thereof
Technical Field
The invention relates to the field of biology, in particular to a skin regeneration and repair cell composition and a preparation method thereof.
Background
A certain number of stem cells are present in the tissues and organs of an organism. Tissue repair stem cells which maintain the regeneration of the stem cells or participate in the injury are primitive cells which have the characteristics of multidirectional differentiation potential and self-renewal and have slow proliferation speed, can be widely applied to various fields of medical development, and are part of the treatment of skin injury, the tissue regeneration and the rejuvenation. Allogenic skin grafts are often used by patients with severe burns. However, such transplants generally only serve to temporarily cover the wound for approximately 30 years. Many patients benefit from the culture of cell therapy products obtained by cell culture through autologous epidermal keratinocytes. A large number of patients with severe burns are effectively treated.
Previous studies have demonstrated that pluripotent stem cells can differentiate into epidermal and dermal cells. Various tissue engineered skin products have been approved by the U.S. FDA, Green, etc. can prevent infection and dehydration by culturing patient's keratinocytes in vitro and applying these cell products to patients with extensive burns. In addition, the treatment method of using allogeneic cells for temporary epidermal cell replacement can also be applied to the treatment of other skin diseases. In particular, wound healing for certain ulcerative skin diseases and certain inherited skin diseases may not require permanent preservation of the transplanted tissue. In fact, it is a biological acellular matrix. Or even a substrate containing biological substances such as fibers, collagen, hyaluronic acid and the like. When it is autografted. The same situation occurs when allogeneic keratinocytes are transplanted. And gradually exclude the temporary covering effect on the wound surface. Can also stimulate the endogenous proliferation of cells and the accumulation of stem cells in normal tissues around the wound surface to the wound surface.
Currently, the current practice is. The medical aspects of skin rejuvenation also include gene therapy related content. For example, in wound healing processes such as treatment of malignant dystrophic epidermolysis bullosa by collagen type VII gene transfection, growth factors regulate the overall process of skin regeneration after injury, including various aspects such as cell chemotaxis, proliferation, matrix synthesis and degradation, inflammatory response, and the like. Therefore, in past clinical practice, mitogenic growth factors such as basic fibroblast growth factor (bFGF), Epidermal Growth Factor (EGF) and Keratinocyte Growth Factor (KGF) are often used to accelerate wound healing and improve wound repair. However, the above-mentioned growth factors have a very limited effect for topical application, which may be related to factors such as short half-life of the growth factor, low activity and bioavailability or the need to carry other (protein) molecules. The advantage of gene therapy is that it overcomes the various deficiencies of external application of growth factors by enabling active and long-term expression of local living cells. At present, the techniques for gene transfection of keratin cells are mature, but with the continued differentiation of keratin cells, the graft eventually falls off in the form of a "crust" in vivo. Therefore, it has not been possible to obtain a good therapeutic effect by introducing a gene into adult cells other than stem cells.
With the deepening of the research of the tissue engineering technology, the application of the tissue engineering skin to repair the skin defect is one of the hot spots of the current skin defect repair research, and the adipose tissue source stem cells (ADSCs) have the multidirectional differentiation potential [, are possible to differentiate towards vascular endothelial cells and epidermal cells under the wound surface microenvironment of the skin due to wide sources and convenient material taking, and are ideal sources of the skin tissue engineering seed cells. In 2001, Zuk and the like find mesenchymal stem cells called Adipose-derived stem cells (ADSCs) in Adipose tissues for the first time, the mesenchymal stem cells are stem cells with multiple differentiation potentials, and recently become star cells in the stem cells, and become the key point of various injury repair researches.
Although the use of adipose-derived stem cells for the treatment of skin lesions has been studied, the efficiency of stem cell transformation into skin cells is not high and the activity is not good, and further improvement is desired.
Disclosure of Invention
The invention overcomes the defects of the prior art and provides a method for efficiently converting adipose-derived stem cells into skin cells.
In the process of researching the differentiation of the adipose-derived stem cells into the skin, the inventor discovers that miR-126 and miR34a are high-expression when the adipose-derived stem cells are differentiated into the skin cells, preliminarily presumes that the high-expression of the miR can promote the differentiation of the adipose-derived stem cells into the skin cells, and discovers that both miRs can up-regulate the expression of RUNX2 protein when the differentiated cells are subjected to protein identification, and the RUNX2 protein is also an important protein for promoting the differentiation of the adipose-derived stem cells into the epidermis, so that the preliminary identification of the miR-126 and miR34a positively influences the expression of RUNX2 through a series of cell regulation and control so as to promote the differentiation of the adipose-derived stem cells into the skin cells.
In one aspect of the invention, the invention provides an miR-126 gene-transferred adipose-derived stem cell.
Specifically, the transgenic adipose-derived stem cell is constructed by the steps of F upstream: CGGGATCCGTTGCCCGGAGCCTCATATC; CCAAGCTTCTCAGCGGCGTTTTCGATG as a primer and an adipose-derived stem cell as a template, and the miR-126 precursor sequence is obtained by amplification and is connected with a vector PcDNA3.1(-) to obtain a recombinant plasmid pcDNA3.1(-) -miR-126 which is further transfected into the adipose-derived stem cell.
Transfection in the present invention means gene transfer and infection by injection of gene DNA, plasmid DNA, viral DNA. Specifically, transfection of the expression vector can be performed by using all available transfection methods known in the art, including calcium phosphate transfection, electroporation, microinjection, liposome injection, and the like. In addition, DNA can be introduced into eukaryotic cells using viruses or bacteria as vectors.
The invention also provides a method for differentiating the transgenic adipose-derived stem cells into skin cells, which comprises the steps of conventionally culturing the transgenic adipose-derived stem cells until the cell fusion degree reaches 50%, replacing the transgenic adipose-derived stem cells with an epidermal induction culture medium for induction culture for 7 days, and replacing liquid for half of every other day. The formula of the epidermal induction conditioned medium comprises: DMEM DF12 ═ 1:1, 20ng/ml epidermal growth factor, 15ng/ml basic fibroblast growth factor, 1% insulin-transferrin-selenium complex, 0.1. mu.M dexamethasone, 100U/ml penicillin and 100. mu.g/ml streptomycin.
In another aspect of the invention, the preparation method comprises the steps of weighing anhydrous sodium alginate, adding deionized water, uniformly stirring until the anhydrous sodium alginate is dissolved, adding glycerol, uniformly mixing, and then adding the serum-free mesenchymal stem cell culture medium, and sufficiently and uniformly mixing to obtain a repair base solution; adding the miR gene-transferred stem cell suspension, the epidermal cell growth factor and the alkaline fibroblast growth factor into 1ml of the repair base solution, adding the sodium hyaluronate solution, and stirring uniformly to obtain the transgenic skin injury repair agent.
The skin injury repairing agent prepared by the invention is a paste, and can be uniformly applied to a skin wound to form a covering. The cell repairing agent can induce to form new epidermis and dermis, promote the self skin at the edge of the wound surface to grow into the wound surface and further efficiently promote healing, and is far faster than the healing promoter in the prior art by only 7 days at the fastest speed.
In another aspect of the invention, the invention provides application of the miR-126 gene-transferred adipose-derived stem cells in preparation of a medicament for treating skin injury.
It is still another object of the present invention to provide a pharmaceutical composition for skin regeneration comprising a component of miR-126 gene-transfected adipose-derived stem cells.
It is still another object of the present invention to provide a pharmaceutical composition for wound healing, which comprises miR-126 gene-transfected adipose-derived stem cells.
The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier, and may be formulated into transdermal dosages according to known methods, such as liquids, suspensions, emulsions, lotions, ointments and the like.
Pharmaceutically acceptable carriers may include aqueous diluents or solvents such as phosphate buffered saline, purified water, sterile water and the like and non-aqueous diluents or solvents such as propylene glycol, olive oil and the like, which may optionally include wetting agents, flavoring agents, preservatives.
The pharmaceutical compositions of the present invention may be formulated to be suitable for the desired route of administration. The route of administration may be transdermal. The medicament may also include sterile diluents such as water for injection, saline, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solutions; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetate, citrate or phosphate; and a tension controller such as sodium chloride or glucose. The pH may be acid or base, for example, controlled with hydrochloric acid or sodium hydroxide.
Systemic administration may also be by mucosal or transdermal routes. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents and bile salts. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated as ointments, pastes, gels or creams as generally known in the art.
In another aspect of the present invention, there is also provided a cosmetic composition, which can be prepared in various types according to the use of the transgenic adipose stem cells of the present invention. For example, the cosmetic composition may be formulated into enteric products, shampoos, hair creams, hair lotions, hair gels, and the like, and may be used by diluting it with a cleansing solution, an astringent solution, and a moisturizing solution. In addition, the cosmetic composition may include conventional adjuvants commonly used in the field of cosmetic compositions, such as stabilizers, solubilizers, vitamins, pigments and flavoring agents.
In another aspect of the present invention, a cosmetic product of transgenic adipose stem cells is prepared. In particular to a skin regeneration repair beauty mask for preparing a transgenic adipose-derived stem cell, which comprises the following components:
1)10ml of the skin injury repair agent containing transgenic adipose-derived stem cells prepared in example 4;
2)1 piece of hydrogel film;
putting the mask into a tin foil paper bag containing 10ml of a repairing agent, and performing thermal shrinkage sealing packaging to form a product; the biological facial mask product is preserved at 4 deg.C.
Advantageous effects
The transgenic miR-126 or miR34a adipose-derived stem cells prepared according to the invention have high expression of miR, and can promote differentiation of adipose-derived stem cells into skin cells, and when protein identification is carried out on the differentiated cells, both miR can up-regulate the expression of RUNX2 protein, and the RUNX2 protein is also an important protein for promoting differentiation of adipose-derived stem cells into epidermis. After the transgenic miR-126 or miR34a adipose-derived stem cells are prepared into a skin injury repairing agent, verification proves that the repairing agent has a remarkable effect of promoting wound healing, and therefore, the repairing agent can be used for diminishing inflammation, regenerating skin or healing wounds.
Drawings
FIG. 1miR gene expression amount result chart
FIG. 2 shows RUNX2 expression level results
Detailed Description
The present invention is described in detail below by way of examples, it should be noted that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention, and those skilled in the art can make some insubstantial modifications and adaptations of the present invention based on the above-described disclosure.
Example 1 isolation screening of adipose-derived Stem cells
About 15g of adipose tissue was extracted under sterile conditions, and erythrocytes were washed out with PBS. Removing blood vessels in adipose tissue by ophthalmic scissors, cutting into fine particles, digesting with 0.25% type I collagenase, centrifuging at 1500 r/min for 10min, and removing lipidSuspending and precipitating adipocytes and supernatant with D-hanks solution, filtering with 200 mesh cell sieve, centrifuging at 1500 r/min for 10min, resuspending the obtained cell extract with high-sugar DMEM culture solution containing 15% fetal calf serum, inoculating in sterile culture flask at appropriate density, and culturing at 37 deg.C under CO2And (3) incubating in an incubator with the volume fraction of 5% and the saturation humidity, changing the liquid for the first time after 5 days, changing the liquid for 1 time after 3 days, digesting and separating the adherent cells by 0.25% trypsin for 3-5 minutes when the primary cells are fused to 85%, carrying out passage, inoculating in a 25ml culture bottle, changing the liquid for 1 time after 3 days, and carrying out passage again when the adherent cells are close to the fusion. Detecting the surface relative specific antigen of the 3 rd generation adipose-derived stem cells by a flow cytometer. Digesting the cells to be detected by 0.25% of trypsin, centrifuging for 10 minutes at 1500 r/min, adding FITC-CD44 fluorescent antibody, PE-CD29 fluorescent antibody and APC-CD105 fluorescent antibody into the cell sediment respectively by 20 mu L, incubating for 30 minutes, washing for 2 times by PBS buffer solution, fixing the cells by 10% formalin, and measuring the positive rate of the antigen on a computer, wherein the results show that characteristic surface markers of the mesenchymal stem cells of CD29, CD44, CD105 and CD13 are all positively expressed in the adipose-derived stem cells, which indicates that the adipose-derived stem cells have the phenotype of the mesenchymal stem cells and are successfully separated. And carrying out subsequent research by taking the third-generation adipose-derived mesenchymal stem cells as cell bases.
Example 2miR-126 transfection of adipose Stem cells
CGGGATCCGTTGCCCGGAGCCTCATATC upstream of the primer F; CCAAGCTTCTCAGCGGCGTTTTCGATG at the downstream of R, the fat stem cell separated in the embodiment 1 is used as a template, a miR-126 precursor sequence is obtained by amplification, BamHI and HindIII are respectively adopted for double enzyme digestion with a vector PcDNA3.1(-), the enzyme digestion product is purified and then is connected with a T4 ligase at 4 ℃ overnight, after a DH5a competent cell is transformed, a positive clone is selected, and a positive plasmid is identified to obtain a recombinant plasmid pcDNA3.1(-) -miR-126.
The third generation adipose-derived stem cells isolated in example 1 were cultured to a logarithmic phase, digested with 0.15% pancreatin, washed with PBS, and washed at 2 × 10 per well5The cells were plated in 6-well plates for 12h and transfected using Liposome Lipo-fectamine2000 transfection reagent as described. A blank control group, an empty vector control group and an experimental group are respectively arranged. After 72h, the transfected cells were harvested, total RNA extracted, and the following stepsReverse transcribing the total RNA into cDNA according to the operation of the kit, detecting the expression of miR-126 by adopting an RT-PCR method, wherein the PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 20s, annealing at 62 ℃ for lmin, 40 cycles. The PCR reaction was repeated 3 times per sample. The result is processed by a delta cycle threshold (Ct) method, and the relative expression quantity 2 is calculated-ΔΔCt. The results are shown in FIG. 1. After the experimental group cells are transfected for 72 hours, the relative expression quantity of miRNA-126 is 3.45 +/-0.21, which is far higher than that of a control group, and the comparison difference has statistical significance (P)<0.05). This indicates that miR-126 is highly expressed.
Example 3 epidermal Induction of miR-126 transfected adipose Stem cells
The transfected positive cells of example 2 were subjected to an epidermal induction experiment. The method is divided into an experimental group 1 (the fat stem cells transfected by miR-126), an experimental group 2 (the fat stem cells not transfected by miR-126) and a control group (normal fat stem cells). The control group is cultured by adopting a low-sugar DMEM medium containing 10% fetal calf serum, and the experimental group is cultured by adopting a conventional method until the cell fusion degree reaches 50%, and then is cultured for 7 days by changing into an epidermal induction medium, and the medium is changed every other day by half. The formula of the epidermal induction conditioned medium comprises: DMEM DF12 ═ 1:1, 20ng/ml epidermal growth factor, 15ng/ml basic fibroblast growth factor, 1% insulin-transferrin-selenium complex, 0.1. mu.M dexamethasone, 100U/ml penicillin and 100. mu.g/ml streptomycin. As a result of observing the change in cell morphology under an inverted microscope, the cells of the experimental groups 1 and 2 exhibited a more typical epithelial-like cell morphology, whereas the control group exhibited no cells exhibiting an epithelial-like cell morphology.
After cells induced and differentiated from adipose-derived stem cells to epidermal cells for 7 days are rinsed once by PBS buffer, 4% paraformaldehyde is added for fixation at room temperature for 15 minutes, the cells are subjected to membrane penetration treatment by the PBS buffer containing 0.3% TritonX100, then the cells are sealed by the PBS buffer containing 10% goat serum, a mouse anti-human cell keratin CK19 monoclonal antibody primary anti-working solution (1:50) is added for overnight incubation at 4 ℃, FITC fluorescent secondary antibody of goat anti-mouse is marked, the cells are incubated at 4 ℃ in dark for 30 minutes, the cells are fully washed three times by the PBS buffer, and the result is observed under a fluorescence microscope. The adipose-derived stem cells were induced into the epidermal cells, expressing the surface marker CK19 unique to the epidermal stem cells, and the total number of cells and the number of completely differentiated cells in 10 fields were randomly counted under a microscope (100 ×) and shown in table 1 by statistical analysis.
TABLE 1 results of cell differentiation efficiency
Group of Cell differentiation efficiency (%)
Experimental group 1 91.4±4.3
Experimental group 2 62.3±3.2
Control group 0
As can be seen from the results of Table 1, the cell differentiation efficiency of the experimental group 1 was 91.4 + -4.3%, and the cell differentiation efficiency of the experimental group 2 was 62.3 + -3.2%, while the control group was not differentiated. This shows that miR-126 can significantly promote the differentiation efficiency of the adipose-derived stem cell. Under the condition of in vitro induction, the adipose-derived stem cells have stronger epidermal cell differentiation capacity.
Example 4 protein detection
Extracting total protein of experimental group before, after and after transfection, performing protein quantification by using dioctylbutyric acid method, denaturing at 100 deg.C for 10min, subjecting 50 μ g of each to PAGE gel electrophoresis, transferring to nitrocellulose filter membrane, and sealing. Adding rabbit anti-human RUNX2 primary antibody and rabbit anti-human beta-actin primary antibody (the dilution ratio is 1: 200) respectively, and incubating overnight at 4 ℃; washing with TTBS solution, adding goat anti-rabbit IgG-HRP secondary antibody (dilution ratio of 1: 5000), and incubating at room temperature for 2 h; and (3) flushing the TTBS liquid, exposing the film, scanning and imaging the film by using a scanner, and performing gray level analysis by using Image Pro-plus6.0 Image analysis software, wherein the result is expressed by the gray value ratio of the target protein to the beta-actin. The experiment was repeated 3 times. The results are shown in FIG. 2:
westernblot showed that miR-transfected adipose stem cells had higher expression of RUNX2 protein than untransfected cells prior to induction. After induction, the expression level of the RUNX2 protein reached 92.2 ± 2.0, which is significantly higher than that of the control group (fig. 2). It can be seen that miR-126 can effectively increase the overexpression of RUNX2 so as to promote the induced differentiation of the human ADSCs to the epidermis.
Example 5 preparation of skin injury repair Agents
Weighing 6g of anhydrous sodium alginate, adding 38ml of deionized water, uniformly stirring until the anhydrous sodium alginate is dissolved, adding 22ml of glycerol, uniformly mixing, adding 40ml of serum-free mesenchymal stem cell culture medium, and fully and uniformly mixing to obtain a repair base solution; adding 1.0 × 10 to 1ml of repair base solution5Cell/ml 1ml of the transgenic stem cell suspension prepared in the embodiment 2, 20ng of the epidermal growth factor, 15ng of the basic fibroblast growth factor, and then 1ml of 1% by mass of sodium hyaluronate solution are added, and the mixture is uniformly stirred to obtain the transgenic skin injury repairing agent.
Weighing 6g of anhydrous sodium alginate, adding 38ml of deionized water, uniformly stirring until the anhydrous sodium alginate is dissolved, adding 22ml of glycerol, uniformly mixing, adding 40ml of serum-free mesenchymal stem cell culture medium, and fully and uniformly mixing to obtain a repair base solution; adding 1.0 × 10 to 1ml of repair base solution5Cell/ml 1ml of the stem cell suspension prepared in the example 1, 20ng of the epidermal growth factor, 15ng of the basic fibroblast growth factor, and then 1ml of the sodium hyaluronate solution with the mass concentration of 1% are added, and the mixture is uniformly stirred to obtain the adipose-derived stem cell skin injury repairing agent.
Weighing 6g of anhydrous sodium alginate, adding 38ml of deionized water, uniformly stirring until the anhydrous sodium alginate is dissolved, adding 22ml of glycerol, uniformly mixing, adding 40ml of serum-free mesenchymal stem cell culture medium, and fully and uniformly mixing to obtain a repair base solution; and adding 20ng of epidermal growth factor and 15ng of basic fibroblast growth factor into 1ml of the repair base solution, adding 1ml of 1% sodium hyaluronate solution by mass concentration, and uniformly stirring to obtain the control skin injury repair agent.
Example 6 mouse experiments
Establishing a rat back full-thickness skin defect model: 10% chloral hydrate is used for carrying out intraperitoneal injection anesthesia (0.3ml/lO0g) on rats, circular wound surfaces with the diameter of 2cm and full-layer skin defect are sequentially manufactured, the two sides of a spine are symmetrically distributed, and the wound surface interval is 2 cm. 12 rats were selected, each with a total of 72 wounds of 6 wounds on the back. Dividing the wound surface of the back of each rat into 3 groups, wherein each group comprises two circular wound surfaces which are symmetrical on two sides of a spine, sequentially arranging a transgenic BMSCs group (A group), an untransformed BMSCs group (B group) and an aseptic PBS control group (C group) from head to tail, smearing the transgenic skin injury repairing agent prepared in the example 5 on the center and the edge of the wound surface of the group A after a model is made, smearing the adipose-derived stem cell skin injury repairing agent prepared in the example 5 on the center and the edge of the wound surface of the group B, smearing the control skin injury repairing agent on the group C, treating the wound surface by a gauze covering and a packing method after smearing is completed, feeding the rat in a single cage, and freely eating and drinking. Wound area was observed at 3, 7, and 14d post-wound, respectively, and wound healing index (WCI) was calculated, which is (1 post-treatment wound area/original wound area) × 100%. Statistical analysis was performed using SPSS13.0 software. As can be seen from the results in table 2:
the healing area ratio of rats in each group increases with the treatment days, and the increase of the groups A and B is more obvious than that of the group C. Wherein the healing area ratio of the rats in the A group is obviously increased compared with the rats in the C group on days 3, 7 and 14, and the healing area ratio of the rats in the B group is obviously increased compared with the rats in the C group on 14 days. And the area ratio of healing was statistically different (P <0.01) on day 7 and 14 in group a compared to group B (table 2). The results show that the transgenic adipose-derived stem cells prepared by the invention have better effect of treating skin injury.
Figure BDA0002654203430000091
P <0.05 compared to group B; compare with group C, # P < 0.05.
After 14 days of using the cell repairing agent, the wound is healed and has better flexibility; the wounds of the control group can be healed after 21 days, and the scar shrinkage is extensive, which shows that the repairing agent of the invention has better application prospect.
Example 7 preparation of cosmetic products of transgenic adipose-derived Stem cells
The skin regeneration repair beauty mask with the transgenic adipose-derived stem cells is prepared from the following components:
1)10ml of the skin injury repair agent containing transgenic adipose-derived stem cells prepared in example 4;
2)1 piece of hydrogel film;
putting the mask into a tin foil paper bag containing 10ml of a repairing agent, and performing thermal shrinkage sealing packaging to form a product; the biological facial mask product is preserved at 4 deg.C.
Sequence listing
<110> Beijing Vast Mei Biotechnology Ltd
<120> cell composition for skin regeneration and repair and preparation method thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cgggatccgt tgcccggagc ctcatatc 28
<210> 2
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ccaagcttct cagcggcgtt ttcgatg 27

Claims (1)

  1. The application of miR-126 in promoting differentiation of human adipose-derived stem cells to epidermal cells is characterized in that: over-expressing miR-126 in adipose-derived stem cells, performing conventional culture on the adipose-derived stem cells over-expressing miR-126 until the cell fusion degree reaches 50%, changing into an epidermal induction culture medium for induction culture for 7 days, changing the culture medium for half every other day, and preparing an epidermal induction condition culture medium formula: DMEM DF12 ═ 1:1, 20ng/ml epidermal growth factor, 15ng/ml basic fibroblast growth factor, 1% insulin-transferrin-selenium complex, 0.1. mu.M dexamethasone, 100U/ml penicillin and 100. mu.g/ml streptomycin, said use being non-therapeutic.
CN202010881284.5A 2020-08-27 2020-08-27 Skin regeneration and repair cell composition and preparation method thereof Active CN111956668B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010881284.5A CN111956668B (en) 2020-08-27 2020-08-27 Skin regeneration and repair cell composition and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010881284.5A CN111956668B (en) 2020-08-27 2020-08-27 Skin regeneration and repair cell composition and preparation method thereof

Publications (2)

Publication Number Publication Date
CN111956668A CN111956668A (en) 2020-11-20
CN111956668B true CN111956668B (en) 2021-07-13

Family

ID=73399677

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010881284.5A Active CN111956668B (en) 2020-08-27 2020-08-27 Skin regeneration and repair cell composition and preparation method thereof

Country Status (1)

Country Link
CN (1) CN111956668B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113373144B (en) * 2021-05-21 2023-09-22 苏州志恒生物科技有限公司 Composition for skin regeneration and repair, preparation method and application thereof
CN114191379A (en) * 2021-12-17 2022-03-18 西安交通大学医学院第一附属医院 Medicine for repairing skin injury by using Pluronic F127 as carrier to perform local transgenosis in vivo and preparation method
CN114875128A (en) * 2022-03-31 2022-08-09 宁波大学 miRNA marker related to skin repair and application thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105154407B (en) * 2015-10-14 2020-06-19 紫程瑞生会(北京)生物技术发展有限公司 Preparation method and application of human adipose-derived stem cells with improved skin repair function
CN108685948B (en) * 2018-05-30 2020-10-30 北京壹典壹生生物技术有限公司 Preparation method of medical cell repairing agent

Also Published As

Publication number Publication date
CN111956668A (en) 2020-11-20

Similar Documents

Publication Publication Date Title
CN111956668B (en) Skin regeneration and repair cell composition and preparation method thereof
EP2368974A1 (en) Methods for isolating mesenchymal stem cells from embryos of human or animals and extracting secretion substances thereof
JP5981947B2 (en) Skin cream
CN108186548A (en) A kind of preparation method of the stem cell factor Essence with anti-aging effects
CN101366728A (en) Compositions for preventing or treating skin defects and methods of use thereof
US9999589B2 (en) Culture medium of adipose-derived stem cell, method for preparing the same, and composition including the same for promoting hair growth
CN108753708B (en) A kind of preparation method of Stem Cell Activity factor freeze-dried powder
CN110129265A (en) A kind of umbilical cord mesenchymal stem cells excretion body, preparation method and the application in cosmetics
CN108685948B (en) Preparation method of medical cell repairing agent
CN103898049B (en) Living cell essence product and preparation method and application thereof
CN105820998A (en) Isolation extraction and culture method for human adipose-derived stem cells (ADSCs) for clinical back-transfusion grade cell therapy
CN100508948C (en) Production for skin beautification and care, and preparation method thereof
CN110898078A (en) Preparation and application of mesenchymal stem cell secretory factor
CN111676187B (en) Isolated mesenchymal stem cell population and uses thereof
CN111821250A (en) Anti-aging composition and preparation method and application thereof
CN106701670A (en) Methods for enhancing bioactive factor secretion capacity of mesenchymal stem cells and extracting active factors in culture solution
CN113151165B (en) Culture medium and culture method for human umbilical cord mesenchymal stem cell amplification
CN108066750A (en) Stem cell and its secretion are used to treat the new application of skin burn
CN113144221A (en) Exosome preparation and preparation method and application thereof
CN115125192B (en) Bone marrow supernatant and application thereof in cell culture
CN111939176B (en) Skin injury repairing agent containing adipose-derived stem cells and preparation method thereof
CN113957040A (en) Adipose-derived stem cell growth factor extract and preparation method and application thereof
CN108066824A (en) A kind of new method for preparing skin blemish medicine
AU8451698A (en) Gene therapy vehicle comprising dermal sheath tissue
CN114525246A (en) Preparation method of umbilical cord mesenchymal stem cell extract for cosmetics

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right

Effective date of registration: 20210623

Address after: No.606, building 1, baihehuayuan community, Tianqiao District, Jinan City, Shandong Province, 250031

Applicant after: Li Xiyuan

Address before: 201-134, 2 / F, building 23, courtyard 8, Dongbei Wangxi Road, Haidian District, Beijing

Applicant before: Beijing Hanmei Biotechnology Co.,Ltd.

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant