CN111808195A - Method for obtaining B cell antibody gene of anti-N-methyl-D-aspartate receptor encephalitis and research on immune repertoire thereof - Google Patents

Method for obtaining B cell antibody gene of anti-N-methyl-D-aspartate receptor encephalitis and research on immune repertoire thereof Download PDF

Info

Publication number
CN111808195A
CN111808195A CN202010742037.7A CN202010742037A CN111808195A CN 111808195 A CN111808195 A CN 111808195A CN 202010742037 A CN202010742037 A CN 202010742037A CN 111808195 A CN111808195 A CN 111808195A
Authority
CN
China
Prior art keywords
microliter
minutes
cell
chain reaction
polymerase chain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010742037.7A
Other languages
Chinese (zh)
Inventor
王晶
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Psychology of CAS
Original Assignee
Institute of Psychology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Psychology of CAS filed Critical Institute of Psychology of CAS
Publication of CN111808195A publication Critical patent/CN111808195A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/286—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against neuromediator receptors, e.g. serotonin receptor, dopamine receptor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/564—Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/28—Neurological disorders

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Rheumatology (AREA)
  • Rehabilitation Therapy (AREA)
  • Neurology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a single cell acquisition method of a B cell surface receptor (BCR) or antibody gene of an anti-N-methyl-D-aspartate receptor encephalitis patient, and further discloses an immune repertoire research of the B cell of the anti-N-methyl-D-aspartate receptor encephalitis patient. The method for amplifying the variable region and the constant region of the single B cell humanized antibody gene is based on the single B cell reverse transcription and BCR amplification method, firstly utilizes the characteristic of antigen-antibody specific combination, and uses flow cytometry to screen out positive B cells combined with a pathogenic antigen NR1 protein subunit resisting encephalitis of an N-methyl-D-aspartate receptor in advance, thereby reducing the interference of other non-positive BCR/antibody information, reducing unnecessary workload, leading the finally obtained antibody information to have stronger correlation with the disease, having higher efficiency of capturing the antibody sequence of the single cell B cell, having simpler experimental steps and stronger operability.

Description

Method for obtaining B cell antibody gene of anti-N-methyl-D-aspartate receptor encephalitis and research on immune repertoire thereof
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a method for obtaining a B cell antibody gene of an anti-N-methyl-D-aspartate receptor encephalitis patient, and further discloses an immune repertoire study of a B cell of the anti-N-methyl-D-aspartate receptor encephalitis patient.
Background
The encephalitis resisting N-methyl-D-aspartate receptor (N-methyl-D-aspartate receptor) is called as the encephalitis resisting N-methyl-D-aspartate receptor, is an autoimmune encephalitis, is recorded in the first batch of rare diseases which are jointly issued by five departments, namely the national health and health committee, the department of science and technology, the department of industry and informatization, the national drug supervision and administration, the national traditional Chinese medicine administration and the like in 2018, 5 and 22 days, and the disease is mainly caused by intrathecal generation of a specific antibody aiming at the N-methyl-D-aspartate receptor. Therefore, the disease is studied by taking cerebrospinal fluid as a sample, and the number of B cells in the cerebrospinal fluid of a patient is often very small, so that the research can be carried out only by using a low-throughput single B cell antibody gene amplification method.
A variety of mature commercial platforms have been developed for the amplification of human heavy and light chains of antibody genes by a single B cell, such as in Li Xinyang et al, establishment of a method for amplifying fully human heavy and light chain genes from a single B cell. However, these methods have certain applicability and limitations, mainly represented by: 1. mature commercial platforms (e.g., 10XGenomics, BD Rhapsody) are mainly suitable for high-throughput single-cell sequencing, often requiring B-cell numbers in the range of thousands to tens of thousands, and are not suitable for samples with small B-cell numbers; 2. few commercial platforms suitable for a small number of B cells are high in sequencing cost (for example, C1 platform, the cost price of a single cell is 400-2000 yuan), and some methods can only obtain variable region sequences of antibodies, and cannot obtain constant region sequences, so that the promotion of some scientific research projects is limited, and a method which is lower in cost and suitable for low-throughput amplification of variable regions and constant regions of human antibody genes of single B cells is urgently needed.
Disclosure of Invention
Therefore, the technical problem to be solved by the present invention is to capture a single B cell capable of binding to a pathogenic antigen (NR1 subunit of N-methyl-D-aspartate receptor) by flow cytometry, and then to provide a method for amplifying a variable region and a constant region of a single B cell human antibody gene at a lower cost by using a single B Cell Receptor (BCR)/antibody sequence amplification method;
the second technical problem to be solved by the invention is to discuss the characteristics of the antibody in the cerebrospinal fluid of the patient with anti-N-methyl-D-aspartate receptor encephalitis, and provide a certain research basis for explaining pathogenesis and disease diagnosis.
In order to solve the technical problem, the method for amplifying the variable region and the constant region of the single B cell human antibody gene comprises the following steps:
(1) cerebrospinal fluid positive isolation of individual B-lymph
Centrifuging fresh cerebrospinal fluid, resuspending cells with the frozen stock solution, placing into a programmed freezing box, and storing for later use;
adding fetal calf serum into 1640 culture medium before flowing, mixing, centrifuging, and removing supernatant; adding cell staining buffer solution, mixing, and adding fluorescent antibody in proportion; incubating at room temperature in a dark place; continuously adding a cell staining buffer solution, centrifuging and repeatedly washing; continuously adding cell staining buffer solution to resuspend the cells; adding 4',6-diamidino-2-phenylindole (4',6-diamidino-2-phenylindole) to dye the core, and then loading the core;
preparing a single cell lysate: oligonucleotide primers (5 '-3': TTTTTTTTTTTTTTTTTT, 10 micromoles/liter) containing 18 thymines, rnase inhibitor (4U), polyethylene glycol octylphenyl ether (100 ml/liter) including: guanine deoxynucleotide triphosphate dGTP, adenine deoxynucleotide triphosphate dATP, thymine deoxynucleotide triphosphate dCTP and cytosine deoxynucleotide triphosphate dCTP, the equimolar mixture of the internal deoxynucleotides (10 mmol/l) and the remaining required volume being filled with nuclease-free water, placing the lysate in a polymerase chain reaction tube, placing on ice, sorting 4',6-diamidino-2-phenylindole negative and weakly positive (representing that the cells are still alive) target cells (CD20+ NR +) into the polymerase chain reaction tube containing the lysate by a flow cytometer, marking and immediately placing in liquid nitrogen after sorting;
(2) single B cell reverse transcription and BCR/antibody gene amplification
Placing the cell-separated polymerase chain reaction tube containing lysis buffer in a polymerase chain reaction instrument for lysis, and immediately placing on ice after the lysis is finished;
preparing a 6 microliter reverse transcription system: first strand synthesis in super second generation Buffer (SuperScript II First-stage Buffer) (5X), betaine (5 mol/L), magnesium chloride (100 mmol/L), dithiothreitol (100 mmol/L), TSO primer (100. mu.mol/L), RNase inhibitor (4U), second generation super Reverse Transcriptase (SuperScript II Reverse Transcriptase Transcriptase);
reverse transcription was performed according to the following conditions: 60-90 minutes at 42 ℃; 2 minutes at 50 ℃ and 2 minutes at 42 ℃ for 10 cycles; 15 minutes at 70 ℃; obtaining cDNA at 4 ℃ or 12 ℃ and infinity;
taking the single-tube cDNA system product obtained in the above steps as a template to carry out two rounds of nested polymerase chain reaction: in the first round, a 25. mu.l PCR system was prepared using the IS primer and the downstream primer of the heavy and light chain CH1 region (labeled as CIR 2): hot start HiFi enzymes (manufacturer: Kapa Biosystems), IS primers (10. mu. mol/L), CIR2 primers (10. mu. mol/L), reverse transcription product, supplement the residual required volume with nuclease-free water, can be used to amplify the system according to the requirement; the second round of polymerase chain reaction uses V region primers (labeled VH as heavy chain upstream primers and VL and VK as light chain upstream primers) and JH primers (heavy chain downstream) or CH1 region primers (labeled IGLC and IGKC, light chain downstream);
preparing a 25 microliter polymerase chain reaction system: hot start HiFi high fidelity enzyme (manufacturer: Kapa biosystems), light chain and heavy chain upstream primer (VH/VL/VK) primer (10 micromole/liter), JH/CH1 primer (10 micromole/liter), first round polymerase chain reaction product, nuclease-free water to make up the residual required volume, can be according to the need of the right amount of amplification system;
the following amplification conditions were set for both rounds of polymerase chain reaction: 3 minutes at 95 ℃; 20-25 cycles of 20s at 98 ℃, 20s at 58-62 ℃, 30s-45s at 72 ℃; 5 minutes at 72 ℃; 4 ℃ or 12; carrying out agarose gel electrophoresis on the product after the nested polymerase chain reaction;
recovering a target band of about 400bp from a heavy chain, recovering a band of about 450bp from a light chain, connecting a gel recovery product and a connecting carrier at 25 ℃ for 30 minutes or overnight at 4 ℃, adding a competent cell into the connecting product, carrying out ice bath for 30 minutes, carrying out heat shock for 30-45 seconds at 42 ℃, standing on ice for 2 minutes or more, then adding 200 microliters of LB culture medium, shaking a table at 37 ℃ and 200rpm for 50 minutes-1 hour, and carrying out primary sequencing after blue-white spot screening.
Specifically, the method for amplifying the variable region and the constant region of the single B cell human antibody gene comprises the following steps:
(1) cerebrospinal fluid positive isolation of individual B-lymph
Transporting fresh cerebrospinal fluid at 0-4 ℃, immediately centrifuging at 1200rpm for 10 minutes, resuspending cells with 500 microliters of cryopreservation fluid (90% fetal calf serum + 10% dimethyl sulfoxide), and placing into a programmed cryopreservation box for preservation at-80 ℃ for later use;
adding 1ml fetal calf serum (4 ℃) into 15ml 1640 culture medium before the flow, uniformly mixing at 4 ℃, centrifuging for 5-12 minutes at 250g, and removing supernatant; adding 1ml of cell staining buffer solution, mixing well, adding fluorescent antibody, (anti-CD 20-phycoerythrin-phycocyanin tandem conjugate (Percp/Cy5.5) of phycocyanin chlorophyll protein, anti-B cell surface molecule CD27 antibody-allophycocin (anti-CD27-APC), anti-B cell surface molecule CD38 antibody-phycoerythrin (anti-CD38-PE)) according to the proportion; incubating for 15-20 minutes at room temperature in a dark place; continuously adding 2ml of cell staining buffer solution, centrifuging for 5 minutes at 250g, and repeatedly washing for 2 times; continuously adding 0.5-1ml of cell staining buffer solution to resuspend the cells; adding 4',6-diamidino-2-phenylindole (3. mu.mol/l, 500. mu.l/tube) to dye the core, and loading the core for about 5 minutes;
preparing 4 microliter of lysate/tube: 1 microliter of an oligonucleotide primer containing 18 thymines (5 '-3': TTTTTTTTTTTTTTTTTT, 10. mu. mol/l)), 0.1 microliter to 0.2 microliter of an RNase inhibitor (4U), 0.04 microliter of polyethylene glycol octylphenyl ether (100 ml/l), 1 microliter comprising: equimolar mixtures (10 mmol/l) of deoxynucleotides including guanine deoxynucleotide triphosphate (dGTP), adenine deoxynucleotide triphosphate (dATP), thymine deoxynucleotide triphosphate (Thymidine triphosphate) and cytosine deoxynucleotide triphosphate (dCTP) are added, the residual required volume is filled up by nuclease-free water, the lysate is placed in a polymerase chain reaction tube, the polymerase chain reaction tube is placed on ice, 4',6-diamidino-2-phenylindole negative and weak positive (representing that the cells still live) target cells (CD20+ NR +) are sorted into the polymerase chain reaction tube containing the lysate by a flow cytometer, and the sorted target cells are marked and immediately placed in liquid nitrogen;
(2) single B cell reverse transcription and BCR/antibody gene amplification
Placing the cell-separated polymerase chain reaction tube containing the lysate in a polymerase chain reaction instrument, and carrying out warm bath at 72 ℃ for 3 minutes; the hot cover is set to 75 ℃, and after the cracking is finished, the glass is immediately placed on ice for 1 minute;
preparing a 6 microliter reverse transcription system: 2. mu.l of First strand synthesis super second generation Buffer (SuperScript II First-stage Buffer) (5X), 2. mu.l of betaine (5M), 0.9. mu.l of magnesium chloride (100 mM), 0.25. mu.l of dithiothreitol (100 mM), 0.1. mu.l of primer labeled TSO (100. mu.M), 0.25. mu.l of RNase inhibitor (4U), 0.5. mu.l of second generation super reverse transcriptase (SuperScript II ReverseTranscriptase);
reverse transcription was performed according to the following conditions: 60-90 minutes at 42 ℃; 2 minutes at 50 ℃ and 2 minutes at 42 ℃ for 10 cycles; 15 minutes at 70 ℃; obtaining cDNA at 4 ℃ or 12 ℃ and infinity;
taking the single-tube cDNA system product obtained in the above steps as a template to carry out two rounds of nested polymerase chain reaction: in the first round, a 25. mu.l PCR system was prepared using the IS primer and the downstream primer of the heavy and light chain CH1 region (labeled as CIR 2): 12.5 microliter hot start HiFi high fidelity enzyme (manufacturer: Kapa Biosystems), 0.5 microliter-1 microliter IS primer (10 micromole/liter), 0.5 microliter-1 microliter CIR2 primer (10 micromole/liter), 5 microliter-10 microliter reverse transcription product, the residual required volume IS filled with nuclease-free water, and a proper amount of amplification system can be used according to requirements; the second round of polymerase chain reaction uses V region primers (labeled VH as heavy chain upstream primers and VL and VK as light chain upstream primers) and JH primers (heavy chain downstream) or CH1 region primers (labeled IGLC and IGKC, light chain downstream);
preparing a 25 microliter polymerase chain reaction system: 12.5 microliter of hot start HiFi high fidelity enzyme (manufacturer: Kapa biosystems), 0.5 microliter-1 microliter of light chain and heavy chain upstream primer (VH/VL/VK) (10 micromole/liter), 0.5 microliter-1 microliter of JH/CH1 primer (10 micromole/liter), 1 microliter-5 microliter of first round polymerase chain reaction product and nuclease-free water are used for supplementing the residual required volume, and a proper amount of amplification system can be used according to the requirement;
the following amplification conditions were set for both rounds of polymerase chain reaction: 3 minutes at 95 ℃; 20-25 cycles of 20s at 98 ℃, 20s at 58-62 ℃, 30s-45s at 72 ℃; 5 minutes at 72 ℃; 4 ℃ or 12; carrying out agarose gel electrophoresis on the product after the nested polymerase chain reaction;
recovering a target band of about 400bp from a heavy chain, recovering a band of about 450bp from a light chain, recovering a product of about 4 microliter of gel and 1 microliter of a connecting carrier, connecting for 30 minutes at 25 ℃ or overnight at 4 ℃, adding 50 microliter of competent cells into the connecting product, carrying out ice bath for 30 minutes, carrying out heat shock for 30 to 45 seconds at 42 ℃, standing for 2 minutes or more on ice, then adding 200 microliter of LB culture medium, shaking a table at 37 ℃, shaking for 50 minutes to 1 hour at 200rpm, and carrying out first-generation sequencing after blue-white screening.
Specifically, the method for amplifying the variable region and the constant region of the single B cell human antibody gene comprises the following steps:
VH1：CAGGTGCAGCTGGTGCAG；
VH1/5：GAGGTGCAGCTGGTGCAG；
VH3：GAGGTGCAGCTGGTGGAG；
VH3-23：GAGGTGCAGCTGTTGGAG；
VH4：CAGGTGCAGCTGCAGGAG；
VH4-34：CAGGTGCAGCTACAGCAGTG；
CμCH1：GGGAATTCTCACAGGAGACGA；
IgG CH1：GTTCGGGGAAGTAGTCCTTGAC；
Ca CH1：GTCCGCTTTCGCTCCAGGTCACACT。
specifically, the method for amplifying the variable region and the constant region of the single B cell human antibody gene further comprises the step of obtaining the constant region of a BCR/antibody sequence to confirm the Ig class, and the specific experimental steps are as follows, and a 50 microliter polymerase chain reaction system is prepared: 10 microliters of SF buffer (5x, containing 10 mmol/l magnesium sulfate), 1 microliter comprising: guanine deoxynucleotide triphosphate dGTP, adenine deoxynucleotide triphosphate dATP, thymine deoxynucleotide triphosphate dGTP and cytosine deoxynucleotide triphosphate dCTP, equimolar mixtures of 4 internal deoxynucleotides (10 mmol/l each), 2 μ l VH primers (10 μ l each), 2 μ l CH1 primers (10 μ l each), 1 μ l to 3 μ l products of the first round polymerase chain reaction, 1 μ l Phanta ultra-fidelity DNA polymerase, and no nuclease water to make up the remaining desired volume;
the polymerase chain reaction process comprises: 3 minutes at 95 ℃; 10s at 95 ℃, 30s at 55-60 ℃, 30s-45s at 72 ℃ and 30-35 cycles; 72 ℃ for 10 minutes, 4 ℃ or 12 ℃ and ∞.
The invention also discloses a public clone sequence obtained by the method for amplifying the variable region and the constant region of the single B cell human antibody gene.
Specifically, the public cloning sequence comprises a heavy chain public cloning sequence and a light chain public cloning sequence.
Specifically, the public clone sequence comprises IGHV1-18 × 04, IGHD1-26 × 01/IGHD2-2 × 02/IGHD2-8 × 01, IGHJ3 × 02_ IGLV1-44 × 01 and IGJ3 × 02.
The invention also discloses application of the public cloning sequence in preparing a diagnostic marker for resisting the encephalitis of the N-methyl-D-aspartate receptor.
The method for amplifying the variable region and the constant region of the single B cell humanized antibody gene is based on the single B cell reverse transcription and BCR amplification method, not only can obtain the variable region sequence of the antibody, but also can obtain the constant region sequence of the antibody, namely 2 types (IgM, IgG) of the antibody can be accurately distinguished, the positive B cells combined with the antigen are screened in advance by flow cytometry by utilizing the characteristic of antigen-antibody specific combination for the first time, and the obtained antibody can be combined with the antigen because the B cells are screened by the antigen for the flow cytometry in the early stage; the interference of other non-positive BCR/antibody information is reduced, unnecessary workload is reduced, the finally obtained antibody information has stronger correlation with the disease, the method has higher efficiency of capturing the antibody sequence of the single-cell B cell, and the experimental steps are simpler and more convenient and have stronger operability. The method can be applied to other low-throughput B cell immune repertoires similar to anti-N-methyl-D-aspartate receptor encephalitis samples, and the cost is lower than that of other commercial platforms.
The present invention studies the conditions of B cell receptor/antibody binding to anti-N-methyl-D-aspartate receptor by single cell amplification and primary sequencing based on collected 12 cerebrospinal fluid (CSF) samples of chinese primary anti-N-methyl-D-aspartate receptor encephalitis patients, and uses healthy human antibody sequencing data in public databases as control, and as a result, 11 of 12 patients in the group were found to have heavy chain public clone IGHV1-18 04, IGHD1-26 01/IGHD2-2 03/IGHD2-8, IGHJ 3-02 (CDR3) ARVGSKYGFETFDI, but not in the control group data set. In addition, 4 public clonotypes were also found, and three of them contained the common heavy chain public clone described above. The study also found that patients and healthy controls had different preference for use of antibody gene families, but similar antibody mutation rates. The heavy chain public clone we found may have potential clinical significance for early diagnosis of anti-N-methyl-D-aspartate receptor encephalitis. The study reports the existence of a heavy chain public clone in most of the grouped (91.67%) anti-N-methyl-D-aspartate receptor encephalitis patients for the first time through a single B cell receptor/single cell antibody sequence capture method and bioinformatics analysis, and suggests that the clone can be a potential diagnostic marker of the disease.
Drawings
In order that the present disclosure may be more readily and clearly understood, the following detailed description of the present disclosure is provided in connection with specific embodiments thereof and the accompanying drawings, in which,
FIG. 1 shows the results of 1 patient (accession No: PA11) CD20+ NR1+ B lymphocyte flow cytometry; wherein, P1: NR1 positive living cells; p2: live NR1 positive B cells; p3: live NR1 positive memory B cells; p4: live NR1 positive B plasmablasts;
FIG. 2 is a Wien diagram showing the common clones between 12 patient heavy chain clones and 94 sets of public data from healthy persons;
FIG. 3 shows the difference in the preference of the patient for the use of the heavy chain V-D-J gene family of 4 healthy Chinese people (5A-C); PA: a patient;
FIG. 4 shows the preference of using light chain V-J gene family for anti-encephalitis patients with N-methyl-D-aspartate receptor; IGL/IGK: immunoglobulin lambda/kappa chains;
FIG. 5 shows the amino acid length distribution of CDR3 in the heavy chain of 12 patients;
FIG. 6 is the difference in heavy chain mutation rate between patients and healthy humans; the boxplot shows the minimum, first quartile, median, third quartile, and maximum; PA: patient, HC: healthy control against Chinese.
Detailed Description
In the following examples, we continuously collected cerebrospinal fluid samples of 12 first-onset anti-N-methyl-D-aspartate receptor encephalitis patients who visited the hospital from 11 months 2018 to 6 months 2019. All patients met the international diagnostic criteria for anti-N-methyl-D-aspartate receptor encephalitis. An Indirect Immunofluorescence (IIF) method is adopted to detect IgG antibodies of the N-methyl-D-aspartate receptor in cerebrospinal fluid and serum samples of patients. Ovarian teratomas were found in only one patient, while the other 11 patients were uninvolved patients.
The invention is described in the following examples. Cerebrospinal fluid samples of 12 patients with anti-N-methyl-D-aspartate receptor encephalitis were provided by hospitals.
Example 1 isolation of cerebrospinal fluid-positive Single B lymph
Freshly extracted cerebrospinal fluid was transported at 0-4 ℃ and immediately centrifuged at 1200rpm for 10 min, and the cells were resuspended in 500. mu.l of cryopreservative (90% fetal bovine serum + 10% dimethyl sulfoxide) and placed in a programmed cryopreservation box and stored at-80 ℃.
Before the flow, 1ml fetal calf serum (4 ℃) and 15ml 1640 culture medium (4 ℃) are taken and mixed evenly, 250g is centrifuged for 5 minutes to 12 minutes, and the supernatant is discarded; then adding 1ml of cell staining buffer solution, mixing uniformly, and adding fluorescent antibody (anti-CD 20-phycoerythrin-phycocyanin tandem conjugate (Percp/Cy5.5), anti-B cell surface molecule CD27 antibody-allophycocyanin (anti-CD27-APC), anti-B cell surface molecule CD38 antibody-phycoerythrin (anti-CD38-PE)) according to the proportion; incubating for 15-20 minutes at room temperature in a dark place; adding 2ml of cell staining buffer solution, centrifuging for 5 minutes at 250g, and repeatedly washing for 2 times; 0.5-1ml of cell staining buffer was added to resuspend the cells.
Taking 4',6-diamidino-2-phenylindole (3. mu. mol/l, 500. mu.l/tube) to dye the nucleus, loading the nucleus for about 5 minutes, and preparing 4. mu.l of lysate/tube: 1 microliter of oligonucleotide primer containing 18 thymines (5 '-3': TTTTTTTTTTTTTTTTTT, 10. mu. mol/l), 0.1. mu.l-0.2. mu.l of RNase inhibitor (4U), 0.04. mu.l of polyethylene glycol octylphenyl ether (100 ml/l), 1. mu.l comprising: guanine deoxynucleotide triphosphate dGTP, adenine deoxynucleotide triphosphate dATP, thymine deoxynucleotide triphosphate dGTP and cytosine deoxynucleotide triphosphate dCTP, the equimolar mixture of the internal deoxynucleotides (10 mmol/l), the remaining required volume being filled with nuclease-free water, the lysate being placed in a 0.2mL polymerase chain reaction tube, placed on ice, and the 4',6-diamidino-2-phenylindole negative and weakly positive (representing that the cells are still alive) target cells (CD20+ NR +) sorted by flow cytometry into the polymerase chain reaction tube containing the lysate, which are marked immediately after sorting and placed in liquid nitrogen.
EXAMPLE 2 Single B cell reverse transcription and BCR/antibody Gene amplification
Placing the cell-separated polymerase chain reaction tube containing the lysate in a polymerase chain reaction instrument, and carrying out warm bath at 72 ℃ for 3 minutes; the hot lid was set at 75 ℃ and immediately after cleavage was placed on ice for 1 minute.
Preparing a 6 microliter reverse transcription system: 2. mu.l of SuperScript II First-stage Buffer (5X), 2. mu.l of betaine (beta, 5 mol/l), 0.9. mu.l of magnesium chloride (100 mmol/l), 0.25. mu.l of dithiothreitol (100 mmol/l), 0.1. mu.l of TSO primer (100. mu.l), 0.25. mu.l of RNase inhibitor (4U), 0.5. mu.l of SuperScript II Reverse Transcriptase (20U) for the synthesis of the First strand. Reverse transcription was performed according to the following conditions: 60-90 minutes at 42 ℃; 2 minutes at 50 ℃ and 2 minutes at 42 ℃ for 10 cycles; 15 minutes at 70 ℃; 4 ℃ or 12 ℃ and ∞ to obtain cDNA.
The product of the single-tube cDNA system obtained by the method is used as a template to carry out two rounds of nested polymerase chain reaction. In the first round, a 25. mu.l PCR system was prepared using the IS primer and the downstream primer of the heavy and light chain CH1 region (labeled as CIR 2): 12.5 microliter hot start HiFi high fidelity enzyme (manufacturer: Kapa Biosystems), 0.5 microliter-1 microliter IS primer (10 micromole/liter), 0.5 microliter-1 microliter CIR2 primer (10 micromole/liter), 5 microliter-10 microliter reverse transcription product, the residual required volume IS filled with nuclease-free water, and a proper amount of amplification system can be used according to requirements; the second round of polymerase chain reaction uses V-region primers (labeled VH as heavy chain upstream primers and VL and VK as light chain upstream primers) and JH primers (heavy chain downstream) or CH1 region primers (labeled IGLC and IGKC, light chain downstream).
Preparing a 25 microliter polymerase chain reaction system: 12.5 microliter of hot start HiFi (manufacturer: Kapa biosystems), 0.5 microliter-1 microliter of light chain and heavy chain upstream primer (VH/VL/VK) primer (10 micromole/liter), 0.5 microliter-1 microliter of JH/CH1 primer (10 micromole/liter), 1 microliter-5 microliter of first round polymerase chain reaction product, and nuclease-free water to supplement the residual required volume, and can be used for an appropriate amount of amplification system according to the requirement.
The following amplification conditions were set for both rounds of polymerase chain reaction: 3 minutes at 95 ℃; 20-25 cycles of 20s at 98 ℃, 20s at 58-62 ℃, 30s-45s at 72 ℃; 5 minutes at 72 ℃; 4 ℃ or 12 ℃ and ∞. The products of the nested polymerase chain reaction were electrophoresed through 1.5% agarose gel.
The heavy chain recovers about 400bp of the target band, and the light chain recovers about 450bp of the band (gel recovery kit). Recovering product with 4 microliter gel and 1 microliter connecting carrier, connecting at 25 deg.c for 30 min or 4 deg.c overnight, adding 50 microliter competent cell into the connecting product, ice-bathing for 30 min, heat-shocking at 42 deg.c for 30-45 s, and standing on ice for 2 min or more. Adding LB culture medium 200 microliter, shaking at 37 deg.C and 200rpm for 50 min-1 hr, blue-white screening, and sequencing.
To obtain constant region acquisitions of BCR/antibody sequences to confirm the Ig class, a 50 microliter polymerase chain reaction system was prepared: 10 microliters of SF buffer, 1 microliter comprising: guanine deoxynucleotide triphosphate dGTP, adenine deoxynucleotide triphosphate dATP, thymine deoxynucleotide triphosphate dGTP and cytosine deoxynucleotide triphosphate dCTP, equimolar mixtures of 4 internal deoxynucleotides (10 mmol/l each), 2 μ l VH primers (10 μ l each), 2 μ l CH1 primers (10 μ l each), see table 1, 1 μ l to 3 μ l products of the first round polymerase chain reaction, 1 μ l Phanta ultra-fidelity DNA polymerase, and no nuclease water to make up the remaining desired volume. Polymerase chain reaction system: 3 minutes at 95 ℃; 10s at 95 ℃, 30s at 55-60 ℃, 30s-45s at 72 ℃ and 30-35 cycles; 72 ℃ for 10 minutes, 4 ℃ or 12 ℃ and ∞.
TABLE 1 polymerase chain reaction primers for Ig class identification
Primer name Primer sequence (5 '-3')
VH1 CAGGTGCAGCTGGTGCAG
VH1/5 GAGGTGCAGCTGGTGCAG
VH3 GAGGTGCAGCTGGTGGAG
VH3-23 GAGGTGCAGCTGTTGGAG
VH4 CAGGTGCAGCTGCAGGAG
VH4-34 CAGGTGCAGCTACAGCAGTG
CμCH1 GGGAATTCTCACAGGAGACGA
IgG CH1 GTTCGGGGAAGTAGTCCTTGAC
Ca CH1 GTCCGCTTTCGCTCCAGGTCACACT
Example 3 bioinformatic analysis of BCR sequencing data
Sequence alignment was performed using bioinformatics methods, and we analyzed the patient's first generation sequencing data, as well as the 4 healthy chinese peripheral blood B-cells downloaded from the Sequence Read Archive (SRA) database.
EXAMPLE 4 public cloning
The definitions of public clones we took are: the definition of common clonotypes is that the heavy chain VJ genes are identical and the amino acids translated from the connecting sequences between the VJ genes are identical, and the amino acids translated from the light chain VJ genes from the same cell are identical and the amino acids translated from the connecting sequences between the VJ genes are identical.
To test whether the heavy chain public clone is specific for anti-N-methyl-D-aspartate receptor encephalitis, we used healthy human antibody sequencing data from public databases.
Statistical analysis: test was performed to determine whether the AA length distribution in the CDR3 region of the heavy chain of the patient fits a normal distribution, with P >0.05 as the criterion for the normal distribution. Statistical analysis was performed on the mutation rates of patients and healthy persons using the Statistical Analysis System (SAS) version 9.4. Analysis of variance (ANOVA), Student's t test, or Wilcoxon test (non-normal distribution) was used to analyze continuous variables, and a two-tailed test P <0.05 was considered statistically significant.
Example 5
By the methods described in examples 1 to 3 above, we found that 0.4% to 1.9% of CSF cells bound to NR1 fluorescent antigen and 0.1% to 1.4% of CSF B cells bound to NR1 subunit by flow cytometry (see fig. 1). It is noted that in cerebrospinal fluid of around 2ml, the number of CD20+ CD27+ CD38-NR1+ B memory cells and CD20+ CD27+ CD38+ NR1+ B plasma cells is less than 40. Therefore, our NR1 positive B cells obtained by flow cytometry (NR1+ CD20+) are mostly B cells other than memory B cells and plasma cells.
By the above method we finally obtained 83 complete B cell complete antibody sequences (as in table 2). For some cells, we obtained multiple light chains (only one heavy chain) or multiple heavy chains (only one light chain), probably because flow cytometry screened multiple cells. We consider them as intact B cells. For cells with two or more light/heavy chains at the same time, or cells with only heavy or light chains, we consider them to be incomplete B cells because the light and heavy chain information of the antibody is incomplete. The sequences of all incomplete B cells (as in table 3) were also used for analysis.
TABLE 212 complete BCR sequence information for patients
Figure BDA0002607065500000131
Figure BDA0002607065500000141
Figure BDA0002607065500000151
Figure BDA0002607065500000161
Table 312 incomplete BCR sequence information for patients.
Figure BDA0002607065500000162
Figure BDA0002607065500000171
Using the above experimental approach, we found that one heavy chain common clone was present in 11 of 12 patients: IGHV1-18 × 04, IGHD1-26 × 01/IGHD2-2 × 02/IGHD2-8 × 01, IGHJ3 × 0_ CDR3(ARVGSKYGFETFDI) (see table 4). It should be noted that although the antibody sequences present in these patients belong to the same clone, the sequences of different patients have base differences, and the sequences of the same patient also have base differences, which mainly occur in structures other than the CDR3 region. Since the variable region of an antibody is composed of 4 framework regions (FR1-FR4) and 3 hypervariable regions (CDR1-CDR3), of which 3 hypervariable regions are thought to play a major role in antigen binding. It is generally accepted that antibodies from the same genus, although differing in base, bind the same antigen.
TABLE 4
CDR3_IGBLAST-AA PA8 PA1 PA1 PA2 PA2 PA2 PA2 PA2 PA2 PA2 PA3 PA3
ARTLGYCSDGRCNSLGH 0 2 0 0 0 0 0 0 0 0 0 0
ARDLISMVRGDSFYYYNMDV 0 0 0 0 4 0 0 0 1 0 0 0
ARGSLWYYYDSSGYGGAFDM 0 3 0 0 0 0 0 0 0 0 0 0
ARVIYGDYGDY 0 5 0 0 0 0 0 0 0 0 0 0
ARVIFGDYGDY 0 1 0 0 0 0 0 0 0 0 0 0
ARGGNNWNYRSWFDP 0 4 0 0 0 0 0 0 0 0 0 0
AKGFVGGSYDY 0 2 0 0 0 0 0 0 0 0 0 0
ASSPYCSGGSCTVRPVWFDP 0 3 0 0 0 0 0 0 0 0 0 0
ARVHRGILTGYCFDY 0 0 0 0 2 0 0 0 0 0 0 0
ARGYCSSSSCYPPNY 0 0 0 0 0 0 0 2 0 0 0 4
ARNRGWYGMDG 0 3 0 0 0 0 0 0 0 0 0 0
AKEVAKYRSGWYWVD 0 2 0 0 0 0 0 0 0 0 0 0
VKDLLGSPLSSWFDP 0 0 0 0 0 0 0 0 4 0 0 0
ARRSSGVRIAARRPFDC 0 28 0 0 0 0 0 0 0 0 0 2
ARRSSGVRIAARRPLDC 0 1 0 0 0 0 0 0 0 0 0 0
ARHSSGVRIAARRPFDC 0 2 0 0 0 0 0 0 0 0 0 0
ARRSSGVRIAARRPFDR 0 1 0 0 0 0 0 0 0 0 0 0
ARLRRSSWGYYGMDV 0 0 0 0 0 0 0 3 0 0 0 0
ARRLDLAPTGAVIGH 0 1 0 0 0 2 0 0 0 0 0 4
VRNQQQLQTGGYFDL 0 1 0 0 0 0 0 0 0 0 0 0
SRVVLVIAAPLGYYYMDV 0 3 0 0 0 0 0 0 0 0 0 0
ARAWAYDSSGHYYFDQ 0 3 0 0 0 0 0 0 0 0 0 0
AKDEGYSGTLKY 0 0 0 0 0 0 0 0 0 0 0 3
ARGKWNSGYVFGWFDP 0 2 0 0 0 0 0 0 0 0 0 0
AKDDYFYGFPPYGVDV 0 0 0 0 0 0 0 0 0 0 0 2
TRGSAGVSAGRN 0 0 0 0 0 0 0 0 0 0 0 2
AKNGEGSSGWYEGPDY 0 3 0 0 0 0 0 0 0 0 0 0
AKDPHAYGYAPDYFDY 0 1 0 0 0 0 0 0 0 0 0 0
ARDRRGYSYGRY 0 1 0 0 0 0 0 0 0 0 0 0
RRALISSRSPWGL 0 1 0 0 0 0 0 0 0 0 0 0
ARALIVAVPLGY 0 3 0 0 0 0 0 0 0 0 0 0
ARAPRWYDGGVVDH 0 0 0 0 0 0 0 0 0 1 0 0
TSYDDYIYGMDV 0 1 0 0 0 0 0 0 0 0 0 2
ARGGGATGTDGGGYYFDY 0 2 0 0 0 0 0 0 0 0 0 0
ARGRGATGTDGGGYYFDY 0 1 0 0 0 0 0 0 0 0 0 0
ARDNWGPDY 0 1 0 0 0 0 0 0 0 0 0 0
ARSEDSSPYSFHF 0 0 0 5 0 0 0 0 0 0 0 0
AKDWGNAYWYFDL 0 3 0 0 0 0 0 0 0 0 0 0
ASSTWYVDW 0 0 0 0 0 0 0 0 0 0 0 3
AVGTVANGRGTGK 0 3 0 0 0 0 0 0 0 0 0 0
ARVGSKYGFETFDI 1 2 1 0 15 34 52 1 8 8 6 7
ARDLVDYDILTGYYKPIDDALDM 0 2 0 0 4 0 0 0 0 0 0 0
ARCGTYLYWYFDL 0 1 0 0 0 0 0 0 0 0 0 0
ARSGTYLYWYFDL 0 3 0 0 0 0 0 0 0 0 0 0
The Ig class of this heavy chain common clone was identified as IgG1 in PA21, and in addition to the heavy chain clones, we analyzed the distribution of light chain clones in patients (see Table 5) indicating that there were light chain common clones in some of the patients.
TABLE 5
CDR3_IGBLAST-AA PA8 PA1 PA2 PA2 PA2 PA2 PA2 PA1 PA2 PA3 PA3
VTWDNSLSGGV 0 3 0 0 0 0 0 0 0 0 0
SSYVRAWV 0 34 0 0 3 0 0 0 0 0 6
SSYTSSSTYWV 0 3 0 0 0 0 0 0 0 0 0
QVWDSSSDHRV 0 0 0 0 2 0 0 0 0 0 0
AAWDDSLTGVV 1 0 0 0 5 0 0 0 0 1 0
AAWDDSLNGPV 0 0 0 1 1 2 0 16 1 0 0
TAWDDSLNGPV 0 0 0 0 0 0 0 0 1 0 0
GAWDDSLNGPV 0 0 0 0 0 0 0 1 0 0 0
AAWDDSLKGWV 0 2 0 0 0 1 0 0 0 0 0
DTWDSYNRNRV 0 4 0 0 0 0 0 0 0 0 1
SSYAGSNNLGV 0 0 0 1 0 1 2 0 0 0 0
LLSHSGARFV 0 0 0 0 0 0 0 0 0 0 3
QHRSAWPPEYT 0 0 0 0 0 0 0 0 0 0 3
QAWDSSTHVV 0 3 0 0 0 0 0 0 0 0 0
CSYAGRYTWV 0 4 0 0 0 0 0 0 0 0 0
SSYTRGNTVL 0 0 0 1 0 0 0 1 0 0 3
CSYAGNGAYV 0 0 0 0 0 0 3 0 0 0 0
SSYTSSSTLV 0 3 0 0 0 0 0 0 0 0 0
SSYTSASTYV 0 1 0 0 0 0 0 0 0 0 0
QSYDNSLSGAYV 0 3 0 0 0 0 0 0 0 0 0
GTWDSSLSAV 0 0 0 0 0 0 0 0 0 0 1
NSRDSSGNHLVV 0 1 0 0 0 0 0 0 0 0 0
LLYYGGAWV 0 3 0 0 0 0 0 0 0 0 0
QTRGTGLWV 0 0 0 0 0 0 0 0 3 0 0
ASWDDSLGGHWV 0 0 0 1 0 0 0 0 0 0 3
QAWDSSTVV 0 2 0 0 0 0 0 0 0 0 0
CAYAGTYRL 0 0 4 0 0 0 0 0 0 0 0
QSYDRSLSGYWV 0 0 0 14 20 36 0 0 0 0 0
AAWDDSLRV 0 0 0 1 0 1 0 0 0 0 0
QHSHSLPLS 0 3 0 0 0 0 0 0 0 0 0
QQYNNWPLT 0 3 0 0 0 0 0 0 0 0 0
QQYYRSPYT 0 1 0 0 0 0 0 0 0 0 0
QQYYSTPRT_33 0 2 0 0 0 0 0 0 0 0 0
QQYYSTPRT_34 0 1 0 0 0 0 0 0 0 0 0
GTWDDSLNGPNWV 0 0 0 0 0 0 0 0 0 0 2
GTWDDSLIGPNWV 0 0 0 0 0 0 0 0 0 0 1
HQYYSTSWS 0 0 0 0 0 0 0 3 0 0 0
QQYYTTSWT 0 3 0 0 0 0 0 0 0 0 0
Example 6
4 public clonotypes were found in different patients (Table 6), of which 3 patients contained the heavy chain public clone described above. The "clonotypes" we have adopted are defined as follows: the recombined B cell variable region sequence is encoded by the same heavy chain V gene and J gene and the paired light chain V gene and J gene and has the same CDR3 amino acids. The patients PA22 and PA23 had significant clonotype amplifications, specifically clonotypes (IGHV1-18 × 04, IGHD1-26 × 01/IGHD2-2 × 03/IGHD2-8 × 01, 02_ IGLV1-40 _ IGLV1-40 × 01/IGLV1-40 × 02, IGJ3 × 02) (see Table 2 above), PA11 had amplifications of IGHV4-39 × 01, IGHD6-6 × 01, IGHJ4 _ 02_ IGLV2-11 × 01, IGJ3 × 02 clonotypes, which were significantly different from those of the other patients.
TABLE 6 summary of public clonotype antibody information for anti-N-methyl-D-aspartate receptor encephalitis patients. AA: an amino acid. And (4) SHM: somatic mutation rate.
Figure BDA0002607065500000201
In addition, we also found 4 public clonotype antibodies in different patients: IGHV1-18 × 04, IGHD1-26 × 01/IGHD2-2 × 02/IGHD2-8 × 01, IGHJ3 × 02_ IGLV1-44 × 01, and IGJ3 × 02 were found in 5 patients; IGHV1-18 × 04, IGHD1-26 × 01/IGHD2-2 × 02/IGHD2-8 × 01, IGHJ3 × 02_ IGLV1-40 × 01/IGLV1-40 × 02, IGLJ3 × 02 were present in 3 of these 5 patients; in 2 patients IGHV1-18 × 04, IGHD1-26 × 01/IGHD2-2 × 02/IGHD2-8 × 01, IGHJ3 × 02_ IGLV1-44 × 01, IGLJ2 × 01/IGLJ3 × 01 were present; in 2 patients IGHV4-39 × 01, IGHD6-6 × 01, IGHJ4 × 02_ IGLV2-11 × 01, IGLJ3 × 02 were present. These results indicate that the appearance of public clones (types) is associated with the same immune response between patients.
The invention further analyzes antibody data of non-anti-N-methyl-D-aspartate receptor encephalitis samples including a plurality of healthy people by searching international public databases (SRA and PubMed) and bioinformatics analysis, does not find the existence of the heavy chain public clone, shows that the public clone does not exist in healthy people, and suggests that the heavy chain public clone can be used as a diagnostic marker for anti-N-methyl-D-aspartate receptor encephalitis.
Example 7
To provide more evidence that the most common clones (IGHV1-18 a 04, IGHD1-26 a 01/IGHD2-2 a 03/IGHD2-8 a 01, IGHJ3 a 02 (on CDR3) ARVGSKYGFETFDI) were associated with anti-N-methyl-D-aspartate receptor encephalitis, we used antibody sequencing data from healthy humans from the SRA public database.
We compared 44 unique heavy chain clone sequences obtained from 12 patients with healthy human antibody data and found 2 overlapping heavy chain clones (CDR 3: CARGGNNWNYRSWFDPW, CDR 3: CARDNWGPDYW) (as in fig. 2) that did not contain the most common clone (CDR 3: ARVGSKYGFETFDI).
Example 8
In addition, the preference for heavy chain gene use in anti-N-methyl-D-aspartate receptor encephalitis patients was IGHV1, IGHD1 and IGHJ3 (a-C in fig. 3), and the antibody gene families IGHV2, IGHV6 and IGHJ1 were not present. The light chains IGLV1, IGLJ3 appeared more frequently, with lambda chains being significantly higher than kappa chains (see FIG. 4).
In healthy populations, the number of cerebrospinal fluid B lymphocytes is about 0.00X 106/L-0.03×106Therefore, we downloaded BCR high throughput sequencing data from the SRA database for 4 healthy chinese as a suitable control group. Our studies show that the preference for using the V-D-J gene family in healthy human peripheral blood is IGHV1/IGHV3, IGHD3 and IGHJ4 (A-C in FIG. 3). Therefore, the use preference of the antibody gene family of the anti-N-methyl-D-aspartate receptor encephalitis patient is different from that of a healthy person.
Example 9
Further, by analyzing the CDR3 amino acid characteristics of the heavy chain, we found that the most common is 14 in length and in a high proportion, with a skewed distribution as tested by Shapiro-Wilk (P ═ 1.61 × 10)-16As in fig. 5). The light chain distribution is also not normally distributed. Our studies also show that the total mutation rate of the antibody sequences in patients is low, similar to that of healthy people (P-0.4174, see fig. 6). Therefore, the mutation rate of the antibody of the patient with the encephalitis resisting the N-methyl-D-aspartate receptor is not different from that of a healthy person.
In summary, the scheme of this application is the first study to reveal the presence of heavy chain public clones and public clonotypes in most of the patients with grouped anti-N-methyl-D-aspartate receptor encephalitis. The main findings of this study include: first, the common clone of B cell heavy chain was found in 11 of 12 patients, but not in healthy persons; secondly, 4 identical clonotypes exist in different patients with encephalitis resisting N-methyl-D-aspartate receptor; third, anti-N-methyl-D-aspartate receptor encephalitis patients and healthy people compared, although with similar antibody mutation rate, V-D-J gene family use preference is different.
Furthermore, the scheme adopts a novel strategy to research a B cell immune repertoire related to the NR1 antigen of an anti-N-methyl-D-aspartate receptor encephalitis patient, namely, B cells combined with the NR1 protein are pre-screened by flow cytometry. Enriching the data of a B cell bank for resisting the encephalitis of the N-methyl-D-aspartate receptor. Meanwhile, the research proves that the method is effective for researching a low-throughput single-cell immune library and can be applied to the diseases such as encephalitis of an anti-N-methyl-D-aspartate receptor and the like.
Furthermore, the present protocol relates to 12 patients including PA24 (with ovarian teratomas), 11 of which showed the most common heavy chain clones IGHV1-18 a 04, IGHD1-26 a 01/IGHD2-2 a 03/IGHD2-8 a 01, and IGHJ3 a 02 (CDR3) ARVGSKYGFETFDI. This common heavy chain clone was not found in healthy humans and patients with anti-leu-glioma-rich inactivated 1 protein antibody encephalitis, multiple sclerosis, or neuromyelitis optica lineage disorders, suggesting that it is not a common clone for autoimmune diseases of the central nervous system, and may be a potential diagnostic biomarker for anti-N-methyl-D-aspartate receptor encephalitis. Next we will proceed to verify if it appears in patients with tumor-associated or Herpes Simplex Virus (HSV) infection, resistant to the N-methyl-D-aspartate receptor encephalitis, to contribute to the early diagnosis of the patients.
Our studies found four identical clonotypes in different anti-N-methyl-D-aspartate receptor encephalitis patients. The presence of a common clonotype among patients is related to the presence of the same epitope among them. For example, PA21, PA22, and PA23 had identical monoclonal antibody amplifications, suggesting that these three boys may have undergone the same selective clonotype amplification and similar adaptive immune responses during the disease. While PA11 showed an expansion of another clonotype, an expansion also appeared in one cell of PA31, indicating that there may be differences in the selection of clonotypes by patients during the course of the disease. Notably, although PA24 (with ovarian teratomas) did not share a common clonotype with other patients, she did share the most common heavy chain common clone, with only the paired light chains differing. Therefore, PA24 may have undergone clonal selection similar to other unknown causal patients who contain heavy chain common clones.
Previous studies demonstrated that healthy humans have multiple antibodies and that the heavy chain CDR3 amino acid length is well gaussian distributed. We have revealed the characteristics of the NR1 positive B cell immune pool against patients with N-methyl-D-aspartate receptor encephalitis: the gene family has very obvious use preference and is obviously different from healthy people; not all families of antibody genes are present and the use of antibody genes is limited; the proportion of the heavy chain with the amino acid length of CDR3 being 14 is the largest. The above results may be driven by specific antigens. In addition, from the result of V-J gene combination, PA11 has unique clonotype selection and whether different epitopes are related needs to be verified.
We also demonstrated that most anti-NR 1 antibodies were low or no mutations in anti-N-methyl-D-aspartate receptor encephalitis cerebrospinal fluid, with antibody mutation rates similar to those of healthy humans (fig. 6).
This study has limitations: first, patients in the cohort were largely immune-provoking unknown. Future studies should also be included in patients with known causes such as tumors or after HSV infection, revealing their pathogenesis from different perspectives. Second, the number of patients in the study is limited. We propose that future studies can expand the number of cases, compare whether the patient's immune repertoire data is correlated with different clinical profiles (first-onset, recurrent type and refractory type), to reveal how the immune system changes, and to find more meaningful markers relevant to the onset and prognosis of anti-N-methyl-D-aspartate receptor encephalitis.
It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.

Claims (9)

1. A method for amplifying variable regions and constant regions of a single B cell human antibody gene, which comprises the following steps:
(1) cerebrospinal fluid positive isolation of individual B-lymph
Centrifuging fresh cerebrospinal fluid, resuspending cells with the frozen stock solution, placing into a programmed freezing box, and storing for later use;
adding fetal calf serum into 1640 culture medium before flowing, mixing, centrifuging, and removing supernatant; adding cell staining buffer solution, mixing, and adding fluorescent antibody in proportion; incubating at room temperature in a dark place; continuously adding a cell staining buffer solution, centrifuging and repeatedly washing; continuously adding cell staining buffer solution to resuspend the cells; adding 4',6-diamidino-2-phenylindole to dye the core, and loading the core;
preparing a single cell lysate: oligonucleotide primers (5 '-3': TTTTTTTTTTTTTTTTTT, 10 micromoles/liter) containing 18 thymines, rnase inhibitors, polyethylene glycol octylphenyl ether (100 ml/liter) comprising: guanine deoxynucleotide triphosphate dGTP, adenine deoxynucleotide triphosphate dATP, thymine deoxynucleotide triphosphate and cytosine deoxynucleotide triphosphate dCTP, 4 kinds of deoxynucleotides in equimolar mixture (10 mmol/l), filling the residual required volume with nuclease-free water, placing the lysate in a polymerase chain reaction tube, placing on ice, sorting 4',6-diamidino-2-phenylindole negative and weakly positive (representing that the cells are still alive) target cells (CD20+ NR +) into the polymerase chain reaction tube containing the lysate by a flow cytometer, and immediately placing the cells in liquid nitrogen after sorting and marking;
(2) single B cell reverse transcription and BCR/antibody gene amplification
Placing the cell-separated polymerase chain reaction tube containing lysis buffer in a polymerase chain reaction instrument for lysis, and immediately placing on ice after the lysis is finished;
preparing a 6 microliter reverse transcription system: SuperSecondary Buffer for First strand synthesis (SuperScripttII First-Standard Buffer) (5X), betaine (5 mol/l), MgCl2(100 mmol/L), dithiothreitol (100 mmol/L), TSO (100. mu.M), RNase inhibitor (4U), second generation super Reverse Transcriptase (SuperScript II Reverse Transcriptase);
reverse transcription was performed according to the following conditions: 60-90 minutes at 42 ℃; 2 minutes at 50 ℃ and 2 minutes at 42 ℃ for 10 cycles; 15 minutes at 70 ℃; obtaining cDNA at 4 ℃ or 12 ℃ and infinity;
taking the single-tube cDNA system product obtained in the above steps as a template to carry out two rounds of nested polymerase chain reaction: in the first round, a 25. mu.l PCR system was prepared using the IS primer and the downstream primer of the heavy and light chain CH1 region (labeled as CIR 2): hot start HiFi enzymes (manufacturer: Kapa Bi systems), IS primers (10. mu. mol/L), CIR2 primers (10. mu. mol/L), reverse transcription products, the residual required volume IS filled with nuclease-free water, and a proper amount of amplification system can be used according to requirements; the second round of polymerase chain reaction uses V region primers (labeled VH as heavy chain upstream primers and VL and VK as light chain upstream primers) and JH primers (heavy chain downstream) or CH1 region primers (labeled IGLC and IGKC, light chain downstream);
preparing a 25 microliter polymerase chain reaction system: hot start HiFi enzyme (Ka pa Biosystems), light chain and heavy chain upstream primer (VH/VL/VK) primer (10 micromole/liter), light chain and heavy chain downstream primer (JH/CH1) primer (10 micromole/liter), first round of polymerase chain reaction product, no nuclease water make up the residual required volume, can be according to the needs of the right amount of amplification system;
the following amplification conditions were set for both rounds of polymerase chain reaction: 3 minutes at 95 ℃; 20-25 cycles of 20s at 98 ℃, 20s at 58-62 ℃, 30s-45s at 72 ℃; 5 minutes at 72 ℃; 4 ℃ or 12; carrying out agarose gel electrophoresis on the product after the nested polymerase chain reaction;
recovering a target band of about 400bp from a heavy chain, recovering a band of about 450bp from a light chain, connecting a gel recovery product and a connecting carrier at 25 ℃ for 30 minutes or overnight at 4 ℃, adding a competent cell into the connecting product, carrying out ice bath for 30 minutes, carrying out heat shock for 30-45 seconds at 42 ℃, standing on ice for 2 minutes or more, then adding 200 microliters of LB culture medium, shaking a table at 37 ℃ and 200rpm for 50 minutes-1 hour, and carrying out primary sequencing after blue-white spot screening.
2. The method for amplifying the variable region and the constant region of the single B cell human antibody gene according to claim 1, comprising the steps of:
(1) cerebrospinal fluid positive isolation of individual B-lymph
Transporting fresh cerebrospinal fluid at 0-4 deg.C, immediately centrifuging at 1200rpm for 10 min, resuspending cells with 500 μ l of frozen stock solution (90% fetal calf serum + 10% dimethyl sulfoxide), and storing in programmed freezing box at-80 deg.C;
adding 1ml fetal calf serum (4 ℃) into 15ml 1640 culture medium before the flow, uniformly mixing at 4 ℃, centrifuging for 5-12 minutes at 250g, and removing supernatant; adding 1ml of cell staining buffer solution, mixing uniformly, adding a fluorescent antibody, (anti-B cell surface CD20 molecular antibody-phycoerythrin chlorophyll protein cyanine tandem conjugate (anti-CD20-Percp/Cy5.5), anti-B cell surface molecular CD27 antibody-allophycocyanin (anti-CD27-APC), anti-B cell surface molecular CD38 antibody-phycoerythrin (anti-CD38-PE), incubating at room temperature in the dark for 15-20 minutes, continuously adding 2ml of cell staining buffer solution, centrifuging for 5 minutes at 250g, repeatedly washing for 2 times, continuously adding 0.5-1ml of cell staining buffer solution to resuspend cells, adding 4',6-diamidino-2-phenylindole (3 micromoles/liter, adding 500 microliters/tube) to stain nuclei, and loading on a machine for about 5 minutes;
preparing 4 microliter of lysate/tube: 1 microliter of oligonucleotide primer containing 18 thymines (5 '-3': TTTTTTTTTTTTTTTTTT, 10. mu. mol/l), 0.1. mu.l-0.2. mu.l of RNase inhibitor (4U), 0.04. mu.l of polyethylene glycol octylphenyl ether (100 ml/l), 1. mu.l comprising: guanine deoxynucleotide triphosphate dGTP, adenine deoxynucleotide triphosphate dATP, thymine deoxynucleotide triphosphate, cytosine deoxynucleotide triphosphate dCTP, the equimolar mixture of the internal deoxynucleotides (10 mmol/l) and the remaining required volume filled with nuclease-free water, placing the lysate in a polymerase chain reaction tube, placing on ice, sorting 4',6-diamidino-2-phenylindole negative and weakly positive (representing that the cells are still alive) target cells (CD20+ NR +) into the polymerase chain reaction tube containing the lysate by a flow cytometer, marking and immediately placing in liquid nitrogen after sorting;
(2) single B cell reverse transcription and BCR/antibody gene amplification
Placing the cell-separated polymerase chain reaction tube containing the lysate in a polymerase chain reaction instrument, and carrying out warm bath at 72 ℃ for 3 minutes; the hot cover is set to 75 ℃, and after the cracking is finished, the glass is immediately placed on ice for 1 minute;
preparing a 6 microliter reverse transcription system: 2. mu.l of First strand synthesis SuperScript II First-stage Buffer (5X), 2. mu.l of betaine (5 mol/l), 0.9. mu.l of magnesium chloride (100 mmol/l), 0.25. mu.l of dithiothreitol (100 mmol/l), 0.1. mu.l of TSO (100. mu.l/l), 0.25. mu.l of RNase inhibitor (4U), 0.5. mu.l of second-generation super Reverse Transcriptase (SuperScript II Reverse Transcriptase);
reverse transcription was performed according to the following conditions: 60-90 minutes at 42 ℃; 2 minutes at 50 ℃ and 2 minutes at 42 ℃ for 10 cycles; 15 minutes at 70 ℃; obtaining cDNA at 4 ℃ or 12 ℃ and infinity;
taking the single-tube cDNA system product obtained in the above steps as a template to carry out two rounds of nested polymerase chain reaction: in the first round, a 25. mu.l PCR system was prepared using the IS primer and the downstream primer of the heavy and light chain CH1 region (labeled as CIR 2): 12.5 microliter hot start HiFi high fidelity enzyme (manufacturer: Kapa Biosystems), 0.5 microliter-1 microliter IS primer (10 micromole/liter), 0.5 microliter-1 microliter CIR2 primer (10 micromole/liter), 5 microliter-10 microliter reverse transcription product, the residual required volume IS filled with nuclease-free water, and a proper amount of amplification system can be used according to requirements; the second round of polymerase chain reaction uses V region primers (labeled VH as heavy chain upstream primers and VL and VK as light chain upstream primers) and JH primers (heavy chain downstream) or CH1 region primers (labeled IGLC and IGKC, light chain downstream);
preparing a 25 microliter polymerase chain reaction system: 12.5 microliter of hot start HiFi high fidelity enzyme (manufacturer: Kapa biosystems), 0.5 microliter-1 microliter of light chain and heavy chain upstream primer (VH/VL/VK) primer (10 micromole/liter), 0.5 microliter-1 microliter of JH/CH1 primer (10 micromole/liter), 1 microliter-5 microliter of first round polymerase chain reaction product, and nuclease-free water to supplement the residual required volume, and a proper amount of amplification system can be used according to the requirement;
the following amplification conditions were set for both rounds of polymerase chain reaction: 3 minutes at 95 ℃; 20-25 cycles of 20s at 98 ℃, 20s at 58-62 ℃, 30s-45s at 72 ℃; 5 minutes at 72 ℃; 4 ℃ or 12; carrying out agarose gel electrophoresis on the product after the nested polymerase chain reaction;
recovering a target band of about 400bp from a heavy chain, recovering a band of about 450bp from a light chain, recovering a product of about 4 microliter of gel and 1 microliter of a connecting carrier, connecting for 30 minutes at 25 ℃ or overnight at 4 ℃, adding 50 microliter of competent cells into the connecting product, carrying out ice bath for 30 minutes, carrying out heat shock for 30 to 45 seconds at 42 ℃, standing for 2 minutes or more on ice, then adding 200 microliter of LB culture medium, shaking a table at 37 ℃, shaking for 50 minutes to 1 hour at 200rpm, and carrying out first-generation sequencing after blue-white screening.
3. The method for amplifying the variable region and the constant region of the single B cell human antibody gene according to claim 1 or 2, wherein the primers comprise:
VH1：CAGGTGCAGCTGGTGCAG；
VH1/5：GAGGTGCAGCTGGTGCAG；
VH3：GAGGTGCAGCTGGTGGAG；
VH3-23：GAGGTGCAGCTGTTGGAG；
VH4：CAGGTGCAGCTGCAGGAG；
VH4-34：CAGGTGCAGCTACAGCAGTG；
Cμ CH1：GGGAATTCTCACAGGAGACGA；
IgG CH1：GTTCGGGGAAGTAGTCCTTGAC；
Ca CH1：GTCCGCTTTCGCTCCAGGTCACACT。
4. the method for amplifying the variable region and the constant region of the single B cell human antibody gene according to any one of claims 1 to 3, further comprising the step of obtaining the constant region of the BCR/antibody sequence to confirm the Ig class, wherein the specific experimental steps are as follows to prepare a 50 microliter polymerase chain reaction system: 10 microliters of SF buffer, 1 microliter comprising: guanine deoxynucleotide triphosphate dGTP, adenine deoxynucleotide triphosphate dATP, thymine deoxynucleotide triphosphate and cytosine deoxynucleotide triphosphate dCTP, equimolar mixtures of 4 internal deoxynucleotides (10 mmol/l each), 2 μ l VH primers (10 μ M each), 2 μ l CH1 primers (10 μ M each), 1 μ l products of the polymerase chain reaction of the first round, 1 μ l ultra-fidelity DNA polymerase, and no nuclease water to make up the remaining desired volume;
the polymerase chain reaction process comprises: 3 minutes at 95 ℃; 10s at 95 ℃, 30s at 55-60 ℃, 30s-45s at 72 ℃ and 30-35 cycles; 72 ℃ for 10 minutes, 4 ℃ or 12 ℃ and ∞.
5. A method for amplifying the variable region and constant region of a single B cell human antibody gene according to any one of claims 1 to 4.
6. Public cloning sequences obtained by the method for amplifying the variable and constant regions of the single B cell human antibody gene according to any one of claims 1 to 5.
7. The public cloning sequence of claim 6, comprising a heavy chain public cloning sequence and a light chain public cloning sequence.
8. The public cloning sequence of claim 6 or 7, comprising IGH V1-18 x 04, IGHD1-26 x 01/IGHD2-2 x 02/IGHD2-8 x 01, IGHJ3 x 02_ IGLV1-44 x 01, IGJ3 x 02.
9. Use of the public cloning sequence of any one of claims 6-8 for the preparation of a diagnostic marker against encephalitis of the N-methyl-D-aspartate receptor.
CN202010742037.7A 2020-06-30 2020-07-29 Method for obtaining B cell antibody gene of anti-N-methyl-D-aspartate receptor encephalitis and research on immune repertoire thereof Pending CN111808195A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2020106070111 2020-06-30
CN202010607011 2020-06-30

Publications (1)

Publication Number Publication Date
CN111808195A true CN111808195A (en) 2020-10-23

Family

ID=72863270

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010742037.7A Pending CN111808195A (en) 2020-06-30 2020-07-29 Method for obtaining B cell antibody gene of anti-N-methyl-D-aspartate receptor encephalitis and research on immune repertoire thereof

Country Status (1)

Country Link
CN (1) CN111808195A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113241177A (en) * 2021-05-19 2021-08-10 上海宝藤生物医药科技股份有限公司 Method, device and equipment for evaluating immunity level and storage medium
CN113838528A (en) * 2021-09-02 2021-12-24 浙江大学 Single cell horizontal coupling visualization method based on single cell immune group library data

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008026927A2 (en) * 2006-08-30 2008-03-06 Academisch Medisch Centrum Process for displaying t- and b-cell receptor repertoires
CN101451134A (en) * 2007-11-29 2009-06-10 上海凯勃生物技术有限公司 Method for amplifying human heavy chain and light chain of antibody from human trace B cells
CN103097888A (en) * 2010-05-06 2013-05-08 赛昆塔公司 Monitoring health and disease status using clonotype profiles
WO2014043813A1 (en) * 2012-09-19 2014-03-27 British Columbia Cancer Agency Branch Immune repertoire profiling
WO2018011584A1 (en) * 2016-07-13 2018-01-18 Genome Research Limited Kit for amplifying immunoglobulin sequences
CN107828785A (en) * 2017-11-27 2018-03-23 深圳华大生命科学研究院 For building the reagent set and method in monkey BCR libraries
WO2020040210A1 (en) * 2018-08-22 2020-02-27 国立研究開発法人国立精神・神経医療研究センター Biomarker for myalgic encephalomyelitis/chronic fatigue syndrome (me/cfs)
CN111139286A (en) * 2019-11-07 2020-05-12 南方医科大学南方医院 Construction method of BCR high-throughput sequencing library

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008026927A2 (en) * 2006-08-30 2008-03-06 Academisch Medisch Centrum Process for displaying t- and b-cell receptor repertoires
CN101451134A (en) * 2007-11-29 2009-06-10 上海凯勃生物技术有限公司 Method for amplifying human heavy chain and light chain of antibody from human trace B cells
CN103097888A (en) * 2010-05-06 2013-05-08 赛昆塔公司 Monitoring health and disease status using clonotype profiles
WO2014043813A1 (en) * 2012-09-19 2014-03-27 British Columbia Cancer Agency Branch Immune repertoire profiling
WO2018011584A1 (en) * 2016-07-13 2018-01-18 Genome Research Limited Kit for amplifying immunoglobulin sequences
CN107828785A (en) * 2017-11-27 2018-03-23 深圳华大生命科学研究院 For building the reagent set and method in monkey BCR libraries
WO2020040210A1 (en) * 2018-08-22 2020-02-27 国立研究開発法人国立精神・神経医療研究センター Biomarker for myalgic encephalomyelitis/chronic fatigue syndrome (me/cfs)
CN111139286A (en) * 2019-11-07 2020-05-12 南方医科大学南方医院 Construction method of BCR high-throughput sequencing library

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
李新洋等: "从单个B细胞扩增全人源抗体重链和轻链基因方法的建立", 《细胞与分子免疫学杂志》, no. 04, 18 April 2018 (2018-04-18), pages 368 - 370 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113241177A (en) * 2021-05-19 2021-08-10 上海宝藤生物医药科技股份有限公司 Method, device and equipment for evaluating immunity level and storage medium
CN113241177B (en) * 2021-05-19 2024-05-10 上海宝藤生物医药科技股份有限公司 Method, device, equipment and storage medium for evaluating immunity level
CN113838528A (en) * 2021-09-02 2021-12-24 浙江大学 Single cell horizontal coupling visualization method based on single cell immune group library data
CN113838528B (en) * 2021-09-02 2023-09-19 浙江大学 Single-cell horizontal coupling visualization method based on single-cell immune repertoire data

Similar Documents

Publication Publication Date Title
US20230313291A1 (en) System and method for massively parallel analysis for nucleic acids in single cells
US20210310076A1 (en) Methods of monitoring conditions by sequence analysis
ES2926722T3 (en) High-throughput sequencing of polynucleotide library and transcriptome analysis
Kirsch et al. T-cell receptor profiling in cancer
Robinson Sequencing the functional antibody repertoire—diagnostic and therapeutic discovery
EP2861760B1 (en) High throughput sequencing of multiple transcripts of a single cell
CN107760690B (en) A kind of preparation method and application of high throughput human antibody
US20160244825A1 (en) High-throughput nucleotide library sequencing
US20140357500A1 (en) Single cell bar-coding for antibody discovery
US20120183969A1 (en) Immunodiversity Assessment Method and Its Use
Friedensohn et al. Synthetic standards combined with error and bias correction improve the accuracy and quantitative resolution of antibody repertoire sequencing in human naïve and memory B cells
US20240150437A1 (en) Immune repertoire mining
CN111808195A (en) Method for obtaining B cell antibody gene of anti-N-methyl-D-aspartate receptor encephalitis and research on immune repertoire thereof
US20230408514A1 (en) Single-cell combinatorial indexed cytometry sequencing
Waltari et al. Functional enrichment and analysis of antigen-specific memory B cell antibody repertoires in PBMCs
Hansmann et al. Clonal expansion and interrelatedness of distinct B-lineage compartments in multiple myeloma bone marrow
Haubold et al. B‐lymphocyte and plasma cell clonal expansion in monosymptomatic optic neuritis cerebrospinal fluid
Rettig et al. Validation of methods to assess the immunoglobulin gene repertoire in tissues obtained from mice on the international space station
EP3394326B1 (en) Highly parallel assays for simultaneous identification of antibody sequences and binding partners
US10513733B2 (en) High throughout sequencing of paired VH and VL transcripts from B cells secreting antigen-specific antibodies
CN111850016A (en) Immune repertoire standard substance sequence and design method and application thereof
Miller et al. Construction and screening of antigen targeted immune yeast surface display antibody libraries
Pan et al. Large-scale antibody immune response mapping of splenic B cells and bone marrow plasma cells in a transgenic mouse model
Rosenfeld et al. Bulk gDNA sequencing of antibody heavy-chain gene rearrangements for detection and analysis of B-cell clone distribution: A method by the AIRR community
Reddy Devulapally High-throughput sequencing of human B cell receptor repertoires at single-cell level with preservation of the native antibody heavy and light chain pairs

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20201023

RJ01 Rejection of invention patent application after publication