CN111773236A

CN111773236A - Application of CD40L aptamer in preparation of medicines for resisting aGVHD effect

Info

Publication number: CN111773236A
Application number: CN202010750046.0A
Authority: CN
Inventors: 杨婷; 胡建达; 骆晓峰; 任金华; 张钰鑫; 庄悠然; 朱浩杰; 吴雪琼; 陈秋茹; 曾雁玲; 肖敏; 陈少桢; 陈永铨; 林康昵; 陈敏敏; 李芊; 陈志哲
Original assignee: Individual
Current assignee: Individual
Priority date: 2020-07-30
Filing date: 2020-07-30
Publication date: 2020-10-16

Abstract

The invention discloses an application of CD40L aptamer in preparation of a medicine with an anti-aGVHD effect, and belongs to the technical field of biomedicine. The inventor of the application finds through experiments that the C40L aptamer can circulate in a mouse body for a long time without influencing the survival of the mouse, can prevent the generation and the development of aGVHD, promotes the hematopoietic reconstruction and the immunity recovery of the mouse after transplantation, and is superior to clinical medicine ATG in the immune reconstruction. Therefore, the CD40L aptamer can be used for preparing medicines with anti-aGVHD effect, which opens up a new application field of the CD40L aptamer and a new medicine with anti-aGVHD effect, and has wide application space.

Description

Application of CD40L aptamer in preparation of medicines for resisting aGVHD effect

Technical Field

The invention relates to an application of CD40L aptamer in preparation of a medicine with an anti-aGVHD effect, belonging to the technical field of biomedicine.

Background

Allogeneic Hematopoietic Stem cell transplantation (allo-HSCT) is the most effective method for treating hematologic malignancies such as leukemia, severe aplastic anemia, and hereditary hematologic disorders. Currently, the most main factor restricting the curative effect of allo-HSCT is the postoperative complication Graft-Versus-Host Disease (GVHD), which not only affects the survival after transplantation, but also seriously affects the life quality of patients. According to the difference of Human Leukocyte Antigen (HLA) compatibility and donor source, about 30% -80% of recipients after transplantation have Acute GVHD (Acute Graft Versus Host Disease, aGVHD); chronic GVHD (cGVHD) can develop in 30% -70% of recipients who survive more than 100 days. Nearly half of patients are directly or indirectly fatal by GVHD.

The development of aGVHD is a complex pathological process that has not been fully elucidated to date, and Ferrara and deeg et al have integrated the disease progression into three stages: 1) starting: radiation or chemotherapy in pre-transplant pretreatment regimens causes tissue damage, induces the release of inflammatory mediators, such as cytokines TNF-a, IL-6, IL-1, and the like; they not only enhance the expression signals of Major Histocompatibility Complex (MHC) proteins, but also promote activation of Antigen Presenting Cells (APCs) and expression of costimulatory molecules. 2) Activation and amplification: the donor-recipient activated antigen-presenting cells simultaneously activate naive T cells, promoting their differentiation into effector T cells, memory T cells, cytotoxic T cells, and the like. 3) The effects are as follows: activated donor T cells migrate to aGVHD target organs (liver, lung, intestine, skin, etc.) to attack the recipient target organs by Fas/FasL, perforin, granzyme and cytokines. Recent new studies have shown that neutrophils also contribute to the development of GVHD by lysing chemokines and producing reactive oxygen species to promote T cell activation and enhance tissue damage from pretreatment protocols. The level of neutrophils infiltrating the gut has been reported to correlate closely with the severity of GVHD in the gut. It was further found that the severity of GVHD was correlated with the number of target organ-infiltrated leukocytes, particularly T cells (CD 4)⁺) And neutrophils.

To date, there have been new studies on the prevention and treatment of GVHD, and it has been found that various types of drugs have been developed with immunosuppressive agents such as anti-human thymic immunoglobulin (ATG), cyclophosphamide, etc., and signal path blocking agents such as bortezomib, CTLA4-Ig, etc.; there are also regulatory epigenetics, cell suicide gene therapy, and the like. Most of these methods can improve GVHD, but the means for thorough cure needs further investigation.

Numerous studies have shown that the CD40-CD40L signaling pathway is one of the important costimulatory signals for T cell activation, and their interaction can stimulate antigen-presenting cells, enhancing the expression of other costimulatory signals such as B7. In 1996, Larsen et al first discovered that blocking the CD40-CD40L signaling pathway by anti-CD 40L monoclonal antibodies (mAbs) could prevent acute rejection and the generation of autoreactive antibodies in a mouse heart transplantation model. Guillonneau et al in heart transplantation in rats, by locally injecting CD40Ig into the transplanted heart, found that it can induce long-term survival of the recipient graft, generate Treg cells, induce the development of CD8+ CD45RClow Treg, which can mediate transplantation immune tolerance and ensure long-term survival of the graft in the recipient. In 2000, Brossart et al reported that soluble CD40L signaling could induce RelB nuclear localization and inhibit IL-10R upregulation, promoting CD83+ Dendritic Cell (DC) maturation, and that blocking the CD40-CD40L pathway was thought to enhance IL-10 inhibition of DC function and reduce immune rejection.

In rodents, the CD40L monoclonal antibody blocks a CD40/CD40L pathway to induce peripheral and central tolerance, and the effect of establishing a stable chimera to induce durable immune tolerance is obvious. However, the attendant complications of renal transplant thrombosis in nonhuman primates have suspended its potential for use.

The applicant of the invention obtains an oligonucleotide sequence of a high specificity recognition and high affinity binding immune T cell surface marker CD40L through a systematic evolution technology of exponential enrichment ligands (SELEX) screening, and the oligonucleotide sequence is named as a C10 or CD40L aptamer. It has similar function to antibody, and has the unique advantages of low immunogenicity, less immune reaction, low molecular weight, easy tissue penetration, etc. Previous studies have shown that the specific high affinity recognition by adaptive folding of CD40L aptamers binds to CD40L proteins of different configurations. However, there are no reports that CD40L aptamers can be used for preparing medicines with anti-aGVHD effect.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides application of CD40L aptamer in preparing a medicament for resisting the effect of aGVHD. The inventor of the application finds through experiments that the C40L aptamer can circulate in a mouse body for a long time without influencing the survival of the mouse, can prevent the generation and the development of aGVHD, promotes the hematopoietic reconstruction and the immunity recovery of the mouse after transplantation, and is superior to clinical medicine ATG in the immune reconstruction. Therefore, the CD40L aptamer can be used for preparing medicines with anti-aGVHD effect, which opens up a new application field of the CD40L aptamer and a new medicine with anti-aGVHD effect, and has wide application space.

The technical scheme for solving the technical problems is as follows: the application of a CD40L aptamer in preparing a medicine for resisting the effect of aGVHD, wherein the CD40L aptamer has a nucleotide sequence shown in SEQ ID NO 1.

SEQ ID NO1：

agcatagagacatctgctatccttggctcaggtccctctctccggtatgcggctccatcctagactccag acttcaggta。

The principle of the invention is as follows:

according to the invention, by establishing an aGVHD mouse model, the function of treating aGVHD by using the CD40L aptamer is developed in an in-vivo environment, and data such as stability, efficacy and the like of the aptamer in an in-vivo microenvironment are provided, so that the CD40L aptamer can be used for preparing a medicine with an anti-aGVHD effect, and thus, a new biomarker and a treatment strategy are provided for transplantation immunity.

The CD40L aptamer has the following beneficial effects in preparing medicines with anti-aGVHD effect:

the inventor of the application finds through experiments that the C40L aptamer can circulate in a mouse body for a long time without influencing the survival of the mouse, can prevent the generation and the development of aGVHD, promotes the hematopoietic reconstruction and the immunity recovery of the mouse after transplantation, and is superior to clinical medicine ATG in the immune reconstruction. Therefore, the CD40L aptamer can be used for preparing medicines with anti-aGVHD effect, which opens up a new application field of the CD40L aptamer and a new medicine with anti-aGVHD effect, and has wide application space.

On the basis of the technical scheme, the invention can be further improved as follows.

Further, the dose of the CD40L aptamer was 0.125. mu. mol/kg body weight.

The adoption of the further beneficial effects is as follows: in the present example, 100. mu.l of 25. mu. mol/L CD40L aptamer was placed under the skin after encapsulation and microinjection, and the dose per mouse was about 2.5 nmol. Also, since each mouse weighs about 20g, the dose of CD40L aptamer was about 0.125. mu. mol/kg body weight. Experiments conducted by the inventors of the present application show that the CD40L aptamer with the above dosage can effectively play an anti-aGVHD effect in an anti-aGVHD effect drug.

Further, the anti-aGVHD effect agent comprises a CD40L aptamer and a pharmaceutically acceptable carrier.

The adoption of the further beneficial effects is as follows: the CD40L aptamer of the invention can be used together with a pharmaceutically acceptable carrier to prepare a medicament for resisting the effect of aGVHD.

Further, the carrier is any one or a mixture of more than two of a slow release agent, an excipient, a filler, a binder, a wetting agent, a disintegrating agent, an absorption enhancer, an adsorption carrier, a surfactant and a lubricant.

Further, the dosage form of the anti-aGVHD effect medicine is any one of an external preparation, an oral preparation and an injection preparation.

The adoption of the further beneficial effects is as follows: the medicine for resisting the aGVHD effect can be prepared into medicines in various dosage forms, is suitable for various administration routes, such as external preparations, oral preparations or injection preparations, and the injection administration can be intradermal, subcutaneous, intramuscular, local or intravenous administration.

Further, the external preparation is a spray or an aerosol.

Further, the oral preparation is any one of granules, capsules, tablets and vesicant agents.

Further, the injection preparation consists of CD40L aptamer, cosolvent and 0.9% sodium chloride solution or water for injection.

Still further, the cosolvent is selected from any one or more of tween-80, propylene glycol, glycerol, ethanol and PEG-400.

Drawings

FIG. 1 is a diagram showing a comparison of postures of a control group and an experimental group in the example of the present invention. Among them, the aGVHD group (lower) was clearly arching.

Fig. 2 is a graph comparing hair textures of a control group and an experimental group in examples of the present invention. Among them, the aGVHD group (lower) peaked moderately.

FIG. 3 is a graph showing a comparison of diarrhea symptoms in the control group and the experimental group in the example of the present invention. Among them, aGVHD group (left) diarrhea, anal red swelling.

Fig. 4 is a graph comparing the hair integrity of the control group and the experimental group in the example of the present invention. Among them, aGVHD group (left) had hair loss at the top of the head and skin damage at the feet.

FIG. 5 shows the weight fluctuation of the PBS group, aGVHD1, aGVHD2 and aGVHD3, in accordance with an embodiment of the present invention.

FIG. 6 is a graph of the clinical scores of the PBS group, aGVHD1, aGVHD2, and aGVHD3, in accordance with an embodiment of the present invention.

FIG. 7 shows pathological liver staining results of PBS mice in the present example, with 400-fold magnification.

FIG. 8 shows pathological liver staining results of mice in the mouse group of aGVHD at 400-fold magnification in the example of the present invention. Degeneration and necrosis of mucous epithelial cells, hair shedding, obvious congestion and edema of mucous membrane and submucosa, gland reduction and more lymphocyte infiltration can be seen at the positions indicated by arrows.

FIG. 9 shows the pathological staining result of the intestinal tract of the mice in the PBS group with 400-fold magnification in the example of the present invention.

FIG. 10 shows the pathological staining results of the aGVHD group in the present invention, with 400-fold magnification.

FIG. 11 is a graph showing the results of H-2K in peripheral blood on day 11 in aCVHD group of mice in accordance with the present invention^dPositive cell proportion.

FIG. 12 is a graph showing H-2K in spleen on day 11 of aCVHD group mice in an example of the present invention^dPositive cell proportion.

FIG. 13 is a graph showing H-2K in bone marrow on day 11 of aCVHD mice in accordance with an embodiment of the present invention^dPositive cell proportion.

FIG. 14 is a graph showing survival curves of three groups of mice in the example of the present invention.

FIG. 15 is a graph showing in vivo imaging qualitative analysis of distribution in mice of group C10 after tail vein injection of 200pmol Alexa Flour680C10 aptamer for 30min-6h in accordance with the present invention.

FIG. 16 is a graph showing that after 200pmol of Alexa Fluur 680C10 aptamer was injected into the tail vein of mice in group C10 for 30min to 6h, the amount of Alexa Fluur 680C10 aptamer contained in the mice and the corresponding metabolic time were qualitatively analyzed by an in vivo imager in the group C10.

FIG. 17 is a graph showing the remaining fluorescein-aptamer residues in the spleen, lung, intestine, liver and kidney after dissecting mice after imaging is completed, in accordance with an embodiment of the present invention.

FIG. 18 is a graph showing the flow cytometry analysis of the expression level of CD40L molecules in peripheral blood 14 days after the transplantation of aGVHD group mice in the example of the present invention.

FIG. 19 is a graph showing the flow cytometry detection of the expression level of CD40L molecule in peripheral blood 14 days after the transplantation of ATG group mice in the example of the present invention.

FIG. 20 is a graph showing the flow cytometry detection of the expression level of CD40L molecules in peripheral blood 14 days after the transplantation of mice in group C10 in the example of the present invention.

FIG. 21 is a graph showing the flow cytometry analysis of the expression level of CD40L molecules in peripheral blood 14 days after D40 group transplantation, in accordance with an embodiment of the present invention.

FIG. 22 is an appearance of each group of mice in an example of the present invention. In the figure, the circle is the osmotic pump implantation site.

FIG. 23 is a photograph of hair loss, redness of the dorsum arcus and swelling of the anus 20 days after transplantation in each group of mice in an example of the present invention.

FIG. 24 shows the condition of disturbance and depilation of hair in each group of mice in the example of the present invention.

FIG. 25 is a hematuria profile of each group of mice in an example of the present invention. The circled mice in the aGVHD group developed severe hematuria.

FIG. 26 is a graph of mouse aGVHD clinical performance scores, in accordance with an embodiment of the present invention.

FIG. 27 shows HE staining of liver pathology in ATG group mice at 200-fold magnification in accordance with an embodiment of the present invention.

FIG. 28 is a HE staining of liver pathology at 200-fold magnification of mice in group C10, according to an embodiment of the present invention.

FIG. 29 is a HE staining of liver pathology at 200-fold magnification of mice in group D40, according to an example of the present invention.

FIG. 30 shows HE staining of intestinal pathology in ATG group mice at 200-fold magnification in accordance with an embodiment of the present invention.

FIG. 31 shows HE staining of intestinal pathology in mice from group C10 at 200-fold magnification in accordance with an embodiment of the present invention.

FIG. 32 shows HE staining of intestinal pathology in mice from group D40 at 200-fold magnification in accordance with an embodiment of the present invention. Degeneration and necrosis of mucous epithelial cells, hair shedding, pseudomembranous formation, obvious congestion and edema of mucous membrane and submucosa, and gland reduction with more lymphocyte infiltration can be seen at the positions indicated by arrows.

FIG. 33 is a graph showing the results of spleen chimerism assay 14 days after transplantation in ATG group mice in the present example.

FIG. 34 shows the results of spleen chimerism assay 14 days after transplantation of mice in group C10 in accordance with the present invention.

FIG. 35 is a graph showing the results of spleen chimerism assay 14 days after transplantation of D40 group mice in the example of the present invention.

FIG. 36 is a graph showing the results of bone marrow chimerism assay 14 days after transplantation in ATG group mice in accordance with an embodiment of the present invention.

FIG. 37 is a graph showing the results of bone marrow chimerism assay 14 days after transplantation in group C10 mice in accordance with an embodiment of the present invention.

FIG. 38 is a graph showing the results of bone marrow chimerism assay 14 days after transplantation in D40 group mice in accordance with the present invention.

FIG. 39 is a graph showing the results of peripheral blood chimerism assay 14 days after the transplantation of ATG group mice in the example of the present invention.

FIG. 40 is a graph showing the results of peripheral blood chimerism assay 14 days after the transplantation of mice in the group C10 in the example of the present invention.

FIG. 41 is a graph showing the results of peripheral blood chimerism assay 14 days after the transplantation of D40 group mice in the example of the present invention.

FIG. 42 is a diagram showing the flow measurement of CD4 and CD8 in peripheral blood 20 days after the transplantation of ATG group mice in the example of the present invention.

FIG. 43 shows a flow cytometry of CD4 and CD8 in peripheral blood 20 days after transplantation of group C10 mice in an example of the present invention.

FIG. 44 is a diagram showing the flow measurement of CD4 and CD8 in peripheral blood 20 days after the transplantation of D40 group mice in the example of the present invention.

Fig. 45 is a flow assay of peripheral blood Treg cells 20 days after ATG group mice transplantation in an example of the invention.

Fig. 46 is a flow assay of peripheral blood Treg cells 20 days after transplantation in group C10 mice, in an example of the invention.

Fig. 47 is a flow assay of peripheral blood Treg cells 20 days after transplantation of D40 group mice in an example of the present invention.

FIG. 48 is a statistical graph of survival times of groups of mice in accordance with the present invention.

Detailed Description

The principles and features of this invention are described below in conjunction with the following detailed drawings, which are given by way of illustration only and are not intended to limit the scope of the invention.

1. Establishing a mouse model of allogeneic hematopoietic stem cell transplantation aGVHD

1.1 materials and methods

1.1.1 Experimental animals

BALB/C, C57bl/6 pure line mice each 21, male, 6-8 weeks old, 18-22g in weight, purchased from Shanghai Si Laike laboratory animals, Inc. in the IVC systems animal laboratory at Fujian university of medicine. All animal experiments strictly comply with animal management and implementation regulations prepared by animal ethics committee of the Fujian medical university subsidiary Hospital, the major hematological research institute of Fujian province, and the hematological research institute of Fujian province. All experimental mice were kept in a constant temperature and humidity environment with 5 mice per cage, with artificial lighting, 12h daily and 12h nighttime (08:00,20:00), allowing free access to water and food.

1.1.2 Main laboratory instruments

Optical microscope, Olympus; biological tissue paraffin microtomes, Leica, germany; paraffin embedding machines, Histoline, italy; a number of surgical instruments, fuzhou mai new biotechnology development ltd; disposable 1ml syringes, BD, usa; a refrigerated high speed centrifuge, Themro Fish Scientific, USA; RS2000-Pro irradiator, Radsource Technologies, USA; FACSVerse flow cytometer, BD, usa.

1.1.3 Main test reagents

C10, D40 aptamer, Shanghai Bioengineered biological products, Inc.; the CD40L aptamer has a nucleotide sequence shown in SEQ ID NO 1. SEQ ID NO 1:

agcatagagacatctgctatccttggctcaggtccctctctccggtatgcggctccatcctagactccagactt caggta。

10% neutral formalin fixing solution, beijing china fir jin qiao biotechnology limited; 4% of paraformaldehyde, and a comprehensive branch plant of the Sanming chemical general plant; phosphate Buffered Saline (PBS), sequoia kummerbon biotechnology limited, beijing; xylene, Shangshu Shang Wen Long chemical plant, Guangdong; normal saline, Shijiazhuang four drugs Co., Ltd; hematoxylin, china fir bridge biotechnology limited, beijing; absolute ethyl alcohol, Shanghai Happy chemical industry one plant; eosin, beijing china fir bridge biotechnology limited; neutral gums, new biotechnology development, fuzhou, ltd; treg kit, R & D company, usa; CD4, CD25, CD8 flow antibody, BD, usa; gibco fetal bovine serum, seimer feishel biochemicals ltd; erythrocyte lysate, ebioscience, usa.

1.1.4 Experimental methods

1.1.4.1 grouping of experimental animals

21 pure-line BALB/C mice of 6-8 weeks of age were randomly divided into irradiation group (irradiation-only blank control group), aGVHD (experimental group), PBS group (negative control group), and 7 mice per group.

1.1.4.2 construction of aGVHD mouse model

Preparing a mouse: sterilized drinking water containing gentamicin (0.5mg/ml) is drunk from 2 days before bone marrow transplantation to 3 weeks after transplantation of mice BALB/C

Irradiation: 21 BALB/C mice were irradiated 2X-ray whole body irradiation (TBI), 4 Gy/time, 4h apart, and 12h of rest.

Preparation of transplanted cells: taking 14 SPF grade C57bl/6 mice, dislocating cervical vertebrae, killing, soaking in 95% alcohol for 5min, peeling bilateral femurs of the mice under a sterile super clean bench, cutting epiphyses at two ends, and repeatedly washing marrow cavities with RPMI-1640 culture solution containing 10% fetal calf serum. Taking mouse spleen under aseptic condition, grinding, filtering with 200 mesh sieve, centrifuging, adding 5ml of 1X erythrocyte lysate, mixing, standing at room temperature for 5min, adding 5ml of PBS containing 10% fetal calf serum to terminate reaction, centrifuging, and adding 10% RPMI-1640 culture solution of fetal calf serum. Both cells were mixed well, centrifuged, and washed 2 times with PBS. Viable cell counts of splenocytes, bone marrow cells were > 95%.

Grouping: randomly group 21 mice: irradiation group (blank control group), PBS group (negative control group), aGVHD group (experimental group), 7 per group.

Infusion by caudal vein injection, no infusion in irradiation group, 200ul PBS in PBS group, 200ul cell liquid in aGVHD group, wherein the cell liquid contains Bone Marrow Cells (BMCs)2.3 × 10⁷Spleen and spleen cells (SPCs)0.8 × 10⁶And (4) respectively.

1.1.4.3 general case

Clinical Cooke scoring (as in Table 1) was used to assess the severity of aGVHD and the clinical performance was monitored 30 days after transplantation in each group of mice. The diet and activity of the mice were recorded daily, and the mice were scored for signs of lassitude, weight loss, dorsum, alopecia, skin ulceration, diarrhea, etc., and the sum of 6 was the clinical GVHD index (maximum index of 10).

TABLE 1 Cooke Scoring System

Index (I)	0 point (min)	1 minute (1)	2 is divided into
				Body weightDescend	<10％	10％-25％	>25％
Posture of a person	Is normal	Bow and back only at rest	Severe back and arch affecting movement
				Degree of motion	Is normal	Mild to moderate reduction	Are still reluctant to move when given a stimulus
Cortex (texture)	Is normal	Light to medium shrug hair	Severe disorders
				Skin integrity	Is normal	Local skin damage of hand claw part	Large apparent skin damage

1.1.4.4 Hematoxylin-eosin staining of tissue sections (Hematoxylin-eosin, HE)

Material taking: dying the moribund mouse by dislocation of cervical vertebra, lightly taking liver and small intestine tissues of the mouse, washing with clear water, flattening the tissues and completely soaking in formalin fixing solution, wherein the area of the liver and the small intestine tissues is about 2cm multiplied by 0.3 cm.

Fixing: fixing in 10% neutral formalin solution for 12-24 hr.

And (3) dehydrating and transparency: the tissue is respectively soaked in 80%, 90%, 95% and 100% ethanol for 2h, then is soaked in a xylene reagent (1/2 xylene +1/2 absolute ethanol) for 1h, and then is soaked in a pure xylene reagent for 1.5 h.

Wax dipping and embedding: paraffin was added, allowed to soak into the transparent tissue, and fixed in molten paraffin to form a wax block.

Slicing and pasting the chip: cutting off excessive wax block at 0.1-0.2cm around the tissue, placing the trimmed wax block on a slicer, cutting into slices with thickness of 4-6um, spreading in water of 40-45 deg.C, spreading, taking out to the middle section of glass slide, and baking in a thermostat of 60-65 deg.C for 15-30 min.

Hematoxylin staining: soaking the tissue slices in freshly prepared hematoxylin for 20min by hematoxylin-eosin (H.E) staining method, taking out, washing with clear water for 15min, and washing until the color of the slices turns blue.

Differentiation rinsing: and immersing in 1% ethanol hydrochloride solution for 2s, wherein the slices turn red and lighter in color, and quickly taking out and washing with parallel-flow water until the slices turn blue.

Eosin staining: performing contrast dyeing with 0.5% eosin ethanol solution for 3min, soaking in 95% ethanol for 5s, adding into anhydrous ethanol for 3min, taking out, and drying with absorbent paper.

Transparent sealing sheet: placing the slices in xylene I, II for 3-5min each, and sealing with neutral gum.

And (3) analyzing an experimental result: the tissue structures of the liver and the small intestine are observed under a microscope, and the cell morphology of each layer is changed.

1.1.4.5 flow cytometry for hematopoietic reconstitution

After constructing the aGVHD mouse model by the method, the peripheral blood, spleen cells and bone marrow cells of the mouse are collected to detect the embedding degree.

Material taking: mice were sacrificed by cervical dislocation 10 days after transplantation to take peripheral blood, spleen cells, and bone marrow cells.

Dyeing: adding erythrocyte lysate 1ml, standing on ice for 5-10 min (splenocyte lysis time is long), centrifuging for 500g and 3min, discarding supernatant, washing with PBS for 1 time, adding monoclonal antibody APC-H2K^d、FITC-H2K^bIncubating each 1ul at 4 ℃ for 30min in the dark, washing with PBSAnd 2, detecting by an up-flow instrument.

1.1.4.6 survival status

The survival status of each group of mice 30 days after transplantation is observed and recorded, and the survival curve is analyzed and drawn.

1.1.5 data statistics and analysis

Statistical analysis of the data was performed using SPSSV20.0 software: the measured data are expressed by mean plus minus standard deviation (x plus minus s), the comparison among 2 groups adopts t test or the comparison among a plurality of time points in the group adopts one-factor variance analysis, and the difference is shown as P less than 0.05 and has statistical significance.

1.2 results of the experiment

1.2.1 mouse aGVHD Performance

1.2.1.1 general case

Irradiation group (blank control), PBS group (control): mice had a reduced diet and a slowed activity on day 3 after irradiation.

aGVHD group (experimental group): the weight of the cell-back-transfused mice is reduced by 15% on the 7 th day after irradiation, the rise appears, and the mobility of the mice is reduced; after irradiation, the body weight slightly rises after the 10 th day, the anus is red and swollen, and the anus is moderately shrunken and slightly arched; on 14 days after irradiation, the hair of the mouse is severely disordered, the hair at the top of the head and around the eyes is sparse, the paw part is slightly damaged by skin, the activity is influenced by severe arch and back, and the mouse is moderately diarrhea and is pasty; around day 25 after irradiation, the mice developed skin lesions around the eyes and on the top of the head, severe diarrhea, and watery stool (as shown in fig. 1-4).

As can be seen in FIG. 1, the aGVHD group (lower) is clearly arching. As can be seen from FIG. 2, the aGVHD group (lower) shows moderate shrubs. As can be seen from FIG. 3, the aGVHD group (left) suffered from diarrhea and red swelling of the anus. As can be seen in FIG. 4, the aGVHD group (left) had hair loss at the top of the head and skin damage at the feet.

Body weight fluctuations for the PBS group, aGVHD1, aGVHD2, and aGVHD3, as shown in figure 5.

Clinical scores for the PBS group, aGVHD1, aGVHD2, and aGVHD3, as shown in figure 6.

1.2.1.2 HE staining of organ tissue sections

1.2.1.2.1 liver tissue

As can be seen from FIG. 7, no obvious abnormality was observed in liver pathology in the PBS group mice, and the cells were well-arranged and morphologically regular under the light microscope.

As can be seen in FIG. 8, the liver of the mice in the aGVHD group showed localized hepatocellular swelling, degeneration, necrosis, disorganization of hepatic cords, central venous dilatation, and massive leukocyte infiltration around the venules and in the region of the venules.

1.2.1.2.2 intestinal tract tissue

As can be seen from FIG. 9, no significant pathological changes were observed in the intestinal tract of the PBS group mice.

As can be seen from FIG. 10, the mucosal epithelial cells of the mice in the aGVHD group underwent the light mirror were degenerated and necrosed, the villi fell off, the pseudomembranous was formed, the mucous membrane and the submucosa were significantly congested, edematous, glandular reduction, interstitial bleeding, and were accompanied by much lymphocyte infiltration.

1.2.2 hematopoietic reconstitution conditions

As can be seen from FIG. 11, H-2K was detected in peripheral blood of mice (Balb/c) at 14 days after irradiation^bThe percentage of positive cells was greater than 90%.

As can be seen from FIG. 12, H-2K was detected in the spleen of the mouse (Balb/c) at 14 days after irradiation^bPositive cells were greater than 90%.

As can be seen from FIG. 13, H-2K was detected in the bone marrow of the mouse (Balb/c) at 14 days after irradiation^bPositive cells were greater than 90%.

This suggests successful transplantation of allogeneic hematopoietic stem cells.

1.2.3 survival situations

As can be seen from fig. 14, the irradiation group (blank control group), the PBS group (control group): death began on day 7 post-irradiation and all died on day 9 post-irradiation. aGVHD group (experimental group): the mice died sequentially about day 30 after irradiation.

And (4) conclusion:

aGVHD is a major factor affecting the quality of life of patients after allo-HSCT. The main reason for this is that donor-reactive T cells are not inhibited and rejection cannot be mediated without alloreactive T cells. However, the dominance of donor-reactive T cells in recognizing leukemia-specific antigens for immune response is such that complete elimination of donor-reactive T cells would inhibit graft-versus-leukemia (GVL) effects, increasing the risk of tumor recurrence, infection, and secondary tumor development. How to induce immune tolerance and separate GVHD and GVL effects is the first challenge in hematopoietic stem cell transplantation.

Therefore, the mouse aGVHD model established in the research provides an animal model for later research. Our study found that after TBI8Gy was irradiated to Balb/C mice, spleen cells and bone marrow cells of C57bl/6 mice were returned to construct aGVHD model. Peripheral blood, spleen cells and bone marrow cells are collected on the 10 th day after irradiation, the chimeric degree can reach more than 90 percent, and the transplantation is successful in consideration of the allogeneic hematopoietic stem cell implantation.

In addition, the weight of the mice in the aGVHD group decreased by 15% on day 7, and the mice appeared slightly rising in weight in the 10 th day part, and the fur was tarnished and moderately shrunken, and the phenomenon of bowing back appeared without affecting normal activities. The mouse hair quality is severely disordered 14 days after irradiation, hair removal occurs at the top of the head and around the eyes, the arch and the back are serious, free movement is influenced, and the excrement is pasty. The symptoms gradually worsen, and the diarrhea was extremely severe and watery on day 25 after irradiation. We monitored that the symptoms in the aGVHD group mice met the cookie scoring criteria and over time, the mice had an increased symptom and increased score. Dissecting tissues of mice, taking liver and small intestine sections of the mice to perform HE staining, finding that the liver tissues and small intestine tissues of the mice in an irradiation group and a PBS group have no obvious pathological changes, while the mice in an aGVHD group show typical aGVHD pathological changes, such as liver focal hepatocyte swelling, degeneration, necrosis and hepatic cord disorder, and a large amount of leukocyte infiltration is observed around venules and in a junction area; the epithelial cells of the small intestine mucous membrane are degenerated and necrotized, the villi are shed, the mucous membrane and the submucosa are obviously congested and edematous, the glands are reduced, and the infiltration of a plurality of lymphocytes is accompanied. The mouse aGVHD model can be successfully constructed by combining the similar occurrence and development processes of clinical manifestations in repeated experiments and pathological examination. The observation was continued for 30 days, and mice in the irradiated group and the PBS group control group died after irradiation on day 7 and all died on day 9. The mice in the aGVHD group can survive for about 30 days, which can indicate that the prognosis of allogeneic hematopoietic stem cell transplantation is good.

Animal experimental study of 2 CD40L aptamer anti-aGVHD effect

2.1 materials and methods

2.1.1 Experimental animals

The same as 1.1.1.

2.1.2 Main laboratory instruments

Coverslips, sequoia kuseki biotechnology limited, beijing; slides, fuzhou mai new biotechnology development ltd; inverted microscope, Carl Zeiss, germany; biological tissue paraffin microtomes, Leica, germany; cell culture chambers, china likang biomedical science and technology stock control; biosafety cabinets, china likang biomedical science and technology control stock company; vortex oscillation mixer, linbel instruments manufacturers; a cell counter, Themro Fish Scientific, USA; alzet osmotic pumps, Alzet corporation, USA; FMT2000 Living 3D imager, Perkinelmer, USA. The rest is the same as 1.1.2.

2.1.3 Main test reagents

Gentamicin sulfate, fujian hui-tianyao biopharmaceutical limited; methylcellulose medium, STEMCELLTechnologies, canada. The rest is the same as 1.1.3.

2.1.4 Experimental methods

2.1.4.1 grouping of experimental animals

Healthy BALB/C mice received 25 mice, which were randomly divided into 5 groups of an irradiated group (irradiation only), an aGVHD group, an ATG group (anti-human thymus immunoglobulin treatment group), a C10 group (CD40L aptamer group), and a D40 group (D40 random sequence control group).

2.1.4.2 preparation of mouse intestinal tract

BALB/C mice were drank 3 days before transplantation with gentamicin (3.2 × 10)⁵U/L) sterilized water, and aseptically feeding.

2.1.4.3 mouse pretreatment

25 mice were all irradiated with X-ray whole body for 8Gy, 4 Gy/time, 2 times and 4h intervals one day before transplantation.

2.1.4.4 cell preparation

Aseptically separating C57BL/6 bilateral femurs of mice in a super clean bench, flushing marrow cavities with PBS 2ml containing 10% fetal calf serum until the femurs are white, preparing cell mixed suspension, centrifuging at 1500rpm for 5min at high speed, discarding supernatant, adding erythrocyte lysate for resuspension, placing the resuspension solution in a refrigerator at 4 ℃ for 30min, centrifuging at 1500rpm for 5min at high speed, discarding supernatant, and adding PBS containing 10% fetal calf serum for resuspension. Taking mouse spleen under aseptic condition, grinding, filtering with 200 mesh sieve, centrifuging, adding 5ml of 1X erythrocyte lysate, mixing, standing at room temperature for 5min, adding 5ml of PBS containing 10% fetal calf serum to terminate reaction, centrifuging, and adding RPMI-1640 culture solution containing 10% fetal calf serum. Both cells were mixed well, centrifuged, and washed 2 times with PBS. Viable cell counts of splenocytes, bone marrow cells were > 95%.

2.1.4.5 Back transfusion of Stem cells

The cells of 200ul of the mixed solution containing 2.3 × 10 in the tail vein of each of the aGVHD group, C10 group (CD40L aptamer group), D40 group (D40 random sequence group) and ATG group (anti-human thymic human immunoglobulin treatment group) mice were injected into the tail vein of each mouse, respectively⁷Bone marrow cells and 0.8 × 10⁶And (4) spleen cells.

2.1.4.6 CD40L aptamer distribution in mice

Depilation: after anesthetizing the mice by intraperitoneal injection of 0.35ml/100mg of 10% chloral hydrate one day before irradiation, the mice were shaved all over the body by lightly pushing the skin of the mice against the hair of the mice with a mouse shaver, so as to expose the skin of the mice as much as possible.

Fasting: randomly grab 1 mouse 1 day after reinfusion and begin fasting 6h before imaging.

Preparing an aptamer: 200pmol of Alexa flow 680C10 (CD40L aptamer) was dissolved in 200ul of PBS.

Injection, 200ul of C10 aptamer solution is injected into tail vein of mouse, after injection, 10% chloral hydrate 0.35ml/100mg is injected into abdominal cavity to anaesthetize mouse, and gauze soaked with warm water is used to wipe mouth, nose, paw and urination position of mouse.

In vivo imaging: mice were fixed in the imager and 680 emission wavelengths were selected for imaging. Images of fluorescence emission in mice were recorded and analyzed for distribution of fluorescein Alexa flours 680 in mice.

Tissue imaging: after imaging, the mice are killed by dislocation of cervical vertebrae, and visceral organs such as brain, heart, liver, spleen, lung and kidney of the mice are dissected for imaging analysis.

2.1.4.7 treatment with mouse CD40L aptamer (C10)

aGVHD group: 5 mice were injected with 200ul PBS solution in tail vein.

ATG group mice: dissolving 25mg of ATG in 5ml of physiological saline, and after 1h of reinfusion, injecting 200ul of ATG solution into tail vein, wherein the drug dose is 4 mg/kg.d; on the 3 rd and 7 th days after the return transfusion, 200ul ATG solution is injected into the tail vein, and the drug dosage is 2.5mg/kg d.

Group C10: 1) medicine preparation, 2) filling a capsule pump, and 3) implanting the capsule pump.

C10 preparation: 2.5nmol of C10 aptamer was added to 100ul PBS.

Filling a capsule pump: a) weighing the empty pump and the pump cap; b) a blunt needle matched with a capsule pump is arranged on a 1ml syringe to extract 100ul of the aptamer solution, and the air in the needle head is exhausted; c) standing the capsule osmotic pressure pump upright, and inserting a blunt needle into the pump to the bottom of the pump; d) slowly injecting the medicinal solution into the pump until a little of the medicinal solution overflows from the pump port, and carefully pulling out the needle head; e) Inserting the pump cap into the pump completely, and wiping off the redundant solution; f) the entire pump was weighed and the amount of infusion solution calculated. According to the formula: the subtraction of the mass of the filled drug and the mass of the empty pump must be greater than 98.3 x 90%.

Pre-starting of the pump: the filled capsules were pumped into PBS and placed in a 37 ℃ incubator for 4 h.

Implanting a capsule pump: a) weighing the mice 7 days after transplantation, carrying out intraperitoneal injection anesthesia on 35mg/kg of pentobarbital sodium for 30min, preparing the back skin, b) carrying out a transverse incision of about 0.5cm below the back skin of the mice, supporting a space with the size of a capsule from the incision to the back of the animals by a tissue clamp subcutaneously, c) carrying out surgical implantation of a capsule osmotic pressure pump filled with a medicinal solution, and suturing the wound.

Group D40: 1) medicine preparation, 2) filling a capsule pump, and 3) implanting the capsule pump.

Preparation of D40: 2.5nmol of D40 aptamer was added to 200ul PBS.

Filling a capsule pump: the steps are the same as above.

Pre-starting of the pump: the steps are the same as above.

Implanting a capsule pump: the steps are the same as above.

2.1.4.8 general case

2.1.4.9 survival status

2.1.4.10 detection of CD40L molecule expression level

Material taking: the tail vein of the mice was bled 20ul 14 days after transplantation.

Dyeing: adding erythrocyte lysate 1ml, standing on ice for 5-10 min (long time for splenocyte lysis), centrifuging for 500g and 3min, discarding supernatant, washing with PBS 1 time, adding monoclonal antibody Per-cp5.5-CD154, incubating at 3ul4 deg.C in dark place for 30min, washing with PBS 2 times, and detecting with an up-flow meter.

2.1.4.11 HE staining of visceral tissue sections

Material taking: on day 22, one mouse was randomly picked from each group, cervical vertebrae were dislocated and sacrificed, liver and small intestine tissues of the mice were gently removed with ophthalmic forceps, the area size was about 2cm × 2cm × 0.3cm, and the tissues were flattened and completely soaked in formalin-fixed solution after rinsing with clear water.

Fixing: fixing in 10% neutral formalin solution for 12-24 hr.

2.1.4.12 hematopoietic reconstitution

After the treatment of the mice by the method, peripheral blood, spleen cells and bone marrow cells of the mice are collected to detect the degree of embedment.

Material taking: mice in ATG group, C10 group and D40 group were sacrificed by cervical dislocation after transplantation for 14 days, and peripheral blood, spleen cells and bone marrow cells were collected.

Dyeing: adding erythrocyte lysate 1ml, standing on ice for 5min-10min (the time for splenocyte lysis is long), centrifuging for 500g and 3min, discarding supernatant, washing with PBS 1 time, adding monoclonal antibodies APC-H2Kd and FITC-H2Kb each 1ul, incubating at 4 deg.C in dark for 30min, washing with PBS 2 times, and detecting with an up-flow meter.

2.1.4.13 immune reconstitution conditions

2.1.4.13.1 testing CD4, CD8 expression

Material taking: 20ul of blood was collected from the tail vein of 20d mice after transplantation

Dyeing: adding erythrocyte lysate 1ml, standing on ice for 5min-10min (long time for splenocyte lysis), centrifuging for 500g and 3min, discarding supernatant, washing with PBS 1 time, adding monoclonal antibodies APC-CD8 and FITC-CD 41 ul, incubating at 4 deg.C in dark for 30min, washing with PBS 2 times, and detecting with flow-up instrument.

2.1.4.13.2 detecting the proportion of Treg in peripheral blood CD4+ T lymphocyte

Material taking: 20ul of blood was collected from the tail vein of 20d mice after transplantation.

Staining (1) two tubes were taken and 200ul of resuspended mouse splenocytes 1 × 10 were added⁶Tube (mix) centrifuge 450g, 5min discard supernatant. (2) Appropriate amount of CD4 and CD25 are added into the test tube and the control tube, mixed evenly and added into the FlowCytomery StaingBuffer to be protected from light for 30min at room temperature. (3) The cells were removed and washed once with pre-cooled 100ul PBS, centrifuged at 450g for 5min and the supernatant discarded. (4) Adding freshly prepared Fixation/Permeabilization working solution for resuspension, mixing, and keeping away from light at 4 ℃ for 18 h. (5) 1ml of 1xPermeabilization Buffer was added for washing, centrifuged at 400g for 5min, and the supernatant was discarded. (6) Add 1ul of Mouse BD FcBlock purified anti-Mouse CD16/CD32mAb at room temperature, protected from light for 10 min. Foxp3-PE labeled antibody was added, and rat IgG2b was added to the control tube at the same dose, mixed well, and incubated overnight at 4 ℃ in the dark. (7) Washed once with 1X Permeabilizationbuffer, 400g, and centrifuged for 5 min. Adding 1ml of 1X Permeabilization Buffer to wash again for 500g, centrifuging for 5min (8), discarding the supernatant, adding 0.5ml of PBS, and loading on the machine within 1 h.

2.1.5 data statistics and analysis

Statistical analysis was performed using graphpadprism version 5.01 system: group comparison was analyzed by Kruskal-Wallis test; the pairing comparison among groups adopts a Mann-Whitney U test analysis method; and multiple comparisons were made using the Bonferroni method to adjust P values, and statistical significance of these comparisons was determined. P < 0.05 is statistically significant.

2.2 results of the experiment

2.2.1 CD40L aptamer distribution in mice

2.2.1.1 real-time fluorescence imaging of CD40L aptamers in vivo in mice

The C10 group mice were imaged after 200pmol Alex-Flour680C100.2ml30min by tail vein injection (as shown in FIGS. 15-16), and it was found that the aptamer existed in the mice for more than 6 hours, and was finally metabolized via the urinary tract through the important organs such as heart, liver, spleen, intestine and kidney.

2.2.1.2 fluorescence imaging of CD40L aptamers on mouse target organs in the model aGVHD

After the end of the living body imaging, the mice were taken through important organs such as heart, liver, spleen, kidney, and intestine, and fluorescence imaging of the target organs was performed, and the remaining fluorescein in the spleen, lung, intestine, liver, and kidney was observed (see fig. 17).

2.2.2 detection of expression level of CD40L

One of ATG group, C10 group and D40 nuclear group was randomly transplanted at 14 days, and peripheral blood was taken for CD40L flow assay, and the expression level of CD40L molecules in the C10 group was found to be lower than that in the aGVHD group, ATG group and D40 group (as shown in FIG. 18-FIG. 21).

2.2.3 mouse aGVHD Performance

2.2.3.1 general case

On day 15 after transplantation, severe aGVHD occurred in the aGVHD group D40 mice, lacklustered hair, extensive depilation around the vertex and eyes, slight depilation of the abdomen, severe slow movement of the back and arch, and red swelling of the anus, diarrhea, hematuria (as shown in fig. 25); the ATG and C10 mice did not have corresponding aGVHD clinical manifestations (as shown in fig. 23, fig. 24); the D40 random sequence has no anti-aGVHD effect, and the preventive treatment of C10 and ATG has certain effect on aGVHD mice; (note: the circles in FIG. 22 are where the osmotic pumps were implanted, and the circles in FIG. 25 are hematuria of mice in the aGVHD group). From the recorded cooke scores, it can be seen that mice in group C10 and ATG exhibited aGVHD significantly delayed and less symptomatic than those in group D40 and aGVHD (see table 2, fig. 26).

TABLE 2 mouse Cooke scores

	Irradiation group	ATG group	Group C10	D40 group	aGVHD group
							10 days	Death was caused by death	0	0	7	6
15 days		0	0	8	7
						20 days		3	4	10	8
25 days		5	5	Death was caused by death	10
						30 days		6	5		Death was caused by death
35 days		6	6
						40 days		7	6

2.2.3.2 HE staining of visceral tissue sections

2.2.3.2.1 HE staining of liver sections

Compared with the control group, the liver and intestinal pathology of 17-day mice in the ATG group, the C10 group and the D40 group are compared under a light microscope. After the transplantation, no obvious abnormality is found in liver pathology of ATG group and C10 mice 22 days after the transplantation, and cells under a light mirror are arranged regularly and are regular in shape; the livers of mice in group D40 were observed to have focal hepatocellular swelling, degeneration, necrosis, disorganization of hepatic cords, central venous distension, and massive leukocyte infiltration around venules and in the area of the junction (see FIGS. 27-28).

2.2.3.2.2 HE staining of small intestine tissue sections

No obvious abnormality is found in intestinal pathology of ATG group and C10 mice 22 days after transplantation, cells are arranged regularly under a light microscope, and the shape is regular; degeneration and necrosis of mucous epithelial cells, villus shedding, pseudomembranous formation, obvious congestion and edema of mucous membrane and submucosa, and gland reduction with more lymphocyte infiltration can be seen in the small intestine of the D40 group. (as shown in fig. 29-31).

2.2.4 hematopoietic reconstitution conditions

Randomly taking one from ATG group, C10 group and D40 group 14 days after transplantation, taking spleen, peripheral blood and bone marrow to perform flow type chimerism detection, and detecting the chimerism of the spleen, bone marrow and peripheral blood of ATG group mice 14 days after transplantation to be 83.1%, 90.2% and 93.8% respectively, wherein the chimerism of the spleen is lower than 90%; the embedding degrees of spleen, bone marrow and peripheral blood of the mice in the C10 group are respectively 95.5%, 97.9% and 92.6%, and all the embedding degrees reach more than 90%; the embedding degrees of the spleen, the bone marrow and the peripheral blood of the D40 group mice are respectively 87.6%, 88.6% and 88.5% which are lower than 90%; the chimerism of the mice in the C10-treated group was higher than that of the mice in the D40 and ATG groups, and it can be seen from the flow chart that the strength of the H-2Kd antigen in the C10-group-supplied mice was stronger than that of the ATG group mice and D40 group-supplied mice in the same batch for 14 days, indicating that the chimerism of the C10-treated mice was more stable than that of the D40 and ATG groups (as shown in FIGS. 32-41).

2.2.5 immune reconstitution conditions

2.2.5.1 CD4+ and CD8+ cell flow detection

The ratios of CD4+ T cells, CD8+ T cells, CD4+ CD8+ T cells detected in the peripheral blood of ATG group mice 20 days after transplantation were 18.7%, 22.4%, 1.94%, respectively; the ratios of CD4+ T cells, CD8+ T cells, CD4+ CD8+ T cells in the peripheral blood of the mice of group C10 were 20.3%, 41.0%, 0.82%, respectively; the ratios of CD4+ T cells, CD8+ T cells, CD4+ CD8+ T cells in the peripheral blood of the D40 group mice were 15.9%, 14.6%, 0.2%, respectively; the immune T cell recovery of mice in group C10 was better than that of mice in groups ATG and D40 (as shown in FIGS. 42-44).

2.2.5.2 Treg percentage of cells detection

The ratios of CD4+ T cells and Treg cells of peripheral blood of ATG mice detected 20 days after transplantation are 22.9% and 0.27%, respectively; the ratios of CD4+ T cells and Treg cells in the peripheral blood of the C10 group mice were 20.8% and 2.56%, respectively; the ratios of CD4+ T cells and Treg cells in the peripheral blood of the D40 group mice were 35.6% and 1.84%, respectively; the recovery of the immune cells Treg of mice in the C10 group was better than those in the ATG and D40 groups (as shown in fig. 45-47).

2.2.6 survival situation

The irradiation group died first, the death time ranged from 7 days to 10 days after irradiation, the survival time of the D40 group mice was 3-4 days earlier than that of the aGVHD group mice, the aGVHD group mice died about 20 days after the reinfusion, and the C10 group mice and the ATG group mice survived for more than 40 days. The survival records of the mice in each group are shown in FIG. 48 and Table 3.

TABLE 3 survival records for groups of mice

Group of	Irradiation group	ATG group	Group C10	D40 group	aGVHD group
						Body weight	Death was caused by death	Increase of	Increase of	Death was caused by death	Do not increase or decrease
Posture of a person	Death was caused by death	Is normal	Is normal	Death was caused by death	Bow back
						Coat alteration	Death was caused by death	Is normal	Is normal	Death was caused by death	Sparse
Degree of motion	Death was caused by death	Is normal	Is normal	Death was caused by death	Reduce

And (4) conclusion: the C40L aptamer can circulate in a mouse body for a long time without influencing the survival of the mouse, can prevent the generation and development of aGVHD, promotes the hematopoietic reconstruction and the immunity recovery of the mouse after transplantation, and is superior to clinical medicine ATG in the immune reconstruction.

In the anti-aGVHD effect medicament, the dosage of the CD40L aptamer is 0.125 mu mol/kg body weight.

The anti-aGVHD effect medicament comprises a CD40L aptamer and a pharmaceutically acceptable carrier.

The carrier is any one or a mixture of more than two of a sustained release agent, an excipient, a filler, an adhesive, a wetting agent, a disintegrating agent, an absorption enhancer, an adsorption carrier, a surfactant and a lubricant.

The dosage form of the anti-aGVHD effect medicine is any one of external preparation, oral preparation and injection preparation.

The external preparation is a spray or an aerosol.

The oral preparation is any one of granules, capsules, tablets and vesicular agents.

The injection preparation consists of CD40L aptamer, cosolvent and 0.9% sodium chloride solution or water for injection.

The cosolvent is selected from any one or more of tween-80, propylene glycol, glycerol, ethanol and PEG-400.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> yangting

Application of <120> CD40L aptamer in preparation of anti-aGVHD effect medicine

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>80

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

agcatagaga catctgctat ccttggctca ggtccctctc tccggtatgc ggctccatcc 60

tagactccag acttcaggta 80

Claims

Use of a CD40L aptamer, said CD40L aptamer having the nucleotide sequence shown in SEQ ID NO1, in the manufacture of a medicament for resisting the effects of aGVHD.
2. The use of claim 1, wherein the CD40L aptamer is dosed at 0.125 μmol/kg body weight in the medicament for use in treating an anti-aGVHD effect.
3. The use of claim 1, wherein the anti-aGVHD effect agent comprises a CD40L aptamer and a pharmaceutically acceptable carrier.
4. The use according to claim 3, wherein the carrier is any one or a mixture of two or more of a sustained-release agent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption enhancer, an adsorption carrier, a surfactant and a lubricant.
5. The use according to claim 3, wherein the anti-aGVHD effect drug is in the form of any one of an external preparation, an oral preparation and an injectable preparation.
6. The use according to claim 5, wherein the external preparation is a spray or an aerosol.
7. The use according to claim 5, wherein the oral preparation is any one of granules, capsules, tablets and caplets.
8. The use of claim 5, wherein the injectable formulation consists of the CD40L aptamer, a cosolvent, and 0.9% sodium chloride solution or water for injection.
9. The use according to claim 8, wherein the cosolvent is selected from any one or more of tween-80, propylene glycol, glycerol, ethanol and PEG-400.